WO2017122915A1 - 집먼지진드기 유래 알레르겐에 의한 과민반응 면역조절제 - Google Patents

집먼지진드기 유래 알레르겐에 의한 과민반응 면역조절제 Download PDF

Info

Publication number
WO2017122915A1
WO2017122915A1 PCT/KR2016/012626 KR2016012626W WO2017122915A1 WO 2017122915 A1 WO2017122915 A1 WO 2017122915A1 KR 2016012626 W KR2016012626 W KR 2016012626W WO 2017122915 A1 WO2017122915 A1 WO 2017122915A1
Authority
WO
WIPO (PCT)
Prior art keywords
der
house dust
dust mite
derived
extracellular vesicles
Prior art date
Application number
PCT/KR2016/012626
Other languages
English (en)
French (fr)
Inventor
지영구
김윤근
박한기
Original Assignee
단국대학교 천안캠퍼스 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from KR1020160145662A external-priority patent/KR101858840B1/ko
Application filed by 단국대학교 천안캠퍼스 산학협력단 filed Critical 단국대학교 천안캠퍼스 산학협력단
Priority to US16/070,220 priority Critical patent/US11065300B2/en
Priority to JP2018536115A priority patent/JP6646155B2/ja
Priority to EP16885226.7A priority patent/EP3403670B1/en
Priority to CN201680078791.7A priority patent/CN108697784B/zh
Publication of WO2017122915A1 publication Critical patent/WO2017122915A1/ko

