WO2017122915A1 - 집먼지진드기 유래 알레르겐에 의한 과민반응 면역조절제 - Google Patents
집먼지진드기 유래 알레르겐에 의한 과민반응 면역조절제 Download PDFInfo
- Publication number
- WO2017122915A1 WO2017122915A1 PCT/KR2016/012626 KR2016012626W WO2017122915A1 WO 2017122915 A1 WO2017122915 A1 WO 2017122915A1 KR 2016012626 W KR2016012626 W KR 2016012626W WO 2017122915 A1 WO2017122915 A1 WO 2017122915A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- der
- house dust
- dust mite
- derived
- extracellular vesicles
- Prior art date
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/35—Allergens
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Definitions
- the present invention relates to an immunomodulator for the prevention or treatment of allergic diseases caused by house dust mite-derived allergens, and more particularly, to pharmaceutical compositions comprising bacterial extracellular vesicles containing house dust mite-derived allergens, and methods for preparing the same. Etc.
- Atopic dermatitis is a syndrome in which an excessive immune response (hypersensitivity) is caused to an unharmful antigen (allergen), which is often exposed, and the atopic disease is an atopic disease.
- Atopic dermatitis, allergic rhinitis, allergic conjunctivitis, allergic asthma, and atopic diseases often occur in people with atopy.
- the immunological etiology of atopy it is associated with at least an allergic reaction of type 1 hypersensitivity.
- atopy is defined in various ways, it is characterized by high concentrations of IgE for allergens in the blood.
- An allergy can be defined as a phenomenon in which an acquired immune response occurs in the body when exposed to surrounding antigens, and the pattern of the immune response changes upon repeated exposure to antigens with the memory of the antigen. Allergens caused by exposure to harmful antigens have a beneficial effect on our bodies and induce immune responses through vaccines. On the other hand, if the immune response is excessively induced to the harmless antigen, the hypersensitivity reaction occurs, an inflammatory reaction occurs in our body to cause allergic diseases. Asthma is a disease characterized by chronic inflammation of the airways. It is a disease that causes symptoms such as wheezing and dyspnea due to structural changes and functional changes caused by inflammation. As a cause of chronic inflammation in asthma, hypersensitivity to allergens in the surrounding environment is an important immune mechanism, and in particular, hypersensitivity to allergens derived from house dust mites is known as an important cause of asthma.
- House dust mite is an arthropod inhabited by humans. House dust mites live on human scales and are present in large quantities in bed mattresses, carpets and furniture in urban houses, and are known to be the most important allergens in the etiology of allergic diseases such as allergic asthma.
- Several digestive enzymes are present in the digestive system of house dust mites, which spread through the air through the feces that house dust mites excrete, and when inhaled, hypersensitivity reactions occur in people with atopy predisposition, followed by repeated exposure to house dust mite-derived allergens. Symptoms include sneezing, runny nose, rhinitis, asthma, asthma, shortness of breath, and atopic dermatitis, such as itching.
- active immunotherapy which induces immune cell activity present in the body by directly administering an antigen-causing substance to the body, and manual control of an immune response by administering substances produced in vitro, such as monoclonal antibodies It can be divided into passive immunotherapy. Active immunotherapy is considered to be more efficient in terms of cost and frequency of administration than passive immunotherapy as a method for preventing disease. Active immunotherapy is the use of strategies to induce an immune response that has the ability to induce antigen-specific long-term protective memory that is characteristic of acquired immunity, thereby inducing protective immunity.
- the key to controlling allergic reactions is key to allergen-specific regulation of immunological hypersensitivity to allergens, such as humoral (or antibody mediated) and cellular (T-cell mediated) immunity.
- Extracellular vesicles (EVs) secreted by bacteria are spherical phospholipid bilayers with diameters of 20-100 nm, and are characterized by outer membrane proteins, lipopolysaccharides (LPS), outer membrane lipids, and DNA through biochemical and proteomic studies. , RNA, and cytoplasmic proteins have been reported.
- Neisseria meningitidis Acinetobacter baumannii
- Porphyromonas gingivalis Salmonella enterica , serovar ( serovar) Typhimurium), Helicobacter pylori (Helicobacter pylori), and Vibrio cholera (Vibrio Gram-negative bacteria, such as cholerae ), secrete extracellular vesicles to induce defense immunity to bacterial infections, and Gram-positive bacteria, like Staphylococcus aureus , induce defense immunity to bacterial infections through extracellular vesicles. It can be reported.
- LPS Lipopolysaccharide
- TLR4 receptors present in large amounts in vascular endothelial cells.
- Protoplasts are living cell materials of plants or bacteria that remove the extracellular membranes and cell walls of these cells by mechanical / enzymatic methods. I can solve it.
