WO2023200203A1 - 신규한 미생물 및 이를 포함하는 조성물 - Google Patents

신규한 미생물 및 이를 포함하는 조성물 Download PDF

Info

Publication number
WO2023200203A1
WO2023200203A1 PCT/KR2023/004816 KR2023004816W WO2023200203A1 WO 2023200203 A1 WO2023200203 A1 WO 2023200203A1 KR 2023004816 W KR2023004816 W KR 2023004816W WO 2023200203 A1 WO2023200203 A1 WO 2023200203A1
Authority
WO
WIPO (PCT)
Prior art keywords
strain
interleukin
expression
intestinal
genus
Prior art date
Application number
PCT/KR2023/004816
Other languages
English (en)
French (fr)
Inventor
고광표
김운기
민성규
Original Assignee
서울대학교산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 서울대학교산학협력단 filed Critical 서울대학교산학협력단
Publication of WO2023200203A1 publication Critical patent/WO2023200203A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/20—Bacteria; Culture media therefor
    • C12N1/205—Bacterial isolates
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L33/00—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • A23L33/135—Bacteria or derivatives thereof, e.g. probiotics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/66—Microorganisms or materials therefrom
    • A61K35/74—Bacteria
    • A61K35/741—Probiotics
    • A61K35/744—Lactic acid bacteria, e.g. enterococci, pediococci, lactococci, streptococci or leuconostocs
    • A61K35/747—Lactobacilli, e.g. L. acidophilus or L. brevis
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/20—Bacteria; Culture media therefor
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
    • C12R2001/07—Bacillus
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
    • C12R2001/225—Lactobacillus

