WO2017131493A1 - Microfluidic device for detecting target mutant gene and method for improving detection efficiency of microfluidic device for detecting target gene - Google Patents

Abstract

The present invention relates to a microfluidic device for detecting a target mutant gene. The device of the present invention requires no temperature changes for nucleic acid amplification and can detect a target mutant gene even in the absence of the supply of external power. Accordingly, the device needs not be accompanied by complicated equipment, can be fabricated easily and inexpensively, and is convenient for operation and is easy to carry. In addition, the device can find applications in the detection of a variety of mutant genes and in the simultaneous detection of two or more mutant genes. Further, the present invention relates to a method for improving a detection efficiency of a microfluidic device for detecting a target gene. When utilized, the method of the present invention can greatly reduce the time taken for conventional microfluidic devices for detecting target genes and can increase the accuracy of detection.

Description

Method for improving the detection efficiency of the microfluidic device for detecting target mutant genes, and the microfluidic device for detecting target genes

The present invention relates to a microfluidic device for detecting a target mutant gene, and a method for improving the detection efficiency of the microfluidic device for detecting a target gene.

A microfluidic device is a device in which each component is connected through a microfluidic channel on a substrate, and when a sample solution is injected, the entire process necessary for obtaining a detection signal is automated. It can be detected in a small amount of sample, uses less reagent, and the entire process is automated, which is convenient.

Publication No. 10-2014-0032094 discloses a microfluidic device that can be combined with a DNA template. However, the microfluidic device disclosed in the above document has a two-layer structure, and the manufacturing process and the use method are complicated because the sample flows by controlling the angle of the flow path. In addition, because the pump is used to inject the sample, it must be externally powered and only one substance can be detected at a time.

[Preceding technical literature]

[Patent Documents]

Domestic Patent No. 10-1263450 (Name of the invention: DNA aptamer specifically binding to kanamycin)

Korean Patent Application Publication No. 10-2014-0032094 (Invention name: Microfluidic device that is easy to capture the target material and target material separation method using the microfluidic device)

Korean Patent Publication No. 10-2012-0125164 (Name of the invention: EFFFR exon 19 polymorphism detection test oligonucleotide and use thereof)

The present invention is to provide a microfluidic device for detecting a target mutant gene and a detection method using the same.

The present invention also provides a microfluidic device kit for detecting a target gene with improved detection efficiency and a method for detecting a target gene using the same.

The present invention

Board;

An inlet through which a sample solution formed on the substrate is introduced from the outside;

A first flow passage connected with the inlet to accommodate the sample solution introduced;

A second flow path connected to the first flow path;

A microfluidic device for detecting a target mutant gene comprising an outlet connected to the second flow path,

The second flow path surface is coated;

A primer is immobilized on the coating;

The fixed primer is coupled to a template for detecting a target mutant gene,

The target mutant gene detection template includes a primer binding portion that complementarily binds to the primer, a binding site complementary to the first template bound to one end of the primer binding portion-a first target mutation gene binding site, and the primer binding Provided is a microfluidic device for detecting a target mutant gene, comprising a complementary binding site-second target mutant gene binding site in a second template bound to the other end of the moiety.

In one embodiment of the present invention, the second flow path may be 1 to 20.

In another embodiment of the present invention, the second flow path is 2 to 20, each of the second flow path is branched at the end of the first flow path, the target mutant gene bound to the primer immobilized on each second flow path The detection template may bind to the same or different mutant genes.

In one embodiment of the invention, the coating is 5-hydroxydopamine hydrochloric acid, norepinephrine, epinephrine, pyrogallolamine, DOPA (3,4-Dihydroxyphenylalanine), catechin, tannins, pyrogallol, pyrocatechol , Heparin-catechol, chitosan-catechol, polyethyleneglycol-catechol, polyethyleneimine-catechol, polymethylmethacrylate-catechol, hyaluronic acid-catechol, polylysine-catechol, and It may be selected from the group containing polylysine (polylysine).

In one embodiment of the invention, the primer is thiol, amine, hydroxyl, carboxyl, isothiocyanate, NHS ester, aldehyde, epoxide, carbonate, HOBt ester, glutaraldehyde, carbamate, imidazole carbamate, Terminals may be modified at least one selected from the group comprising maleimide, aziridine, sulfone, vinylsulfone, hydrazine, phenyl azide, benzophenone, anthraquinone, and diene groups.

In one embodiment of the present invention, the coating is 5-hydroxydopamine hydrochloric acid, the primer may be a terminal modified with a thiol or amine group.

In one embodiment of the present invention, the primer binding portion of the target mutant gene detection template may comprise a nucleotide sequence described in SEQ ID NO: 2.

There is no limitation on the type of mutant gene that can be detected by the microfluidic device for detecting a target mutant gene of the present invention. The present invention can be applied to various mutant genes known in the art.

