KR101976117B1 - Microfluidic device for detection of a target gene mutation, and method to improve the efficacy of detection of a microfluidic device for detection of target gene - Google Patents

Abstract

The present invention relates to a microfluidic device for detecting a target mutation gene. The apparatus of the present invention does not need to change the temperature for nucleic acid amplification and can detect the target mutant gene without external power supply. Therefore, it is not necessary to carry complicated equipment, and it can be manufactured simply, inexpensively, is easy to operate, and is easy to carry. It can also be used for the detection of various mutant genes and can be used for the simultaneous detection of two or more mutant genes.
The present invention also relates to a method for improving the detection efficiency of a microfluidic device for detecting a target gene. By using the method of the present invention, it is possible to greatly shorten the time required for detection of a conventional microfluidic device for detecting a target gene and improve the accuracy of detection.

Description

Microfluidic device for detecting target mutant gene and method for improving detection efficiency of microfluidic device for detection of target gene (Microfluidic device for detection of a target gene mutation, and method for improving the detection efficiency of a microfluidic device for detection target gene}

The present invention relates to a microfluidic device for detecting a target mutant gene, and a method for improving the detection efficiency of a microfluidic device for detecting a target gene.

A microfluidic device refers to a device in which each component is connected through a microfluidic channel on a substrate, and the entire process is automated until a detection signal is obtained when a sample solution is injected. It is advantageous because it can detect even small amount of sample, use few reagents, and automate the entire process.

Publication No. 10-2014-0032094 discloses a microfluidic device that can be coupled with a DNA template. However, the microfluidic device disclosed in the above document has a two-layer structure and flows the sample by adjusting the angle of the flow path, so that the manufacturing process and the use method are complicated. In addition, a pump is used to inject the sample, so it must be powered externally and only one substance can be detected at a time.

Korean Patent No. 10-1263450 (entitled DNA aptamer specifically binding to kanamycin) Korean Patent Laid-Open No. 10-2014-0032094 (entitled "Microfluidic Device Capable of Capture of Target Material and Method for Separating Target Material Using Microfluidic Device") Korean Patent Laid-Open No. 10-2012-0125164 (entitled: Oligonucleotides for EGFR exon 19 polymorphism detection test and uses thereof)

The present invention provides a microfluidic device for detecting a target mutant gene and a detection method using the same.

The present invention also provides a kit for detecting a target gene having improved detection efficiency and a method for detecting a target gene using the same.

The present invention

Board;

An inlet through which the sample solution formed on the substrate flows from the outside;

A first flow path connected to the inlet port to receive the introduced sample solution;

A second flow path connected to the first flow path;

And a discharge port connected to the second flow path, the microfluidic device for detecting a target mutant gene,

The second flow path surface is coated;

A primer is immobilized on the coating;

The fixed primer is bound to a template for detecting a target mutation gene,

Wherein the template for detecting the target mutant gene comprises a primer binding portion complementarily binding to the primer, a complementary binding site-first target mutation gene binding site in the first template bound to one end of the primer binding portion, And a second target mutation gene binding site complementary to the second template in the second template bound to the other end of the second template.

In one embodiment of the present invention, the second flow path may be one to twenty.

In another embodiment of the present invention, the second flow path is 2 to 20, and each of the second flow paths is branched at the end of the first flow path, and the target mutation gene The detection template may be one which binds to mutant genes that are the same or different from each other.

In one embodiment of the present invention, the coating is selected from the group consisting of 5-hydroxydopamine hydrochloride, norepinephrine, epinephrine, pyrogallol amine, DOPA (3,4-Dihydroxyphenylalanine), catechin, tannins, pyrogallol, , Polyethylene glycol-catechol, polyethyleneimine-catechol, polymethylmethacrylate-catechol, hyaluronic acid-catechol, polylysine-catechol, and And may be selected from the group comprising polylysine.

In one embodiment of the present invention, the primer is selected from the group consisting of thiol, amine, hydroxyl, carboxyl, isothiocyanate, NHS ester, aldehyde, epoxide, carbonate, HOBt ester, glutaraldehyde, carbamate, imidazole carbamate, The terminal may be modified at least one terminal group selected from the group consisting of maleimide, aziridine, sulfone, vinyl sulfone, hydrazine, phenylazide, benzophenone, anthraquinone, and a diene group.

In one embodiment of the present invention, the coating is 5-hydroxydopamine hydrochloric acid, and the primer may have a terminal modified to a thiol or amine group.

In one embodiment of the present invention, the primer binding portion of the template for detecting the target mutant gene may include the nucleotide sequence shown in SEQ ID NO: 2.

There is no limitation on the kind of the mutant gene which can be detected by the microfluidic device for detecting the target mutant gene of the present invention. The present invention is applicable to various mutant genes known in the art.