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/35—Allergens
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • the present invention relates to an immunomodulator for the prevention or treatment of allergic diseases caused by house dust mite-derived allergens, and more particularly, to pharmaceutical compositions comprising bacterial extracellular vesicles containing house dust mite-derived allergens, and methods for preparing the same. Etc.
  • Atopic dermatitis is a syndrome in which an excessive immune response (hypersensitivity) is caused to an unharmful antigen (allergen), which is often exposed, and the atopic disease is an atopic disease.
  • Atopic dermatitis, allergic rhinitis, allergic conjunctivitis, allergic asthma, and atopic diseases often occur in people with atopy.
  • the immunological etiology of atopy it is associated with at least an allergic reaction of type 1 hypersensitivity.
  • atopy is defined in various ways, it is characterized by high concentrations of IgE for allergens in the blood.
  • An allergy can be defined as a phenomenon in which an acquired immune response occurs in the body when exposed to surrounding antigens, and the pattern of the immune response changes upon repeated exposure to antigens with the memory of the antigen. Allergens caused by exposure to harmful antigens have a beneficial effect on our bodies and induce immune responses through vaccines. On the other hand, if the immune response is excessively induced to the harmless antigen, the hypersensitivity reaction occurs, an inflammatory reaction occurs in our body to cause allergic diseases. Asthma is a disease characterized by chronic inflammation of the airways. It is a disease that causes symptoms such as wheezing and dyspnea due to structural changes and functional changes caused by inflammation. As a cause of chronic inflammation in asthma, hypersensitivity to allergens in the surrounding environment is an important immune mechanism, and in particular, hypersensitivity to allergens derived from house dust mites is known as an important cause of asthma.
  • House dust mite is an arthropod inhabited by humans. House dust mites live on human scales and are present in large quantities in bed mattresses, carpets and furniture in urban houses, and are known to be the most important allergens in the etiology of allergic diseases such as allergic asthma.
  • Several digestive enzymes are present in the digestive system of house dust mites, which spread through the air through the feces that house dust mites excrete, and when inhaled, hypersensitivity reactions occur in people with atopy predisposition, followed by repeated exposure to house dust mite-derived allergens. Symptoms include sneezing, runny nose, rhinitis, asthma, asthma, shortness of breath, and atopic dermatitis, such as itching.
  • active immunotherapy which induces immune cell activity present in the body by directly administering an antigen-causing substance to the body, and manual control of an immune response by administering substances produced in vitro, such as monoclonal antibodies It can be divided into passive immunotherapy. Active immunotherapy is considered to be more efficient in terms of cost and frequency of administration than passive immunotherapy as a method for preventing disease. Active immunotherapy is the use of strategies to induce an immune response that has the ability to induce antigen-specific long-term protective memory that is characteristic of acquired immunity, thereby inducing protective immunity.
  • the key to controlling allergic reactions is key to allergen-specific regulation of immunological hypersensitivity to allergens, such as humoral (or antibody mediated) and cellular (T-cell mediated) immunity.
  • Extracellular vesicles (EVs) secreted by bacteria are spherical phospholipid bilayers with diameters of 20-100 nm, and are characterized by outer membrane proteins, lipopolysaccharides (LPS), outer membrane lipids, and DNA through biochemical and proteomic studies. , RNA, and cytoplasmic proteins have been reported.
  • Neisseria meningitidis Acinetobacter baumannii
  • Porphyromonas gingivalis Salmonella enterica , serovar ( serovar) Typhimurium), Helicobacter pylori (Helicobacter pylori), and Vibrio cholera (Vibrio Gram-negative bacteria, such as cholerae ), secrete extracellular vesicles to induce defense immunity to bacterial infections, and Gram-positive bacteria, like Staphylococcus aureus , induce defense immunity to bacterial infections through extracellular vesicles. It can be reported.
  • LPS Lipopolysaccharide
  • TLR4 receptors present in large amounts in vascular endothelial cells.
  • Protoplasts are living cell materials of plants or bacteria that remove the extracellular membranes and cell walls of these cells by mechanical / enzymatic methods. I can solve it.
  • drugs such as polymyxin B can be treated to remove the activity of endotoxins present in extracellular vesicles.
  • house dust mite allergen immunotherapy has mainly been used to extract allergens from house dust mites, or in the form of recombinant proteins, and there are no examples of using allergens to express antigens such as extracellular vesicles.
  • the present invention is to provide a pharmaceutical composition
  • a pharmaceutical composition comprising a bacterium expressing house dust mite-derived allergens, and extracellular vesicles derived therefrom, and a preparation method thereof.
  • the present invention is to provide a method for controlling hypersensitivity by house dust mite-derived allergens using the composition.
  • the present invention provides a pharmaceutical composition for preventing or treating allergic diseases, which contains a bacterial-derived extracellular vesicle as an active ingredient.
  • the bacterium is a bacterium that overexpresses an allergen gene derived from house dust mite, and the allergic disease is an allergic disease caused by house dust mite-derived allergen.
  • the bacteria is characterized in that Escherichia coli (E. coli), or in bacteria or Salmonella (Salmonella spp.).
  • the house dust mite is a European house dust mite ( Dermatophagoides pteronyssinus ) or North American house dust mite.
  • the house dust mite-derived allergens are Der p1, Der p2, Der p3, Der p4, Der p6, Der p9, Der p15, Der f1, Der f2, Der f11, and Der f18. It is characterized in that it is selected from the group consisting of.
  • the present invention comprises the steps of (a) overexpressing a house dust mite-derived allergen gene in bacteria; (b) culturing the overexpressed bacteria; (c) separating the vesicles from the bacterial culture; And (d) provides a method for producing bacterial vesicles for preventing or treating allergic diseases caused by house dust mite-derived allergens, comprising the step of removing the outer membrane endotoxin activity of the bacterial vesicles.
  • the method for separating the vesicles in the step (c) is to separate the naturally secreted vesicles by a filter method, and / or ultracentrifugation method, or after making the vesicles in an artificial method, Separation by filtration, and / or ultracentrifugation.
  • the method for removing endotoxin activity in step (d) is to remove toxins (LPS, peptidoglycan, etc.) in the vesicles with lysozyme or the like, or endotoxin (LPS) polymyxin (polymyxin B A method of inhibiting activity with a drug such as).
  • the house dust mite allergic disease is characterized in that selected from the group consisting of asthma, rhinitis, atopic dermatitis.
  • the present invention provides an immunomodulator for preventing or treating allergic diseases caused by house dust mite, comprising as an active ingredient bacteria-derived extracellular vesicles prepared by the above method.
  • the immunomodulator is characterized in that the house dust mite allergen (Der f2, etc.) is overexpressed in the lumen of the bacteria-derived extracellular vesicles.
  • the bacteria-derived vesicles are characterized in that the average diameter of 10-200nm.
  • the present invention also provides a method for preventing or treating allergic diseases caused by house dust mite-derived allergens using bacterial-derived vesicles. Specifically, it provides a method for preventing or treating allergic diseases, comprising administering to a subject a pharmaceutical composition containing a bacterial-derived extracellular vesicle as an active ingredient.
  • the bacterium is a bacterium that overexpresses an allergen gene derived from house dust mite, and the allergic disease is an allergic disease caused by house dust mite-derived allergen.
  • the present invention provides a use or prevention of allergic diseases caused by house dust mite-derived allergens of the bacteria-derived extracellular vesicles.
  • the bacterium is a bacterium that overexpresses an allergen gene derived from house dust mite, and the allergic disease is an allergic disease caused by house dust mite-derived allergen.
  • the present invention is to control allergic diseases caused by house dust mite by controlling hypersensitivity reactions caused by allergens by using a bacterial-derived vesicle containing house dust mite-derived allergens (Der f2, etc.) as an allergen immunomodulator derived from house dust mite. It is expected to be prevented or cured.
  • coli 1 is a clone of the North American house dust mite ( D. farinae ) allergen (Der f2) and a bacterium ( Esherichia). coli ), the process of lysozyme in the culturing process to produce a protoplast, and then an extrusion (extrusion) to produce an artificial extracellular vesicles to create an immunomodulator.
  • FIG. 2 is a photograph of an extracellular vesicle loaded with a Der f2 allergen under a transmission electron microscope.
  • Figure 4 shows the results of measuring the expression of co-stimulatory molecules (CD86) by treating extracellular vesicles loaded with Der f2 allergens to bone marrow-derived dendritic cells.
  • IL interleukin
  • IL-6 interleukin-6
  • FIG. 6 is a method of cloning small RNA present in bacteria, loading them into bacteria ( Salmonella typhimurium ), culturing bacteria to separate extracellular vesicles, and removing the activity of lipopolysaccharide (LPS) present in the outer membrane of the vesicles.
  • PMB polymyxin B
  • FIG. 7 is a diagram illustrating morphological characteristics of extracellular vesicles derived from Mic A small RNA overexpressing strains by dynamic light scattering and electron microscopy.
  • FIG 8 after three times intraperitoneal injection of the small RNA overexpressing strain ( Salmonella typhimurium ) present in the bacteria, the immune cells are isolated from local lymph nodes and stimulated with anti-CD3 / anti-CD28, gamma interferon Figure shows the measured amount of IL-4 and IL-17.
  • PMB polymyxin B
  • Figure 10 after administering the MIC A small RNA overexpressing strain ( Salmonella typhimurium ) -derived vesicles (macrophage line RAW264.7) to the polymyxin B (PMB) concentrations in more detail, Figure shows the measurement of IL-6 secretion.
  • Salmonella typhimurium Salmonella typhimurium -derived vesicles (macrophage line RAW264.7)
  • PMB polymyxin B
  • 11 is an experimental protocol for evaluating the immunogenicity of extracellular vesicles loaded with Der f2 allergens in mice.
  • IM intramuscular injection
  • IN nasal administration
  • BAL Bronchoalveolar Lavage
  • 12A and 12B show the results of measuring the antigen-specific IgG antibody in mouse serum and antigen-specific IgA antibody generation ability in bronchial alveolar lavage fluid after administration of the extracellular vesicles loaded with Der f2 allergen by the method of FIG. 11.
  • T cells are isolated from mouse lung tissue and stimulated with anti-CD3 / CD28, gamma-interferon, IL-17 , IL-4 and IL-10 were measured.
  • FIG. 14 is a protocol for evaluating the immunomodulatory efficacy of Der f2 allergen-loaded extracellular vesicles in mice in a mouse asthma model induced with a North American dust mite extract antigen and an immunostimulant (aluminum hydroxide, alum).
  • an immunostimulant aluminum hydroxide, alum
  • IM intramuscular injection
  • IN nasal administration
  • IP intraperitoneal administration
  • FIG. 15 shows the anti-inflammatory effect of extracellular vesicles loaded with Der f2 allergens in the mouse asthma model induced by house dust mite allergens by the number of inflammatory cells in bronchoalveolar lavage fluid.
  • extracellular vesicles derived from bacteria as an adjuvant, LPS, peptidoglycan It contains a toxin such as, there is a problem to solve the toxicity problem caused by extracellular vesicles.
  • the outer membrane and the peptidoglycan layer of the extracellular vesicles After producing a protoplast (protoplast) made by removing the cell wall (cell wall) containing, artificially prepared and used extracellular vesicles.
  • protoplast a protoplast made by removing the cell wall (cell wall) containing, artificially prepared and used extracellular vesicles.
  • polymyxin B which inhibits the activity of LPS present in the vesicle envelope, was combined with naturally secreted vesicles to reduce toxicity.
  • Der f2 antigen a major allergen derived from North American house dust mite
  • E. coli E. coli
  • lysozyme a major allergen derived from North American house dust mite
  • protoplasts a major allergen derived from North American house dust mite
  • extracellular vesicles were prepared by extrusion.
  • candidate material cloned Mic
  • cloned Mic A small RNA present in bacteria, inserted into Salmonella and overexpressed, and then cultured, followed by simultaneous administration of PMB with vesicles, while maintaining immunogenicity, The optimal PMB concentration with reduced toxicity was set.
  • the immunogenicity of the antigen-loaded candidate extracellular vesicles was evaluated through in vitro and in vitro experiments to determine the route of administration and the dose for efficacy evaluation. This suggests that the extracellular vesicles loaded with the antigen are effective vaccines.
  • the North American dust mite extract and alum were injected into the abdominal cavity to sensitize with allergens, and then only the tick extract was administered to the nasal cavity to prepare an asthma animal model.