Definitions

  • the present invention relates to novel Lactobacillus rhamnosus strains and compositions for improving, preventing, or treating intestinal diseases including the strains.
  • IBD Inflammatory bowel disease
  • UC ulcerative colitis
  • Crohn's disease is caused by Th1 (T helper type 1), such as an increase in pro-inflammatory cytokines such as interferon- ⁇ (IFN- ⁇ ) and tumor necrosis factor- ⁇ (TNF- ⁇ ).
  • Th1 Th1
  • IFN- ⁇ interferon- ⁇
  • TNF- ⁇ tumor necrosis factor- ⁇
  • Th2 T helper type 2-derived immune response, such as increased expression of Th17 cells and increased interleukin 13 (IL-13).
  • IBS irritable bowel syndrome
  • Urgency, abdominal distension, and a feeling of incomplete bowel movements are also common symptoms of IBS. Therefore, this disease is classified as a functional gastrointestinal disorder, including diseases such as functional bloating, non-cardiac chest pain, non-ulcer dyspepsia, and chronic constipation or diarrhea.
  • IBS has a huge impact on morbidity and quality of life beyond abdominal pain and discomfort, as the associated symptoms affect both the patient's well-being and normal functioning.
  • the purpose of the present invention is to provide live bacteria and compositions for improving intestinal health by utilizing the various activities and functionality of the novel Lactobacillus rhamnosus strain.
  • Lactobacillus rhamnosus KBL2290 strain accession number KCTC14875BP.
  • interleukin 1-beta IL-1 ⁇
  • interleukin 2 IL-2
  • interleukin 4 IL-4
  • interleukin 12p40 IL-12p40
  • interleukin 13 IL-13
  • interleukin A strain that suppresses the expression of 17A IL-17A
  • IL-10 interleukin 10
  • TGF- ⁇ transforming growth factor beta
  • a pharmaceutical composition for the prevention or treatment of inflammatory bowel disease comprising the strain of 1 above, a culture thereof, or an extract of the strain.
  • the inflammatory bowel disease is acute enteritis, ulcerative colitis, Crohn's disease, celiac disease, collagenous colitis, and intestinal leakage.
  • a pharmaceutical composition for preventing or treating one or more inflammatory bowel diseases selected from the group consisting of leaky gut syndrome and pseudomembranous colitis.
  • a pharmaceutical composition for preventing or treating functional gastrointestinal disorders comprising the strain of 1 above, a culture thereof, or an extract of the strain.
  • the functional gastrointestinal disorder includes irritable bowel syndrome, functional bloating, noncardiac chest pain, non-ulcer dyspepsia, A composition comprising at least one selected from the group consisting of chronic constipation and diarrhea.
  • the Lactobacillus rhamnosus KBL2290 strain of the present invention exhibits various activities such as improving intestinal flora, anti-inflammatory, and strengthening intestinal tight junctions. Accordingly, it can be preferably used as a pharmaceutical composition for intestinal diseases, health functional food to improve intestinal flora, etc.
  • Figure 1 analyzes the in vitro anti-inflammatory effect of Lactobacillus rhamnosus KBL2290 strain. This corresponds to the results of measuring the expression levels of IL-2, IFN- ⁇ , IL-10, IL-4, IL-13, and IL-17A depending on the presence or absence of treatment with the above strain.
  • Figure 2 analyzes the in vivo inflammatory bowel disease improvement effect of Lactobacillus rhamnosus KBL2290 strain. Specifically, Figure 2a shows the mRNA expression levels of CXCL-1, CCL-2, IL-1 ⁇ , IL-12p40, COX2, iNOS, TGF- ⁇ , FOXP3, and IL-10, and Figure 2b shows Zo-1, This corresponds to the mRNA expression level of Occludin.
  • Figure 3 analyzes the in vivo inflammatory bowel disease improvement effect of Lactobacillus rhamnosus KBL2290 strain. Specifically, it corresponds to showing the amounts of IFN ⁇ , IL-17A, TNF- ⁇ , and IL-6 proteins according to the presence or absence of treatment with the strain of the present invention.
  • Figure 4 analyzes the effect of Lactobacillus rhamnosus KBL2290 strain on improving intestinal flora. Specifically, Figures 4a and 4b show the results of analysis based on 16S rRNA, and Figures 4c and 4d show the distribution of intestinal flora according to the presence or absence of treatment with the strain of the present invention.
  • Figure 5 analyzes the effect of Lactobacillus rhamnosus KBL2290 strain on short-chain fatty acid production. Specifically, it corresponds to showing the production amount of acetate, butyrate, and propionate.
  • Figure 6 analyzes the effect of Lactobacillus rhamnosus KBL2290 strain on improving inflammatory bowel disease. Specifically, Figure 6a shows the change in body weight of mice due to acute enteritis, and Figure 6b shows the change in intestine length.
  • Figure 7 analyzes the effect of Lactobacillus rhamnosus KBL2290 strain on improving inflammatory bowel disease. Specifically, it corresponds to showing the results of hematoxylin&eosin (H&E) staining of the mouse colon according to the presence or absence of treatment with the above strain.
  • H&E hematoxylin&eosin
  • Figure 8 shows a comparative analysis of the in vitro anti-inflammatory effect of Lactobacillus rhamnosus KBL2290 strain with the commercial strain Lactobacillus rhamnosus GG (LGG) strain.
  • the present invention relates to the novel Lactobacillus rhamnosus KBL2290.
  • the strain was deposited at the Biological Resources Center (KCTC) on February 24, 2022, and the deposit number is KCTC14875BP.
  • KCTC Biological Resources Center
  • the strain can increase the intestinal flora of the genus Akkermansia , Lactobacillus , Ruminococcus , or Prevotella .
  • the strain contains interleukin 1 beta (IL-1 ⁇ ), interleukin 2 (IL-2), interleukin 4 (IL-4), interleukin 12p40 (IL-12p40), interleukin 13 (IL-13), or interleukin 17A (IL-17A). ) can reduce the expression of.
  • IL-1 ⁇ interleukin 1 beta
  • IL-2 interleukin 2
  • IL-4 interleukin 4
  • IL-12p40 interleukin 12p40
  • IL-13 interleukin 13
  • IL-17A interleukin 17A
  • the strain can reduce the expression of chemokine ligand 2 (CCL2) or chemokine ligand 1 (CXCL1).
  • CCL2 chemokine ligand 2
  • CXCL1 chemokine ligand 1
  • the strain can reduce the expression of cyclooxygenase 2 (Cox-2) or nitric oxide synthase (iNOS).
  • Cox-2 cyclooxygenase 2
  • iNOS nitric oxide synthase
  • the strain can increase the expression of interleukin 10 (IL-10) or transforming growth factor beta (TGF- ⁇ ).
  • IL-10 interleukin 10
  • TGF- ⁇ transforming growth factor beta
  • the strain can increase the expression of Zo-1 or Occludin.
  • the strain can exhibit strong resistance to high concentrations of bile salts and low acidity, pH 4.
  • the strain or its culture has several excellent activities. For example, it has the effect of suppressing the growth of harmful intestinal flora, promoting the growth of beneficial intestinal flora, anti-inflammatory effect, producing short-chain fatty acids, strengthening intestinal tight junctions, etc. Accordingly, the strain, its culture, or its extract can be used as a composition for preventing or treating inflammatory bowel disease, functional gastrointestinal disorder, leaky gut syndrome, and pseudomembranous colitis, and a probiotic composition for improving intestinal function and intestinal flora. You can.
  • the culture may contain the strain, or the strain may be an isolated culture.
  • the short-chain fatty acid production effect means that the strain of the present invention or its culture can produce short-chain fatty acid through decomposition of dietary fiber, and the short-chain fatty acid may include acetic acid, butyric acid, or propionic acid. You can.
  • These short-chain fatty acids can contribute to various processes related to intestinal homeostasis, such as epithelial cell differentiation, regulatory T cell stimulation, and improvement of mucosal inflammation, thereby resulting in preventive and alleviating effects on ulcerative colitis. Additionally, the above effect may be more significantly pronounced when the balance of normal bacterial flora is broken, such as when intestinal colitis is induced. However, it is not limited to this.
  • the intestinal tight junction generally refers to the formation of a solid defense membrane through tight junctions between cells in the intestinal epithelial cell layer.
  • the strain or culture thereof of the present invention is a protein involved in tight junctions, Zo- 1 Alternatively, intestinal tight junctions can be strengthened by increasing the expression level of Occludin. And this reinforcing effect can be more significant in cases where tight junctions are weakened due to intestinal leakage or inflammation. However, it is not limited to this.
  • the present invention relates to a composition containing Lactobacillus rhamnosus KBL2290 strain, its culture, or its extract.
  • the culture of the Lactobacillus rhamnosus strain may include a medium (solid, liquid, etc.) containing the strain, a medium (solid, liquid, etc.) from which the strain was isolated after culturing the strain, etc. there is.
  • the extract of the strain may be, for example, a lysate of the strain, and specifically may be a powder obtained by freeze-drying the lysate of the strain, or a solution or dispersion thereof.
  • the composition may be a pharmaceutical composition for preventing or treating inflammatory bowel disease.
  • Lactobacillus rhamnosus KBL2290 strain, its culture, or its extract has the effect of suppressing the expression of inflammatory cytokines both in vitro and in vivo , or increases the expression of anti-inflammatory cytokines. It can have an excellent anti-inflammatory effect.
  • the inhibitory or increasing effect may be due to transcriptional or post-transcriptional regulation of the factors at the transcription level, or may be due to translation or post-translational regulation of mRNA. However, it is not limited to this.
  • the inflammatory cytokines include IL-2, a Th1 inflammatory cytokine, IL-4 and IL-13, a Th2 inflammatory cytokine, and IL-17A, a Th17 (T helper 17) inflammatory cytokine. This inhibitory effect can suppress the immune response of Th1 and Th2 cells.
  • the inflammatory bowel disease corresponds to a gastrointestinal disease in which chronic inflammation repeats improvement and recurrence, for example, acute enteritis, ulcerative colitis, Crohn's disease, celiac disease, pseudomembranous colitis, collagenous enteritis, leaky gut syndrome, or Examples include, but are not limited to, pseudomembranous colitis.
  • the composition can suppress the inflammatory bowel disease by inhibiting the action of Th1, Th2 or Th17, which are known to cause the inflammatory bowel disease.
  • the composition may be a pharmaceutical composition for preventing or treating functional gastrointestinal disorders.
  • the functional gastrointestinal disorder corresponds to a chronic disease in which chronic gastrointestinal symptoms of unknown cause persist, for example, irritable bowel syndrome, functional bloating, non-cardiac chest pain, non-ulcer dyspepsia, chronic constipation and diarrhea, etc. It may be mentioned, but it is not limited to this.
  • the composition can inhibit the inflammatory bowel disease by inhibiting the actions of Th1, Th2, and Th17, which are known to cause the inflammatory bowel disease.
  • the present invention relates to a probiotic composition containing Lactobacillus rhamnosus KBL2290 strain.
  • the strain of the present invention has beneficial effects such as an effect of inhibiting the growth of harmful intestinal flora, an effect of promoting the growth of beneficial intestinal flora, an anti-inflammatory effect, a short-chain fatty acid production effect, or an effect of strengthening intestinal tight junctions, including the above-mentioned strains.
  • the composition may be used as a probiotic composition. More specifically, it may be used to improve the aforementioned inflammatory bowel disease or functional gastrointestinal disorders. However, it is not limited to this.
  • the present invention relates to a prebiotic composition
  • a prebiotic composition comprising Lactobacillus rhamnosus KBL2290 strain, strain extract, and culture of the strain. Extracts or cultures derived from the strain of the present invention can help improve the intestinal environment as a nutrient source that helps the growth of beneficial bacteria in the intestine.
  • the intestinal flora can be improved by reducing the distribution in the intestine or having no significant effect.
  • the above effect can be more pronounced when the distribution of harmful bacteria in the intestines is relatively increased due to intestinal diseases such as acute enteritis, ulcerative colitis, Crohn's disease, celiac disease, pseudomembranous colitis, collagenous enteritis, leaky gut syndrome, or pseudomembranous colitis.
  • intestinal diseases such as acute enteritis, ulcerative colitis, Crohn's disease, celiac disease, pseudomembranous colitis, collagenous enteritis, leaky gut syndrome, or pseudomembranous colitis.
  • intestinal diseases such as acute enteritis, ulcerative colitis, Crohn's disease, celiac disease, pseudomembranous colitis, collagenous enteritis, leaky gut syndrome, or pseudomembranous colitis.
  • intestinal diseases such as acute enteritis, ulcerative colitis, Crohn's disease, celiac disease, pseudomembranous colitis, collagenous enteritis, leaky gut syndrome, or pseudomembranous colitis.
  • composition of the present invention can be administered orally, parenterally, rectally, topically, transdermally, intravenously, intramuscularly, intraperitoneally, subcutaneously, etc.
  • Dosage forms for oral administration may be tablets, pills, soft and hard capsules, granules, powders, fine granules, solutions, emulsions or pellets, but are not limited thereto.
  • Formulations for parenteral administration may be solutions, suspensions, emulsions, gels, injections, drops, suppositories, patches, ointments, or sprays, but are not limited thereto.
  • the formulation can be easily prepared according to conventional methods in the field, and contains surfactants, excipients, wetting agents, emulsification accelerators, suspending agents, salts or buffers for adjusting osmotic pressure, colorants, flavorings, stabilizers, preservatives, preservatives or Other commonly used supplements may be additionally included.
  • the application amount or dosage of the composition of the present invention will vary depending on the age, gender, weight, pathological condition and severity of the subject to be administered, route of administration, or the judgment of the prescriber. Determination of the application amount based on these factors is within the level of those skilled in the art, and the daily administration dose of the active ingredient is, for example, 0.0001 ⁇ g/kg/day to 5000 mg/kg/day, more specifically 0.00001 mg/kg/day to 15 mg. It may be /kg/day, but is not limited thereto.
  • Lactobacillus rhamnosus KBL2290 strain was isolated from the intestinal flora of Koreans. The strain showed strong resistance to high concentrations of bile salts (2%) and low acidity, pH 4. The strain was cultured on Lactobacilli MRS Agar (BD Difco, Sparks, MD, USA) supplemented with 0.05% L-cysteine hydrochloride at 37°C for 24 hours under anaerobic conditions. The cells were collected by centrifugation at 3000 rpm and washed twice with 1 ⁇ phosphate-buffered saline (PBS). Bacterial concentration was measured using a culture method, and bacterial colonies containing 1 ⁇ PBS containing 20% glycerol were stored at -80°C until use.
  • PBS phosphate-buffered saline
  • BMDCs Mouse bone marrow-derived dendritic cells
  • DMEM medium Thermo Fisher Scientific, Inc., Waltham, MA, USA
  • penicillin/streptomycin 1% penicillin/streptomycin
  • FBS 1% penicillin/streptomycin
  • enterohemorrhagic Escherichia coli Escherichia coli O157:H7 EC4115 isolated from the intestines was added to each well with 5 ⁇ 10 6 cells based on the number of viable cells, and cultured at 37°C for 24 hours. After strain treatment, the supernatant of the cultured cells was obtained, the amount of TNF cytokine was measured using BD Mouse TNF (Mono/Mono) ELISA Set II (Thermo Fisher Scientific, 558534), and RNA was extracted from the cultured cells. For this purpose, easy-spin total RNA extraction kit (Intron) was used.
  • RNA-to-cDNA kit Thermo Fisher Scientific
  • gene expression level was analyzed using a roter-gene SYBR green PCR kit (Qiagen).
  • the primers in Table 1 below were used to target inflammatory cytokines and chemokines, anti-inflammatory cytokines, toll-like receptors, and immune checkpoint protein genes, and the expression level was corrected using the GAPDH housekeeping gene.
  • the expression of inflammatory cytokine TNF and toll-like receptor TLR2 in the KBL2290 strain treatment group was significantly lower than that of the LGG treatment group at the mRNA level, and the anti-inflammatory cytokines IL-10 and T
  • the expression of PD-L1 an immune checkpoint protein that reduces cell activity, was significantly higher than that in the LGG-treated group.
  • the inflammatory cytokine TNF was significantly lower than that of the LGG-treated group at the protein level.
  • the normal control group was supplied with drinking water without added DSS, and at the same time, the control group was orally administered 200 ⁇ L of PBS daily.
  • Mice belonging to the experimental group were cultured with the Lactobacillus rhamnosus KBL2290 strain in MRS liquid medium at 37°C under anaerobic conditions to reach the exponential phase, then removed the supernatant, diluted in PBS to 5x109 CFU/mL, and then fed with DSS from the start date. 200 ⁇ L was administered daily by oral gavage until the end of the experiment. DSS supply was stopped after 7 days, and on the 9th day after starting DSS supply, the experiment was terminated and the mice were necropsied.
  • RNAlater Thermo Fisher Scientific
  • Intron an easy-spin total RNA extraction kit
  • An equal amount of extracted RNA was immediately synthesized into cDNA using a high capacity RNA-to-cDNA kit (Thermo Fisher Scientific), and then the gene expression level was analyzed using a roter-gene SYBR green PCR kit (Qiagen).
  • the primers shown in Table 1 below were used to target inflammatory cytokines and chemokines, anti-inflammatory cytokines, and Zo-1 and Occludin, which are related to tight junctions between intestinal epithelial cells. Expressed as a GAPDH housekeeping gene. The amount was corrected.
  • Lactobacillus rhamnosus strain contributes to the improvement of inflammatory bowel disease in vivo through immune regulation that induces IL-1 ⁇ , IL-12p40, CCL2, CXCL1, IL-10, and TGF ⁇ production and regulatory T cell differentiation. it means.
  • mice feces were obtained at the end of the experiment in Example 2.2 and stored frozen at -80°C.
  • Total bacterial genomic DNA was extracted from the frozen sample according to the method of Example 1 above, and large-capacity sequence data was generated targeting the V4 region of the bacterial 16S rRNA gene.
  • the entire genetic information of intestinal bacteria was confirmed to determine the structure of the mouse fecal flora, and univariate analysis (LEfSE) was performed according to group.
  • Figure 4b shows the results of principal component analysis using weighted UniFrac distance of the intestinal flora analyzed based on 16S rRNA, and the PCA plot confirmed that the DSS positive control group had a very different intestinal flora structure from the normal control group. . Meanwhile, the KBL2290 administration group was confirmed to have an intestinal flora structure similar to that of the DSS positive control group and the normal control group. This suggests that administration of the KBL2290 strain changed the species that make up the intestinal flora and adjusted its structure.
  • Example 2.2 To confirm the ability of the Lactobacillus rhamnosus KBL2290 strain to induce short-chain fatty acid production, a cecal sample was obtained at the end of the experiment in Example 2.2, homogenized in distilled water, and centrifuged at 13,000 g for 5 minutes. The supernatant was collected, 1% 2-methylpentanoic acid was added to the supernatant as an internal standard, and ethyl ether was used as an extraction solvent. The organic layer of the sample was measured using an Agilent 7890A gas chromatograph (Agilent Technologies) under the following conditions: 1.5 kV capillary voltage, 600 L/h desolvation gas flow rate, 50 L/h cone gas flow rate, and 170 °C oven. temperature and 225 °C (flame ionization detector and injection port temperature). Nitrogen gas was used as a carrier gas. The retention time and peak area of the sample were confirmed using a standard mixture.
  • Agilent 7890A gas chromatograph Agilent
  • Example 3 Analysis of the effect of improving inflammatory bowel disease
  • mice were measured daily for 9 days during which enteritis caused by DSS was induced during the experiment in Example 2.2. Changes in mouse body weight due to acute enteritis were measured, and after completion of the experiment, mice were autopsied to measure changes in intestinal length.
  • the DSS control group showed a significant decrease in body weight compared to the normal control group, confirming the construction of a colitis mouse model. Meanwhile, it was confirmed that the KBL2290 administration group showed a significantly improved effect on weight loss compared to the DSS positive control group. Additionally, in Figure 6b, it was confirmed that the reduction in colon length in the KBL2290 administration group was significantly improved compared to the DSS control group.
  • H&E staining was performed to observe histopathological changes in the large intestine caused by administration of a single strain of Lactobacillus rhamnosus.
  • the distal segment of the large intestine was fixed in 10% neutral formalin solution, and paraffin tissue samples were sectioned at 5 ⁇ m thickness, stained with H&E reagent, and observed under an optical microscope.
  • the histological score of the distal segment was then examined using Panoramic Viewer (3DHISTECH, Ltd), and the histological score was calculated as follows: (1) epithelial loss, (2) intestinal crypt, and (3) goblet cells. A score of 0 to 12 was recorded for four categories: depletion and (4) inflammatory cell infiltration.
  • Lactobacillus rhamnosus KBL2290 the receipt of Lactobacillus rhamnosus KBL2290 and the translation of the receipt are attached.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Mycology (AREA)
  • Medicinal Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Microbiology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Veterinary Medicine (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Public Health (AREA)
  • Genetics & Genomics (AREA)
  • Biotechnology (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Engineering & Computer Science (AREA)
  • Virology (AREA)
  • Food Science & Technology (AREA)
  • Polymers & Plastics (AREA)
  • Molecular Biology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Epidemiology (AREA)
  • Nutrition Science (AREA)
  • Biochemistry (AREA)
  • Biomedical Technology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)