In one embodiment of the present invention, the mutant gene can be a cancer-specific mutant gene that appears in cancer. Cancer-specific mutant genes can be found on websites such as http://www.mycancergenome.org, or any other cancer-specific mutant gene known in the art. For example, the mutant gene may be a cancer-causing mutant gene that is a cancer-causing gene, specifically, a lung cancer-specific mutant gene, more specifically, a gene in which EGFR exon 19 deletion occurs, and It is not limited.

Mutations in the genes that appear in each cancer have been reported (http://www.mycancergenome.org excerpt);

Mutation of CRLF2 or JAK2 gene of acute lymphoblastic leukemia, mutation of acute myeloid leukemia CBFB-MYH11, DEK-NUP214, DNMT3A, FLT3, IDH1, IDH2, KIT, MLL-MLLT3, PML of acute lymphoblastic leukemia Mutation of RARA, RBM15-MKL1, RPN1-EVI1, or RUNX1-RUNX1T1 gene, ALK gene mutation of anaplastic large cell lymphoma, SMO gene mutation of basal cell carcinoma, bladder cancer Bladder Cancer), mutations of AKT1, AR, ERBB2, ESR1, FGFR1, FGFR2, PGR, PIK3CA or PTEN genes of Breast Cancer, BCR-ABL1 of Molecular Profiling of Chronic Myeloid Leukemia Mutation of the BRAF, KIT, or PDGFRA gene of a mutation of the gene, AKT1, BRAF, KRAS, NRAS, PIK3CA, PTEN, or SMAD4 gene of Colorectal Cancer, Gastrointestinal Stromal Tumor (GIST) , Gastric cancer mutations of the ERBB2 gene in the glioma, mutations in the BRAF, IDH1, or IDH2 gene in the tric cancer, mutations in the ALK gene in the inflammatory myofibroblastic tumor, mutations in the AKT1, ALK, BRAF, Mutations of the SMO gene of the medulloblastoma, mutations of the SMO gene of the melanoma, medulloblastoma, mutations of the DDR2, EGFR, ERBB2, FGFR1, FGFR3, KRAS, MAP2K1, MET, NRAS, NTRK1, PIK3CA, PTEN, RET, RICTOR, Mutations of BRAF, CTNNB1, GNA11, GNAQ, KIT, MAP2K1, NF1 or NRAS genes, ASXL1, BCOR, DNMT3A, ETV6, EZH2, NF1, RUNX1, SF3B1, SRSF2, STAG2, TET2 of Myelodysplastic Syndromes Mutation of the ALK gene of Neuroblastoma, mutation of BRAF, KRAS, PIK3CA or PTEN gene of ovarian cancer, mutation of ALK gene of Rhabdomyosarcoma, mutation of TP53, U2AF1 or ZRSR2 gene, mutation of ALK gene of neuroblastoma, Thymic Malignancies KIT gene mutations, and mutations in the BRAF, HRAS, KRAS, NRAS, or RET genes of thyroid cancer.

The mutant gene which can be detected by the present invention is not limited to a mutant gene related to cancer, and any mutant gene related to other congenital or acquired diseases or malformations may also be a gene.

A mutant gene that can be detected by the present invention may be any mutant gene in which a normal gene and one or more bases are substituted, deleted, or added.

In another embodiment of the present invention, the mutant gene may be a mutant gene in which two or more bases are continuously or discontinuously substituted, deleted or added.

The first target mutation gene binding site and the second target mutation gene binding site of the template for detecting a target mutant gene of the present invention can be designed so as to complementarily bind only to a mutant gene and not bind to a normal gene.

The mutant gene of the present invention can be, for example, a mutation of an epidermal growth factor receptor (EGFR) gene. For example, the mutant gene may be a gene in which EGFR exon 19 deletion (hereinafter referred to as 'EGFR 19del') occurs.

EGFR 19del is an exon 19 of the EGFR gene in which several to several dozen bases are consecutively deleted, and a plurality of mutations are known. The variants of EGFR 19del are shown in Table 1 below. In the following table, '' denotes the deletion region, the lower case means the mutation site, and the 'wild type' means the gene of the normal EGFR exon 19 region without deletion. Domestic Laid-Open Patent No. 10-2012-0125164 describes a variety of EGFR exon 19 polymorphisms, and many other reports have reported the EGFR exon 19 polymorphism. However, the EGFR 19del is not limited to that described in Table 1 below.

[Table 1]

The EGFR 19del is a mutation commonly found in lung cancer such as non-small cell lung cancer (NSCLC), and histologically, it is frequently observed in adenocarcinoma. Whether an EGFR 19del has developed can be used to confirm lung cancer. Iressa (ingredient name: gefitinib), tasseba (ingredient name: elotinib) and geotrip (ingredient name: apatinate) are commercially available as a target cancer drug that can be used to treat patients suffering from lung cancer with EGFR 19del, A number of targeted anticancer drugs for 19del-derived lung cancer are currently in development or clinical trials. In patients with lung cancer who do not have EGFR 19del, these anticancer drugs are often prescribed initially, but the anticancer effects do not appear as expected. This not only increases the patient's economic burden, but also misses the opportunity to be treated with other appropriate anticancer drugs, which can lead to poor prognosis.