- drugs such as polymyxin B can be treated to remove the activity of endotoxins present in extracellular vesicles.
- house dust mite allergen immunotherapy has mainly been used to extract allergens from house dust mites, or in the form of recombinant proteins, and there are no examples of using allergens to express antigens such as extracellular vesicles.
- the present invention is to provide a pharmaceutical composition
- a pharmaceutical composition comprising a bacterium expressing house dust mite-derived allergens, and extracellular vesicles derived therefrom, and a preparation method thereof.
- the present invention is to provide a method for controlling hypersensitivity by house dust mite-derived allergens using the composition.
- the present invention provides a pharmaceutical composition for preventing or treating allergic diseases, which contains a bacterial-derived extracellular vesicle as an active ingredient.
- the bacterium is a bacterium that overexpresses an allergen gene derived from house dust mite, and the allergic disease is an allergic disease caused by house dust mite-derived allergen.
- the bacteria is characterized in that Escherichia coli (E. coli), or in bacteria or Salmonella (Salmonella spp.).
- the house dust mite is a European house dust mite ( Dermatophagoides pteronyssinus ) or North American house dust mite.
- the house dust mite-derived allergens are Der p1, Der p2, Der p3, Der p4, Der p6, Der p9, Der p15, Der f1, Der f2, Der f11, and Der f18. It is characterized in that it is selected from the group consisting of.
- the present invention comprises the steps of (a) overexpressing a house dust mite-derived allergen gene in bacteria; (b) culturing the overexpressed bacteria; (c) separating the vesicles from the bacterial culture; And (d) provides a method for producing bacterial vesicles for preventing or treating allergic diseases caused by house dust mite-derived allergens, comprising the step of removing the outer membrane endotoxin activity of the bacterial vesicles.
- the method for separating the vesicles in the step (c) is to separate the naturally secreted vesicles by a filter method, and / or ultracentrifugation method, or after making the vesicles in an artificial method, Separation by filtration, and / or ultracentrifugation.
- the method for removing endotoxin activity in step (d) is to remove toxins (LPS, peptidoglycan, etc.) in the vesicles with lysozyme or the like, or endotoxin (LPS) polymyxin (polymyxin B A method of inhibiting activity with a drug such as).
- the house dust mite allergic disease is characterized in that selected from the group consisting of asthma, rhinitis, atopic dermatitis.
- the present invention provides an immunomodulator for preventing or treating allergic diseases caused by house dust mite, comprising as an active ingredient bacteria-derived extracellular vesicles prepared by the above method.
- the immunomodulator is characterized in that the house dust mite allergen (Der f2, etc.) is overexpressed in the lumen of the bacteria-derived extracellular vesicles.
- the bacteria-derived vesicles are characterized in that the average diameter of 10-200nm.
- the present invention also provides a method for preventing or treating allergic diseases caused by house dust mite-derived allergens using bacterial-derived vesicles. Specifically, it provides a method for preventing or treating allergic diseases, comprising administering to a subject a pharmaceutical composition containing a bacterial-derived extracellular vesicle as an active ingredient.
- the bacterium is a bacterium that overexpresses an allergen gene derived from house dust mite, and the allergic disease is an allergic disease caused by house dust mite-derived allergen.
- the present invention provides a use or prevention of allergic diseases caused by house dust mite-derived allergens of the bacteria-derived extracellular vesicles.
- the bacterium is a bacterium that overexpresses an allergen gene derived from house dust mite, and the allergic disease is an allergic disease caused by house dust mite-derived allergen.
- the present invention is to control allergic diseases caused by house dust mite by controlling hypersensitivity reactions caused by allergens by using a bacterial-derived vesicle containing house dust mite-derived allergens (Der f2, etc.) as an allergen immunomodulator derived from house dust mite. It is expected to be prevented or cured.
- coli 1 is a clone of the North American house dust mite ( D. farinae ) allergen (Der f2) and a bacterium ( Esherichia). coli ), the process of lysozyme in the culturing process to produce a protoplast, and then an extrusion (extrusion) to produce an artificial extracellular vesicles to create an immunomodulator.
- FIG. 2 is a photograph of an extracellular vesicle loaded with a Der f2 allergen under a transmission electron microscope.
- Figure 4 shows the results of measuring the expression of co-stimulatory molecules (CD86) by treating extracellular vesicles loaded with Der f2 allergens to bone marrow-derived dendritic cells.
- IL interleukin
- IL-6 interleukin-6
- FIG. 6 is a method of cloning small RNA present in bacteria, loading them into bacteria ( Salmonella typhimurium ), culturing bacteria to separate extracellular vesicles, and removing the activity of lipopolysaccharide (LPS) present in the outer membrane of the vesicles.