In one embodiment of the present invention, the mutant gene may be a cancer specific mutant gene appearing in cancer. The cancer specific mutant gene may be a website such as http://www.mycancergenome.org, and any cancer specific mutant gene known in the art. For example, the mutant gene may be a carcinogenic mutant gene, which is a gene causing cancer, specifically a lung cancer specific mutant gene, more specifically, a gene in which EGFR exon 19 deletion has occurred, It is not limited.

The following have been reported for the mutation of genes in each cancer (excerpt from http://www.mycancergenome.org);

Mutation of the CRLF2 or JAK2 gene in Acute Lymphoblastic Leukemia, CBFB-MYH11, DEK-NUP214, DNMT3A, FLT3, IDH1, IDH2, KIT, MLL-MLLT3, PML in Acute Lymphoblastic Leukemia Mutations in the RARA, RBM15-MKL1, RPN1-EVI1, or RUNX1-RUNX1T1 genes, ALK gene mutations in Anaplastic Large Cell Lymphoma, SMO gene mutations in Basal Cell Carcinoma, bladder cancer Bladder Cancer TSC1 Gene Mutation, Breast Cancer AKT1, AR, ERBB2, ESR1, FGFR1, FGFR2, PGR, PIK3CA, or PTEN Gene Mutation, BCR-ABL1 of Molecular Profiling of Chronic Myeloid Leukemia Mutations in genes, mutations in AKT1, BRAF, KRAS, NRAS, PIK3CA, PTEN, or SMAD4 genes in colorectal cancer, BRAF, KIT, or PDGFRA genes in Gastrointestinal Stromal Tumor (GIST) , Stomach cancer (Gas mutation of ERBB2 gene of tric cancer, BRAF of IDG1, IDH1, or mutation of IDH2 gene, mutation of ALK gene of Inflammatory Myofibroblastic Tumor, AKT1, ALK, BRAF of Lung Cancer Mutation of DDR2, EGFR, ERBB2, FGFR1, FGFR3, KRAS, MAP2K1, MET, NRAS, NTRK1, PIK3CA, PTEN, RET, RICTOR, or ROS1 gene, mutation of SMO gene of Medulloblastoma, melanoma Mutations in BRAF, CTNNB1, GNA11, GNAQ, KIT, MAP2K1, NF1, or NRAS genes, ASXL1, BCOR, DNMT3A, ETV6, EZH2, NF1, RUNX1, SF3B1, SRSF2, SSF2, STAG2 of Myelodysplastic Syndromes , Mutation of TP53, U2AF1 or ZRSR2 gene, mutation of ALK gene of Neuroblastoma, mutation of BRAF, KRAS, PIK3CA, or PTEN gene of Ovarian Cancer, mutation of ALK gene of Rhabdomyosarcoma, Of Thymic Malignancies KIT gene mutations, and mutations in the BRAF, HRAS, KRAS, NRAS, or RET genes in Thyroid Cancer.

Mutant genes that can be detected by the present invention are not limited to mutant genes associated with cancer, and other mutant genes associated with other congenital or acquired diseases or malformations may be used.

A mutant gene that can be detected by the present invention can be any mutant gene in which the normal gene and one or more bases are substituted, deleted or added.

In another embodiment of the invention, the mutant gene may be a mutant gene in which two or more bases are substituted, deleted or added continuously or discontinuously.

The first target mutant gene binding site and the second target mutant gene binding site of the target mutant gene detection template of the present invention may be designed to bind complementarily to the mutant gene but not to the normal gene.

The mutant gene of the present invention can be, for example, a mutation of an epidermal growth factor receptor (EGFR) gene. For example, the mutant gene may be a gene in which EGFR exon 19 deletion (hereinafter, 'EGFR 19del') occurs.

EGFR 19del is a deletion of several to several ten bases consecutively in exon 19 of the EGFR gene, and a plurality of variants are known. Exemplary variants of EGFR 19del are shown in Table 1 below. In the table below, '-' means a deletion, lowercase means a mutation, and 'wild type' means a gene of the normal EGFR exon 19 part without deletion. Korean Patent Publication No. 10-2012-0125164 describes variously about the EGFR exon 19 polymorph, and many other documents have been reported about the EGFR exon 19 polymorph. However, EGFR 19del is not limited to that described in Table 1 below.

TABLE 1

The EGFR 19del is a mutation commonly occurring in lung cancers such as Non-Small Cell Lung Cancer (NSCLC), and among them, abundantly observed in adenocarcinoma. Whether EGFR 19del has occurred can be used to confirm lung cancer. In addition, there are commercially available iresa (compound name: gefitinib), tarseva (compound name: erlotinib), geotripps (compound name: afatinib) and the like as target anticancer agents that can be used to treat patients with lung cancer with EGFR 19del. Numerous target anticancer agents for 19del's lung cancer are currently under development or clinical trials. When these target anticancer drugs are prescribed to patients with lung cancer without EGFR 19del, they often respond initially but the anticancer effect is not as expected. This not only increases the economic burden on the patient, but can also lead to poor treatment prognosis by missing out on the opportunity to be treated with other appropriate anticancer drugs.

