WO2017115993A1 - 지방산 생산능이 향상된 재조합 미생물 및 이를 이용한 지방산의 제조방법 - Google Patents
지방산 생산능이 향상된 재조합 미생물 및 이를 이용한 지방산의 제조방법 Download PDFInfo
- Publication number
- WO2017115993A1 WO2017115993A1 PCT/KR2016/012439 KR2016012439W WO2017115993A1 WO 2017115993 A1 WO2017115993 A1 WO 2017115993A1 KR 2016012439 W KR2016012439 W KR 2016012439W WO 2017115993 A1 WO2017115993 A1 WO 2017115993A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- fatty acid
- recombinant microorganism
- gene encoding
- present
- fatty acids
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
- C12N15/75—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for Bacillus
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
- C12N15/77—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for Corynebacterium; for Brevibacterium
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
- C12N15/81—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P7/00—Preparation of oxygen-containing organic compounds
- C12P7/64—Fats; Fatty oils; Ester-type waxes; Higher fatty acids, i.e. having at least seven carbon atoms in an unbroken chain bound to a carboxyl group; Oxidised oils or fats
Definitions
- the present invention relates to a recombinant microorganism transformed to improve fatty acid production ability and a method for producing a fatty acid using the same, and more particularly, a gene encoding a acetyl-CoA-carboxylase involved in the fatty acid biosynthesis process, a maleic enzyme.
- the present invention relates to a recombinant microorganism into which a gene encoding a gene and a gene encoding a thioesterase are introduced, and a method for producing a fatty acid by culturing the same.
- Fatty acid production and production increase using microorganisms that can utilize biomass-derived sugars have been studied to form a platform for producing fatty acid-derived chemicals.
- Fatty acid is a carboxylic acid of a hydrocarbon chain having one carboxyl group (-COOH), and refers to a monovalent carboxylic acid in the form of a chain. These names are named because they occur when the fat is hydrolyzed.
- Fatty acid molecules are composed of hydrocarbon chains. Hydrocarbons are connected to the basic skeleton of carbon and hydrogen is connected to one end, and carboxyl groups are bonded to one end.
- fatty acids are broken down or synthesized by fatty acid metabolic pathways. Fatty acid metabolic pathways synthesize or decompose fatty acids in units of two carbons, so that most of the fatty acids present in nature are even-numbered carbon.
- Fatty acid synthesis from glucose in microorganisms begins with acetyl-CoA, followed by a long chain of carbon atoms attached to the hydrocarbon chain two at a time.
- acetyl-CoA involves ATP degradation and is carboxylated by binding to CO 2 to produce malonyl-CoA, an important intermediate in fatty acid biosynthesis.
- There is a reaction catalyzed by acetyl -CoA- carboxylic la kinase complex the complex is composed of three enzymes, and ATP, as well as for enzymatic activity requires a Mn 2 + and biotin.
- Malonyl-CoA is synthesized at the same time by fatty acid synthase, such as acetyl-CoA, up to C16 palmitic acid or C18 stearic acid, but this process is carried out by the decarboxyl group involved in acyl transport protein (ACP), C2 unit. Condensation, reduction by NADPH, is a complex process that occurs repeatedly.
- fatty acid synthase such as acetyl-CoA
- ACP acyl transport protein
- the present inventors have made intensive efforts to develop recombinant microorganisms for increasing fatty acid biosynthetic production, and confirmed that fatty acid biosynthetic production increases when the co-factor imbalance is resolved during fatty acid biosynthesis, thereby completing the present invention.
- An object of the present invention is to provide a recombinant microorganism with improved fatty acid production capacity.
- Another object of the present invention is to provide a recombinant vector containing a gene encoding acetyl-CoA-carboxylase, a gene encoding a malic enzyme and a gene encoding a thioesterase.
- Another object of the present invention is to provide a method for producing a fatty acid to synthesize the fatty acid by culturing the recombinant microorganism.
- the present invention provides a recombinant microorganism having a fatty acid generating ability is introduced, a gene encoding acetyl-CoA-carboxylase, a gene encoding a maleic enzyme and a gene encoding a thioesterase do.