- PMB polymyxin B
- FIG. 7 is a diagram illustrating morphological characteristics of extracellular vesicles derived from Mic A small RNA overexpressing strains by dynamic light scattering and electron microscopy.
- FIG 8 after three times intraperitoneal injection of the small RNA overexpressing strain ( Salmonella typhimurium ) present in the bacteria, the immune cells are isolated from local lymph nodes and stimulated with anti-CD3 / anti-CD28, gamma interferon Figure shows the measured amount of IL-4 and IL-17.
- PMB polymyxin B
- Figure 10 after administering the MIC A small RNA overexpressing strain ( Salmonella typhimurium ) -derived vesicles (macrophage line RAW264.7) to the polymyxin B (PMB) concentrations in more detail, Figure shows the measurement of IL-6 secretion.
- Salmonella typhimurium Salmonella typhimurium -derived vesicles (macrophage line RAW264.7)
- PMB polymyxin B
- 11 is an experimental protocol for evaluating the immunogenicity of extracellular vesicles loaded with Der f2 allergens in mice.
- IM intramuscular injection
- IN nasal administration
- BAL Bronchoalveolar Lavage
- 12A and 12B show the results of measuring the antigen-specific IgG antibody in mouse serum and antigen-specific IgA antibody generation ability in bronchial alveolar lavage fluid after administration of the extracellular vesicles loaded with Der f2 allergen by the method of FIG. 11.
- T cells are isolated from mouse lung tissue and stimulated with anti-CD3 / CD28, gamma-interferon, IL-17 , IL-4 and IL-10 were measured.
- FIG. 14 is a protocol for evaluating the immunomodulatory efficacy of Der f2 allergen-loaded extracellular vesicles in mice in a mouse asthma model induced with a North American dust mite extract antigen and an immunostimulant (aluminum hydroxide, alum).
- an immunostimulant aluminum hydroxide, alum
- IM intramuscular injection
- IN nasal administration
- IP intraperitoneal administration
- FIG. 15 shows the anti-inflammatory effect of extracellular vesicles loaded with Der f2 allergens in the mouse asthma model induced by house dust mite allergens by the number of inflammatory cells in bronchoalveolar lavage fluid.
- extracellular vesicles derived from bacteria as an adjuvant, LPS, peptidoglycan It contains a toxin such as, there is a problem to solve the toxicity problem caused by extracellular vesicles.
- the outer membrane and the peptidoglycan layer of the extracellular vesicles After producing a protoplast (protoplast) made by removing the cell wall (cell wall) containing, artificially prepared and used extracellular vesicles.
- protoplast a protoplast made by removing the cell wall (cell wall) containing, artificially prepared and used extracellular vesicles.
- polymyxin B which inhibits the activity of LPS present in the vesicle envelope, was combined with naturally secreted vesicles to reduce toxicity.
- Der f2 antigen a major allergen derived from North American house dust mite
- E. coli E. coli
- lysozyme a major allergen derived from North American house dust mite
- protoplasts a major allergen derived from North American house dust mite
- extracellular vesicles were prepared by extrusion.
- candidate material cloned Mic
- cloned Mic A small RNA present in bacteria, inserted into Salmonella and overexpressed, and then cultured, followed by simultaneous administration of PMB with vesicles, while maintaining immunogenicity, The optimal PMB concentration with reduced toxicity was set.
- the immunogenicity of the antigen-loaded candidate extracellular vesicles was evaluated through in vitro and in vitro experiments to determine the route of administration and the dose for efficacy evaluation. This suggests that the extracellular vesicles loaded with the antigen are effective vaccines.
- the North American dust mite extract and alum were injected into the abdominal cavity to sensitize with allergens, and then only the tick extract was administered to the nasal cavity to prepare an asthma animal model.
- the house dust mite allergic disease is not particularly limited as long as it can be caused by house dust mite-derived allergens, but is preferably selected from the group consisting of asthma, rhinitis and atopic dermatitis.
- 'treatment or prevention of allergic diseases means including alleviating, alleviating and alleviating allergic diseases, and also including lowering the possibility of allergic diseases.
- the bacterium is not particularly limited, but is capable of over-expressing the gene, it is preferred that the Escherichia coli (E. coli), or Salmonella (Salmonella spp.).
- the step of separating the extracellular vesicles can be used naturally secreted extracellular vesicles, there is no particular limitation on the method for separating the extracellular vesicles, can be obtained by concentrating with a filter, and then ultracentrifugation, etc. It may include the process of.