By using the microfluidic device of the present invention, a mutant gene in which various variants of EGFR 19del can be detected quickly and accurately, can be used to confirm lung cancer, and an appropriate anti-cancer agent can be selected to plan treatment of lung cancer patients. It can be a decisive help in establishing.

The present invention provides a method for producing a microfluidic device for detecting a target mutant gene, comprising the following steps.

1) a microfluidic device including a substrate, an inlet formed on the substrate, a first flow path connected to the inlet to receive the sample solution introduced therein, a second flow path connected to the first flow path, and an outlet connected to the second flow path Providing a;

2) coating a second flow path surface of the microfluidic device;

3) immobilizing a primer on the coating; And

4) binding a template for detecting a target mutant gene to the immobilized primer.

In another aspect, the present invention provides a method for detecting a target mutant gene using the microfluidic device for detecting the target mutant gene comprising the following steps.

a) providing a microfluidic device for detecting said target mutant gene;

b) injecting a sample solution into the inlet of said microfluidic device for detecting said target mutant gene; And

c) adding ligase to a second flow path of said microfluidic device;

d) adding dNTP and isothermal nucleic acid polymerase to the first flow path of the microfluidic device.

In one embodiment of the present invention, the steps c) and d) may be performed simultaneously (i.e., let the ligation and the rotation amplification reaction occur simultaneously), or c) after step d) is performed ( That is, after the ligation to cause a rotation ring amplification reaction). Simultaneously or separately, steps c) and d) may be determined according to the number and type of target substances to be detected.

In one embodiment of the invention, the method is

e) injecting a dyeing reagent, a high salt solution or a fluorescent reagent into the inlet of the microfluidic device.

The microfluidic device for detecting a target mutant gene of the present invention can be used for detection of various mutant genes occurring in humans and animals. The animal includes all mammals, birds, reptiles, amphibians, fish and the like.

The present invention provides a microfluidic device for detecting a target gene;

dNTP;

Ligase;

Isothermal nucleic acid polymerase; And

Provided is a microfluidic device kit for detecting a target gene, comprising additional primers.

The microfluidic device is

Board;

An inlet through which a sample solution formed on the substrate is introduced from the outside;

A first flow passage connected with the inlet to accommodate the sample solution introduced;

A second flow path connected to the first flow path;

A microfluidic device for detecting a target gene comprising an outlet connected to the second flow path,

The second flow path surface is coated;

A primer is immobilized on the coating;

The fixed primer is coupled to a template for detecting a target gene,

The target gene detection template includes a primer binding portion that complementarily binds to the primer, a binding site complementary to the first template bound to one end of the primer binding portion-a first target gene binding portion, and the other of the primer binding portion. A microfluidic device for detecting target genes, comprising a complementary binding site-second target gene binding site in a second template bound to a terminal, and the specific configuration and features of the microfluidic device for detecting target genes are described in Application No. 10. -2015-0151941 (name of the invention: a microfluidic device for detecting a target gene, a preparation method thereof and a detection method using the same).

In one embodiment of the present invention, the additional primer (additional primer) may be the entire sequence, or a partial sequence of the primer binding portion of the target gene detection template, for example 5 to 50, preferably 10 to 25 Some, more preferably 15 to 22 bases in length.

For example, when the primer binding portion of the template for detecting a target gene of the present invention is SEQ ID NO: 2 (5'-TA GCA TGC TAG TAT CGA CGT-3 '), the additional primer sequence is the same sequence as the sequence, or a part of the sequence. It may be a corresponding sequence, and in the case of a sequence corresponding to a part of the sequence, it may be preferably a sequence consisting of 10 to 25 bases, such as SEQ ID NO: 3 (5 ′ TGC TAG TAT C 3 ′).

In one embodiment of the invention, the ligase may be a DNA ligase, such as T7 ligase, or CircLigase ™. In addition, the isothermal nucleic acid polymerase may be phi 29 polymerase.

In another embodiment of the present invention, the kit may further include dithiothreitol (DTT) or pyrophosphatase.

In addition, the kit may further include a dyeing reagent, a high salt solution, or a fluorescent reagent.

In another aspect, the present invention provides a method for producing a microfluidic device comprising: a) providing a microfluidic device for detecting a target gene;

b) injecting a sample solution into the inlet of the microfluidic device; And

c) adding a dNTP, a ligase, an isothermal nucleic acid polymerase, and an additional primer to a second flow path of said microfluidic device, providing a method for detecting a target gene using said microfluidic device.