Abstract

본 발명은 신규한 락토바실러스 람노서스(Lactobacillus rhamnosus) KBL2290균주 및 이를 포함하는 조성물에 관한 것으로, 상기 균주는 장내 균총 개선, 항염, 장내 밀착연접 강화 등의 다양한 활성을 나타낸다. 이에, 장 관련 질환들에 대한 의약품 및 건강기능식품 등으로 바람직하게 활용될 수 있다.

Description

신규한 미생물 및 이를 포함하는 조성물
본 발명은 신규한 락토바실러스 람노서스 균주 및 균주를 포함하는 장 질환 개선, 예방 또는 치료용 조성물에 관한 것이다.
건강한 인체의 내부에는 인체의 세포 수보다 약 10배 많은 약 100조에 이르는 미생물이 공생하고 있다. 이들의 유전자 수는 인간의 100배가 넘으며, 장내 미생물총은 개인별, 병증별로 특이하게 구조화되어 있다. 건강한 장내 공생 미생물총은 인체 세포와 복잡한 상호 작용을 하며 물질 대사, 면역 반응의 조절을 통한 면역계 발달과 장내 항상성을 유지하는 등 다양한 기능을 수행한다.
프로바이오틱스(probiotics)는 장내 미생물 균형에 도움을 주는 항균 활성과 효소 활성을 가진 미생물 및 상기 미생물이 생산하는 생산물을 말하며, 특히 건조세포나 발효산물 형태로 사람이나 동물에 공급되어, 장내 균총을 개선하는 단일 또는 복합 균주 형태의 생균으로 정의된다. 락토바실러스(Lactobacillus) 종은 다양한 항균 물질들을 생산하는 균주들이 존재하기 때문에 매우 유용한 프로바이오틱스로 알려져 있다. 예를 들어, 락토바실러스 람노서스 등이 활용되고 있고, 상세 균주로는 락토바실러스 람노서스 GG 등이 있다.
염증성 장질환(inflammatory bowel disease, IBD)은 원인미상의 만성 염증이 호전과 재발을 반복하는 위장관계 질환으로, 궤양성 대장염(ulcerative colitis, UC)과 크론병(Chron's disease)이 대표적인 질환에 속한다. 크론병은 인터페론 감마(interferon-γ, IFN-γ)와 종양괴사인자 알파(tumor necrosis factor-α, TNF-α) 등 염증성 사이토카인(pro-inflammatory cytokine)의 증가와 같은 Th1(T helper type 1) 유래 면역 반응이 나타나며, 궤양성 대장염은 Th17 세포의 발현 증가와 더불어 인터루킨 13(interleukin 13, IL-13)의 증가 등의 Th2(T helper type 2) 유래 면역 반응을 보인다.
상기 염증성 장질환을 치료하기 위한 약물 개발 연구가 방대하게 수행되고 있으며, 최근 장내 균총의 조성의 불균형(dysbiosis)과 비정상적인 장내 면역 반응과의 상관관계가 밝혀졌다. 차세대 염기서열 분석 방법을 이용하여 염증성 장질환 및 궤양성 대장염 환자의 장내 균총을 분석한 결과, 건강한 정상인에 비해 환자군에서는 다양성이 감소하고 프로테오박테리아(Proteobacteria)가 우점하는 등 장내 균총의 불균형이 나타나며, 단쇄 지방산(short-chain fatty acid)을 생성과 관련이 있는 루미노코카시에이(Ruminococcaceae)와 라크노스피라시에이(Lachnospiracaea)가 감소하고 염증과 연관성을 보이는 장내 세균인 엔테로박테리아시에이(Enterobacteriaceae) 및 푸소박테리아시에이(Fusobacteriaceae)가 증가하는 특성을 보였다.
한편, 과민성 대장 증후군(irritable bowel syndrome, IBS)은 복통 및/또는 변화된 장 거동 또는 배변 습관과 관련된 불편함을 특징으로 하는 증상으로, 이러한 증상은 구조적 또는 생화학적 이상으로는 설명되지 않는다. 긴박뇨, 복부 팽만 및 불완전한 장 운동의 느낌 역시 IBS의 일반적 증상이다. 따라서, 이 질환은 기능성 팽만감, 비심장성 흉통, 비-궤양성 소화불량 및 만성적인 변비 또는 설사 등의 질환을 포함하는 기능성 위장 장애로 분류된다. 특히 IBS는 관련 증상이 환자의 안녕과 정상적인 기능성 측면 모두에 작용하기 때문에, 복통 및 불편함을 넘어 이환율과 삶의 질에 막대한 영향을 미친다.
그러나 염증성 장질환과 과민성 대장 증후군을 포함하는 장 건강 개선에 탁월한 효과를 보이는 균주는 아직 발견되지 않아, 관련 연구가 지속적으로 수행되고 있다.
본 발명은 신규한 락토바실러스 람노서스(Lactobacillus rhamnosus) 균주의 다양한 활성, 기능성 등을 활용한 장 건강 개선 용도의 생균 및 조성물 제공을 목적으로 한다.
1. 락토바실러스 람노서스(Lactobacillus rhamnosus) KBL2290 균주 (기탁번호 KCTC14875BP).
2. 위 1에 있어서, 아커만시아(Akkermansia) 속, 락토바실러스(Lactobacillus) 속, 루미노코커스(Ruminococcus) 속 또는 프레보텔라(Prevotella) 속의 장내 균총을 증가시키는 균주.
3. 위 1에 있어서, 인터루킨 1-베타(IL-1β), 인터루킨 2(IL-2), 인터루킨 4(IL-4), 인터루킨 12p40(IL-12p40), 인터루킨 13(IL-13) 또는 인터루킨 17A(IL-17A)의 발현을 억제하는 균주.
4. 위 3에 있어서, 키모카인 리간드2(CCL2) 또는 키모카인 리간드 1 (CXCL1)의 발현을 억제하는 균주.
5. 위 3에 있어서, cyclooxygenase 2(Cox-2) 또는 산화질소 합성효소(iNOS)의 발현을 억제하는 균주.
6. 위 3에 있어서, 인터루킨 10(IL-10) 또는 전환성장인자 베타(transforming growth factor-β, TGF-β)의 발현을 촉진하는 균주.
7. 위 1에 있어서, Zo-1 또는 Occludin의 발현을 증가시키는 균주.
8. 위 1의 균주, 그 배양물 또는 상기 균주의 추출물을 포함하는 염증성 장질환의 예방 또는 치료용 의약 조성물.
9. 위 8에 있어서, 상기 염증성 장질환은 급성 장염(acute enteritis), 궤양성 대장염(ulcerative colitis), 크론병(Chron's disease), 셀리악병(celiac disease, 교원성 대장염(collagenous colitis), 장누수 증후군(leaky gut syndrome) 및 위막성 대장염(pseudomembranous colitis)으로 이루어진 군에서 선택된 1종 이상인 염증성 장질환의 예방 또는 치료용 의약 조성물.
10. 위 1의 균주, 그 배양물 또는 상기 균주의 추출물을 포함하는 기능성 위장장애의 예방 또는 치료용 의약 조성물.
11. 위 10에 있어서, 상기 기능성 위장장애는 과민성 대장 증후군(irritable bowel syndrome), 기능성 팽만감(functional bloating), 비심장성 흉통(noncardiac chest pain), 비-궤양성 소화불량(non-ulcer dyspepsia), 만성적인 변비 및 설사로 이루어진 군에서 선택된 1 종 이상인 조성물.
12. 위 1의 균주, 그 배양물 또는 상기 균주의 추출물을 포함하는 프리바이오틱스 조성물.
13. 위 12에 있어서, 아커만시아(Akkermansia) 속, 락토바실러스(Lactobacillus) 속, 루미노코커스(Ruminococcus) 속 또는 프레보텔라(Prevotella) 속 중 적어도 하나 이상의 장내 균총 개선용인 프리바이오틱스 조성물.
본 발명의 락토바실러스 람노서스 KBL2290 균주는 장내 균총 개선, 항염증, 장내 밀착연접 강화 등의 다양한 활성을 나타낸다. 이에, 장내 질환용 의약 조성물, 장내 균총 개선을 위한 건강기능식품 등으로 바람직하게 활용될 수 있다.
도 1은 락토바실러스 람노서스 KBL2290 균주의 생체 외(in vitro) 항염증 효과를 분석한 것이다. 상기 균주 처리 유무에 따른 IL-2, IFN-γ, IL-10, IL-4, IL-13 및 IL-17A의 발현량을 측정한 결과에 해당한다.
도 2는 락토바실러스 람노서스 KBL2290 균주의 생체 내(in vivo) 염증성 장질환 개선 효과를 분석한 것이다. 구체적으로, 도 2a는 CXCL-1, CCL-2, IL-1β, IL-12p40, COX2, iNOS, TGF-β, FOXP3, IL-10의 mRNA 발현량을 나타낸 것이고, 도 2b는 Zo-1, Occludin의 mRNA 발현량을 나타낸 것에 해당한다.
도 3은 락토바실러스 람노서스 KBL2290 균주의 생체 내(in vivo) 염증성 장질환 개선 효과를 분석한 것이다. 구체적으로, 본 발명 균주 처리 유무에 따른 IFNγ, IL-17A, TNF-α 및 IL-6 단백질 양을 나타낸 것에 해당한다.
도 4는 락토바실러스 람노서스 KBL2290 균주의 장내 균총 개선 효과를 분석한 것이다. 구체적으로, 도 4a 및 4b는 16S rRNA에 기반한 분석 결과를 나타낸 것이고, 도 4c 및 4d는 본 발명의 균주 처리 유무에 따른 장 내 균총의 분포를 나타낸 것에 해당한다.
도 5는 락토바실러스 람노서스 KBL2290 균주의 단쇄 지방산 생성 효과를 분석한 것이다. 구체적으로, 아세트산(acetate), 부티르산(butyrate) 및 프로피온산(propionate)의 생성량을 나타낸 것에 해당한다.
도 6은 락토바실러스 람노서스 KBL2290 균주의 염증성 장질환 개선 효과를 분석한 것이다. 구체적으로, 도 6a는 급성 장염에 따른 마우스의 체중 변화를 나타낸 것이고, 도 6b는 장 길이 변화를 나타낸 것에 해당한다.