The microfluidic device of the present invention can rapidly and accurately detect a mutant gene of various mutant EGFR 19del, and thus can be used for the confirmation of lung cancer. Also, it is possible to select an appropriate anticancer drug, It can be a decisive help in establishing.

The present invention provides a method for producing a microfluidic device for detecting a target mutant gene comprising the following steps.

1) A microfluidic device comprising a substrate, an inlet formed on the substrate, a first flow path connected to the inlet and containing the introduced sample solution, a second flow path connected to the first flow path, and a discharge port connected to the second flow path ;

2) coating the second flow path surface of the microfluidic device;

3) fixing the primer to the coating; And

4) binding the template for detecting the target mutation gene to the fixed primer.

The present invention also provides a method for detecting a target mutant gene using the microfluidic device for detecting the target mutant gene, comprising the steps of:

a) providing a microfluidic device for detecting the target mutant gene;

b) injecting the sample solution into the inlet of the microfluidic device for detecting the target mutant gene; And

c) adding a ligase to a second flow path of the microfluidic device;

d) adding dNTP and isothermal nucleic acid polymerase to the first flow path of the microfluidic device.

In one embodiment of the present invention, the step c) and the step d) may be performed simultaneously (that is, the ligation and the roundup amplification reaction are simultaneously performed), or the step d) is performed after the step c) That is, the reaction may be performed after the ligation reaction). The simultaneous or separate occurrence of step c) and step d) may be determined depending on the number and type of target substances to be detected, and the like.

In one embodiment of the present invention,

e) injecting a dyeing reagent, a high salt solution or a fluorescent reagent into the inlet of the microfluidic device.

The microfluidic device for detecting a target mutant gene of the present invention can be used for the detection of various mutant genes occurring in humans and animals. The animal includes all mammals, birds, reptiles, amphibians, fishes, and the like.

The present invention relates to a microfluidic device for detecting a target gene;

dNTP;

Ligase;

Isothermal nucleic acid polymerase; And

There is provided a microfluidic device kit for detecting a target gene, comprising an additional primer.

The microfluidic device

Board;

An inlet through which the sample solution formed on the substrate flows from the outside;

A first flow path connected to the inlet port to receive the introduced sample solution;

A second flow path connected to the first flow path;

And an outlet connected to the second flow path, the microfluidic device comprising:

The second flow path surface is coated;

A primer is immobilized on the coating;

The template for detecting a target gene is bound to the fixed primer,

Wherein the template for detecting a target gene comprises a primer binding portion complementarily binding to the primer, a complementary binding site-first target gene binding site in the first template bound to one end of the primer binding portion, And a second target gene binding site complementary to the second template in the second template. The specific structure and characteristics of the microfluidic device for detecting the target gene are disclosed in Application No. 10 -2015-0151941 (the name of the invention: microfluidic device for detecting target gene, a method for producing the same, and a detection method using the same).

In one embodiment of the present invention, the additional primer may be a whole sequence or a partial sequence of the primer binding portion of the target gene detection template, and may be, for example, 5 to 50, preferably 10 to 25 , And more preferably from 15 to 22 nucleotides in length.

For example, when the primer-binding portion of the template for detecting a target gene of the present invention is SEQ ID NO: 2 (5'-TA GCA TGC TAG TAT CGA CGT-3 '), the additional primer sequence has the same sequence as the above sequence, (SEQ ID NO: 3) (5 'TGC TAG TAT C 3'), which is a sequence corresponding to a part of the above sequence, preferably 10 to 25 bases.

In one embodiment of the present invention, the ligase may be an DNA ligase such as T7 ligase, or CircLigase (TM). The isothermal nucleic acid polymerase may also be a phi 29 polymerase.

In another embodiment of the present invention, the kit may further comprise dithiothreitol (DTT) or phyrophosphatase.

The kit may further comprise a dyeing reagent, a high salt solution, or a fluorescent reagent.

The present invention also provides a method for detecting a target gene, comprising the steps of: a) providing a microfluidic device for detecting a target gene;

b) injecting a sample solution into the inlet of the microfluidic device; And

c) adding a dNTP, a ligase, an isothermal nucleic acid polymerase, and an additional primer to a second flow path of the microfluidic device, and detecting the target gene using the microfluidic device.

In the target gene detection method, an additional primer is added, and an additional primer is added to the middle of the sequence to be converted and amplified, thereby amplifying the template much more rapidly. That is, by adding the additional primer, the amplification time of the nucleic acid mass can be greatly shortened and can be detected much more quickly. Further, even when a small amount of the target gene is contained in the sample, or even when the amount of the sample itself is small, By amplifying the amplification site through the second amplification by the template, amplification of the template occurs to form a large lump of nucleic acid, so that the accuracy of detection increases.