In the target gene detection method, additional primers are coupled in the middle of the sequence to be rotated and amplified by the addition of additional primers, thereby causing amplification of the template in a larger amount more rapidly. That is, the addition of additional primers significantly shortens the time for amplification of the nucleic acid mass and can be detected much faster, and also if the target contains a small amount of the target gene or if the amount of the sample itself is small. By increasing the amplification site through the second amplification by a large amount of template amplification can form a large nucleic acid clumps, thereby increasing the accuracy of detection.

According to one embodiment of the present invention, the target gene detection method of the present invention is a daughter strand generated through the second amplification (additional amplification) by adding additional primers (mother strand generated by the first amplification (mother) Complementary binding to the strand) forms a DNA hydrogel faster and more robustly, thus improving the detection efficiency compared to the conventional detection method.

The method of detecting a target gene using a microfluidic device kit for detecting a target gene including the additional primer is used for detecting genes that can be derived from all origins such as animals, plants, bacteria, viruses, fungi, and the environment. Applicable

According to one embodiment of the invention, the target gene to be detected may be a pathogen gene. The target gene can be targeted to any pathogen that knows the nucleic acid sequence. Specifically, the pathogen is avian influenza, SARS, Escherichia coli O157: H7, Mycobacterium tuberculosis, Bacillus anthracis, Streptococcus pneumonia, Malaria (Plasmodium), Salmonella (Salmonella), Hepatitis A, B, C, D and E viruses, Françasella tularensis, Yersinia pestis, Ersinia enterocolitica and Ebola virus, It is useful for the detection of MERS-Cov virus. In addition, according to one embodiment of the present invention, the pathogen is also useful for the detection of pneumococci, enterococci, staphylococcus, tropic fever and pathogens with antibiotic resistance such as tuberculosis or malaria bacteria in the third world.

According to another embodiment of the present invention, the target gene to be detected may be a mutant gene. Specifically, the mutant gene may be a cancer specific mutant gene that appears in cancer. The cancer specific mutant gene may be any cancer specific mutant gene known in the art, and specific cancer specific mutant genes are as described above. More specifically, it may be a lung cancer specific mutant gene, such as but not limited to a gene in which EGFR exon 19 deletion has occurred.

The present invention does not need to change the temperature for nucleic acid amplification, and can detect a target mutant gene without external power supply. Therefore, there is no need for complicated equipment, it is simple and inexpensive to manufacture, easy to operate, and easy to carry. It can also be used to detect a variety of mutant genes, and can be used to detect two or more mutant genes simultaneously.

In addition, the microfluidic device kit for detecting a target gene comprising the additional primer of the present invention; And by using the detection method using the same it can significantly shorten the detection time of the conventional microfluidic device for detecting the target material and increase the accuracy of the detection.

1 is a diagram showing a result of detecting a gene having a EGFR exon 19 deletion mutation of SEQ ID NO: 5 using a microfluidic device for detecting a target mutant gene of the present invention with fluorescence.

Figure 2 is a schematic diagram showing that the secondary amplification of the ring by the addition of the additional primer can be amplified more quickly and a lot of templates.

3 is a result of detecting a target gene by a method developed by the present inventor (named DNA Hydrogel Formation by Isothermal Amplification of Complementary Target in Fluidic Channels) using the same microfluidic device for detecting a target gene. Figures (a) and (c)) and the results of detecting target genes (DbITACT-TR) by adding additional primers (DhITACT-TR) developed this time are shown respectively (b) and (d).

4 is a diagram showing an Atomic Force Microscope (AFM) image of a target mers coronavirus gene hydrogel formed through DhITACT.

FIG. 5 shows an Atomic Force Microscope (AFM) image of a target mers coronavirus gene hydrogel formed through DhITACT-TR.

6 is a diagram showing the results of rheology measurement of target mers coronavirus gene hydrogel formed through DhITACT and DhITACT-TR.

Figure 7 is a diagram confirming the result of detecting the gene for which the EGFR exon 19 deletion mutation of SEQ ID NO: 5 by the target gene detection method of the present invention with the addition of additional primers.

Hereinafter, with reference to the drawings in order to help the understanding of the present invention will be described in detail. However, the following description is only to exemplify the contents of the present invention and the scope of the present invention is not limited to the following description and may be embodied in other forms. In addition, in the drawings, the width, length, thickness, etc. of the components may be exaggerated for convenience. Like numbers refer to like elements throughout. In addition, when one component is on another component, this includes not only the case where the component is directly above the other component, but also another component in the middle of the component.

Microfluidic Device for Target Mutant Gene Detection

Basic structure of the microfluidic device for detecting a target mutant gene of the present invention, a manufacturing method, and a method for detecting a target mutant gene using the same are disclosed in Korean Patent Application No. 10-2015-0151941 (Invention: Microfluidic device for detecting a target gene, its Production method and detection method using the same).

The type of target mutant gene that can be detected by the microfluidic device for detecting a target mutant gene of the present invention is not limited, and may be any mutant gene having one or more base differences from a normal gene. Mutant genes that can be detected with the present invention can be any mutant genes associated with a congenital or acquired disease or malformation.