  • the house dust mite allergic disease is not particularly limited as long as it can be caused by house dust mite-derived allergens, but is preferably selected from the group consisting of asthma, rhinitis and atopic dermatitis.
  • 'treatment or prevention of allergic diseases means including alleviating, alleviating and alleviating allergic diseases, and also including lowering the possibility of allergic diseases.
  • the bacterium is not particularly limited, but is capable of over-expressing the gene, it is preferred that the Escherichia coli (E. coli), or Salmonella (Salmonella spp.).
  • the step of separating the extracellular vesicles can be used naturally secreted extracellular vesicles, there is no particular limitation on the method for separating the extracellular vesicles, can be obtained by concentrating with a filter, and then ultracentrifugation, etc. It may include the process of.
  • the extracellular vesicles can be artificially manufactured, and there is no particular limitation on the method for producing the extracellular vesicles, and may be obtained by extruding with a filter, and may further include a process such as centrifugation and ultracentrifugation.
  • the method for separating extracellular vesicles in the present invention is not particularly limited as long as it includes bacterial derived extracellular vesicles, for example, in culture, centrifugation, ultra-fast centrifugation, filtration by filter, gel filtration chromatography, pre-flow electrophoresis
  • Extracellular vesicles can be isolated using methods such as capillary electrophoresis and combinations thereof. In addition, it may further include a process for washing to remove impurities, concentration of the obtained extracellular vesicles and the like.
  • the extracellular vesicles are naturally secreted or include extracellularly secreted extracellular vesicles.
  • house dust mite-derived allergens are expressed in lumens of extracellular vesicles prepared by the above method, and as expression proteins, Der f2, Der p2, and the like are preferred, and Der f2 is most preferred.
  • the extracellular vesicles of the immunomodulator prepared by the above method may have an average diameter of 10-200 nm, but preferably 20-100 nm.
  • an immunomodulator for treating or preventing the allergic disease may be prepared as a pharmaceutical composition. It is possible to administer the bacteria-derived extracellular vesicles of the present invention for use in treatment and prophylaxis, but it is preferred that the extracellular vesicles are included as active ingredients of the pharmaceutical composition.
  • the pharmaceutical composition may contain the isolated extracellular vesicles as an active ingredient, and may include a pharmaceutically acceptable carrier.
  • pharmaceutically acceptable carriers are conventionally used in the preparation, and include, but are not limited to, saline solution, sterile water, Ringer's solution, buffered saline, cyclodextrin, dextrose solution, maltodextrin solution, glycerol, ethanol, liposomes, and the like. If necessary, other conventional additives such as antioxidants and buffers may be further included.
  • diluents, dispersants, surfactants, binders, lubricants and the like may be additionally added to formulate into injectable formulations, pills, capsules, granules or tablets such as aqueous solutions, suspensions, emulsions and the like.
  • Suitable pharmaceutically acceptable carriers and formulations may be preferably formulated according to each component using the methods disclosed in Remington's Pharmaceutical Science, Mack Publishing Company, Easton PA.
  • the pharmaceutical composition of the present invention is not particularly limited in formulation, but may be formulated as an injection, inhalant, or external skin preparation.
  • the method of administering the pharmaceutical composition of the present invention is not particularly limited, but may be parenterally or orally administered, such as intramuscular injection, subcutaneous, inhalation, nasal, sublingual, and skin application.
  • Dosage varies depending on the patient's weight, age, sex, health condition, diet, time of administration, method of administration, rate of excretion and severity of disease.
  • Daily dosage refers to the amount of therapeutic substance of the invention sufficient for treatment for a disease state alleviated by administration to a subject in need thereof.
  • Effective amounts of therapeutic agents depend on the particular compound, disease state and severity thereof, and on the individual in need thereof, and can be routinely determined by one skilled in the art.
  • the dosage of the composition according to the present invention to the human body may vary depending on the age, weight, sex, dosage form, health condition and degree of disease of the patient.
  • Der f2 gene (reference sequence: GeneBank AB195580) was synthesized for cDNA by RT-PCR for cloning Der f2, a major allergen of North American house dust mites. PCR products were inserted into a T-blunt PCR cloning kit (Solgent), and each plasmid was digested with EcoRI (OmpA, ABC transporter) and BglII (FepA). The sections were separated by electrophoresis and inserted into the pET-30a plasmid, transformed into E. coli DH5a by thermal shock, and finally the gene was cloned.
  • Solgent T-blunt PCR cloning kit
  • Exprep plasmid mini prep After incubating the Der f2 clone obtained in the above example in Luria Bertani broth (Merch) at 37 ° C., 200 rpm, for 12 hours, Exprep plasmid mini prep. Each plasmid was isolated using Kit (GeneAll) and transfected into E. coli BL21 (Real Biotech).
  • the bacterial pellet was resuspended in Tris buffer and treated with 1 mg / ml lysozyme (Sigma) at 37 ° C., 100 rpm, 2 hours to obtain protoplasts, followed by 10 ⁇ m, 5 ⁇ m, and 1 Extruded with LiposoFast extruder (Avestin) in order through the membrane of the pore size. Finally, ultracentrifugation with 10% and 50% opti-prep density gradient medium (OptiPrep) yielded extracellular vesicles loaded with Der f2 antigen.
  • 1 mg / ml lysozyme Sigma
  • the extracellular vesicles loaded with Der f2 antigen obtained in Example 1 were diluted with PBS (50 ⁇ g / ml) and loaded onto 10 ⁇ l of 300-mesh copper grids (EMS). Uranyl acetate (2%) was dropped on the grid for negative staining and observed with a JEM1011 electron microscope (JEOL). As a result, as shown in Figure 2, it was confirmed that the extracellular vesicles are surrounded by a lipid bilayer as spherical.
  • the extracellular vesicles were diluted with PBS (500 ng / ml) and subjected to dynamic light scattering using Zetasizer Nano ZS (Malvern Instruments). Diameter size distributions were measured and the results were analyzed using Dynamic V6 software. As a result, as shown in Figure 3, the diameter of the extracellular vesicles was found to be 100-300nm.
  • Example 3 Der f2 antigen Loaded By parcel Innate immune response
  • the bone marrow cells are derived from bone marrow cells to assess the level of innate immune response induced by extracellular vesicles loaded with Der f2 antigen.
  • dendritic cells bone marrow-derived dendritic cells, BMDC.
  • BMDC BMDC (5 ⁇ 10 5 cells / well) was treated with DMEM containing 10% FBS and antibiotics (100 unit / ml penicillin and 100 ⁇ g / ml streptomycin), and a 24-well tissue culture plate (TPP) for 24 hours at 37 ° C. Incubated). After removal of the medium, extracellular vesicles loaded with Der f2 antigen were changed to serum-free DMEM medium added at concentrations of 0.1 and 1 ug / ml. After 15 hours, the expression level of CD86 in BMDC and ELISA assay with the culture medium were measured to determine the expression level of T-12 cell cytokines IL-12 and IL-6.
  • CD86 expression in antigen-presenting cells was significantly increased by extracellular vesicles loaded with Der f2 antigen as shown in FIG. 4 (see FIG. 4).
  • antigen-presenting cells treated with the extracellular vesicles loaded with the Der f2 antigen showed significant secretion of IL-6, which is important for differentiation into IL-12 and Th17 cells, which are important for differentiation into Th1 cells. Increased (see FIG. 5).
  • Example 4 Mic A sRNA Physical Characterization of Vesicles Derived from Overexpressing Strains
  • the pBRplac-sRNA plasmid containing the same Mic A sRNA (CATCTCTGAATTCAGGGATGATGATAACAAATGCGCGTCTTT) as the E. coli sRNA sequence was introduced into Salmonella by utilizing sRNA having excellent species conservation among Hfq-binding sRNAs. Specifically, pBRplac-sRNA was introduced into Salmonella Typhimurium 14028S species by electroporation.
  • the sRNA overexpressing strains were cultured in vitro, and the vesicles were separated, and the physical properties of the vesicles were confirmed using dynamic light scattering and transmission electron microscopy.
  • Table 1 and FIG. 7 it was confirmed that the extracellular vesicles derived from the Mic A sRNA overexpressing strain were about 20 nm in size and similar in shape to those of the control pBRplac (FIG. 7).
  • sRNA Average size (nm) Salmonella typhimurium (pBRplac) 26.07 ⁇ 5.98 Salmonella typhimurium (RseX) 19.93 ⁇ 2.503 Salmonella typhimurium (MicA) 21.39 ⁇ 1.92
  • Example 5 Mic A sRNA Immunogenicity of Overexpressed Salmonella-derived Vesicles
  • Salmonella strains are known to induce enteritis and induce a Th1 immune response.
  • Th1 immune response of extracellular vesicles obtained through sRNA overexpression was confirmed.
  • 100 ug / hd of extracellular vesicles were administered to the five mice per group (C67BL / 6) at two-day intervals through the intraperitoneal route. After dissecting the cells on the 5th day, the cells were isolated from the intraperitoneal lymph nodes, and then subjected to T cell restimulation for 12 hours using anti-CD3 and CD28, and the amount of cytokines secreted from the T cells was measured.
  • the cytokines involved in the Th1, Th17 immune response, IFN- ⁇ , IL-17 was increased compared to the control group when administered extracellular vesicles derived from sRNA overexpressing strain, cytokines involved in Th2 immune response Caine IL-4 was confirmed that no difference from the control group when administered extracellular vesicles derived from sRNA overexpressing strain (Fig. 8).
  • Example 6 Mic A sRNA Optimization of Overexpressed Salmonella-derived Vesicles
  • Salmonella-derived vesicles themselves have good immunogenicity, but the toxicity caused by LPS present in the extracellular membrane is a problem.
  • PMB which inhibits the activity of LPS, was mixed with Mic A sRNA overexpressing Salmonella-derived vesicles to evaluate the level of innate immune response.
  • inflammatory cells macrophage lines RAW264.7, 5 x 10 5 cells / well
  • DMEM fetal bovine serum
  • antibiotics 100 unit / ml penicillin and 100 ⁇ g / ml streptomycin
  • TPP tissue culture plates
  • PMB-containing extracellular vesicles were changed to serum-free DMEM medium added at a concentration of 1 ug / ml.
  • secretion levels of IL-6 and TNF-alpha were measured in inflammatory cells.
  • the optimal PMB dilution concentration for the vesicles prepared by the above method is between 1 ug / ml and 10 ug / ml.
  • the PMB concentration was subdivided into concentrations of 1, 2, 4, 8 and 10 ug / ml and administered to macrophages along with vesicles. As a result, it was shown that the secretion amount of IL-6 in macrophages no longer decreased above the concentration of 2 ug / ml. Therefore, it was confirmed that the candidate substance could be optimized by varying the diluted PMB concentration. (See Figure 10).
  • Der f2 antigen For in vivo (in vivo) in the Der f2 antigen is to determine the antibody immune response inducing ability based on the load cell outside the package, and determining an effective amount of Der f2 antigen is loaded extracellular vesicles, Der f2 antigen is loaded cells Outer vesicles were administered to mice to induce immunity. In addition, after inducing an immune response, blood was collected from mice treated with control (PBS) and extracellular vesicles loaded with Der f2 antigen to measure Der f2 specific IgG antibody, and bronchioalveolar lavage fluid was collected to derive Der f2 specific sIgA. The concentration of the antibody was measured.
  • PBS control
  • mice sera that induced an immune response by intramuscular injection with extracellular vesicles loaded with Der f2 antigen were specific to Der f2 antigen regardless of the intranasal vesicles loaded with Der f2 antigen.
  • IgG antibody production was increased.
  • Der f2 antigen-specific sIgA production in bronchoalveolar lavage fluid was increased only after intramuscular injection of extracellular vesicles loaded with Der f2 antigen (see FIGS. 12A and 12B).
  • Example 8 Der f2 antigen Loaded Extracellular T Cell Immune Responses by Vesicles
  • the extracted lung tissue was digested by passing through a 100 ⁇ m cell strainer (BD Biosciences) with 5 ml syringe washing buffer (2.5% FBS, DMEM containing 0.01M HEPES).
  • the isolated cells were treated with ammonium chloride solution (STEM CELL) at 4 ° C. for 10 minutes to allow erythrocyte cells to lyse.
  • the obtained cells were washed with washing buffer and filtered with 40 ⁇ m cell strainer (BD), followed by 10% FBS, 50 ⁇ M 2-ME, 0.01 M HEPES and antibiotics (100 unit / ml penicillin, 100 ⁇ g / ml streptomycin).
  • the amount of IFN- ⁇ a major cytokine produced by Th1 cells, was increased in the extracellular vesicle-administered group loaded with Der f2 antigen compared to the control group, and the Der f2 antigen loaded Dose-dependent decrease in extracellular vesicle nasal administration.
  • the major cytokine produced in Th17, the extracellular vesicles loaded with Der f2 antigen were increased compared to the control regardless of nasal administration (see FIG. 13).
  • the present invention is to control allergic diseases caused by house dust mites by controlling allergen hypersensitivity reactions by using an allergen-derived immune deregulator using a bacterial-derived vesicle containing house dust mite-derived allergens (Der f2, etc.). It is expected to be prevented or cured.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Immunology (AREA)
  • Medicinal Chemistry (AREA)
  • Microbiology (AREA)
  • Mycology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)