According to one embodiment of the present invention, a method for detecting a target gene of the present invention is characterized in that a daughter strand generated through a secondary amplification (addition amplification) by adding an additional primer is inserted into a mother strand strand) to form a DNA hydrogel faster and more robustly than the conventional method.

The method for detecting a target gene using the microfluidic kit for detecting a target gene containing the additional primer can be used for detecting a gene that can be derived from all origins such as an animal, a plant, a bacterium, a virus, a fungus, Can be applied.

According to one embodiment of the present invention, the target gene to be detected may be a pathogen gene. The target gene may be any pathogen known to have a nucleic acid sequence. Specifically, the pathogenic microorganisms include avian influenza, SARS, Escherichia coli O157: H7, Mycobacterium tuberculosis, Bacillus anthracis, Streptococcus pneumonia, Plasmodium, Salmonella Salmonella, Hepatitis A, B, C, D and E virus, Francisella tularensis, Yersinia pestis, Yersinia enterocolitica and Ebola virus, It is useful for the detection of MERS-Cov virus. According to one embodiment of the present invention, the pathogen is also useful for the detection of a pathogenic bacterium having antibiotic resistance such as pneumococcal bacteria, enterococci, staphylococci, tropical fever viruses and tuberculosis in third world or malaria bacteria.

According to another embodiment of the present invention, the target gene to be detected may be a mutant gene. Specifically, the mutant gene can be a cancer-specific mutant gene that appears in cancer. The cancer-specific mutation gene may be any cancer-specific mutation gene known in the art, and the specific cancer-specific mutation gene is as described above. More specifically, it may be a lung cancer-specific mutant gene, for example, a gene in which EGFR exon 19 deletion occurs, but is not limited thereto.

The present invention eliminates the need to change the temperature for nucleic acid amplification and allows detection of the target mutant gene without external power supply. Therefore, it is not necessary to carry complicated equipment, and it can be manufactured simply, inexpensively, is easy to operate, and is easy to carry. It can also be used for the detection of various mutant genes and can be used for the simultaneous detection of two or more mutant genes.

A microfluidic kit for detecting a target gene comprising the additional primer of the present invention; And the detection method using the same, the time required for detection of a conventional microfluidic device for detecting a target substance can be greatly shortened and the accuracy of detection can be increased.

Brief Description of the Drawings Fig. 1 is a fluorescence image showing the result of detection of a gene having a mutation in EGFR exon 19 of SEQ. ID. NO. 5 using a microfluidic device for detecting a target mutant gene of the present invention.
FIG. 2 is a schematic diagram showing that the addition of an additional primer allows secondary amplification to occur and the amplification of the template can be faster and more rapid.
FIG. 3 is a graph showing the results of detection of a target gene by the method developed by the present inventors (named as DhITACT (DNA Hydrogel Formation by Isothermal Amplification of Complementary Target in Fluidic Channels)) using the same target gene detection microfluidic device ((A) and (⒞)) and the result of detection of the target gene by the method (DhITACT-TR) in which the additional primer developed at this time is added (및 and ⒟), respectively.
FIG. 4 is an atomic force microscope (AFM) image of a target mammal coronavirus gene hydrogel formed through DhITACT.
FIG. 5 is an atomic force microscope (AFM) image of a target mers coronavirus gene hydrogel formed through DhITACT-TR.
FIG. 6 is a graph showing the rheological measurement results of a target mollusc corona virus gene hydrogel formed through DhITACT and DhITACT-TR. FIG.
FIG. 7 is a fluorescence image showing the result of detection of a gene in which the mutation of EGFR exon 19 of SEQ ID NO: 5 has been detected by the target gene detection method of the present invention to which an additional primer has been added.

Hereinafter, the present invention will be described in detail with reference to the accompanying drawings in order to facilitate understanding of the present invention. It is to be understood, however, that the invention is not limited to the disclosed embodiments, but, on the contrary, is intended to cover various modifications and equivalent arrangements included within the spirit and scope of the invention. Also, in the drawings, the width, length, thickness, etc. of components may be exaggerated for convenience. Like reference numerals designate like elements throughout the specification. Also, when an element is referred to as being on another element, it includes not only the element just above another element, but also the case where there is another element in between.

Microfluidic device for target mutant gene detection

The basic structure of the microfluidic device for detecting the target mutant gene of the present invention, the production method thereof, and the method for detecting the target mutant gene using the microfluidic device are disclosed in Japanese Patent Application No. 10-2015-0151941 (entitled Microfluidic Device for Target Gene Detection, And a detection method using the same).

The target mutant gene that can be detected by the microfluidic device for detecting the target mutant gene of the present invention is not limited and may be any mutant gene having one or more base differences with the normal gene. A mutant gene that can be detected by the present invention may be any mutant gene associated with a congenital or acquired disease or malformation.