In one embodiment of the present invention, the mutant gene may be a mutant gene in which two or more genes are substituted or deleted continuously or discontinuously.

For example, the mutant gene may be a gene described by SEQ ID NO: 5, which is a kind of EGFR 19del. Comparing the mutant gene with a normal gene is shown in Table 2 below.

TABLE 2

In this case, the template for detecting the target mutant gene of the present invention can be designed as follows (SEQ ID NO: 6).

In this sequence, the first target mutant gene binding site and the second target mutant gene binding site, shown in bold, bind complementarily to 'AAATTCCCGGGA' and 'ATTAAGAGAAGCCAACAAGG' in the mutant gene of SEQ ID NO: 5, respectively. That is, the template can be designed such that the target mutant gene binding site complementarily binds only to the mutant gene.

The dark gray portion is a 'primer binding portion', and is prepared to bind complementarily with the primer represented by SEQ ID NO: 1 (5′-Thiol-AAA AAA AAA GGG ACG TCG ATA CTA GCA TGC TA-3 ′). (SEQ ID NO: 2). In addition, the light gray portions are portions that complementarily bind to each other in the template (complementary binding sites in the first template and complementary binding sites in the second template).

How to Improve Detection Efficiency of Microfluidic Devices for Target Material Detection

The method for detecting a target gene using the microfluidic device for detecting a target substance, that is, the microfluidic device for detecting a target gene, invented by the inventors of the present invention is disclosed in Korean Patent Application No. 10-2015-0151941 (name of the invention: for detecting a target gene). Microfluidic device, its preparation method and detection method using the same), but the same as the addition of additional primer (ditional primer) when adding dNTP, ligase, isothermal nucleic acid polymerase, etc. for rotation ring amplification There is this.

The additional primer may be the entire sequence or a partial sequence of the primer binding portion of the target gene detection template used in the microfluidic device, for example, a partial sequence of 10 to 25 bases in length.

In the schematic diagram of FIG. 2, the upper two diagrams show a process in which rotation amplification occurs in the method of the existing application, and the lower diagram shows additional primers coupled in the middle of the sequence to be amplified by the rotation when additional primers are added. As amplification takes place, the process of amplifying the template in larger amounts is shown. That is, the addition of additional primers significantly shortens the time for amplification of the nucleic acid mass and can be detected much faster, and also template amplification when small amounts of target material are included in the sample or when the amount of the sample itself is small. This can occur a lot and form a large nucleic acid lump, which increases the accuracy of detection.

Example

Hereinafter, examples are provided to help understand the present invention. The following examples are merely provided to more easily understand the present invention, but the contents of the present invention are not limited by the examples.

Example  1. Detection of EGFR 19del using microfluidic device for detecting target gene (cancer mutant gene)

1-1. Preparation of Microfluidic Device for EGFR 19del Detection

1 μ-Slide III ³ⁱⁿ¹ uncoated Microscopy Chamber manufactured by ibidi was purchased and prepared.

5-hydroxydopamine hydrochloric acid (5-hydroxydopamine HCl) was used as the coating material of the second flow path. Specifically, 5-hydroxydopamine hydrochloric acid (Sigma Aldrich) was dissolved in 10 mM Tris buffer (1M UltraPure 1M Tris-HCl pH 8.0 / Invitrogen) at a concentration of 1 mg / ml. Then, the pH was adjusted to 8 to prepare a coating composition. Wherein in the coating composition for a ^{1 μ-Slide Ⅲ 3in1 uncoated Microscopy} Chamber filled the each second flow path of the product. After 2 hours it was washed with DDW (Water Purification System / LABOGENE).

In addition, a primer to be attached on the coating of the second flow path was prepared. Primer was used to purchase Primer-5SS-polyA9 (BIONEER) having the following sequence. The 5 'end of the primer sequence is attached to a thiol group.

5′-Thiol-AAA AAA AAA GGG ACG TCG ATA CTA GCA TGC TA-3 ′ (SEQ ID NO: 1)

After preparing 100 pmol of the primer and 5 M DTT (DL-Dithiothreitol / Sigma Aldrich), 5 μl of 5 M DTT was added to 100 pmol of the primer, and DDW (Water Purification System / LABOGENE) was added to 50 μl in total. The primer composition was prepared by the addition. Allow 4 hours to break any disulfide bonds that may have been generated in the primer by DTT, and then at 132,000 rpm, 4 ° C., 25 minutes using a 3K amicon tube (Amicon Ultra Centrifugal Filters 3K / MILLIPORE). First centrifugation, 40 μl DDW was added and second centrifugation to completely remove DTT remaining after reaction. 5 μl of the primer composition, in which the DTT was removed, was added to each of the second flow passages and allowed to stand for 2 hours to attach the primer on the coating of the second flow passage, followed by washing with DDW (Water Purification System / LABOGENE).