Abstract

본 발명은, 집먼지진드기 유래 알레르겐에 의한 알레르기질환의 예방 또는 치료용 면역조절제에 관한 것으로, 구체적으로 북아메리카집먼지진드기 혹은 유럽집먼지진드기 유래의 알레르겐 함유 세균유래 세포밖 소포를 유효성분으로 포함하는 면역조절용 약학적 조성물, 및 이의 제조방법 등을 제공하고자 한다.

Description

집먼지진드기 유래 알레르겐에 의한 과민반응 면역조절제
본 발명은, 집먼지진드기 유래 알레르겐에 의한 알레르기질환의 예방 또는 치료용 면역조절제에 관한 것으로, 보다 구체적으로는 집먼지진드기 유래 알레르겐을 함유하는 세균 유래 세포밖 소포를 포함하는 약학적 조성물, 및 이의 제조방법 등에 관한 것이다.
아토피는 흔히 노출되는 해롭지 않은 항원 (알레르겐)에 과도한 면역반응 (과민반응)이 일어나는 증후군이고, 이로 인한 질환이 아토피질환이다. 아토피가 있는 사람에서 아토피피부염, 알레르기비염, 알레르기결막염, 알레르기천식 등의 아토피질환이 자주 발생한다. 아토피의 면역학적 병인과 관련해서 최소한 제 1형 과민반응의 알레르기반응과 연관되어 있다. 비록 아토피가 다양하게 정의되고 있지만 혈액 속에 알레르겐에 대한 IgE의 농도가 높게 나타나는 것이 특징이다.
알레르기는 주변 항원에 노출시 우리 몸에 후천적인 면역반응이 발생하고, 항원에 대한 기억으로 항원에 반복노출 시에 면역반응의 양상이 바뀌는 현상으로 정의할 수 있다. 해로운 항원에 노출 시에 발생하는 알레르기현상은 우리 몸에 이로운 효과를 나타내고, 백신을 통한 면역반응을 유도하는 것이 대표적이다. 반면, 해롭지 않은 항원에 면역반응이 과도하게 유도되어 과민반응이 발생하면, 우리 몸에 염증반응이 발생하여 알레르기질환을 일으키게 된다. 천식은 기도의 만성염증을 특징으로 하는 질환으로서 염증에 의한 구조적인 변화와 이에 따른 기능적인 변화로 천명, 호흡곤란 등의 증상이 발생하는 질환이다. 천식에서 보이는 만성염증의 병인으로서 주변 환경에 존재하는 알레르겐에 대한 과민반응이 중요한 면역기전이고, 특히 집먼지진드기에서 유래하는 알레르겐에 대한 과민반응이 천식의 중요한 원인인자로 알려져 있다.
집먼지진드기 (house dust mite)는 인간이 거주하는 지역에서 서식하는 절지동물에 속하는 동물이다. 집먼지진드기는 사람의 인설을 먹고 서식하며, 주로는 도시형 가옥의 침대매트리스, 카펫, 가구 등에 다량으로 존재하며, 전 세계적으로 알레르기천식과 같은 알레르기질환의 병인에 가장 중요한 알레르겐으로 알려져 있다. 집먼지진드기의 소화기관에는 여려가지 소화효소가 존재하고, 이는 집먼지진드기가 배설하는 대변을 통해 공기 중으로 퍼져서, 이를 흡입하면 아토피 소인이 있는 사람에서 과민반응의 발생하고, 이후 집먼지진드기 유래 알레르겐에 반복 노출 시 재채기, 콧물과 같은 비염증상, 혹은 천명, 호흡곤란과 같은 천식증상, 가려움증과 같은 아토피피부염증상이 유발된다. 알레르기질환을 일으키는 중요한 집먼지진드기에는 유럽집먼지진드기 (Dermatophagoides pteronyssinus)와 북아메리카집먼지진드기 (Dermatophagoides farinae)가 대표적이다. 유럽집먼지진드기 유래 알레르겐으로서 Der p1, Der p2, Der p3, Der p4, Der p6, Der p9, 및 Der p15 등이 알려져 있고, 북아메리카집먼지진드기 유래 알레르겐으로 Der f1, Der f2, Der f11, 및 Der f18 등이 중요하다고 알려져 있다. 국내에서 조사된 역학연구 결과를 보면, 대도시지역 실내먼지에는 유럽집먼지진드기보다는 북아메리카집먼지진드기에서 유래하는 알레르겐이 주로 존재하고, 북아메리카집먼지진드기 유래 알레르겐 중에는 주로 Der f2 알레르겐이 실내 먼지에 가장 많이 존재하는 것으로 보고되었다(손종렬 외. 일부 주택에서 집먼지 진드기 알러젠 조사. 한국대기환경학회지 2006;22(5):719-23).
면역요법에는 질병을 일으키는 항원 물질을 체내로 직접 투여하여 체내에 존재하는 면역세포 활성을 유도하는 능동면역요법 (active immunotherapy)과 단클론 항체와 같이 체외에서 생산한 물질을 투여하여 면역반응을 조절하는 수동면역요법 (passive immunotherapy)로 나눌 수 있다. 질병을 예방하기 위한 방법으로 수동면역요법에 비하여 능동면역요법이 비용이나 투여횟수 측면에서 좀더 효율적인 방법으로 인식되고 있다. 능동면역요법은, 후천면역의 특징인 항원 특이적인 장기 방어 기억을 유도하는 능력을 가진 후천면역반응을 유도하는 전략을 사용함으로써, 방어면역이 유도되도록 하는 것이다. 알레르기반응을 조절하기 위한 열쇠는 체액성(또는 항체 매개) 및 세포성(T-세포 매개) 면역과 같은 알레르겐에 대한 면역학적 과민반응을 알레르겐 특이적으로 조절하는 것이 핵심이다.
세균에서 분비되는 세포밖 소포(extracellular vesicles; EVs)는 구형의 인지질 이중막으로 20-100 nm의 직경을 가지며, 생화학 및 프로테옴 연구를 통해 외막 단백질, 지질다당류(lipopolysaccharide; LPS), 외막 지질, DNA, RNA, 및 세포질 내 단백질 등을 포함하고 있음이 보고되었다. 최근 수막염균(Neisseria meningitidis), 아시네토박터 바우마니(Acinetobacter baumannii), 포르피로모나스 진지발리스(Porphyromonas gingivalis), 살모넬라 엔테리카(Salmonella enterica), 세로바 티피무륨(serovar Typhimurium), 헬리코박터 파일로리(Helicobacter pylori), 및 비브리오 콜레라(Vibrio cholerae)와 같은 그람음성세균이 세포밖 소포를 분비하여 세균감염에 대한 방어면역을 유도하고, 황색포도상구균 (Staphylococcus aureus)와 같이 그람양성세균도 세포밖 소포를 통해 세균감염에 대한 방어면역을 유도할 수 있음이 보고되었다.
항원 전달체로서 그람음성세균에서 유래하는 소포는 자체의 우수한 면역유도 효과에도 불구하고, 패혈증과 같은 심각한 독성을 유도하는 문제가 있다. 이는 그람음성세균의 세포외막에 내독소로 알려진 리포폴리사카라이드 (lipopolysaccharide, LPS)가 존재하고, 이는 혈관내피세포에 다량으로 존재하는 TLR4 수용체를 통해 전신적인 혈관염증을 유도하여 패혈증을 유도함이 최근 밝혀졌다. 그람음성세균 유래 세포밖 소포에 의한 독성문제를 해결하기 위한 방법으로 세포밖 소포에 존재하는 LPS를 제거하거나, 혹은 LPS 활성을 억제하는 화합물을 처리하여 항원 전달체로 사용할 수 있다. 원형질체(protoplast)는 식물 또는 세균의 살아있는 세포 물질이며, 이들 세포의 세포외막과 세포벽을 기계적/효소적인 방법으로 제거한 형태로서, 세균의 외막에 존재하는 내독소 함량이 제거되어 소포 자체의 독성문제를 해결할 수 있다. 또한, 폴리믹신(polymyxin) B와 같은 약물을 처리하여 세포밖 소포 내에 존재하는 내독소의 활성을 제거할 수 있다.
현재까지 집먼지진드기 알레르겐 면역요법은 주로 집먼지진드기에서 알레르겐을 추출하거나, 재조합 단백질 형태로 사용하고 있고, 아직까지 세포밖 소포와 같은 항원전달체에 알레르겐을 발현시켜 사용한 예는 전무한 상태이다.
이에, 본 발명은 집먼지진드기 유래 알레르겐을 발현하는 세균, 및 이로부터 유래하는 세포밖 소포를 포함하는 약학적 조성물, 및 이의 제조방법 등을 제공하고자 한다.
또한, 본 발명은 상기 조성물을 이용하여 집먼지진드기 유래 알레르겐에 의한 과민반응을 조절하는 방법 등을 제공하고자 한다.
본 발명이 이루고자 하는 기술적 과제는 이상에서 언급한 과제에 제한되지 않으며, 언급되지 않은 또 다른 과제들은 아래의 기재로부터 당업자에게 명확하게 이해될 수 있을 것이다.
본 발명은 세균유래 세포밖 소포를 유효성분으로 함유하는 알레르기질환 예방 또는 치료용 약학적 조성물을 제공한다. 상기 세균은 집먼지진드기 유래 알레르겐 유전자를 과발현시킨 세균이고, 상기 알레르기 질환은 집먼지진드기 유래 알레르겐에 의한 알레르기 질환인 것을 특징으로 한다.
본 발명의 일 구현예에 있어서, 상기 세균은 대장균(E. coli) 또는 혹은 살모넬라속 세균 (Salmonella spp.) 인 것을 특징으로 한다.
본 발명의 다른 구현예에 있어서, 상기 집먼지진드기는 유럽집먼지진드기 (Dermatophagoides pteronyssinus) 또는 북아메리카집먼지진드기인 것을 특징으로 한다.
본 발명의 또 다른 구현예에 있어서, 상기 집먼지진드기 유래 알레르겐은 Der p1, Der p2, Der p3, Der p4, Der p6, Der p9, Der p15, Der f1, Der f2, Der f11, 및 Der f18로 이루어진 군으로부터 선택되는 것을 특징으로 한다.
또한, 본 발명은 (a) 집먼지진드기 유래 알레르겐 유전자를 세균에 과발현시키는 단계; (b) 상기 과발현된 세균을 배양하는 단계; (c) 상기 세균 배양액에서 소포를 분리하는 단계; 및 (d) 상기 세균유래 소포의 외막 내독소 활성을 제거하는 단계를 포함하는, 집먼지진드기 유래 알레르겐에 의한 알레르기질환 예방 또는 치료용 세균유래 소포의 제조방법을 제공한다.
본 발명의 일 구현예에 있어서, 상기 (c) 단계에서 소포를 분리하는 방법은 자연적으로 분비된 소포를 필터법, 및/혹은 초원심분리법으로 분리하거나, 혹은 인공적인 방법으로 소포를 만든 후, 필터법, 및/혹은 초원심분리법 등으로 분리하는 것을 포함한다.
본 발명의 다른 구현예에 있어서, 상기 (d) 단계에서 내독소 활성을 제거하는 방법은 소포 내 독소 (LPS, peptidoglycan 등)를 라이소자임 등으로 제거하거나, 내독소 (LPS)를 폴리믹신 (polymyxin B)와 같은 약물로 활성을 억제하는 방법을 포함한다.
본 발명의 또 다른 구현예에 있어서, 상기 집먼지진드기에 의한 알레르기질환은 천식, 비염, 아토피피부염으로 이루어진 군에서 선택되는 것을 특징으로 한다.
또한, 본 발명은 상기 방법으로 제조된 세균유래 세포밖 소포를 유효성분으로 포함하는, 집먼지진드기에 의한 알레르기질환 예방 또는 치료용 면역조절제를 제공한다.
본 발명의 일 구현예에 있어서, 상기 면역조절제는 세균유래 세포밖 소포의 내강(lumen)에 집먼지진드기 알레르겐 (Der f2 등)이 과발현되어 존재하는 것을 특징으로 한다.
본 발명의 또 다른 구현예에 있어서, 상기 세균유래 소포는 평균 직경이 10-200nm인 것을 특징으로 한다.
또한, 본 발명은 세균유래 소포를 이용하여 집먼지진드기 유래 알레르겐에 의한 알레르기질환을 예방 또는 치료하는 방법을 제공한다. 구체적으로, 세균유래 세포밖 소포를 유효성분으로 함유하는 약학적 조성물을 개체에 투여하는 단계를 포함하는, 알레르기질환의 예방 또는 치료 방법을 제공한다.
상기 세균은 집먼지진드기 유래 알레르겐 유전자를 과발현시킨 세균이고, 상기 알레르기 질환은 집먼지진드기 유래 알레르겐에 의한 알레르기 질환인 것을 특징으로 한다.
또한, 본 발명은 상기 세균유래 세포밖 소포의, 집먼지진드기 유래 알레르겐에 의한 알레르기질환 예방 또는 치료 용도를 제공한다.
상기 세균은 집먼지진드기 유래 알레르겐 유전자를 과발현시킨 세균이고, 상기 알레르기 질환은 집먼지진드기 유래 알레르겐에 의한 알레르기 질환인 것을 특징으로 한다.
본 발명은 집먼지진드기 유래 알레르겐 (Der f2 등)을 함유하는 세균 유래 소포를 집먼지진드기 유래 알레르겐 면역조절제로 이용하여, 알레르겐에 의한 과민반응을 조절함으로써, 궁극적으로 집먼지진드기에 의해 발생하는 알레르기질환을 효율적으로 예방 또는 치료할 수 있을 것으로 기대된다.
도 1은, 북아메리카집먼지진드기 (D. farinae) 알레르겐 (Der f2)을 클로닝하여, 세균 (Escherichia coli)에 로딩한 후, 배양과정에서 라이소자임으로 처리하여 원형질체를 만든 후, 압출법 (extrusion)으로 인공적인 세포밖 소포를 제조하여 면역조절제를 만드는 방법을 도식화한 그림이다.
도 2는, Der f2 알레르겐이 로딩된 세포밖 소포를 투과전자현미경 (transmission electron microscope)으로 촬영한 사진이다.
도 3은, Der f2 알레르겐이 로딩된 세포밖 소포를 동적광산란법 (dynamic light scattering) 방법으로 크기를 측정한 결과이다.
도 4는, Der f2 알레르겐이 로딩된 세포밖 소포를 골수세포 유래 항원제시세포 (bone marrow-derived dendritic cell)에 처리하여 co-stimulatory molecule (CD86)의 발현을 측정한 결과이다.
도 5는, Der f2 알레르겐이 로딩된 세포밖 소포를 골수세포 유래 항원제시세포 (bone marrow-derived dendritic cell)에 처리하여 IL(interleukin, 인터루킨)-12 및 IL-6의 분비량을 측정한 결과이다.