도 7은 락토바실러스 람노서스 KBL2290 균주의 염증성 장질환 개선 효과를 분석한 것이다. 구체적으로, 상기 균주 처리 유무에 따른 마우스 대장의 헤마톡실린&에오신(hematoxylin&eosin, H&E) 염색 수행 결과를 나타낸 것에 해당한다.
도 8은 락토바실러스 람노서스 KBL2290 균주의 생체 외 항염증 효과를 상업균주인 락토바실러스 람노서스 GG (Lactobacillus rhamnosus GG, LGG) 균주와 비교 분석한 것이다.
이하 본 발명을 상세히 설명한다. 특별한 정의가 없는 한 본 명세서의 모든 용어는 본 발명이 속하는 기술분야의 통상의 지식을 가진 기술자가 이해하는 당해 용어의 일반적인 의미와 동일하고 만약 본 명세서에 사용된 용어의 의미와 충돌하는 경우에는 본 명세서에 사용된 의미를 따른다.
본 발명은 신규한 락토바실러스 람노서스(Lactobacillus rhamnosus) KBL2290에 관한 것이다.
상기 균주는 생물자원센터(KCTC)에 2022년 02월 24일 자로 기탁되었고, 기탁번호는 기탁번호 KCTC14875BP 이다.
기탁기관명: 생물자원센터(KCTC)
수탁 번호: KCTC14875BP
수탁 일자: 2022년 03월 17일
상기 균주는 아커만시아(Akkermansia) 속, 락토바실러스(Lactobacillus) 속, 루미노코커스(Ruminococcus) 속 또는 프레보텔라(Prevotella) 속의 장내 균총을 증가시킬 수 있다.
상기 균주는 인터루킨 1 베타(IL-1β), 인터루킨 2(IL-2), 인터루킨 4 (IL-4), 인터루킨 12p40(IL-12p40), 인터루킨 13(IL-13) 또는 인터루킨 17A(IL-17A)의 발현을 감소시킬 수 있다.
상기 균주는 키모카인 리간드 2(CCL2) 또는 키모카인 리간드 1(CXCL1)의 발현을 감소시킬 수 있다.
상기 균주는 cyclooxygenase 2(Cox-2) 또는 산화질소 합성효소(iNOS)의 발현을 감소시킬 수 있다.
상기 균주는 인터루킨 10(IL-10) 또는 전환성장인자 베타(TGF-β)의 발현을 증가시킬 수 있다.
상기 균주는 Zo-1 또는 Occludin의 발현을 증가시킬 수 있다.
상기 균주는 고농도의 담즙 염 및 낮은 산도인 pH 4에서 강한 저항성을 나타낼 수 있다.
상기 균주 또는 그 배양물은 여러 우수한 활성을 가진다. 예를 들어, 장내 유해 균총 성장 억제 효과, 장내 유익 균총 성장 촉진 효과, 항염증 효과, 단쇄 지방산 생성 효과, 장내 밀착 연접 강화 효과 등이다. 이에, 상기 균주, 그 배양물 또는 이의 추출물은 염증성 장질환, 기능성 위장장애, 장누수증후군, 위막성 대장염에 대한 예방 또는 치료용 조성물, 장 기능 개선 및 장내 균총 개선을 위한 프로바이오틱스 조성물 등으로 활용될 수 있다. 상기 배양물은 상기 균주를 포함한 것이거나, 균주는 분리해낸 배양물일 수 있다.
상기 단쇄 지방산 생성 효과는 본 발명의 균주 또는 그 배양물이 식이섬유 분해를 통해 단쇄 지방산(short-chain fatty acid)을 생성할 수 있는 것을 의미하고, 상기 단쇄 지방산은 아세트산, 부티르산 또는 프로피온산을 포함할 수 있다. 이들 단쇄 지방산은 장 항상성과 관련된 상피 세포 분화, 조절 T 세포 자극 및 점막 염증의 개선과 같은 다양한 과정에 기여함으로써 궤양성 대장염 예방 및 완화 효과를 가져올 수 있다. 또한 상기 효과는 장내 대장염이 유발된 경우 등 정상세균총의 균형이 깨진 경우에 더욱 유의미하게 두드러질 수 있다. 다만, 이에 제한되지 않는다.
상기 장내 밀착 연접은 일반적으로 장내 상피세포 층에서 세포 간 밀착연접(tight junction)을 통해 단단한 방어막을 형성하는 것을 의미하는 것으로서, 본 발명의 균주 또는 그 배양물은 밀착연접에 관여하는 단백질인 Zo-1 또는 Occludin의 발현량을 증가시킴으로써 장내 밀착 연접을 강화시킬 수도 있다. 그리고 이러한 강화 효과는 장 내 누수가 생기거나, 염증이 발생하는 등으로 밀착연접이 약화되는 경우 등에서 더욱 유의미하게 두드러질 수 있다. 다만, 이에 제한되지 않는다.
또한, 본 발명은 락토바실러스 람노서스(Lactobacillus rhamnosus) KBL2290 균주, 그 배양물 또는 그 추출물을 포함하는 조성물에 관한 것이다.
락토바실러스 람노서스(Lactobacillus rhamnosus) 균주의 배양물은 상기 균주를 포함하는 배지(고체, 액체 등), 상기 균주를 배양하고 난 후, 균주가 분리된 배지(고체, 액체 등) 등을 포함할 수 있다.
상기 균주의 추출물은 예를 들면, 균주의 파쇄물일 수 있으며, 구체적으로 균주의 파쇄물을 동결건조하여 얻어진 분말 또는 이의 용액 또는 분산액일 수 있다.
상기 조성물은 염증성 장질환의 예방 또는 치료용 의약 조성물일 수 있다.
락토바실러스 람노서스 KBL2290 균주, 그 배양물 또는 그 추출물은 생체 외(in vitro) 및 생체 내(in vivo) 모두에서 염증성 사이토카인의 발현을 억제하는 효과를 가지고 있거나, 항 염증성 사이토카인의 발현을 증가시키는 효과를 가져, 우수한 항염증 효과를 나타낼 수 있다. 상기 억제 또는 증가 효과는 전사 수준에서 상기 인자들의 전사 또는 전사 후 조절(post-transcriptional regulation)에 의한 것일 수 있고, 또는 mRNA의 번역 또는 번역 후 조절(post-translational regulation)에 의한 것일 수도 있다. 다만 이에 제한되지 않는다. 상기 염증성 사이토카인은 Th1의 염증성 사이토카인인 IL-2, Th2의 염증성 사이토카인인 IL-4 및 IL-13, 그리고 Th17(T helper 17)의 염증성 사이토카인인 IL-17A을 포함한다. 이러한 억제 효과는 Th1, Th2 세포의 면역반응을 억제할 수 있다.
상기 염증성 장질환은 만성 염증이 호전과 재발을 반복하는 위장관계 질환에 해당하고, 예를 들면, 급성 장염, 궤양성 대장염, 크론병, 셀리악병, 위막성 대장염, 교원성 장염, 장누수증후군 또는 위막성 대장염 등을 들 수 있으나, 이에 제한되는 것은 아니다. 상기 조성물은 상기 염증성 장질환을 유발하는 것으로 알려진 Th1, Th2 또는 Th17의 작용을 억제하여, 본 염증성 장질환을 억제할 수 있다.
또한, 상기 조성물은 기능성 위장장애의 예방 또는 치료용 의약 조성물일 수 있다. 상기 기능성 위장장애는 원인 미상의 만성적인 위장관 증상이 지속되는 만성 질환에 해당하고, 예를 들면, 과민성 대장증후군, 기능성 팽만감, 비심장성 흉통, 비-궤양성 소화불량, 만성적인 변비 및 설사 등을 들 수 있으나, 이에 제한되는 것은 아니다. 상기 조성물은 상기 염증성 장질환을 유발하는 것으로 알려진 Th1, Th2 및 Th17의 작용을 억제하여, 본 염증성 장질환을 억제할 수 있다.
또한, 본 발명은 락토바실러스 람노서스 KBL2290 균주를 포함하는 프로바이오틱스 조성물에 관한 것이다. 앞서 언급한 대로, 본 발명의 균주는 장내 유해 균총 성장 억제 효과, 장내 유익 균총 성장 촉진 효과, 항염증 효과, 단쇄 지방산 생성 효과 또는 장내 밀착 연접 강화 효과 등의 유익한 효과를 가지는 바, 상기 균주를 포함하는 조성물을 프로바이오틱스 조성물로서 사용될 수 있다. 보다 구체적으로, 앞서 언급한 염증성 장질환 또는 기능성 위장장애의 개선 용도로 사용될 수도 있다. 다만, 이에 제한되지 않는다.
또한, 본 발명은 락토바실러스 람노서스 KBL2290 균주, 균주 추출물 및 그 균주 배양물을 포함하는 프리바이오틱스 조성물에 관한 것이다. 본 발명의 균주 균주에서 유래한 추출물 또는 배양물은 장 내 유익한 박테리아의 생장을 돕는 영양원으로서 장 내 환경을 개선하는데 도움을 줄 수 있다. 보다 구체적으로, 장내 유익균에 속하는 균주, 예를 들면 상기 아커만시아 속, 락토바실러스 속, 루미노코커스 속, 프레보텔라 속 등의 장내 분포를 증가시키면서, 다양한 유해균(스타필로코커스 속(Staphylococcus), 스트렙토코커스 속(streptococcus), 엔테로코커스(enterococcus) 속 등)이나 그 외 세균들에 대해서는 장내 분포를 감소시키거나 별다른 영향을 미치지 않음으로써 장내 균총을 개선할 수 있다. 상기 효과는 급성 장염, 궤양성 대장염, 크론병, 셀리악병, 위막성 대장염, 교원성 장염, 장누수증후군 또는 위막성 대장염 등 장내 질환으로 인하여 장내 유해균의 분포가 상대적으로 증가한 경우에 더욱 두드러질 수 있다. 예를 들면, 유해균에 속하는 박테로이데스(Bacteroides) 속 및 장염을 일으킬 수 있다고 알려진 무시스피릴룸(Mucislpirillum)이 전체 장내 균총 수 대비 40%, 50%, 60%, 70% 등으로 포함되는 경우에, 본 발명의 상기 조성물을 처리하는 경우 장내 유해균의 분포를 감소시키면서, 상기 장내 유익균의 분포를 증가시킬 수 있다. 다만, 이에 제한되지 않는다.