In one embodiment of the present invention, the mutant gene may be a mutant gene in which two or more genes are continuously or discontinuously substituted or deleted.

For example, the mutant gene may be a gene described in SEQ ID NO: 5, which is a kind of EGFR 19del. The mutant gene is compared with a normal gene as shown in Table 2 below.

[Table 2]

In this case, the template for detecting the target mutant gene of the present invention can be designed as follows (SEQ ID NO: 6).

In the above sequence, the first target mutation gene binding site and the second target mutation gene binding site expressed in dark letters complementarily bind to 'AAATTCCCGGGA' and 'ATTAAGAGAAGCCAACAAGG' in the mutant gene of SEQ ID NO: 5, respectively. That is, the template can be designed such that the target mutation gene binding site is complementarily bound to the mutation gene only.

The dark gray portion was prepared to be complementary to a primer represented by SEQ ID NO: 1 (5'-Thiol-AAA AAA AAA GGG ACG TCG ATA CTA GCA TGC TA-3 ') as a primer binding site. (SEQ ID NO: 2). In addition, the light gray portions are complementary binding sites in the template (complementary binding sites in the first template and complementary binding sites in the second template).

Method for improving the detection efficiency of a microfluidic device for detecting a target substance

A method for detecting a target gene using a microfluidic device for detecting a target substance, that is, a microfluidic device for detecting a target gene, which is invented by the present inventors, is disclosed in Application No. 10-2015-0151941 (entitled: A microfluidic device, a method for producing the same, and a detection method using the same), but an additional primer is also added when dNTPs, ligases, isothermal nucleic acid polymerase, etc. are added for conversion amplification .

The additional primer may be an entire sequence or a partial sequence of the primer binding site of the target gene detection template used in the microfluidic device, and may be, for example, a partial sequence of 10-25 base length.

In the schematic diagram of FIG. 2, the two upper diagrams show the process in which the conversion amplification occurs in the method of the existing application, and in the case of adding the additional primer at the lower end, the additional primer is inserted at the mid- The amplification occurs and the amplification of the template occurs in a larger amount. That is, by adding the additional primer, the amplification time of the nucleic acid mass can be greatly shortened and can be detected much more quickly, and even when a small amount of the target substance is contained in the sample, or even when the amount of the sample itself is small, Can be formed to form a large mass of nucleic acid, thereby increasing the accuracy of detection.

Example

Hereinafter, embodiments are described to help understand the present invention. The following examples are provided to further understand the present invention, but the present invention is not limited by the examples.

Example 1. EGFR 19del detection using a microfluidic device for detection of a target gene (cancer mutation gene)

1-1. Preparation of microfluidic device for EGFR 19del detection

1 μ-Slide Ⅲ ³ⁱⁿ¹ uncoated Microscopy Chamber manufactured by ibidi Inc. was purchased and prepared.

5-Hydroxydopamine HCl was used as the coating material of the second flow path. Specifically, 5-hydroxydopamine hydrochloride (Sigma Aldrich) was dissolved in 10 mM Tris buffer (1M UltraPure 1M Tris-HCl pH 8.0 / Invitrogen) at a concentration of 1 mg / ml. Thereafter, the pH was adjusted to 8 to prepare a coating composition. Wherein in the coating composition for a ^{1 μ-Slide Ⅲ 3in1 uncoated Microscopy} Chamber filled the each second flow path of the product. After 2 hours, the cells were washed with DDW (Water Purification System / LABOGENE).

Further, a primer to be adhered to the coating of the second flow path was prepared. Primer-5SS-polyA9 (BIONEER) having the following sequences was purchased and used. The 5 'end of the following primer sequence is bound to a thiol group.

5'-Thiol-AAA AAA AAA GGG ACG TCG ATA CTA GCA TGC TA-3 '(SEQ ID NO: 1)

100 pmol of this primer and 5 M DTT (DL-Dithiothreitol / Sigma Aldrich) were prepared, and then 5 pmol of 5 M DTT was added to 100 pmol of the primer. DDW (Water Purification System / LABOGENE) To prepare a primer composition. The mixture was allowed to stand for 4 hours so that the disulfide bond that might have formed in the primer was cut off by DTT, and then immersed in a 3K Amicon tube (Amicon Ultra Centrifugal Filters 3K / MILLIPORE) at 132,000 rpm, After primary centrifugation, 40 μl of DDW was added and secondary centrifugation was performed to remove the remaining DTT after the reaction. 5 [mu] L of the primer composition from which the DTT was removed was added to each second flow path and allowed to stand for 2 hours to allow the primer to adhere to the coating on the second flow path, followed by washing with DDW (Water Purification System / LABOGENE).

The template for EGFR 19del detection (SEQ ID NO: 6) described in SEQ ID NO: 5 was also prepared as follows.