In addition, the template for detecting EGFR 19del described in SEQ ID NO: 5 (SEQ ID NO: 6) was prepared as follows.

0.2 μl (= 20 pmole) of 100 μM of the EGFR 19del detection template was added thereto to prepare 5 μl of EGFR 19del detection template composition by adding 1 × PBS (gibco® from life technoligies) to prepare two second flow paths of the microfluidic device. (Center and left when viewed from above) respectively. The EGFR 19del was detected by DDW (Water Purification System / LABOGENE) and then left for 2 hours to allow complementary binding to occur between the primer binding portion of the template for detection and the second immobilized primer. On the other hand, the right channel contains a template for detection of EGFR 19del in which nicking has already occurred (positive control).

1-2. EGFR 19del detection

A solution containing the EGFR 19del gene of SEQ ID NO: 5 was prepared as a sample solution. As a negative control solution, a solution containing the EGFR normal gene of SEQ ID NO: 4 was prepared. 3.5 μl of the sample solution was introduced into the second channel in the middle, and the negative control solution was introduced into the second channel on the left. 30 μl of T7 ligase, 0.2 μl of 100 mM DTT, and 24.8 μl of Water Purification System / LABOGENE (DDW) were used to fill the second flow path of the microfluidic device for target gene detection. It was placed in a plastic container sealed with a para film to prevent the moisture in the second flow passage. The plastics were filled with a tissue dampened with water and water at 30 ° C. Thereafter, it was left to stand at a non-shaking, 30 ° C., and 3 hours to allow the ligation of nicks of the EGFR 19del detection template.

Then 2 μl of 25 mM dNTP, 50 μl of phi 29 polymerase (10 unit / μl), 1 μl of pyrophosphatase, reaction buffer of each enzyme, and about 60 μl of a mixture of DDW were injected (via inlet). Injection into the second flow path along the first flow path, or injection into each second flow path). It was placed in a plastic container sealed with a para film to prevent the moisture in the second flow passage. The plastics were filled with a tissue dampened with water and water at 30 ° C. Thereafter, the mixture was allowed to stand at a non-shaking, 30 ° C., and 2 hours to cause the rotation amplification reaction of the EGFR 19del detection template.

As a result of fluorescence, the EGFR 19del detection template was amplified in the central flow path of FIG. 1 and entangled with hydroxydopamine hydrochloric acid coated with the second flow path to form a large hydrogel mass to block the outlet of the second flow path. there was. Similarly, it was confirmed that the outlet of the second flow path was blocked in the right flow path as the positive control. In contrast, no fluorescence was observed in the left channel, which was a negative control.

Example 2 Method of Further Increase Detection Efficiency of Microfluidic Devices

The inventors have invented a microfluidic device for detecting a target gene. The present inventors invented a method of shortening the detection time of the microfluidic device and increasing the accuracy as follows.

2-1. Targeted MERS Gene Detection

A microfluidic device for detecting a target MERS gene was prepared as described in Experiment 5 of Application No. 10-2015-0151941. The basic structure of the device is as described in 1-1 above, and the template sequence is as follows.

In the template MERS sequence, portions complementary to the target mers coronavirus gene are shown in bold letters, and portions complementary to the primers are light gray on a light gray background, and the portions complementary to the primer are displayed in dark gray. It was.

In addition, the target mers coronavirus gene sequence to which the first target gene binding site and the second target gene binding site of the template sequence bind complementarily is as follows.

5 '-/ CG GAG AUG UGC CCU GGG UAU / 3Phos / -3' (SEQ ID NO: 7)

In the prepared microfluidic device for detecting the target MERS gene, 3.5 μl of the sample solution was placed in the second channel in the middle and the negative control solution was placed in the leftmost second channel in the same manner as in the method of 1-2. Inflow. 30 μl of T7 ligase, 0.2 μl of 100 mM DTT, and 24.8 μl of Water Purification System / LABOGENE (DDW) were used to fill the second flow path of the microfluidic device for target gene detection. It was placed in a plastic container sealed with a para film to prevent the moisture in the second flow passage. The plastics were filled with a tissue dampened with water and water at 30 ° C. Thereafter, it was left to stand at a non-shaking, 30 DEG C, and 3 hours to allow the ligation of the nick of the template to occur.

Then 2 μl of 25 mM dNTP, 50 μl of phi 29 polymerase (10 unit / μl), 1 μl of pyrophosphatase, reaction buffer of each enzyme, and about 60 μl of a mixture of DDW were injected (via inlet). Injection into the second flow path along the first flow path, or injection into each second flow path). It was placed in a plastic container sealed with a para film to prevent the moisture in the second flow passage. The plastics were filled with a tissue dampened with water and water at 30 ° C. Thereafter, the mixture was left to stand at a non-shaking, 30 ° C. for 2 hours to allow a rotational amplification reaction of the template. When the fluorescence was observed after 30 minutes, the template amplified could not be observed (Fig. 3 (a)). After about 2 hours the template was amplified to form a hydrogel mass.