본 발명의 조성물은 경구, 비경구, 직장, 국소, 경피, 정맥 내, 근육 내, 복강 내, 피하 등으로 투여될 수 있다. 경구 투여를 위한 제형은 정제, 환제, 연질 및 경질 캅셀제, 과립제, 산제, 세립제, 액제, 유탁제 또는 펠렛제일 수 있으나, 이에 제한되는 것은 아니다. 비경구 투여를 위한 제형은 용액제, 현탁제, 유액제, 겔, 주사제, 점적제, 좌제(坐劑), 패치, 연고제 또는 분무제일 수 있으나, 이에 제한되는 것은 아니다. 상기 제형은 당해 분야의 통상적인 방법에 따라 용이하게 제조될 수 있으며, 계면 활성제, 부형제, 수화제, 유화 촉진제, 현탁제, 삼투압 조절을 위한 염 또는 완충제, 착색제, 향신료, 안정화제, 방부제, 보존제 또는 기타 상용하는 보조제를 추가로 포함할 수 있다.
본 발명의 조성물의 적용량 또는 투여량은 투여 받을 대상의 연령, 성별, 체중, 병리 상태 및 그 심각도, 투여 경로 또는 처방자의 판단에 따라 달라질 것이다. 이러한 인자에 기초한 적용량 결정은 당업자의 수준 내에 있으며, 유효성분의 1일 투여 용량은 예를 들어 0.0001μg/kg/일 내지 5000mg/kg/일, 보다 구체적으로는 0.00001mg/kg/일 내지 15 mg/kg/일이 될 수 있으나, 이에 제한되는 것은 아니다.
이하, 본 발명을 구체적으로 설명하기 위해 실시예를 들어 상세하게 설명하기로 한다.
실시예 1. 락토바실러스 람노서스 균주의 분리
한국인의 장내 균총에서 락토바실러스 람노서스(Lactobacillus rhamnosus) KBL2290 균주를 분리하였다. 해당 균주는 고농도의 담즙 염(2%) 및 낮은 산도인 pH 4에서 강한 저항성을 나타냈다. 상기 균주를 혐기성 조건에서 24시간 동안 37 ℃에서 0.05% L-cysteine hydrochloride를 첨가한 Lactobacilli MRS Agar(BD Difco, Sparks, MD, USA)에서 배양하였다. 균체를 3000rpm에서 원심 분리하여 수집하였으며 1Х인산염 완충 식염수(PBS, Phosphate-buffered saline)로 2회 세척하였다. 배양법을 이용하여 세균 농도를 측정하였고, 20% 글리세롤이 포함된 1Х PBS를 함유한 세균 군락을 사용 전까지 -80 ℃에서 보관하였다.
실시예 2. 락토바실러스 람노서스 균주의 균학적 특성 분석
2.1. 항염증 효과 분석
본 발명의 균주의 면역조절효과 확인을 위해 생체 외 실험을 진행하였다. 인간 유래 PBMC(Zen-Bio, Inc.)를 1%의 페니실린/스트렙토마이신, 1%의 젠타마이신 및 10%의 FBS를 함유한 RPMI-1640 배지(Gibco, Paisley UK)에서 배양하였다. 배양된 PBMC(2Х105 cells)를 96-well plate에 넣고 T 세포를 활성화시키는 항 CD3 항체를 1μg/mL(OKT3; Thermo Fisher Scientific, Inc.)로 처리한 후 1:100 비율의 본 발명의 균주 혹은 대장균을 첨가하여 37 ℃에서 72시간을 배양하였다. 균주 처리 후 배양된 PBMC 세포의 상층액만을 수득하여 각 사이토카인의 양을 측정하였다.
그 결과 도 1에서, KBL2290 균주 처리군(CD3/KBL2290)에서 Th1의 염증성 사이토카인인 IL-2, Th2의 염증성 사이토카인인 IL-4 및 IL-13, 그리고 Th17의 염증성 사이토카인인 IL-17A의 발현이 대장균 처리군(CD3/E.coli) 및 PBS 처리군 (CD3/PBS)에 비해 현저히 낮게 유지되는 것을 확인하였다
2.1.2 항염증 효과 분석 ( in vitro )
본 발명의 균주의 면역조절효과 확인을 위해 생체 외 실험을 진행하였다. 마우스 골수 유래 수지상세포(BMDC)를 1%의 페니실린/스트렙토마이신 및 10%의 FBS를 함유한 DMEM 배지 (Thermo Fisher Scientific, Inc., Waltham, MA, USA)에서 배양하였다. 배양된 BMDC (2.5Х105 cell)를 48-well plate에 넣고 1:20 비율의 본 발명의 균주를 첨가하였다. 대조군으로는 장 내에서 분리한 장출혈성 대장균 (Escherichia coli O157:H7 EC4115)을 생균수 기준으로 각 well에 5Х106 cell씩 넣고 37 ℃에서 24시간을 배양하였다. 균주 처리 후 배양된 세포의 상층액을 수득, BD Mouse TNF (Mono/Mono) ELISA Set Ⅱ (Thermo Fisher Scientific, 558534)를 이용하여 TNF 사이토카인의 양을 측정하였고, 배양된 세포에서 RNA를 추출하기 위하여 easy-spin total RNA extraction kit (Intron)을 사용하였다. 추출한 RNA는 즉시 동량으로 high capacity RNA-to-cDNA kit (Thermo Fisher Scientific)를 사용하여 cDNA로 합성시킨 후 roter-gene SYBR green PCR kit (Qiagen)를 사용하여 유전자 발현량을 분석하였다. 염증성 사이토카인 및 케모카인, 항염증 사이토카인과 톨유사수용체, 면역관문 단백질 유전자를 타겟으로 아래 표 1의 프라이머를 이용하였으며, GAPDH 항존유전자 (housekeeping gene)로 발현량을 보정하였다.
그 결과 도 8에서 나타난 바와 같이, KBL2290 균주 처리군에서 염증성 사이토카인 TNF, 톨유사수용체 TLR2의 발현이 mRNA 수준에서 LGG 처리군에 비해 현저히 적게 나타났으며, 항염증 사이토카인인 IL-10과 T세포 활성을 낮추는 면역관문 단백질인 PD-L1의 발현이 LGG 처리군에 비해 현저히 높게 나타났다. 또한, 염증성 사이토카인 TNF가 단백질 수준에서 LGG 처리군에 비해 현저히 낮게 나타났다.
2.2. 항염증 효과 및 밀착연접 강화 효과 분석
본 발명의 균주의 단일 균주 투여에 의한 생체 내 항염증 효과 및 밀착연접 강화 효과 분석을 위하여 동물 실험을 실시하였다(서울대학교 IACUC 승인번호: SNU-160602-9). 구체적으로, 대장염 마우스 모델을 구축하기 위하여 C57BL/6 7~8주령 암컷 마우스를 각 8마리의 군집으로 구분한 후 12시간의 명암 주기 전환 설정 및 항온항습기가 설치된 케이지에 두었으며, 식수와 먹이에 자유롭게 접근 가능하도록 하였다. 대장염을 유도하기 위해 2% 덱스트란 황산 나트륨(dextran sulfate sodium, DSS, MP Biomedicals)을 식수에 용해하여 총 7일간 공급하였다. 정상 대조군으로는 DSS가 첨가되지 않은 식수를 공급하였으며, 이와 동시에 대조군에는 PBS를 매일 200μL씩 경구 투여하였다. 실험군에 속하는 마우스는 락토바실러스 람노서스 KBL2290 균주를 각각 MRS 액체 배지에서 지수기에 도달하도록 37℃, 혐기 조건에서 배양 후 상층액을 제거하고 PBS에 5x109 CFU/mL이 되도록 희석시킨 후 DSS 공급 개시일부터 실험 종료시까지 매일 200μL씩 경구 위관 영양법으로 투여하였다. DSS 공급은 7일 후 중단하였으며, DSS 공급 개시 9일째 되는 날 실험을 종료하고 마우스를 부검하였다.
2.2.1. mRNA 발현량 분석
실험 종료시 마우스의 장 조직을 수득하여 일부 결장 샘플은 RNAlater (Thermo Fisher Scientific) 용액에 보존하여 -80 ℃에 냉동보관 하였으며, RNA를 추출하기 위하여 easy-spin total RNA extraction kit(Intron)을 사용하였다. 추출한 RNA는 즉시 동량으로 high capacity RNA-to-cDNA kit(Thermo Fisher Scientific)를 사용하여 cDNA로 합성시킨 후 roter-gene SYBR green PCR kit(Qiagen)를 사용하여 유전자 발현량을 분석하였다. 염증성 사이토카인 및 케모카인, 항염증 사이토카인과 장 상피세포간 밀착연접(tight junction)과 관련된 Zo-1, Occludin를 타겟으로 하여 아래 표 1의 프라이머를 이용하였으며, GAPDH 항존유전자(housekeeping gene)로 발현량을 보정하였다.
타겟 서열 서열 번호
ZO-1 Fw: 5'-ACCCGAAACTGATGCTGTGGATAG-3' 1
Rv: 5'-AAATGGCCGGGCAGAACTTGTGTA-3' 2
Occludin Fw: 5'-ATGTCCGGCCGATGCTCTC-3' 3
Rv: 5'-TTTGGCTGCTCTTGGGTCTGTAT-3' 4
COX2 Fw: 5'- CACCCTGACATAGACAGTGAAAG-3' 5
Rv: 5'- CTGGGTCACGTTGGATGAGG-3' 6
CCL2 Fw: 5'- AGGTCCCTGTCATGCTTCTG-3' 7
Rv: 5'- TCTGGACCCATTCCTTCTTG-3' 8
CXCL1 Fw: 5'- TTGTGCGAAAAGAAGTGCAG -3' 9
Rv: 5'- TACAAACACAGCCTCCCACA -3' 10
IL-12p40 Fw: 5'- GGAAGCACGGCAGCAGAATAA -3' 11
Rv: 5'- CTTGAGGGAGAAGTAGGAATG -3' 12
IL-1β Fw: 5'- GAAATGCCACCTTTTGACAGTG -3' 13
Rv: 5'- CTGGATGCTCTCATCAGGACA -3' 14
iNOS Fw: 5'- TTTGCTTCCATGCTAATGCGAAAG -3' 15
Rv: 5'- GCTCTGTTGAGGTCTAAAGGCTCC G -3' 16
FOXP3 Fw: 5'- CCCATCCCCAGGAGTCTTG -3' 17
Rv: 5'- CCATGACTAGGGGCACTGTA -3' 18
TGFβ Fw: 5'- GAAGGCAGAGTTCAGGGTCTT-3' 19
Rv: 5'- GGTTCCTGTCTTTGTGGTGAA -3' 20