도 6은, 세균에 존재하는 small RNA를 클로닝하여, 세균 (Salmonella typhimurium)에 로딩한 후, 세균을 배양하여 세포밖 소포를 분리한 후, 소포의 외막에 존재하는 lipopolysaccharide (LPS)의 활성을 제거하기 위하여 polymyxin B (PMB)를 처리하여 면역조절제를 만드는 방법을 도식화한 그림이다.
도 7은, Mic A small RNA 과발현 균주 유래 세포밖 소포의 형태학적 특성을 동적광산란법 및 전자현미경으로 관찰한 그림이다.
도 8은, 세균에 존재하는 small RNA 과발현 균주(Salmonella typhimurium)유래 소포를 복강으로 3회 주사한 후, 국소 림프절에서 면역세포를 분리하여 anti-CD3/anti-CD28으로 자극을 준 후, 감마인터페론, IL-4, IL-17 분리량을 측정한 그림이다.
도 9는, Mic A small RNA 과발현 균주(Salmonella typhimurium)유래 소포를 염증세포 (대식세포주 RAW264.7)에 투여하는 과정에서 polymyxin B (PMB)를 다양한 농도로 섞어서 투여한 후, 염증성 매개체 (IL-6, TNF-alpha) 분비량을 측정한 그림이다.
도 10은, Mic A small RNA 과발현 균주(Salmonella typhimurium)유래 소포를 염증세포 (대식세포주 RAW264.7)에 투여하는 과정에서 polymyxin B (PMB)의 농도를 좀 더 세부적으로 구분하여 섞어서 투여한 후, IL-6 분비량을 측정한 그림이다.
도 11은, Der f2 알레르겐이 로딩된 세포밖 소포의 면역원성을 마우스에서 평가하기 위한 실험프로토콜이다.
IM: 근육주사; IN: 비강투여; BAL: 기관지폐포세척액
도 12a 및 도 12b는, Der f2 알레르겐이 로딩된 세포밖 소포를 도 11의 방법으로 투여한 후, 마우스 혈청 내 항원특이 IgG 항체와 기관지폐포세척액 내 항원특이 IgA 항체 생성능을 측정한 결과이다.
도 13은, Der f2 알레르겐이 로딩된 세포밖 소포를 도 6의 방법으로 투여한 후, 마우스 폐조직에서 T 세포를 분리하여 anti-CD3/CD28로 자극을 준 후, 감마-인터페론, IL-17, IL-4, IL-10을 측정한 결과이다.
도 14는, 북아메리카집먼지진드기 추출액 항원과 면역보강제 (aluminum hydroxide, alum)으로 유도한 마우스 천식모델에서, Der f2 알레르겐이 로딩된 세포밖 소포의 면역조절 효능을 마우스에서 평가하기 위한 프로토콜이다.
IM: 근육주사; IN: 비강투여; IP: 복강투여
도 15는, 집먼지진드기 알레르겐으로 유도된 마우스 천식모델에서, Der f2 알레르겐이 로딩된 세포밖 소포의 항염증효과를 기관지폐포세척액 내 염증세포 수로 평가한 결과이다.
항원특이적 면역조절제를 개발하기 위해서는 항원선정과 원하는 면역반응을 유도하는 면역보강제 선정이 중요하다. 본 발명에서는, 집먼지진드기 유래 알레르겐에 대한 과민반응을 조절하기 위한 면역조절제 후보 항원으로 국내에서 가장 많이 존재하는 Der f2 알레르겐을 타겟으로 하였다.
한편, 세균 유래 세포밖 소포가 숙주에 다양한 면역반응을 유도할 수 있다는 사실에 근거하여, 세균에서 유래하는 세포밖 소포를 면역보강제로 이용하고자 하는 시도가 있으나, 세균 유래 세포밖 소포는 LPS, peptidoglycan 등과 같은 독소를 함유하고 있어, 세포밖 소포에 의한 독성문제를 해결해야 하는 문제가 있다. 이에, 본 발명에서는, 종래 세균유래 세포밖 소포를 약물전달체로 사용함에 있어, 세포밖 소포가 갖고 있는 독성문제를 제거하기 위하여, 세포밖 소포의 외막(outer membrane)과 펩티도글리칸층(peptidoglycan)을 포함하는 세포벽(cell wall)을 제거하여 만들어진 원형질체(protoplast)를 제조한 후, 인공적으로 세포밖 소포를 제조하여 사용하였다. 또한, 세균을 배양한 후, 자연적으로 분비되는 소포에 소포 외막에 존재하는 LPS의 활성을 저해하는 polymyxin B를 병용투여하여 독성을 감소시키고자 하였다.
구체적으로, 본 발명에서는, 북아메리카집먼지진드기 유래 주요 알레르겐인 Der f2 항원을 대장균(E. coli)에 과발현시킨 후 배양하였고, 이후 라이소자임을 처리하여 원형질체를 제조한 후, extrusion 방법으로 세포밖 소포를 제조하여 후보물질을 생산하였다. 또한, 백신 후보물질을 최적화하기 위하여, 세균에 존재하는 Mic A small RNA를 클론닝한 후, 살모넬라균에 삽입하여 과발현시킨 후 배양하였고, 이후 PMB를 소포와 동시에 투여하여, 면역원성은 유지하면서, 독성이 감소된 최적의 PMB 농도를 설정하였다.
이후, 항원이 로딩된 후보 세포밖 소포의 면역원성을 체외 및 체내 실험을 통해 평가하여, 효능 평가를 위한 투여경로와 투여용량을 결정하였다. 이를 통해 상기 항원이 로딩된 세포밖 소포가 유효한 백신임을 알 수 있었다.
또한, 상기의 면역조절제의 효능을 질병모델에서 평가하기 위하여, 북아메리카집먼지진드기 추출액과 alum을 복강으로 주입하여 알레르겐으로 감작시킨 후, 비강으로 진드기 추출액만을 투여하여 천식동물모델을 제작하여 사용하였다.
본 발명에서, '집먼지진드기 알레르기질환'이란, 집먼지진드기 유래 알레르겐에 의해 발생될 수 있는 질환이면 특별히 제한은 없으나, 천식, 비염, 아토피피부염으로 이루어진 군으로부터 선택되는 것이 바람직하다.
본 발명에서 '알레르기질환의 치료 또는 예방'이란, 알레르기질환의 경감, 완화 및 증상의 개선을 포함하며, 또한 알레르기질환이 걸릴 가능성을 낮추는 것을 포함하는 의미이다.
본 발명에서, 유전자를 과발현시킬 수 있는 세균에는 특별히 제한은 없으나, 대장균(E. coli), 또는 살모넬라균(Salmonella spp.)인 것이 바람직하다.
본 발명에서, 세포밖 소포를 분리하는 단계에는 자연적으로 분비된 세포밖 소포를 사용할 수 있고, 세포밖 소포를 분리하는 방법에 특별히 제한은 없으나, 필터로 농축하여 얻을 수 있으며, 이후 초원심분리 등의 공정을 포함할 수 있다.
본 발명에서, 인공적으로 세포밖 소포를 제조할 수 있으며, 그 제조하는 방법에 특별히 제한은 없으나, 필터로 압출하여 얻을 수 있으며, 원심분리, 초원심분리 등의 공정을 더 포함할 수 있다.
본 발명에서 세포밖 소포를 분리하는 방법은 세균 유래 세포밖 소포를 포함한다면 특별히 제한되지 않으며, 예컨대 배양액에서, 원심분리, 초고속 원심분리, 필터에 의한 여과, 겔 여과 크로마토그래피, 프리-플로우 전기영동, 모세관 전기영동 등의 방법 및 이들의 조합을 이용하여 세포밖 소포를 분리할 수 있다. 또한, 불순물의 제거를 위한 세척, 수득된 세포밖 소포의 농축 등의 과정을 추가로 포함할 수 있다. 상기 세포밖 소포는 자연적으로 분비된 것이거나, 혹은 인공적으로 분비된 세포밖 소포를 포함한다.
본 발명에서, 상기 방법에 의해 제조된 세포밖 소포의 내강(lumen)에 집먼지진드기 유래 알레르겐이 발현되어 있으며, 이때 발현 단백질로는 Der f2, Der p2 등이 바람직하며, Der f2가 가장 바람직하다.
본 발명에서, 상기 방법에 의해 제조된 면역조절제의 세포밖 소포는 평균 직경이 10-200nm일 수 있으나, 바람직하게는 20-100nm이다.
본 발명에서, 상기 알레르기질환의 치료 또는 예방용 면역조절제는 약학적 조성물로 제조될 수 있다. 치료 및 예방에 사용하기 위해 본 발명의 세균 유래 세포밖 소포 자체를 투여하는 것이 가능하나, 약학적 조성물의 활성 성분으로서 상기 세포밖 소포가 포함되는 것이 바람직하다.
상기 약학적 조성물은 상기 분리된 세포밖 소포를 유효성분으로 함유하며, 약학적으로 허용 가능한 담체를 포함할 수 있다. 상기 약학적으로 허용 가능한 담체는 제제 시에 통상적으로 이용되는 것으로서, 식염수, 멸균수, 링거액, 완충 식염수, 사이클로덱스트린, 덱스트로즈 용액, 말토덱스트린 용액, 글리세롤, 에탄올, 리포좀 등을 포함하지만 이에 한정되지 않으며, 필요에 따라 항산화제, 완충액 등 다른 통상의 첨가제를 더 포함할 수 있다. 또한 희석제, 분산제, 계면활성제, 결합제, 윤활제 등을 부가적으로 첨가하여 수용액, 현탁액, 유탁액 등과 같은 주사용 제형, 환약, 캡슐, 과립 또는 정제로 제제화할 수 있다. 적합한 약학적으로 허용되는 담체 및 제제화에 관해서는 레밍턴의 문헌 (Remington's Pharmaceutical Science, Mack Publishing Company, Easton PA)에 개시되어 있는 방법을 이용하여 각 성분에 따라 바람직하게 제제화할 수 있다. 본 발명의 약학적 조성물은 제형에 특별한 제한은 없으나 주사제, 흡입제, 피부 외용제 등으로 제제화할 수 있다.
본 발명의 약학적 조성물의 투여방법은 특별히 제한되는 것은 아니나, 목적하는 방법에 따라 근육주사, 피하, 흡입, 비강, 설하, 피부도포와 같이 비경구 투여하거나 경구 투여할 수 있다.
투여량은 환자의 체중, 연령, 성별, 건강상태, 식이, 투여시간, 투여방법, 배설률 및 질환의 중증도 등에 따라 그 범위가 다양하다. 일일 투여량은 치료를 필요로 하는 개체에 투여됨으로써 경감된 질병 상태에 대한 치료에 충분한 본 발명의 치료용 물질의 양을 의미한다. 치료용 물질의 효과적인 양은 특정 화합물, 질병 상태 및 그의 심각도, 치료를 필요로 하는 개체에 따라 달라지며, 이는 당업자에 의해 통상적으로 결정될 수 있다. 비제한적 예로서, 본 발명에 의한 조성물의 인체에 대한 투여량은 환자의 나이, 몸무게, 성별, 투여 형태, 건강 상태 및 질환 정도에 따라 달라질 수 있다.
이하, 본 발명의 이해를 돕기 위하여 바람직한 실시예를 제시한다. 그러나 하기의 실시예는 본 발명을 보다 쉽게 이해하기 위하여 제공되는 것일 뿐, 하기 실시예에 의해 본 발명의 내용이 한정되는 것은 아니다.
[ 실시예 ]
실시예 1: Der f2 항원이 로딩된 세포밖 소포 제조 (도 1 참조)
북아메리카집먼지진드기 주요 알레르겐인 Der f2 클로닝을 위해 Der f2 유전자(reference sequence: GeneBank AB195580)를 RT-PCR 방법으로 cDNA로 합성하였다. PCR 산물은 T-blunt PCR 벡터(T-blunt PCR cloning kit, Solgent)에 삽입한 후, 각각의 플라스미드를 EcoRI(OmpA, ABC transporter) 및 BglII(FepA)로 절단하였다. 절편을 전기영동으로 분리한 후 pET-30a 플라스미드에 삽입하고, 대장균 DH5a에 열충격법으로 형질전환(transformation)하여, 최종적으로 상기 유전자를 클로닝하였다.
상기 실시 예에서 얻어진 Der f2 클론을 37℃, 200 rpm, 12시간 동안 Luria Bertani broth (Merch)에서 배양한 후, Exprep plasmid mini prep. Kit (GeneAll)를 이용하여 각각의 플라스미드를 분리하여 대장균 BL21(Real Biotech)에 트랜스펙션시켰다.
BL21를 OD값이 0.3이 될 때까지 200 rpm, 37℃, 100 ml LB broth(1 mM IPTG)에서 3시간 배양한 후, 3,000 × g, 4℃에서 10분 동안 원심분리하여 얻어진 박테리아 펠렛을 Tris buffer(0.01M Tris HCl, 0.5M sucrose)로 세척하였고, 4℃, 3,000 × g에서 10분 동안 원심분리한 다음 Tris buffer로 재현탁하였다. 재현탁한 박테리아를 37℃, 100 rpm에서 30분 동안 0.01 M EDTA로 처리하고, 4℃, 3,000 × g에서 10분 동안 펠릿화한 후, Tris buffer로 세척하여 펠릿화하였다.
다음으로, 박테리아 펠릿을 Tris buffer로 재현탁하고, 원형질체를 얻기 위하여 37℃, 100 rpm, 2시간 동안 1 mg/ml 라이소자임(lysozyme)(Sigma)을 처리한 후, 10 μm, 5 μm, 및 1 μm 기공 크기의 막을 통해 순서대로 LiposoFast extruder (Avestin)로 압출하였다. 최종적으로, 10% 및 50% opti-prep 밀도구배 배지(OptiPrep)로 초원심분리하여 Der f2 항원이 로딩된 세포밖 소포를 얻었다.
실시예 2: Der f2 항원이 로딩된 세포밖 소포의 물리적 특성 분석
실시예 1에서 얻은 Der f2 항원이 로딩된 세포밖 소포를 PBS로 희석(50μg/ml)시키고, 300-mesh copper grids(EMS)에 10 μl 로딩하였다. 음성염색(negative stain)을 위하여 우라닐아세테이트(2%)를 그리드에 떨어뜨리고, JEM1011 전자 현미경(JEOL)으로 관찰하였다. 그 결과, 도 2에 나타낸 바와 같이, 상기 세포밖 소포는 구형으로서 지질이중층으로 둘러싸여 있음을 확인하였다.
실시예 1에서 얻은 Der f2 항원이 로딩된 세포밖 소포의 크기를 측정하기 위하여, 세포밖 소포를 PBS로 희석(500 ng/ml)시키고, Zetasizer Nano ZS (Malvern Instruments)을 이용하여 동적 광산란법으로 지름 크기 분포를 측정하고, Dynamic V6 software를 이용하여 결과를 분석하였다. 그 결과, 도 3에 나타낸 바와 같이, 세포밖 소포의 직경이 100-300nm임을 알 수 있었다.