In the same manner, a microfluidic device for detecting a target MERS gene was prepared, a sample solution containing the MERS virus gene was injected, and a ligation reaction and a rotation ring amplification reaction occurred in sequence. At this time, 'additional primer' (consisting of a short DNA sequence) was further added during the rotation amplification reaction. Additional primer sequences added are as follows.

 5 'TGC TAG TAT C 3' (SEQ ID NO: 3)

When observed with fluorescence after 30 minutes, it was observed that the template is amplified to form a hydrogel mass (FIG. 3 (b)). That is, when additional primer is added, the time required for amplification is greatly shortened.

In addition, 4 hours after the addition of the additional primer and the addition of the dye was visually confirmed, and when the additional primer was not added, when the template amplification occurred (center flow path) and negative control (left flow path) and However, when the additional primer was added, the second flow path was not blocked only in the negative control, and the flow path was blocked in the remaining two flow paths, so that the template amplification and the negative control could be distinguished. 3 (c) and (d), that is, when an additional primer is added, even when a small amount of the target MERS virus gene is present in the sample solution, the sensitivity can be detected with high sensitivity, thereby increasing accuracy.

2-2. Confirmation of increased detection efficiency by adding additional primer

The present inventors also added the pore size of the hydrogel using an Atomic Force Microscope (AFM) and to confirm the improved detection efficiency of the microfluidic device for target gene detection by adding additional primers. Rheology was measured.

The target MERS gene hydrogel of Example 2-1, which was amplified by adding the target MERS gene hydrogel of Example 1 and an additional primer, which was formed by using an atomic force microscope (NX10, Park Systems, South Korea) as an existing device The pore size of the mass was measured and the results are shown in FIGS. 4 and 5.

4 and 5, the average pore size of the hydrogel amplified using the existing microfluidic device for detecting target genes (DhITACT) was 56 nm (FIG. 4), but when additional primers were added (DhITACT -TR) average pore size was 16 nm (Fig. 5), the density was confirmed to increase about 3.5 times. That is, by adding additional primers to form a more robust DNA hydrogel mass it was confirmed that the detection efficiency was improved.

In addition, the viscoelasticity of the target MERS gene hydrogel formed through DhITACT and DhITACT-TR was measured using a viscoelasticity meter (parallel rheometer, Kinexus, Malvern, UK), and the results are shown in FIG. 6.

As confirmed in FIG. 6, the MERS gene hydrogel (TR) formed through DhITACT-TR formed a more viscoelastic gel than the hydrogel (D) formed through DhITACT, and storage modulus (G ′) was also increased. High. That is, it was confirmed that by adding additional primers to form a hydrogel having a stronger elasticity, the detection efficiency of the microfluidic device was increased.

2-3. Target EGFR 19del Mutant Gene Detection

We also confirmed increased detection efficiency by adding additional primers using a microfluidic device for detecting target mutant genes. As described in 1-1 above, a microfluidic device for detecting EGFR 19del was prepared. The specific template sequence (SEQ ID NO: 6) is as follows, and the meaning indicated in the sequence is the same as the MERS template.

In addition, the target EGFR 19del gene sequence to which the first target gene binding site and the second target gene binding site of the template sequence bind complementarily is as follows.

5 '-/ AAA TTC CCG GGA ATT AAG AGA AGC CAA CAA GG / 3Phos / -3' (SEQ ID NO: 4)

Using the prepared microfluidic device for detecting the target EGFR 19del gene, amplification of the EGFR 19del gene was performed in the same manner as the method using the microfluidic device for detecting MERS, and an additional primer of SEQ ID NO: 3 was added.

As a result, as shown in FIG. 7, the template was amplified to visually observe that the hydrogel mass was formed only 30 minutes after the reaction, and the time required for amplification was greatly shortened by the addition of additional primers. That is, the detection of the target EGFR 19del gene of Example 1-2 without adding the additional primer was able to visually confirm the hydrogel 2 hours after the rotation amplification reaction (Fig. 1), but the addition of the additional primer In this case, the time required for amplification of the EGFR 19del mutant gene was significantly shortened. Therefore, when the additional primer is added, even when a small amount of the target EGFR 19del mutant gene is present in the sample solution, it is possible to detect with high sensitivity, thereby increasing the accuracy.