- the present invention also provides a recombinant vector containing a gene encoding acetyl-CoA-carboxylase, a gene encoding a malic enzyme and a gene encoding a thioesterase.
- the present invention also provides a method for producing a fatty acid by culturing the recombinant microorganism to synthesize a fatty acid.
- Figure 1 is a schematic diagram showing the smooth circulation of NADPH CYCLE by overexpressing each enzyme in order to regulate the fatty acid biosynthesis metabolic pathways to Saccharomyces cerevisiae in the present invention.
- Figure 2 is a schematic diagram showing a cleavage map of recombinant vector pESC-Trp, pAccI, pMaeI, pCgl1664, pCgl2451, pCgl0091, pAccIMaeI, pAccICgl1664 and pAccIMaeICgl1664 presented in the present invention.
- Figure 3 shows the analysis results of fatty acid production of each recombinant yeast presented in the present invention.
- Figure 4 shows the results of the composition analysis of C16 (palmitic acid) and C18 (stearic acid) analyzed from recombinant yeast expressing two or more enzymes shown in Example 2 of the present invention.
- the present invention relates to a recombinant microorganism having a fatty acid-generating ability into which a gene encoding acetyl-CoA-carboxylase, a gene encoding a malic enzyme, and a gene encoding a thioesterase are introduced.
- two subunits (BC and D1) of acetylcoenzyme Acarboxylase derived from Corynebacterium glutamicum strain and putative thioesterase were introduced, and NADPH was extracted from genomic DNA of yeast used as a production strain.
- the effect of regeneration of NADPH on the fatty acid production of recombinant microorganisms overexpressed by introducing malic acid enzymes involved in regeneration was analyzed. As a result, it was confirmed that the recombinant microorganisms increased fatty acid production.
- the microorganism may be one selected from the group consisting of Saccharomyces cerevisiae, Escherichia coli, Lactobacillus, Bacillus cereus, Corynebacterium glutamicum, TCA cycle, NADPH cycle and If the microorganism having a fatty acid biosynthetic pathway consisting of Fatty Acid elongation process can be applied to the present invention without limitation.
- the acetyl-CoA-carboxylase may be characterized by having the amino acid sequence of SEQ ID NO: 1.
- the maleic enzyme may be characterized by having an amino acid sequence of SEQ ID NO: 2.
- the thioesterase may be characterized by having an amino acid sequence of any one of SEQ ID NOs: 3 to 5.
- the present invention relates to a recombinant vector containing a gene encoding acetyl-CoA-carboxylase, a gene encoding a malic enzyme and a gene encoding a thioesterase.
- a recombinant vector having a cleavage map described in FIG. 2 was used, but is not limited thereto.
- the term "vector” refers to a DNA preparation containing a DNA sequence operably linked to a suitable regulatory sequence capable of expressing the DNA in a suitable host.
- the vector may be a plasmid, phage particles, or simply a potential genomic insert. Once transformed into the appropriate host, the vector can replicate and function independently of the host genome, or in some cases can be integrated into the genome itself. Since plasmids are the most commonly used form of current vectors, "plasmid” and “vector” are sometimes used interchangeably in the context of the present invention. However, the present invention includes other forms of vectors having functions equivalent to those known or known in the art.
- expression control sequence refers to a DNA sequence essential for the expression of a coding sequence operably linked in a particular host organism.
- regulatory sequences include promoters for performing transcription, any operator sequence for regulating such transcription, sequences encoding suitable mRNA ribosomal binding sites, and sequences that control the termination of transcription and translation.
- suitable control sequences for prokaryotes include promoters, operator sequences, and ribosomal binding sites.
- Eukaryotic cells include promoters, polyadenylation signals, and enhancers. The factor that most influences the amount of gene expression in the plasmid is the promoter.
- an SR ⁇ promoter a promoter derived from cytomegalovirus, and the like are preferably used.
- any of a wide variety of expression control sequences can be used in the vector.