- the extracellular vesicles can be artificially manufactured, and there is no particular limitation on the method for producing the extracellular vesicles, and may be obtained by extruding with a filter, and may further include a process such as centrifugation and ultracentrifugation.
- the method for separating extracellular vesicles in the present invention is not particularly limited as long as it includes bacterial derived extracellular vesicles, for example, in culture, centrifugation, ultra-fast centrifugation, filtration by filter, gel filtration chromatography, pre-flow electrophoresis
- Extracellular vesicles can be isolated using methods such as capillary electrophoresis and combinations thereof. In addition, it may further include a process for washing to remove impurities, concentration of the obtained extracellular vesicles and the like.
- the extracellular vesicles are naturally secreted or include extracellularly secreted extracellular vesicles.
- house dust mite-derived allergens are expressed in lumens of extracellular vesicles prepared by the above method, and as expression proteins, Der f2, Der p2, and the like are preferred, and Der f2 is most preferred.
- the extracellular vesicles of the immunomodulator prepared by the above method may have an average diameter of 10-200 nm, but preferably 20-100 nm.
- an immunomodulator for treating or preventing the allergic disease may be prepared as a pharmaceutical composition. It is possible to administer the bacteria-derived extracellular vesicles of the present invention for use in treatment and prophylaxis, but it is preferred that the extracellular vesicles are included as active ingredients of the pharmaceutical composition.
- the pharmaceutical composition may contain the isolated extracellular vesicles as an active ingredient, and may include a pharmaceutically acceptable carrier.
- pharmaceutically acceptable carriers are conventionally used in the preparation, and include, but are not limited to, saline solution, sterile water, Ringer's solution, buffered saline, cyclodextrin, dextrose solution, maltodextrin solution, glycerol, ethanol, liposomes, and the like. If necessary, other conventional additives such as antioxidants and buffers may be further included.
- diluents, dispersants, surfactants, binders, lubricants and the like may be additionally added to formulate into injectable formulations, pills, capsules, granules or tablets such as aqueous solutions, suspensions, emulsions and the like.
- Suitable pharmaceutically acceptable carriers and formulations may be preferably formulated according to each component using the methods disclosed in Remington's Pharmaceutical Science, Mack Publishing Company, Easton PA.
- the pharmaceutical composition of the present invention is not particularly limited in formulation, but may be formulated as an injection, inhalant, or external skin preparation.
- the method of administering the pharmaceutical composition of the present invention is not particularly limited, but may be parenterally or orally administered, such as intramuscular injection, subcutaneous, inhalation, nasal, sublingual, and skin application.
- Dosage varies depending on the patient's weight, age, sex, health condition, diet, time of administration, method of administration, rate of excretion and severity of disease.
- Daily dosage refers to the amount of therapeutic substance of the invention sufficient for treatment for a disease state alleviated by administration to a subject in need thereof.
- Effective amounts of therapeutic agents depend on the particular compound, disease state and severity thereof, and on the individual in need thereof, and can be routinely determined by one skilled in the art.
- the dosage of the composition according to the present invention to the human body may vary depending on the age, weight, sex, dosage form, health condition and degree of disease of the patient.
- Der f2 gene (reference sequence: GeneBank AB195580) was synthesized for cDNA by RT-PCR for cloning Der f2, a major allergen of North American house dust mites. PCR products were inserted into a T-blunt PCR cloning kit (Solgent), and each plasmid was digested with EcoRI (OmpA, ABC transporter) and BglII (FepA). The sections were separated by electrophoresis and inserted into the pET-30a plasmid, transformed into E. coli DH5a by thermal shock, and finally the gene was cloned.
- Solgent T-blunt PCR cloning kit
- Exprep plasmid mini prep After incubating the Der f2 clone obtained in the above example in Luria Bertani broth (Merch) at 37 ° C., 200 rpm, for 12 hours, Exprep plasmid mini prep. Each plasmid was isolated using Kit (GeneAll) and transfected into E. coli BL21 (Real Biotech).
- the bacterial pellet was resuspended in Tris buffer and treated with 1 mg / ml lysozyme (Sigma) at 37 ° C., 100 rpm, 2 hours to obtain protoplasts, followed by 10 ⁇ m, 5 ⁇ m, and 1 Extruded with LiposoFast extruder (Avestin) in order through the membrane of the pore size. Finally, ultracentrifugation with 10% and 50% opti-prep density gradient medium (OptiPrep) yielded extracellular vesicles loaded with Der f2 antigen.
- 1 mg / ml lysozyme Sigma
- the extracellular vesicles loaded with Der f2 antigen obtained in Example 1 were diluted with PBS (50 ⁇ g / ml) and loaded onto 10 ⁇ l of 300-mesh copper grids (EMS). Uranyl acetate (2%) was dropped on the grid for negative staining and observed with a JEM1011 electron microscope (JEOL). As a result, as shown in Figure 2, it was confirmed that the extracellular vesicles are surrounded by a lipid bilayer as spherical.