실시예 3: Der f2 항원이 로딩된 소포에 의한 선천면역반응
Der f2 항원이 로딩된 세포밖 소포를 면역조절제로서 이용하기 위해서는 면역반응을 유도할 수 있어야 하기 때문에, Der f2 항원이 로딩된 세포밖 소포에 의한 선천성 면역반응 유도 수준을 평가하기 위해 골수세포에서 유래하는 수지상세포 (bone marrow-derived dendritic cell, BMDC)를 사용하여 in vitro 실험을 수행하였다.
우선, BMDC (5 x 105cells/well)를 10% FBS와 항생제(100 unit/ml 페니실린 및 100 μg/ml 스트렙토마이신)를 함유한 DMEM으로 37℃에서 24시간 동안 24 well 조직배양플레이트(TPP)에서 배양하였다. 배지 제거 후, Der f2 항원이 로딩된 세포밖 소포를 0.1 및 1 ug/ml의 농도로 첨가한 무혈청 DMEM 배지로 갈아주었다. 15시간 후 BMDC에서 CD86 발현정도와 상기 배양 배지로 ELISA assay를 수행하여 T 세포 분화 사이토카인인 IL-12 및 IL-6의 발현수준을 측정하였다.
그 결과, 도 4와 같이 Der f2 항원이 로딩된 세포밖 소포에 의해 항원제시세포에서의 CD86 발현이 크게 증가하였다 (도 4 참조). 또한, 도 5에 나타낸 바와 같이, Der f2 항원이 로딩된 세포밖 소포가 처리된 항원제시세포는 Th1 세포로의 분화에 중요한 IL-12 및 Th17 세포로의 분화에 중요한 IL-6의 분비를 유의하게 증가시켰다 (도 5 참조).
실시예 4: Mic A sRNA 과발현 균주 유래 소포의 물리적 특성 분석
Hfq-결합 sRNA 중 종 보존성이 우수한 sRNA를 활용하여 대장균 sRNA 염기서열과 동일한 Mic A sRNA (CATCTCTGAATTCAGGGATGATGATAACAAATGCGCGTCTTT)가 포함된 pBRplac-sRNA 플라스미드를 살모넬라균에 도입하였다. 구체적으로, Salmonella Typhimurium 14028S 종에 pBRplac-sRNA를 전기천공법(electroporation)을 이용하여 도입하였다.
상기 실시예에서 sRNA 과발현 균주를 체외에서 배양하여, 소포를 분리하여 소포의 물리적 특성을 동적광산란법(Dynamic light scattering)과 전자현미경(Transmission electron microscopy)을 사용하여 확인하였다. 그 결과 하기 표 1 및 도 7에 나타낸 바와 같이, Mic A sRNA 과발현 균주 유래 세포밖 소포가 대조군인 pBRplac와 비슷한 20 nm 내외의 크기이고, 모양도 비슷한 것을 확인하였다(도 7).
균주(sRNA) 평균 크기(nm)
Salmonella typhimurium(pBRplac) 26.07±5.98
Salmonella typhimurium(RseX) 19.93±2.503
Salmonella typhimurium(MicA) 21.39±1.92
실시예 5: Mic A sRNA 과발현 살모넬라균(salmonella) 유래 소포의 면역원성
살모넬라 균주는 장염을 유발하여 Th1 면역반응을 유도함이 알려져 있다. 이에, sRNA 과발현을 통해 얻은 세포밖 소포의 Th1 면역반응 유도능을 확인하였다. 구체적으로, 그룹당 5개체의 마우스(C67BL/6)에 복강경로를 통해 세포밖 소포 100 ug/hd를 2일 간격으로 투여하였다. 그리고 5일째 되는 날 해부하여 복강내 림프절에서 세포를 분리한 후, 항-CD3 및 CD28을 사용하여 12시간 동안 T 세포 재자극을 실시한 후 T 세포에서 분비되는 사이토카인 양을 측정하였다.
그 결과 도 8에 나타낸 바와 같이, Th1, Th17 면역반응에 관련된 사이토카인인 IFN-γ, IL-17은 sRNA 과발현 균주 유래 세포밖 소포를 투여하였을 때 대조군에 비해 증가하였으며, Th2 면역반응에 관련된 사이토카인인 IL-4는 sRNA 과발현 균주 유래 세포밖 소포를 투여하였을 때 대조군과 차이가 없는 것을 확인하였다(도 8).
이를 통해, sRNA 과발현 균주 살모넬라 유래 세포밖 소포를 이용해 생균감염과 유사한 Th1, Th17 면역반응을 유도할 수 있음을 확인하였다.
실시예 6: Mic A sRNA 과발현 살모넬라균(salmonella) 유래 소포의 최적화
살모넬라균 유래 소포 자체는 면역원성이 좋으나, 세포외막에 존재하는 LPS에 의한 독성이 문제가 된다. 이를 해결하기 위한 방안으로, LPS의 활성을 억제하는 PMB를 Mic A sRNA 과발현 살모넬라균 유래 소포와 섞어서 선천성 면역반응 유도 수준을 평가하였다.
구체적으로, 염증세포 (대식세포주 RAW264.7, 5 x 105cells/well)를 10% FBS와 항생제(100 unit/ml 페니실린 및 100 μg/ml 스트렙토마이신)를 함유한 DMEM으로 37℃에서 24시간 동안 24 well 조직배양플레이트(TPP)에서 배양하였다. 배지 제거 후, PMB 함유 세포밖 소포를 1 ug/ml의 농도로 첨가한 무혈청 DMEM 배지로 갈아주었다. 15시간 후 염증세포에서 IL-6와 TNF-alpha의 분비량을 측정하였다.
그 결과 도 9 에 나타낸 바와 같이, 세포밖 소포에 PMB 1 ug/ml 혹은 10 ug/ml 농도로 섞어서 투여하였을 때, IL-6 분비량이 감소하였고, TNF-alpha 분리량은 PMB 10 ug/ml의 농도에 의해 억제됨을 확인하였다. 이는 상기의 방법으로 제조한 소포에 대한 최적의 PMB 희석농도는 1 ug/ml 내지 10 ug/ml 사이에 존재함을 의미한다.
최적의 PMB 희석 농도를 결정하기 위하여, 상기의 방법에서 PMB 농도를 1, 2, 4, 8, 10 ug/ml의 농도로 세분하여 소포와 함께 대식세포에 투여하였다. 그 결과, 대식세포에서의 IL-6의 분비량이 2 ug/ml의 농도 이상에서는 더 이상 감소하지 아니하는 것으로 나타났으며, 따라서 희석하는 PMB 농도를 달리하여 후보물질을 최적화할 수 있음을 확인하였다(도 10 참조).　
실시예 7: Der f2 항원이 로딩된 소포에 의한 항체 면역반응
생체내(in vivo)에서 Der f2 항원이 로딩된 세포밖 소포에 의한 항체 면역반응 유도능을 확인하고, Der f2 항원이 로딩된 세포밖 소포의 유효량을 결정하기 위하여, Der f2 항원이 로딩된 세포밖 소포를 마우스에 투여하여 면역을 유도하였다. 또한, 면역반응을 유도한 후 대조군(PBS) 및 Der f2 항원이 로딩된 세포밖 소포를 투여한 마우스에서 혈액을 채취하여 Der f2 특이 IgG 항체를 측정하였고, 기관지폐포세척액을 채취하여 Der f2 특이 sIgA 항체의 농도를 측정하였다.
구체적으로, 100 ng의 Der f2가 포함된 100 μl의 PBS를 4℃에서 96-well black plate (Greiner Bio-one)에 24시간 동안 코팅하였다. Der f2로 코팅된 플레이트를 PBS로 세척하고 PBS로 희석한 1% BSA용액을 1시간 동안 처리하여 블로킹 과정을 수행하고 PBS로 다시 세척하였다.
대조군(PBS)과 Der f2 항원이 로딩된 세포밖 소포를 투여한 마우스로부터 혈액과 혈청과 세포층을 분리한 후 혈청을 분리하였고, 기관지폐포세척액에서 세포층과 상층액를 분리하여, 혈청과 기관지폐포세책액 상층액을 1% BSA 용액으로 희석하였으며, Der f2 항원으로 코팅된 플레이트에서 2시간 동안 반응시켰다. 배양 후 플레이트를 세척하고 horseradish peroxidase-conjugated goat anti-mouse IgG 및 IgA (Santa Cruz Biotechnology) 200 ng/ml를 첨가하여 2시간 동안 반응시켰다. 다시 플레이트를 세척한 후 ECL substrate(Thermo Scientific)를 첨가하고 Victor Wallac 1420 apparatus (PerkinElmer)를 이용하여 IgG 및 sIgA 항체 역가를 분석하였다.
그 결과, 도 11에 나타낸 바와 같이, Der f2 항원이 로딩된 세포밖 소포로 근육주사로 면역반응을 유도한 마우스 혈청에는 Der f2 항원이 로딩된 세포밖 소포 비강투여 유무에 상관없이 Der f2 항원 특이 IgG 항체 생성이 증가되었다. 반면, 기관지폐포세척액 내 Der f2 항원 특이 sIgA 생성은 Der f2 항원이 로딩된 세포밖 소포를 근육주사한 후, 비강으로 투여한 경우에만 증가하였다(도 12a 및 도 12b 참조).
실시예 8: Der f2 항원이 로딩된 세포밖 소포에 의한 T 세포 면역반응
생체내(in vivo)에서 Der f2 항원이 로딩된 세포밖 소포를 투여하여 면역반응을 유도한 후, 대조군(PBS) 및 Der f2 항원이 로딩된 세포밖 소포를 투여한 마우스에서 T 세포에서 생성되는 사이토카인의 양을 측정하여 T 세포 반응을 평가하였다.
즉, 적출한 폐조직을 5ml 시린지 washing buffer (2.5% FBS, 0.01M HEPES 함유 DMEM)로 100 μm cell strainer (BD Biosciences)에 통과시켜 분해시켰다. 분리된 세포에 암모늄 클로라이드 용액(STEM CELL)을 4℃에서 10분간 처리하여 적혈구 세포가 용해되도록 하였다. 얻어진 세포를 washing buffer로 세척하고 40 μm cell strainer(BD)로 필터링한 후 10% FBS, 50 μM 2-ME, 0.01 M HEPES 및 항생제(100 unit/ml 페니실린, 100 μg/ml 스트렙토마이신)가 포함된 RPMI 1640 배지를 이용해 24-well 플레이트에서 12시간 동안 배양하였다. 이때 24-well 플레이트는 T 세포를 재자극시키기 위하여 1 μg/ml의 항-CD3(eBioscience)과 1 μg/ml의 항-CD28(eBioscience) 항체로 코팅된 것을 이용하였다.
그 결과, 도 13에 나타낸 바와 같이, Th1 세포에 의해 생성되는 주요 사이토카인인 IFN-γ의 양은, Der f2 항원이 로딩된 세포밖 소포 투여군은 대조군과 비교하여 증가되었고, Der f2 항원이 로딩된 세포밖 소포 비강투여 시 용량의존적으로 감소하였다. Th17에서 생성되는 주요 사이토카인인 IL-17의 경우, Der f2 항원이 로딩된 세포밖 소포 투여군은 비강투여와 상관없이 대조군과 비교하여 증가되었다(도 13 참조).
실시예 9: 북아메리카집먼지진드기 추출 알레르겐으로 유도된 천식동물모델에서 Der f2 항원이 로딩된 세포밖 소포의 항염증 효과
집먼지진드기 알레르겐으로 유도된 마우스 천식모델에서 Der f2 항원이 로딩된 세포밖 소포의 효능을 평가하기 위하여, 다음과 같은 실험을 수행하였다(도 14 참조). 도 14에 표현된 것처럼, 천식모델을 제작하기 위하여 북아메리카집먼지진드기에서 알레르겐을 추출한 후, 알레르겐 75 ㎍에 alum을 섞어서 복강으로 2회 투여한 후, 알레르겐 50 ㎍ 단독으로 2회 비강으로 투여하여 천식모델을 제작하였다(도 14 참조).
Der f2 항원이 로딩된 세포밖 소포로 면역반응을 유도하기 위해선, 실시예 5의 방법으로 설정된 농도로 도 9에 표현된 것처럼, 천식모델을 만들기 전에 Der f2 항원이 로딩된 세포밖 소포를 3회 근육주사와 비강투여 하였고, 천식모델을 제작하는 동안에는 비강으로만 Der f2 항원이 로딩된 세포밖 소포를 투여하였다(도 14 참조).
그 결과, 도 15에 표현한 것처럼, Der f2 항원이 로딩된 세포밖 소포를 투여하지 않은 양성 대조군 마우스에선, 집먼지진드기 알레르겐으로 천식을 유도하였을 때, 기관지폐포세척액 내 염증세포의 수가 현저히 증가되었다. 천식모델 제작 전에 Der f2 항원이 로딩된 세포밖 소포로 면역반응을 유도한 마우스에선 기관지폐포세척액 내 염증세포의 수가 양성 대조군에 비하여 현저히 감소하였고, Der f2 항원이 로딩된 세포밖 소포를 천식모델 제작 전과 제작 후에 지속적으로 투여한 마우스에선 양성 대조군뿐만 아니라, 천식모델 제작 전에 Der f2 항원이 로딩된 세포밖 소포를 투여한 경우에 비하여 염증세포 수가 현저히 감소하였다(도 15 참조).
따라서, Der f2 항원이 로딩된 세포밖 소포를 비강으로 투여하였을 때, 북아메리카집먼지진드기 알레르겐에 의한 천식을 효율적으로 억제함을 알 수 있었다.
전술한 본 발명의 설명은 예시를 위한 것이며, 본 발명이 속하는 기술분야의 통상의 지식을 가진 자는 본 발명의 기술적 사상이나 필수적인 특징을 변경하지 않고서 다른 구체적인 형태로 쉽게 변형이 가능하다는 것을 이해할 수 있을 것이다. 그러므로 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적이 아닌 것으로 이해되어야 한다.
본 발명은 집먼지진드기 유래 알레르겐 (Der f2 등)을 함유하는 세균 유래 소포를 집먼지진드기 유래 알레르겐 면역조절제로 이용함으로써, 알레르겐에 의한 과민반응을 조절함으로써, 궁극적으로 집먼지진드기에 의해 발생하는 알레르기질환을 효율적으로 예방 또는 치료할 수 있을 것으로 기대된다.