IL-10 Fw: 5'- TCATTTCCGATAAGGCTTGG -3' 21
Rv: 5'- ATAACTGCACCCACTTCCCA -3' 22
TNF Fw: 5'- GCCACCACGCTCTTCTGCCT -3' 23
Rv: 5'- GGCTGATGGTGTGGGTGAGG -3' 24
TLR2 Fw: 5'- TCTAAAGTCGATCCGCGACAT -3' 25
Rv: 5'- CTACGGGCAGTGGTGAAAACT -3' 26
PD-L1 Fw: 5'- TGCTGCATAATCAGCTACGG -3' 27
Rv: 5'- GCTGGTCACATTGAGAAGCA -3' 28
GAPDH Fw: 5'- CTACAGCAACAGGGTGGTGG - 3' 29
Rv: 5'- TATGGGGGTCTGGGATGG - 3' 30
그 결과 도 2a에서, DSS 양성 대조군에 비해 KBL2290 투여군에서 염증성 사이토카인 IL-1β, IL-12p40와 염증성 케모카인 CCL2, CXCL1, 그리고 염증성 마커인 COX2, iNOS가 유의미하게 감소하였고, 항염증 사이토카인인 IL-10, TGFβ 유전자 및 조절 T 세포 분화를 유도하는 FOXP3의 발현량이 유의하게 증가하였다.
이는 상기 락토바실러스 람노서스 균주가 IL-1β, IL-12p40, CCL2, CXCL1, IL-10, TGFβ 생성과 조절 T 세포 분화를 유도하는 면역 조절을 통해 생체 내 염증성 장질환 개선 효과에 기여하고 있음을 의미한다.
한편 도 2b에서, 장 상피세포간 밀착연접과 관련된 Zo-1과 Occludin의 경우 정상 대조군에 비해 DSS 양성 대조군에서 두 유전자 모두 유의한 발현량 감소를 보였고, DSS 양성 대조군에 비교하여 KBL2290 투여군은 두 유전자 모두 발현량이 유의하게 증가하였다. 이는 상기 균주 투여가 Zo-1과 Occludin의 발현량을 증가시켜 장 상피세포간 밀착연접을 강화하여 생체 내 염증성 장질환 완화에 도움을 주었음을 의미한다.
2.2.2. 단백질 발현량 분석
조직의 면역세포 분석을 위해 나머지 일부 결장 샘플은 1ХRIPA 완충액 (Thermo Fisher Scientific) 및 Halt Protease Inhibitor Cocktail(Thermo Fisher Scientific)에서 MM 400 Mixer Mill homogenizer(Retsch, GmbH)를 이용하여 균질화한 후 원심 분리(4℃에서 15,000g에서 10 분 동안)하여 상청액을 수집하였다. IFN-γ, IL-6, IL-17A 및 종양 괴사 인자를 포함한 사이토카인을 BD 세포 측정 비드 어레이 마우스 Th1/Th2/Th17 사이토카인 키트(BD cytometric bead array mouse Th1/Th2/Th17 cytokine kit, BD Biosciences)를 사용하여 제조업체의 지침에 따라 측정하였다.
그 결과 도 3에서, IFN-γ, IL-17A, IL-6 및 TNF-α와 같은 주요 염증성 사이토카인들이 락토바실러스 람노서스 KBL2290 투여군에서 DSS 양성 대조군에 비해 유의하게 감소됨을 확인하였다.
2.3. 장내 균총 개선 효과
DSS로 인한 대장염과 단일 균주의 정착(colonization)이 유도하는 장내 균총의 변화를 분석하기 위하여 상기 실시예 2.2의 실험 종료 시 마우스의 분변을 수득하여 -80 ℃에 냉동보관 하였다. 냉동 보관된 시료는 상기 실시예 1의 방법을 따라 총 박테리아 genomic DNA를 추출 및 박테리아의 16S rRNA 유전자의 V4 영역을 타겟으로 대용량 염기서열 데이터를 생성하였다. QIIME pipeline을 사용하여 장내 세균의 전체 유전정보를 확인하여 마우스 분변 내 균총의 구조를 파악하였으며, 그룹에 따른 단변량 분석(LEfSE)을 실시하였다.
그 결과 도 4a에서, 16S rRNA에 기반하여 분석된 장 내 균총을 그룹에 따라 장 내 균총의 다양성 변화를 4가지 alpha diversity 지표로 확인한 결과를 나타냈으며, DSS 양성 대조군의 경우 정상 대조군보다 장 내 균총의 다양성이 유의하게 감소함을 확인하였다. 이는 DSS로 인한 급성 장염에 따라, 유익균의 다양성의 감소 및 잠재적인 유해균의 우점으로 인해, 장 건강에 부정적인 영향을 미칠 수 있음을 시사한다. 한편 KBL2290 투여군에서 DSS 양성 대조군에 비해 장 내 균총의 다양성이 유의하게 증가했음을 확인하였다. 이는 KBL2290 균주 투여가 장 내 균총의 다양성을 회복시켜 장 건강에 긍정적인 영향을 미칠 수 있음을 시사한다.
도 4b에서 16S rRNA에 기반하여 분석된 장 내 균총의 weighted UniFrac distance를 통한 주성분 분석을 실시한 결과를 나타냈으며, PCA plot을 통해 DSS 양성 대조군이 정상 대조군과 매우 다른 장 내 균총 구조를 지닌 것을 확인하였다. 한편 KBL2290 투여군은 DSS 양성 대조군이 정상 대조군 사이의 장 내 균총 구조를 지닌 것을 확인하였다. 이는 KBL2290 균주 투여가 장 내 균총을 구성하고 있는 종을 변화시켜 그 구조를 조절하였음을 시사한다.
도 4c 및 4d에서 어떤 장 내 균총이 달라졌는지 분석하기 위하여 단변량 분석(LEfSE)을 실시하였다. DSS 양성 대조군에서는 박테로이데스(Bacteroides) 속과 장염을 일으킬 수 있다고 알려진 무시스피릴룸(Mucislpirillum) 속의 우점을 확인하였다. 한편, KBL2290 투여군에서는 아커만시아(Akkermansia), 락토바실러스(Lactobacillus), 루미노코커스(Ruminococcus) 및 프레보텔라(Prevotella)의 증가를 확인하였다. 이는 KBL2290 균주 투여가 이러한 장내 균총을 변화시켜 대장염 완화에 도움을 주었음을 의미한다.
2.4. 단쇄 지방산 생성 효과 분석( in vivo )
락토바실러스 람노서스 KBL2290 균주의 단쇄 지방산 생성 유도 능력을 확인하기 위해 실시예 2.2의 실험 종료 시 맹장 샘플을 수득하여 증류수에서 균질화하고, 5 분 동안 13,000g에서 원심 분리하였다. 상청액을 수집하고 1%의 2-메틸펜탄산을 내부 표준 물질로 상청액에 첨가하였고, 추출 용매로는 에틸 에테르를 사용하였다. 샘플의 유기층은 Agilent 7890A 가스 크로마토그래프(Agilent Technologies)를 사용하여 다음 조건에서 측정하였다: 1.5 kV 모세관 전압, 600 L/h 탈용매 가스 유량, 50 L/h 콘(cone) 가스 유량, 170 ℃오븐 온도 및 225 ℃(불꽃 이온화 검출기 및 주입 포트 온도). 질소 가스를 캐리어(carrier) 가스로 사용하였다. 샘플의 머무름 시간과 피크 면적은 표준 혼합물을 사용하여 확인하였다.
그 결과 도 5에서, 아세트산, 부티르산 및 프로피온산 과 같은 주요 미생물 대사 산물인 단쇄 지방산(short chain fatty acid, SCFA)이 균주를 투여한 DSS+ KBL2290 군에서 유의하게 증가하는 것을 확인하였다. 이들 단쇄 지방산은 장 항상성과 관련된 상피 세포 분화, 조절 T 세포 자극 및 점막 염증의 개선과 같은 다양한 과정에 기여함으로써 궤양성 대장염 예방 및 완화 효과를 가져올 수 있다.
실시예 3. 염증성 장질환 개선 효과 분석
락토바실러스 람노서스 KBL2290 균주의 단일 균주 투여에 의한 생체 내 염증성 장질환 개선 효과가 있는지 규명하기 위하여 상기 실시예 2.2의 실험 중 DSS로 인한 장염이 유발되는 9일 동안 대조군 및 실험군 마우스의 체중 변화를 매일 측정하여 급성 장염에 따른 마우스 체중의 변화를 측정하고, 실험 종료 후 마우스를 부검하여 장 길이 변화를 측정하였다.
그 결과 도 6a에서, 정상 대조군에 비해 DSS 대조군은 유의한 체중의 감소가 나타나 대장염 마우스 모델의 구축을 확인하였다. 한편, KBL2290 투여군이 DSS 양성 대조군에 비해 체중 감소에 있어 유의하게 개선된 효과를 보이는 것을 확인하였다. 또한 도 6b에서, KBL2290 투여군이 DSS 대조군에 비해 대장 길이 감소 폭이 현저히 개선된 것을 확인하였다.
또한 락토바실러스 람노서스 단일 균주 투여로 인한 대장의 조직병리학적 변화를 관찰하기 위한 헤마톡실린&에오신(hematoxylin&Eosin, H&E) 염색을 실시하였다. 부검 후 대장의 원위 분절을 10% 중성 포르말린 용액에 고정시킨 후 파라핀 조직표본을 5μm 두께로 절편 후 H&E 시약으로 염색하고 광학 현미경으로 관찰하였다. 이후 원위 분절의 조직학적 점수를 Panoramic Viewer(3DHISTECH, Ltd)를 사용하여 검사하였고, 조직학적 점수는 다음 (1) 상피 손실, (2) intestinal crypt(창자움) (3) 배상(goblet) 세포의 고갈(depletion), (4) 염증 세포 침윤의 4개 카테고리에 대해서 0점부터 12점까지 기록하였다.
그 결과 도 7에서, DSS 양성 대조군에서 정상 대조군에 비해 대장 조직내 염증 세포들의 침윤 및 점막층 조직의 현저한 파괴를 관찰하였다. 반면 락토바실러스 람노서스 KBL2290 투여군이 DSS 양성 대조군에 비해 염증이 완화되었음을 조직학적으로 확인할 수 있었다.
아래에 락토바실러스 람노서스 KBL2290 수탁증 및 수탁증의 번역문을 첨부하였다.
Figure PCTKR2023004816-appb-img-000001
Figure PCTKR2023004816-appb-img-000002