- the extracellular vesicles were diluted with PBS (500 ng / ml) and subjected to dynamic light scattering using Zetasizer Nano ZS (Malvern Instruments). Diameter size distributions were measured and the results were analyzed using Dynamic V6 software. As a result, as shown in Figure 3, the diameter of the extracellular vesicles was found to be 100-300nm.
- Example 3 Der f2 antigen Loaded By parcel Innate immune response
- the bone marrow cells are derived from bone marrow cells to assess the level of innate immune response induced by extracellular vesicles loaded with Der f2 antigen.
- dendritic cells bone marrow-derived dendritic cells, BMDC.
- BMDC BMDC (5 ⁇ 10 5 cells / well) was treated with DMEM containing 10% FBS and antibiotics (100 unit / ml penicillin and 100 ⁇ g / ml streptomycin), and a 24-well tissue culture plate (TPP) for 24 hours at 37 ° C. Incubated). After removal of the medium, extracellular vesicles loaded with Der f2 antigen were changed to serum-free DMEM medium added at concentrations of 0.1 and 1 ug / ml. After 15 hours, the expression level of CD86 in BMDC and ELISA assay with the culture medium were measured to determine the expression level of T-12 cell cytokines IL-12 and IL-6.
- CD86 expression in antigen-presenting cells was significantly increased by extracellular vesicles loaded with Der f2 antigen as shown in FIG. 4 (see FIG. 4).
- antigen-presenting cells treated with the extracellular vesicles loaded with the Der f2 antigen showed significant secretion of IL-6, which is important for differentiation into IL-12 and Th17 cells, which are important for differentiation into Th1 cells. Increased (see FIG. 5).
- Example 4 Mic A sRNA Physical Characterization of Vesicles Derived from Overexpressing Strains
- the pBRplac-sRNA plasmid containing the same Mic A sRNA (CATCTCTGAATTCAGGGATGATGATAACAAATGCGCGTCTTT) as the E. coli sRNA sequence was introduced into Salmonella by utilizing sRNA having excellent species conservation among Hfq-binding sRNAs. Specifically, pBRplac-sRNA was introduced into Salmonella Typhimurium 14028S species by electroporation.
- the sRNA overexpressing strains were cultured in vitro, and the vesicles were separated, and the physical properties of the vesicles were confirmed using dynamic light scattering and transmission electron microscopy.
- Table 1 and FIG. 7 it was confirmed that the extracellular vesicles derived from the Mic A sRNA overexpressing strain were about 20 nm in size and similar in shape to those of the control pBRplac (FIG. 7).
- sRNA Average size (nm) Salmonella typhimurium (pBRplac) 26.07 ⁇ 5.98 Salmonella typhimurium (RseX) 19.93 ⁇ 2.503 Salmonella typhimurium (MicA) 21.39 ⁇ 1.92
- Example 5 Mic A sRNA Immunogenicity of Overexpressed Salmonella-derived Vesicles
- Salmonella strains are known to induce enteritis and induce a Th1 immune response.
- Th1 immune response of extracellular vesicles obtained through sRNA overexpression was confirmed.
- 100 ug / hd of extracellular vesicles were administered to the five mice per group (C67BL / 6) at two-day intervals through the intraperitoneal route. After dissecting the cells on the 5th day, the cells were isolated from the intraperitoneal lymph nodes, and then subjected to T cell restimulation for 12 hours using anti-CD3 and CD28, and the amount of cytokines secreted from the T cells was measured.
- the cytokines involved in the Th1, Th17 immune response, IFN- ⁇ , IL-17 was increased compared to the control group when administered extracellular vesicles derived from sRNA overexpressing strain, cytokines involved in Th2 immune response Caine IL-4 was confirmed that no difference from the control group when administered extracellular vesicles derived from sRNA overexpressing strain (Fig. 8).
- Example 6 Mic A sRNA Optimization of Overexpressed Salmonella-derived Vesicles
- Salmonella-derived vesicles themselves have good immunogenicity, but the toxicity caused by LPS present in the extracellular membrane is a problem.
- PMB which inhibits the activity of LPS, was mixed with Mic A sRNA overexpressing Salmonella-derived vesicles to evaluate the level of innate immune response.
- inflammatory cells macrophage lines RAW264.7, 5 x 10 5 cells / well
- DMEM fetal bovine serum
- antibiotics 100 unit / ml penicillin and 100 ⁇ g / ml streptomycin
- TPP tissue culture plates
- PMB-containing extracellular vesicles were changed to serum-free DMEM medium added at a concentration of 1 ug / ml.