Claims (11)

  1. 세균유래 세포밖 소포를 유효성분으로 함유하는 알레르기질환 예방 또는 치료용 약학적 조성물로서, 상기 세균은 집먼지진드기 유래 알레르겐 유전자를 과발현시킨 세균이고, 상기 알레르기 질환은 집먼지진드기 유래 알레르겐에 의한 알레르기 질환인 것을 특징으로 하는, 약학적 조성물.
  2. 제 1 항에 있어서,
    상기 세균은 대장균(E. coli) 또는 살모넬라균인 것을 특징으로 하는, 약학적 조성물.
  3. 제 1 항에 있어서,
    상기 집먼지진드기는 유럽집먼지진드기(Dermatophagoides pteronyssinus) 또는 북아메리카집먼지진드기(Dermatophagoides farinae) 인 것을 특징으로 하는, 약학적 조성물.
  4. 제 3 항에 있어서,
    상기 집먼지진드기는 북아메리카집먼지진드기(Dermatophagoides farinae) 인 것을 특징으로 하는, 약학적 조성물.
  5. 제 1 항에 있어서,
    상기 집먼지진드기 유래 알레르겐은 Der p1, Der p2, Der p3, Der p4, Der p6, Der p9, Der p15, Der f1, Der f2, Der f11, 및 Der f18 로 이루어진 군으로부터 선택되는 것을 특징으로 하는, 약학적 조성물.
  6. 제 5 항에 있어서,
    상기 집먼지진드기 유래 알레르겐은 Der f2 인 것을 특징으로 하는, 약학적 조성물.
  7. (a) 집먼지진드기 유래 알레르겐 유전자를 세균에 과발현시키는 단계;
    (b) 상기 과발현된 세균을 배양하는 단계;
    (c) 상기 세균 배양액에서 소포를 분리하는 단계; 및
    (d) 상기 세균유래 소포의 외막 내독소 활성을 제거하는 단계를 포함하는, 집먼지진드기 유래 알레르겐에 의한 알레르기질환 예방 또는 치료용 세균유래 소포의 제조방법으로, 상기 (a) 단계의 집먼지진드기 유래 알레르겐은 Der f2 인 것을 특징으로 하는, 방법.
  8. 제 7 항에 있어서,
    상기 집먼지진드기는 북아메리카집먼지진드기(Dermatophagoides farinae) 인 것을 특징으로 하는, 방법.
  9. 제 7 항에 있어서,
    상기 세균은 대장균(E. coli) 또는 살모넬라균인 것을 특징으로 하는, 방법.
  10. 제 1 항의 약학적 조성물을 개체에 투여하는 단계를 포함하는, 알레르기질환의 치료 방법.
  11. 제 1 항의 약학적 조성물의 알레르기질환 예방 또는 치료 용도.
PCT/KR2016/012626 2016-01-15 2016-11-04 집먼지진드기 유래 알레르겐에 의한 과민반응 면역조절제 WO2017122915A1 (ko)