5 [mu] l of a template composition for EGFR 19del detection was added to 0.2 [mu] l (= 20 pmole) of the above EGFR 19del detection template at 100 [mu] M to add 2X of PBS (life technology gibco) (Left when viewed from the center and above). After standing for 2 hours to allow complementary binding between the primer binding portion of the EGFR 19del detection template and the primer immobilized in the second flow path, DDW (Water Purification System / LABOGENE) was washed. On the right channel, a template for detection of EGFR 19del in which a nick was already ligation was introduced (positive control group).

1-2. EGFR 19del detection

A solution containing the EGFR 19del gene of SEQ ID NO: 5 was prepared as a sample solution. As a negative control solution, a solution containing the EGFR normal gene of SEQ ID NO: 4 was prepared. The sample solution was introduced into the second flow path in the center and the negative control solution was introduced into the leftmost second flow path in an amount of 3.5 l each. 30 μl of T7 ligase, 0.2 μl of 100 mM DTT and 24.8 μl of DDW (Water Purification System / LABOGENE) were filled with the second flow path of the microfluidic device for target gene detection. And placed in a plastic container sealed with a parafilm to prevent moisture in the second flow path from flying. The plastic was filled with water dampened with water and 30 ° C water. After that, the plate was allowed to stand in a non-shaking condition at 30 ° C for 3 hours to allow the nicking of the template for EGFR 19del detection to occur.

Then, about 60 μl of a mixture of 2 μl of 25 mM dNTP, 50 μl of phi 29 polymerase (10 units / μl), 1 μl of pyrophosphatase, reaction buffer of each enzyme, and DDW was injected Injected into the second flow path along the first flow path, or injected into the respective second flow paths). And placed in a plastic container sealed with a parafilm to prevent moisture in the second flow path from flying. The plastic was filled with water dampened with water and 30 ° C water. After that, the sample was allowed to stand in a non-shaking condition at 30 ° C for 2 hours to induce a round-trip amplification reaction of a template for detection of EGFR 19del.

1, the template for EGFR 19del detection was amplified to form a large hydrogel lump with hydroxydopamine hydrochloric acid coated with the second flow path to block the outlet of the second flow path. there was. It was confirmed that the right-side flow path, which is a positive control, similarly blocks the outlet of the second flow path. On the other hand, fluorescence was not observed in the left channel, which is a negative control group.

Example 2. Method for further increasing the detection efficiency of the microfluidic device

The present inventors have invented a microfluidic device for detecting a target gene. The present inventors have invented a method for shortening the detection time and increasing the accuracy of the microfluidic device as follows.

2-1. Target Mers (MERS) gene detection

A microfluidic device for detecting target mers (MERS) genes was prepared as described in Experimental Example 5 of Application No. 10-2015-0151941. The basic structure of the device is as described in 1-1 above, and the template sequence is as follows.

In the template MERS (MERS) sequence, the portion complementary to the target mers coronavirus gene is shown in bold, the complementary portion in the template is lightly grayed, and the portion complementarily binding to the primer is shown in dark gray Respectively.

Also, the target mammalian coronavirus gene sequence complementarily binding to the first target gene binding site and the second target gene binding site of the template sequence is as follows.

5 '- / CG GAG AUG UGC CCU GGG UAU / 3Phos / -3' (SEQ ID NO: 7)

To the microfluidic device for detection of the target MERS gene, the sample solution was added to the second flow path and the negative control solution was added to the leftmost second flow path in an amount of 3.5 μl Lt; / RTI > 30 μl of T7 ligase, 0.2 μl of 100 mM DTT and 24.8 μl of DDW (Water Purification System / LABOGENE) were filled with the second flow path of the microfluidic device for target gene detection. And placed in a plastic container sealed with a parafilm to prevent moisture in the second flow path from flying. The plastic was filled with water dampened with water and 30 ° C water. Thereafter, non-shaking, 30 ° C, and 3 hours were allowed to allow the nicking of the template to occur.

Then, about 60 μl of a mixture of 2 μl of 25 mM dNTP, 50 μl of phi 29 polymerase (10 units / μl), 1 μl of pyrophosphatase, reaction buffer of each enzyme, and DDW was injected Injected into the second flow path along the first flow path, or injected into the respective second flow paths). And placed in a plastic container sealed with a parafilm to prevent moisture in the second flow path from flying. The plastic was filled with water dampened with water and 30 ° C water. After that, the mixture was allowed to stand at 30 ° C for 2 hours in a non-shaking condition, so that a round-fold amplification reaction of the template occurred. It was not observed that the template was amplified when observed with fluorescence after 30 minutes (FIG. 3 (a)). After about 2 hours, the template was amplified to form a hydrogel mass.

In the same manner, a microfluidic device for detecting MERS gene was prepared, a sample solution containing the MERS virus gene was injected, and a ligation reaction and a round-trip amplification reaction were sequentially performed. At this time, an additional primer (consisting of a short DNA sequence) was further added during the round-trip amplification reaction. Additional primer sequences added are as follows.