- secretion levels of IL-6 and TNF-alpha were measured in inflammatory cells.
- the optimal PMB dilution concentration for the vesicles prepared by the above method is between 1 ug / ml and 10 ug / ml.
- the PMB concentration was subdivided into concentrations of 1, 2, 4, 8 and 10 ug / ml and administered to macrophages along with vesicles. As a result, it was shown that the secretion amount of IL-6 in macrophages no longer decreased above the concentration of 2 ug / ml. Therefore, it was confirmed that the candidate substance could be optimized by varying the diluted PMB concentration. (See Figure 10).
- Der f2 antigen For in vivo (in vivo) in the Der f2 antigen is to determine the antibody immune response inducing ability based on the load cell outside the package, and determining an effective amount of Der f2 antigen is loaded extracellular vesicles, Der f2 antigen is loaded cells Outer vesicles were administered to mice to induce immunity. In addition, after inducing an immune response, blood was collected from mice treated with control (PBS) and extracellular vesicles loaded with Der f2 antigen to measure Der f2 specific IgG antibody, and bronchioalveolar lavage fluid was collected to derive Der f2 specific sIgA. The concentration of the antibody was measured.
- PBS control
- mice sera that induced an immune response by intramuscular injection with extracellular vesicles loaded with Der f2 antigen were specific to Der f2 antigen regardless of the intranasal vesicles loaded with Der f2 antigen.
- IgG antibody production was increased.
- Der f2 antigen-specific sIgA production in bronchoalveolar lavage fluid was increased only after intramuscular injection of extracellular vesicles loaded with Der f2 antigen (see FIGS. 12A and 12B).
- Example 8 Der f2 antigen Loaded Extracellular T Cell Immune Responses by Vesicles
- the extracted lung tissue was digested by passing through a 100 ⁇ m cell strainer (BD Biosciences) with 5 ml syringe washing buffer (2.5% FBS, DMEM containing 0.01M HEPES).
- the isolated cells were treated with ammonium chloride solution (STEM CELL) at 4 ° C. for 10 minutes to allow erythrocyte cells to lyse.
- the obtained cells were washed with washing buffer and filtered with 40 ⁇ m cell strainer (BD), followed by 10% FBS, 50 ⁇ M 2-ME, 0.01 M HEPES and antibiotics (100 unit / ml penicillin, 100 ⁇ g / ml streptomycin).
- the amount of IFN- ⁇ a major cytokine produced by Th1 cells, was increased in the extracellular vesicle-administered group loaded with Der f2 antigen compared to the control group, and the Der f2 antigen loaded Dose-dependent decrease in extracellular vesicle nasal administration.
- the major cytokine produced in Th17, the extracellular vesicles loaded with Der f2 antigen were increased compared to the control regardless of nasal administration (see FIG. 13).
- the present invention is to control allergic diseases caused by house dust mites by controlling allergen hypersensitivity reactions by using an allergen-derived immune deregulator using a bacterial-derived vesicle containing house dust mite-derived allergens (Der f2, etc.). It is expected to be prevented or cured.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Immunology (AREA)
- Medicinal Chemistry (AREA)
- Microbiology (AREA)
- Mycology (AREA)
- Pharmacology & Pharmacy (AREA)
- Epidemiology (AREA)
- Animal Behavior & Ethology (AREA)
- General Health & Medical Sciences (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
Abstract
Description
균주(sRNA) | 평균 크기(nm) |
Salmonella typhimurium(pBRplac) | 26.07±5.98 |
Salmonella typhimurium(RseX) | 19.93±2.503 |
Salmonella typhimurium(MicA) | 21.39±1.92 |
Claims (11)
- 세균유래 세포밖 소포를 유효성분으로 함유하는 알레르기질환 예방 또는 치료용 약학적 조성물로서, 상기 세균은 집먼지진드기 유래 알레르겐 유전자를 과발현시킨 세균이고, 상기 알레르기 질환은 집먼지진드기 유래 알레르겐에 의한 알레르기 질환인 것을 특징으로 하는, 약학적 조성물.
- 제 1 항에 있어서,상기 세균은 대장균(E. coli) 또는 살모넬라균인 것을 특징으로 하는, 약학적 조성물.
- 제 1 항에 있어서,상기 집먼지진드기는 유럽집먼지진드기(Dermatophagoides pteronyssinus) 또는 북아메리카집먼지진드기(Dermatophagoides farinae) 인 것을 특징으로 하는, 약학적 조성물.
- 제 3 항에 있어서,상기 집먼지진드기는 북아메리카집먼지진드기(Dermatophagoides farinae) 인 것을 특징으로 하는, 약학적 조성물.