Claims (23)

1. Board;

   An inlet through which a sample solution formed on the substrate is introduced from the outside;

   A first flow passage connected with the inlet to accommodate the sample solution introduced;

   A second flow path connected to the first flow path;

   A microfluidic device for detecting a target mutant gene comprising an outlet connected to the second flow path,

   The second flow path surface is coated;

   A primer is immobilized on the coating;

   The fixed primer is coupled to a template for detecting a target mutant gene,

   The target mutant gene detection template includes a primer binding portion that complementarily binds to the primer, a binding site complementary to the first template bound to one end of the primer binding portion-a first target mutation gene binding site, and the primer binding Comprising a complementary binding site-second target mutant gene binding site in a second template bound to the other end of the moiety,

   Microfluidic device for detection of target mutant genes.
2. The microfluidic device of claim 1, wherein the second flow path is 1-20.
3. The method of claim 1, wherein the second flow path is 2 to 20, each second flow path is branched at the end of the first flow path,

   The target mutant gene detection template bound to primers immobilized on each second flow path binds to the same or different mutant genes.
4. The microfluidic device of claim 1, wherein the mutant gene is a cancer specific mutant gene.
5. 5. The microfluidic device of claim 4, wherein the cancer-specific mutant gene is a gene in which an exon deletion of epidermal growth factor receptor (EGFR) No. 19 occurs.
6. The microfluidic device for detecting a target mutant gene according to claim 5, wherein the gene in which the EGFR 19 exon deletion has occurred is a gene described in SEQ ID NO: 5.
7. The method of claim 1, wherein the first target mutant gene binding site and the second target mutant gene binding site of the template for detecting the target mutant gene bind complementarily only to the mutant gene and do not bind to the normal gene. Microfluidic devices.
8. The microfluidic device of claim 1, wherein the mutant gene is substituted, deleted or added with one or more bases compared to a normal gene.
9. The method of claim 1, wherein the target mutant gene is a gene containing a point mutation, the terminal base of the first target mutation gene binding site or the second target mutation gene binding site of the template for detecting the target mutation gene is Microfluidic device for detecting a target mutant gene, which will bind complementarily to the generated base.
10. The microfluidic device for detecting a target mutant gene according to claim 1, wherein the target mutant gene detection template is set forth as SEQ ID NO: 6.
11. Microfluidic devices for detecting target genes;

    dNTP;

    Ligase;

    Isothermal nucleic acid polymerase; And

    Microfluidic device kit for detecting a target gene, comprising additional primers.
12. The method of claim 11, wherein the microfluidic device for detecting a target gene

    Board;

    An inlet through which a sample solution formed on the substrate is introduced from the outside;

    A first flow passage connected with the inlet to accommodate the sample solution introduced;

    A second flow path connected to the first flow path;

    A discharge port connected to the second flow path;

    The second flow path surface is coated;

    A primer is immobilized on the coating;

    The fixed primer is coupled to a template for detecting a target gene,

    The target gene detection template includes a primer binding portion that complementarily binds to the primer, a binding site complementary to the first template bound to one end of the primer binding portion-a first target gene binding portion, and the other of the primer binding portion. A microfluidic device kit for detecting target genes comprising a binding site-second target gene binding site in a second template bound at the end.
13. The method of claim 12,

    The additional primer is the entire sequence of the primer binding portion of the template for detecting the target material, or a partial sequence of 10 to 25 bases in length, microfluidic device kit for detecting a target gene.
14. The method of claim 11,

    The ligase is T7 ligase or circularLase (CircLigase ™), microfluidic device kit for detecting a target gene.
15. The method of claim 11,

    The isothermal nucleic acid polymerase is phi 29 polymerase, microfluidic device kit for detecting a target gene.
16. The method of claim 11,

    The kit further comprises dithiothreitol (DTT) or pyrophosphatase (phyrophosphatase), microfluidic device kit for detecting a target gene.
17. The method of claim 11,

    The kit further comprises a dyeing reagent, a high salt solution, or a fluorescent reagent, microfluidic device kit for detecting a target gene.
18. a) providing a microfluidic device for detecting a target gene;

    b) injecting a sample solution into the inlet of the microfluidic device; And

    c) adding a dNTP, a ligase, an isothermal nucleic acid polymerase, and an additional primer to a second flow path of said microfluidic device, wherein said target gene is detected using said microfluidic device for target gene detection.
19. The method of claim 18,

    The target gene detection method is a method for detecting a target gene, the second amplification occurs by adding an additional primer.
20. The method of claim 18,

    The target gene is a method of detecting a target gene, which is derived from animals, animals, plants, bacteria, viruses, fungi, environment.
21. The method of claim 18,

    The target genes are avian influenza, SARS, Escherichia coli O157: H7, Mycobacterium tuberculosis, Bacillus anthracis, Streptococcus pneumonia, Malaria (Plasmodium), Salmonella (Salmonella) ), Hepatitis A, B, C, D, or E virus, Frantisella tularensis, Yersinia pestis, Yersinia enterocolitica, and Ebola virus, and Mer A method for detecting a target gene, wherein the target gene is a target gene derived from one or more selected from the group consisting of SOR-Cov virus.
22. The method of claim 18,

    And said target gene is a mutant gene.
23. The method of claim 22,

    Wherein said mutant gene is a gene having a deletion of EGFR exon 19.

Images