Priority Applications (4)

Application Number Priority Date Filing Date Title
US16/070,220 US11065300B2 (en) 2016-01-15 2016-11-04 Immunomodulator for hypersensitivity reaction to house dust mite-derived allergen
JP2018536115A JP6646155B2 (ja) 2016-01-15 2016-11-04 家塵ダニ由来アレルゲンによる過敏反応免疫調節剤
EP16885226.7A EP3403670B1 (en) 2016-01-15 2016-11-04 Immunomodulator for hypersensitivity reaction to house dust mite-derived allergen
CN201680078791.7A CN108697784B (zh) 2016-01-15 2016-11-04 用于对屋尘螨来源的过敏原的超敏反应的免疫调节剂

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
KR10-2016-0005094 2016-01-15
KR20160005094 2016-01-15
KR10-2016-0145662 2016-11-03
KR1020160145662A KR101858840B1 (ko) 2016-01-15 2016-11-03 집먼지진드기 유래 알레르겐에 의한 과민반응 면역조절제

Publications (1)

Publication Number Publication Date
WO2017122915A1 true WO2017122915A1 (ko) 2017-07-20

Family

ID=59311510

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2016/012626 WO2017122915A1 (ko) 2016-01-15 2016-11-04 집먼지진드기 유래 알레르겐에 의한 과민반응 면역조절제

Country Status (1)

Country Link
WO (1) WO2017122915A1 (ko)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20050013831A1 (en) * 2001-12-17 2005-01-20 Foster Keith Alan Outer membrane vesicles from gram negative bacteria and use as a vaccine
KR20110038575A (ko) * 2009-10-08 2011-04-14 주식회사이언메딕스 실내 공기유래 세포밖 소포체를 포함하는 조성물 및 이의 용도

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20050013831A1 (en) * 2001-12-17 2005-01-20 Foster Keith Alan Outer membrane vesicles from gram negative bacteria and use as a vaccine
KR20110038575A (ko) * 2009-10-08 2011-04-14 주식회사이언메딕스 실내 공기유래 세포밖 소포체를 포함하는 조성물 및 이의 용도

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
KIM, M. -R. ET AL.: "Staphylococcus Aureus-derived Extracellular Vesicles Induce Neutrophilic Pulmonary Inflammation via Both Th l and Thl7 Cell Responses", ALLERGY, vol. 67, 2012, pages 1271 - 1281, XP 055399385 *
KIM, Y. -S. ET AL.: "Extracellular Vesicles Derived from Gram-negative Bacteria, such as Escherichia Coli, Induce Emphysema Mainly via IL -17A-mediated Neutrophilic Inflammation", THE JOURNAL OF IMMUNOLOGY, vol. 194, no. 7, 1 April 2015 (2015-04-01), pages 3361 - 3368, XP055558680, DOI: 10.4049/jimmunol.1402268 *
PARK, S. -Y. ET AL.: "House Dust Mite Allergen Der f 2-induced Phospholipase D1 Activation is Critical for the Production of Interleukin-1 3 through Activating Transcription Factor-2 Activation in Human Bronchial Epithelial Cells", THE JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 284, no. 30, 2009, pages 20099 - 20110, XP 055399382 *
See also references of EP3403670A4 *

Similar Documents

Publication Publication Date Title
Kinnebrew et al. Interleukin 23 production by intestinal CD103+ CD11b+ dendritic cells in response to bacterial flagellin enhances mucosal innate immune defense
Kurono et al. Nasal immunization induces Haemophilus influenzae—specific Th1 and Th2 responses with mucosal IgA and systemic IgG antibodies for protective immunity
Zaiss et al. The intestinal microbiota contributes to the ability of helminths to modulate allergic inflammation
Goto et al. Segmented filamentous bacteria antigens presented by intestinal dendritic cells drive mucosal Th17 cell differentiation
Chen et al. Th17 cells mediate clade-specific, serotype-independent mucosal immunity
Galdeano et al. Mechanisms involved in the immunostimulation by probiotic fermented milk
US20070190076A1 (en) Gram positive bacteria preparations for the treatment of disease comprising an immune dysregulation
Dunkley et al. A role for CD4+ T cells from orally immunized rats in enhanced clearance of Pseudomonas aeruginosa from the lung.
WO2020059895A1 (ko) 스팅 작용자를 포함하는 면역항원보강제 및 백신 조성물
WO2018124393A1 (ko) 브루셀라 균 주요 공통 항원을 발현하는 lps의 o-항원 결실 비병원성 살모넬라 균주를 포함하는 브루셀라증 예방 또는 치료용 백신 조성물
Joo et al. Critical role of TSLP-responsive mucosal dendritic cells in the induction of nasal antigen-specific IgA response
Dong et al. The recombinant fusion protein of cholera toxin B and neutrophil-activating protein expressed on Bacillus subtilis spore surface suppresses allergic inflammation in mice
KR101854904B1 (ko) 비피막형 헤모필루스 인플루엔자 백신 및 그의 용도
WO2017122915A1 (ko) 집먼지진드기 유래 알레르겐에 의한 과민반응 면역조절제
WO2017123025A1 (ko) 세균유래 세포밖 소포에 의한 기도 면역기능이상 조절제
EP3403670B1 (en) Immunomodulator for hypersensitivity reaction to house dust mite-derived allergen
Ciszek-Lenda et al. Further studies on immunomodulatory effects of exopolysaccharide isolated from Lactobacillus rhamnosus KL37C
KR101911893B1 (ko) 세균유래 세포밖 소포에 의한 기도 면역기능이상 조절제
Kinnebrew et al. Intestinal CD103+ CD11b+ lamina propria dendritic cells instruct intestinal epithelial cells to express antimicrobial proteins in response to Toll-like receptor 5 activation
WO2012093754A1 (ko) 포유동물 체내에서 유래된 세포밖 소포체를 포함하는 조성물 및 이의 용도
Strygin et al. Mycobacterium vaccae lysate induces anti-allergic immune response in vitro
Albright et al. Endogenous antigen presenting cell-derived IL-10 inhibits T lymphocyte responses to commensal enteric bacteria
Reynolds Advances in understanding pulmonary host defense mechanisms: dendritic cell function and immunomodulation
WO2022145680A1 (ko) 마이크로코커스 루테우스 유래 세포외 소포를 포함하는 호중구성 폐질환의 예방 또는 치료용 조성물
Srutkova et al. Exopolysaccharide from Lacticaseibacillus rhamnosus induces IgA production in airways and alleviates allergic airway inflammation in mouse model

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 16885226

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2018536115

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 2016885226

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 2016885226

Country of ref document: EP

Effective date: 20180816