- 제 1 항에 있어서,상기 집먼지진드기 유래 알레르겐은 Der p1, Der p2, Der p3, Der p4, Der p6, Der p9, Der p15, Der f1, Der f2, Der f11, 및 Der f18 로 이루어진 군으로부터 선택되는 것을 특징으로 하는, 약학적 조성물.
- 제 5 항에 있어서,상기 집먼지진드기 유래 알레르겐은 Der f2 인 것을 특징으로 하는, 약학적 조성물.
- (a) 집먼지진드기 유래 알레르겐 유전자를 세균에 과발현시키는 단계;(b) 상기 과발현된 세균을 배양하는 단계;(c) 상기 세균 배양액에서 소포를 분리하는 단계; 및(d) 상기 세균유래 소포의 외막 내독소 활성을 제거하는 단계를 포함하는, 집먼지진드기 유래 알레르겐에 의한 알레르기질환 예방 또는 치료용 세균유래 소포의 제조방법으로, 상기 (a) 단계의 집먼지진드기 유래 알레르겐은 Der f2 인 것을 특징으로 하는, 방법.
- 제 7 항에 있어서,상기 집먼지진드기는 북아메리카집먼지진드기(Dermatophagoides farinae) 인 것을 특징으로 하는, 방법.
- 제 7 항에 있어서,상기 세균은 대장균(E. coli) 또는 살모넬라균인 것을 특징으로 하는, 방법.
- 제 1 항의 약학적 조성물을 개체에 투여하는 단계를 포함하는, 알레르기질환의 치료 방법.
- 제 1 항의 약학적 조성물의 알레르기질환 예방 또는 치료 용도.
Priority Applications (4)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US16/070,220 US11065300B2 (en) | 2016-01-15 | 2016-11-04 | Immunomodulator for hypersensitivity reaction to house dust mite-derived allergen |
CN201680078791.7A CN108697784B (zh) | 2016-01-15 | 2016-11-04 | 用于对屋尘螨来源的过敏原的超敏反应的免疫调节剂 |
JP2018536115A JP6646155B2 (ja) | 2016-01-15 | 2016-11-04 | 家塵ダニ由来アレルゲンによる過敏反応免疫調節剤 |
EP16885226.7A EP3403670B1 (en) | 2016-01-15 | 2016-11-04 | Immunomodulator for hypersensitivity reaction to house dust mite-derived allergen |
Applications Claiming Priority (4)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR10-2016-0005094 | 2016-01-15 | ||
KR20160005094 | 2016-01-15 | ||
KR1020160145662A KR101858840B1 (ko) | 2016-01-15 | 2016-11-03 | 집먼지진드기 유래 알레르겐에 의한 과민반응 면역조절제 |
KR10-2016-0145662 | 2016-11-03 |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2017122915A1 true WO2017122915A1 (ko) | 2017-07-20 |
Family
ID=59311510
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/KR2016/012626 WO2017122915A1 (ko) | 2016-01-15 | 2016-11-04 | 집먼지진드기 유래 알레르겐에 의한 과민반응 면역조절제 |
Country Status (1)
Country | Link |
---|---|
WO (1) | WO2017122915A1 (ko) |
Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US20050013831A1 (en) * | 2001-12-17 | 2005-01-20 | Foster Keith Alan | Outer membrane vesicles from gram negative bacteria and use as a vaccine |
KR20110038575A (ko) * | 2009-10-08 | 2011-04-14 | 주식회사이언메딕스 | 실내 공기유래 세포밖 소포체를 포함하는 조성물 및 이의 용도 |
-
2016
- 2016-11-04 WO PCT/KR2016/012626 patent/WO2017122915A1/ko active Application Filing
Patent Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US20050013831A1 (en) * | 2001-12-17 | 2005-01-20 | Foster Keith Alan | Outer membrane vesicles from gram negative bacteria and use as a vaccine |
KR20110038575A (ko) * | 2009-10-08 | 2011-04-14 | 주식회사이언메딕스 | 실내 공기유래 세포밖 소포체를 포함하는 조성물 및 이의 용도 |
Non-Patent Citations (4)
Title |
---|
KIM, M. -R. ET AL.: "Staphylococcus Aureus-derived Extracellular Vesicles Induce Neutrophilic Pulmonary Inflammation via Both Th l and Thl7 Cell Responses", ALLERGY, vol. 67, 2012, pages 1271 - 1281, XP 055399385 * |
KIM, Y. -S. ET AL.: "Extracellular Vesicles Derived from Gram-negative Bacteria, such as Escherichia Coli, Induce Emphysema Mainly via IL -17A-mediated Neutrophilic Inflammation", THE JOURNAL OF IMMUNOLOGY, vol. 194, no. 7, 1 April 2015 (2015-04-01), pages 3361 - 3368, XP055558680, DOI: 10.4049/jimmunol.1402268 * |
PARK, S. -Y. ET AL.: "House Dust Mite Allergen Der f 2-induced Phospholipase D1 Activation is Critical for the Production of Interleukin-1 3 through Activating Transcription Factor-2 Activation in Human Bronchial Epithelial Cells", THE JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 284, no. 30, 2009, pages 20099 - 20110, XP 055399382 * |