Claims (13)

  1. 락토바실러스 람노서스(Lactobacillus rhamnosus) KBL2290균주 (기탁번호 KCTC14875BP).
  2. 청구항 1에 있어서, 아커만시아(Akkermansia) 속, 락토바실러스(Lactobacillus) 속, 루미노코커스(Ruminococcus) 속 또는 프레보텔라(Prevotella) 속의 장내 균총을 증가시키는 균주.
  3. 청구항 1에 있어서, 인터루킨 1-베타(IL-1β), 인터루킨 2(IL-2), 인터루킨 4(IL-4), 인터루킨 12p40(IL-12p40), 인터루킨 13(IL-13) 또는 인터루킨 17A(IL-17A)의 발현을 억제하는 균주.
  4. 청구항 3에 있어서, 키모카인 리간드2(CCL2) 또는 키모카인 리간드 1 (CXCL1)의 발현을 억제하는 균주.
  5. 청구항 3에 있어서, cyclooxygenase 2(Cox-2) 또는 산화질소 합성효소(iNOS)의 발현을 억제하는 균주.
  6. 청구항 3에 있어서, 인터루킨 10(IL-10) 또는 전환성장인자 베타(transforming growth factor-β, TGF-β)의 발현을 촉진하는 균주.
  7. 청구항 1에 있어서, Zo-1 또는 Occludin의 발현을 증가시키는 균주.
  8. 청구항 1의 균주, 그 배양물 또는 상기 균주의 추출물을 포함하는 염증성 장질환의 예방 또는 치료용 의약 조성물.
  9. 청구항 8에 있어서, 상기 염증성 장질환은 급성 장염(acute enteritis), 궤양성 대장염(ulcerative colitis), 크론병(Chron's disease), 셀리악병(celiac disease, 교원성 대장염(collagenous colitis), 장누수 증후군(leaky gut syndrome) 및 위막성 대장염(pseudomembranous colitis)으로 이루어진 군에서 선택된 1종 이상인 염증성 장질환의 예방 또는 치료용 의약 조성물.
  10. 청구항 1의 균주, 그 배양물 또는 상기 균주의 추출물을 포함하는 기능성 위장장애의 예방 또는 치료용 의약 조성물.
  11. 청구항 10에 있어서, 상기 기능성 위장장애는 과민성 대장 증후군(irritable bowel syndrome), 기능성 팽만감(functional bloating), 비심장성 흉통(noncardiac chest pain), 비-궤양성 소화불량(non-ulcer dyspepsia), 만성적인 변비 및 설사로 이루어진 군에서 선택된 1 종 이상인 조성물.
  12. 청구항 1의 균주, 그 배양물 또는 상기 균주의 추출물을 포함하는 프리바이오틱스 조성물.
  13. 청구항 12에 있어서, 아커만시아(Akkermansia) 속, 락토바실러스(Lactobacillus) 속, 루미노코커스(Ruminococcus) 속 또는 프레보텔라(Prevotella) 속 중 적어도 하나 이상의 장내 균총 개선용인 프리바이오틱스 조성물.
PCT/KR2023/004816 2022-04-12 2023-04-10 신규한 미생물 및 이를 포함하는 조성물 WO2023200203A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020220045316A KR20230146369A (ko) 2022-04-12 2022-04-12 신규한 미생물 및 이를 포함하는 조성물
KR10-2022-0045316 2022-04-12