 5 'TGC TAG TAT C 3' (SEQ ID NO: 3)

When observed with fluorescence after 30 minutes, it was observed that the template was amplified to form a hydrogel mass (Fig. 3 (b)). That is, the time required for amplification was greatly reduced when an additional primer was added.

When no additional primer was added and 4 hours after addition, dye was injected into each eye. As a result, when no additional primer was added, template amplification (central channel) was observed with negative control (left channel) However, when the additional primers were added, it was clearly confirmed that the second flow path was not blocked only in the negative control group and the flow path was blocked in the remaining two flow paths, so that it was possible to discriminate between the amplification of the template and the negative control group 3 (c) and 3 (d). That is, even when a small amount of target mers virus gene is present in the sample solution when the additional primer is added, the sensitivity can be detected with high sensitivity and the accuracy is increased.

2-2. Confirmation of increase of detection efficiency by addition of additional primer

The present inventors have also found that, in order to confirm the improved detection efficiency of a microfluidic device for detecting a target gene by adding an additional primer, the pore size of the hydrogel using an atomic force microscope (AFM) Rheology was measured.

The target mammalian hydrogel of Example 1 and the additional primer, which were formed into an existing apparatus using an interatomic microscope (NX10, Park Systems, Korea), and the target mers gene hydrogel of Example 2-1 The pore size of the agglomerate was measured, and the results are shown in FIGS. 4 and 5. FIG.

4 and 5, the mean pore size of the hydrogel amplified using the existing target gene detection microfluidic device (DhITACT) was 56 nm (FIG. 4), but when the additional primer was added (DhITACT -TR) The average pore size was 16 nm (Fig. 5), confirming that the density increased about 3.5 times. That is, it was confirmed that the addition of the additional primer resulted in formation of a more rigid DNA hydrogel mass, thereby improving the detection efficiency.

In addition, the viscoelasticity of the target mers gene hydrogel formed through DhITACT and DhITACT-TR was measured using a parallel rheometer (Kinexus, Malvern, UK) and the results are shown in FIG.

As can be seen from FIG. 6, the Mels gene hydrogel (TR) formed through DhITACT-TR formed a gel having higher viscoelasticity than the hydrogel (D) formed through DhITACT, and the storage elastic modulus (G ') Respectively. That is, it was confirmed that the detection efficiency of the microfluidic device was increased by forming a hydrogel having stronger elasticity by adding the additional primer.

2-3. Target EGFR 19del mutant gene detection

The present inventors also confirmed increased detection efficiency by adding an additional primer using a microfluidic device for detecting a target mutant gene. As described in 1-1 above, a microfluidic device for EGFR 19del detection was prepared. The specific template sequence (SEQ ID NO: 6) is as follows, and the meanings indicated in the sequence are the same as the above-mentioned mercaptans template.

The target EGFR 19del gene sequence complementarily binding to the first target gene binding site and the second target gene binding site of the template sequence is as follows.

5 '- / AAA TTC CCG GGA ATT AAG AGA AGC CAA CAA GG / 3Phos / -3' (SEQ ID NO: 4)

Using the microfluidic device for detecting the target EGFR 19del gene, amplification of the EGFR 19del gene was carried out in the same manner as the method using the microfluidic device for detection of the mussel, and the additional primer of SEQ ID NO: 3 was added.

As a result, as shown in FIG. 7, it was visually observed that the template was amplified and a hydrogel mass was formed within 30 minutes after the reaction, and the time required for the amplification was greatly shortened by adding an additional primer. That is, the detection of the target EGFR 19del gene of Example 1-2 in which the additional primer was not added could be confirmed visually by the 2 hours after the conversion amplification reaction (FIG. 1), but the addition of the additional primer , The time required for amplification of the EGFR 19del mutant gene was greatly shortened. Therefore, it was confirmed that even when a small amount of the target EGFR 19del mutant gene is present in the sample solution, the sensitivity can be detected with high sensitivity and the accuracy is increased when the additional primer is added.

<110> Ewha University - Industry Collaboration Foundation <120> Microfluidic device for detection of a target gene mutation, and          method to improve the efficacy of a microfluidic          device for detection of target gene <130> P16-009-REA-EWHA <150> KR 10/2016/0011953 <151> 2016-01-29 <160> 7 <170> KoPatentin 3.0 <210> 1 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 1 aaaaaaaaag ggacgtcgat actagcatgc ta 32 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer binding region of a template <400> 2 tagcatgcta gtatcgacgt 20 <210> 3 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> additional primer <400> 3 tgctagtatc 10 <210> 4 <211> 57 <212> DNA <213> Unknown <220> Human EGFR exon 19 (wild) <400> 4 aaattcccgt cgctatcaag gaattaagag aagcaacatc tccgaaagcc aacaagg 57 <210> 5 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> human EGFR exon 19 gene with EGFR 19del <400> 5 aaattcccgg gaattaagag aagccaacaa gg 32 <210> 6 <211> 111 <212> DNA <213> Artificial Sequence <220> <223> a template for the detection of human EGFR exon 19 gene with EGFR          19del <400> 6 tcccgggaat ttaatcgaag tactcagcgt aagtttagag gtagcatgct agtatcgacg 60 tacgtaccaa cttacgctga gtacttcgat tccttgttgg cttctcttaa t 111 <210> 7 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Middle East respiratory syndrome coronavirus <400> 7 cggagaugug cccuggguau 20