See also references of EP3403670A4 * |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Kurono et al. | Nasal immunization induces Haemophilus influenzae—specific Th1 and Th2 responses with mucosal IgA and systemic IgG antibodies for protective immunity | |
Kinnebrew et al. | Interleukin 23 production by intestinal CD103+ CD11b+ dendritic cells in response to bacterial flagellin enhances mucosal innate immune defense | |
Jan et al. | Lactobacillus gasseri suppresses Th17 pro-inflammatory response and attenuates allergen-induced airway inflammation in a mouse model of allergic asthma | |
US8404250B2 (en) | Gram positive bacteria preparations for the treatment of diseases comprising an immune dysregulation | |
Galdeano et al. | Mechanisms involved in the immunostimulation by probiotic fermented milk | |
Girard-Madoux et al. | IL-10 control of CD11c+ myeloid cells is essential to maintain immune homeostasis in the small and large intestine | |
Dunkley et al. | A role for CD4+ T cells from orally immunized rats in enhanced clearance of Pseudomonas aeruginosa from the lung. | |
WO2018124393A1 (ko) | 브루셀라 균 주요 공통 항원을 발현하는 lps의 o-항원 결실 비병원성 살모넬라 균주를 포함하는 브루셀라증 예방 또는 치료용 백신 조성물 | |
Su et al. | Differential roles of Porphyromonas gingivalis lipopolysaccharide and Escherichia coli lipopolysaccharide in maturation and antigen-presenting functions of dentritic cells. | |
Joo et al. | Critical role of TSLP-responsive mucosal dendritic cells in the induction of nasal antigen-specific IgA response | |
Dong et al. | The recombinant fusion protein of cholera toxin B and neutrophil-activating protein expressed on Bacillus subtilis spore surface suppresses allergic inflammation in mice | |
WO2017122915A1 (ko) | 집먼지진드기 유래 알레르겐에 의한 과민반응 면역조절제 | |
KR101854904B1 (ko) | 비피막형 헤모필루스 인플루엔자 백신 및 그의 용도 | |
WO2017123025A1 (ko) | 세균유래 세포밖 소포에 의한 기도 면역기능이상 조절제 | |
EP3403670B1 (en) | Immunomodulator for hypersensitivity reaction to house dust mite-derived allergen | |
Edwan et al. | Treatment with Flt3 ligand plasmid reverses allergic airway inflammation in ovalbumin-sensitized and-challenged mice | |
Ciszek-Lenda et al. | Further studies on immunomodulatory effects of exopolysaccharide isolated from Lactobacillus rhamnosus KL37C | |
KR101911893B1 (ko) | 세균유래 세포밖 소포에 의한 기도 면역기능이상 조절제 | |
Kinnebrew et al. | Intestinal CD103+ CD11b+ lamina propria dendritic cells instruct intestinal epithelial cells to express antimicrobial proteins in response to Toll-like receptor 5 activation | |
Reynolds | Advances in understanding pulmonary host defense mechanisms: dendritic cell function and immunomodulation | |
Strygin et al. | Mycobacterium vaccae lysate induces anti-allergic immune response in vitro | |
Albright et al. | Endogenous antigen presenting cell-derived IL-10 inhibits T lymphocyte responses to commensal enteric bacteria | |
WO2022145680A1 (ko) | 마이크로코커스 루테우스 유래 세포외 소포를 포함하는 호중구성 폐질환의 예방 또는 치료용 조성물 | |
WO2021060792A1 (ko) | 키토산을 포함하는 면역억제용 조성물 및 이의 용도 | |
WO2023200203A1 (ko) | 신규한 미생물 및 이를 포함하는 조성물 |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 16885226 Country of ref document: EP Kind code of ref document: A1 |
|
ENP | Entry into the national phase |
Ref document number: 2018536115 Country of ref document: JP Kind code of ref document: A |
|
NENP | Non-entry into the national phase |
Ref country code: DE |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2016885226 Country of ref document: EP |
|
ENP | Entry into the national phase |
Ref document number: 2016885226 Country of ref document: EP Effective date: 20180816 |