Publications (1)

Publication Number Publication Date
WO2023200203A1 true WO2023200203A1 (ko) 2023-10-19

Family

ID=88330008

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2023/004816 WO2023200203A1 (ko) 2022-04-12 2023-04-10 신규한 미생물 및 이를 포함하는 조성물

Country Status (2)

Country Link
KR (1) KR20230146369A (ko)
WO (1) WO2023200203A1 (ko)

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101782170B1 (ko) * 2009-02-02 2017-09-26 시에이치알. 한센 에이/에스 락토바실러스 람노서스 필루스 폴리펩티드 및 그 생산방법
CN109266568A (zh) * 2018-08-19 2019-01-25 东北农业大学 一种具有高产细菌素的益生功能鼠李糖乳杆菌及其应用
KR20200027855A (ko) * 2018-09-05 2020-03-13 서울대학교산학협력단 장내 항염증 및 균총 개선 활성을 갖는 락토바실러스 람노서스 균주
KR102166461B1 (ko) * 2020-03-10 2020-10-15 주식회사 종근당바이오 장관 면역조절 기능과 염증성 장 질환의 예방 또는 치료 활성을 갖는 락토바실러스 람노서스 균주
KR102296286B1 (ko) * 2020-06-16 2021-09-01 주식회사 바이오뱅크힐링 락토바실러스 람노서스 균주, 및 그의 유래의 소포체 및 그의 항염증 및 항균 용도

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102294456B1 (ko) 2021-02-17 2021-08-27 주식회사 메디오젠 영유아 유래 유산균 락토바실러스 람노서스 mg4502 및 이를 포함하는 장 건강 증진, 항산화 및 항비만용 조성물

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101782170B1 (ko) * 2009-02-02 2017-09-26 시에이치알. 한센 에이/에스 락토바실러스 람노서스 필루스 폴리펩티드 및 그 생산방법
CN109266568A (zh) * 2018-08-19 2019-01-25 东北农业大学 一种具有高产细菌素的益生功能鼠李糖乳杆菌及其应用
KR20200027855A (ko) * 2018-09-05 2020-03-13 서울대학교산학협력단 장내 항염증 및 균총 개선 활성을 갖는 락토바실러스 람노서스 균주
KR102166461B1 (ko) * 2020-03-10 2020-10-15 주식회사 종근당바이오 장관 면역조절 기능과 염증성 장 질환의 예방 또는 치료 활성을 갖는 락토바실러스 람노서스 균주
KR102296286B1 (ko) * 2020-06-16 2021-09-01 주식회사 바이오뱅크힐링 락토바실러스 람노서스 균주, 및 그의 유래의 소포체 및 그의 항염증 및 항균 용도

Also Published As

Publication number Publication date
KR20230146369A (ko) 2023-10-19

Similar Documents

Publication Publication Date Title
CN112534043B (zh) 副干酪乳杆菌菌株及其用途
AU2020336649B2 (en) Akkermansia muciniphila EB-AMDK19 strainand use thereof
AU2020339348B2 (en) Akkermansia muciniphila EB-AMDK27 strain and use thereof
WO2020040408A1 (ko) 신규의 큐티박테리움 그래뉼로섬 균주, 및 이러한 균주 또는 이의 배양물을 포함하는 여드름 예방 또는 치료용 조성물
KR20010101171A (ko) 비뇨생식기 감염의 치료 및 예방을 위한 락토바실러스의경구 투여
WO2019088379A1 (ko) 신규 유산균 및 이의 용도
WO2021066549A1 (ko) 락토바실러스 애시도필러스 kbl409 균주 및 그 용도
WO2022086041A1 (ko) 신규 락토바실러스 속 균주 및 그의 용도
WO2019103198A1 (ko) 락토바실러스 퍼멘텀 kbl 375 균주 및 그 용도
WO2019004668A1 (ko) 프로테우스 속 세균 유래 나노소포 및 이의 용도
WO2022035269A1 (ko) 피칼리박테리움 프라우스니치이 균주 및 그 용도
AU2021212021B2 (en) Pharmaceutical composition for preventing or treating atopic disease containing Akkermansia muciniphila strain
WO2021246610A1 (ko) 락토바실러스 사케이 cvl-001 균주를 포함하는 염증성 질환 예방 또는 치료용 조성물
WO2021230581A1 (ko) 신규한 아커만시아 뮤시니필라 ak32 균주의 발견 및 장 손상의 예방 또는 치료를 위한 응용
WO2023177215A1 (ko) 구강 건강 개선 활성을 갖는 와이셀라 시바리아 균주 및 그 용도
WO2023200203A1 (ko) 신규한 미생물 및 이를 포함하는 조성물
WO2023177218A1 (ko) 치주 질환 유발균을 억제하는 활성을 갖는 락티카제이바실러스 파라카제이 균주 및 그 용도
WO2022231178A1 (ko) 신규한 락토바실러스 퍼멘텀 atg-v5 균주 또는 이를 포함하는 면역증강용 조성물
WO2023014054A1 (ko) 블라우티아 속 균주, 류코노스톡 속 균주 또는 루미노코쿠스 속 균주 및 그의 유래의 소포체 및 그의 항염증 및 항균 용도
WO2023058801A1 (ko) 락토바실러스 애시도필러스 kbl402 또는 kbl409 균주를 포함하는 장 질환 개선, 예방 또는 치료용 조성물
WO2022149851A1 (ko) 염증성 장 질환의 예방 또는 치료용 조성물
WO2019164230A1 (ko) 큐프리아비더스 속 세균 유래 나노소포 및 이의 용도
WO2020171256A1 (ko) 클로스트리디움 디피실레(clostridium difficile) 성장 억제효과를 갖는 락토바실러스 균주
WO2023287025A1 (ko) 큐티박테리움 아비덤 균주, 그의 유래의 배양액 및 그의 항균 용도
JP7342192B1 (ja) 化学療法による腸管損傷の関連病変又は細菌叢の不均衡の予防或いは補助療法におけるバチルスコアグランスｂｃ１９８又はその代謝産物の用途

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 23788553

Country of ref document: EP

Kind code of ref document: A1