Claims (23)

Board;
An inlet through which the sample solution formed on the substrate flows from the outside;
A first flow path connected to the inlet port to receive the introduced sample solution;
A second flow path connected to the first flow path;
And a discharge port connected to the second flow path, the microfluidic device for detecting a target mutant gene,
The second flow path surface is coated;
A primer is immobilized on the coating;
The fixed primer is bound to a template for detecting a target mutation gene,
Wherein the template for detecting the target mutant gene comprises a primer binding portion complementarily binding to the primer, a complementary binding site-first target mutation gene binding site in the first template bound to one end of the primer binding portion, A complementary binding site in a second template joined to the other end of the first target mutation;
Microfluidic device for target mutant gene detection. 2. The microfluidic device according to claim 1, wherein the second flow path is 1 to 20 targets. 2. The apparatus according to claim 1, wherein the second flow path is 2 to 20, each second flow path is branched at an end of the first flow path,
Wherein the target mutant gene detection template bound to the primer immobilized on each second flow path binds to the same or different mutant genes. The microfluidic device according to claim 1, wherein the mutant gene is a cancer-specific mutant gene. The microfluidic device for detecting a target mutant gene according to claim 4, wherein the cancer-specific mutant gene is an EGFR (epidermal growth factor receptor) exon 19 deletion gene. The microfluidic device for detecting a target mutant gene according to claim 5, wherein the gene in which the EGFR 19 exon deletion occurs is a gene represented by SEQ ID NO: 5. 2. The method according to claim 1, wherein the first target mutation gene binding site and the second target mutation gene binding site of the template for detecting the target mutant gene are complementary to the mutant gene but not to the normal gene, Microfluidic device. The microfluidic device for detecting a target mutant gene according to claim 1, wherein the mutant gene is one in which at least one base is substituted, deleted or added as compared with a normal gene. 2. The method according to claim 1, wherein the target mutation gene is a gene containing a point mutation, and the first target mutation gene binding site of the template for detecting the target mutant gene or the terminal base of the second target mutation gene binding site is the point mutation Wherein the target is complementarily bound to the resulting base. The microfluidic device for detecting a target mutant gene according to claim 1, wherein the template for detecting the target mutant gene is represented by SEQ ID NO: 6. A microfluidic device for detecting the target mutant gene of claim 1;
dNTP;
Ligase;
Isothermal nucleic acid polymerase; And
A microfluidic kit for detecting a target mutant gene comprising an additional primer. delete 12. The method of claim 11,
Wherein the additional primer is an entire sequence of the primer binding portion of the template for detecting the target mutant gene or a partial sequence of 10-25 base lengths. 12. The method of claim 11,
Wherein the ligase is a T7 ligase or CircLigase (TM). 12. The method of claim 11,
Wherein the isothermal nucleic acid polymerase is a phi 29 polymerase, a microfluidic device kit for detecting a target mutant gene. 12. The method of claim 11,
Wherein the kit further comprises dithiothreitol (DTT) or phyrophosphatase. &Lt; RTI ID = 0.0 &gt; 21. &lt; / RTI &gt; 12. The method of claim 11,
Wherein the kit further comprises a dyeing reagent, a high salt solution, or a fluorescent reagent. a) providing a microfluidic device for detecting the target mutant gene of claim 1;
b) injecting a sample solution into the inlet of the microfluidic device; And
c) a method for detecting a target mutant gene using a microfluidic device for detecting a target mutant gene, comprising the step of adding dNTP, ligase, isothermal nucleic acid polymerase, and an additional primer to a second flow path of the microfluidic device . 19. The method of claim 18,
Wherein the target mutant gene detection method is that a second amplification occurs by adding an additional primer. 19. The method of claim 18,
Wherein the target mutant gene is derived from an animal, an animal, a plant, a bacterium, a virus, a fungus or an environment. 19. The method of claim 18,
The target mutant gene may be selected from the group consisting of avian influenza, SARS, Escherichia coli O157: H7, Mycobacterium tuberculosis, Bacillus anthracis, Streptococcus pneumonia, Plasmodium, Salmonella Salmonella, Hepatitis A, B, C, D or E virus, Francisella tularensis, Yersinia pestis, Yersinia enterocolitica and Ebola virus, Wherein the target mutant gene is a target mutant gene derived from at least one selected from the group consisting of MERS-Cov virus. delete 19. The method of claim 18,
Wherein the target mutant gene is a gene in which EGFR exon 19 deletion occurs.

Images