- useful expression control sequences include early and late promoters of SV40 or adenovirus, lac system, trp system, TAC or TRC system, T3 and T7 promoters, major operator and promoter regions of phage lambda, regulation of fd code protein Known to modulate expression of a region, a promoter for 3-phosphoglycerate kinase or other glycolysis enzymes, promoters of the phosphatase, promoter of the yeast alpha-crossing system and prokaryotic or eukaryotic cells or genes of their viruses Other sequences of construction and derivation and various combinations thereof.
- Nucleic acids are "operably linked” when placed in a functional relationship with other nucleic acid sequences. This may be genes and regulatory sequence (s) linked in such a way as to allow gene expression when appropriate molecules (eg, transcriptional activating proteins) are bound to regulatory sequence (s).
- DNA for a pre-sequence or secretion leader is operably linked to DNA for a polypeptide when expressed as a shear protein that participates in the secretion of the polypeptide, and a promoter or enhancer
- the ribosome binding site is operably linked to the coding sequence when affecting the transcription of the sequence, or the ribosomal binding site is operably linked to the coding sequence when affecting the transcription of the sequence; Or the ribosomal binding site is operably linked to a coding sequence when positioned to facilitate translation.
- "operably linked" means that the linked DNA sequence is in contact, and in the case of a secretory leader, is in contact and present within the reading frame. However, enhancers do not need to touch. Linking of these sequences is performed by ligation (linking) at convenient restriction enzyme sites. If such sites do not exist, synthetic oligonucleotide adapters or linkers according to conventional methods are used.
- heterologous DNA refers to heterologous DNA, which is DNA not naturally found in host cells.
- the expression vector can replicate independently of the host chromosomal DNA once it is in the host cell and produce several copies of the vector and the inserted (heterologous) DNA thereof.
- the gene must be operably linked to transcriptional and translational expression control sequences that function in the selected expression host.
- the expression control sequence and the gene of interest are included in one expression vector including both a fungal selection marker and a replication origin.
- Host cells transformed with the expression vectors described above constitute another aspect of the present invention.
- transformation means introducing DNA into a host so that the DNA is replicable as an extrachromosomal factor or by chromosomal integration. It should be understood that not all vectors and expression control sequences function equally in expressing the DNA sequences of the present invention. Likewise not all hosts function equally for the same expression system. However, those skilled in the art can make appropriate choices among various vectors, expression control sequences and hosts without departing from the scope of the present invention without undue experimental burden.
- the host in selecting a vector, the host must be considered, since the vector must be replicated in it.
- the number of copies of the vector, the ability to control the number of copies, and the expression of other proteins encoded by the vector, such as antibiotic markers, must also be considered.
- expression control sequences several factors must be considered. For example, the relative strength of the sequence, the controllability, and the compatibility with the DNA sequences of the present invention should be considered, particularly with regard to possible secondary structures.
- Single cell hosts may be selected from a host for the selected vector, the toxicity of the product encoded by the DNA sequence of the invention, the ability to secrete the protein correctly, the culture and fermentation requirements, the product encoded by the DNA sequence of the invention from the host.
- a binding method binding method
- a panning method panning method
- a film emulsion method film emulsion method
- the present invention relates to a method for producing a fatty acid by culturing the recombinant microorganism to synthesize a fatty acid.
- the fatty acid may be characterized in that the C16 (palmitic acid) and C18 (stearic acid).
- the fatty acid production of recombinant yeast is analyzed, and the fatty acid of the recombinant microorganism into which a gene encoding acetyl-CoA-carboxylase, a gene encoding malic enzyme, and a gene encoding thioesterase are introduced. The highest yield was confirmed.
- AccI acetyl-CoA-carboxylase
- Primer (accBC-r) SEQ ID NO: 8 GTCGACTTACTTGATCTCGAGGAGAA
- cgl1664, cgl2451 and cgl0091 were obtained, respectively.
- PCR was performed with primers pCgl1664-f, pCgl1664-r, pCgl2451-f, pCgl2451-r, pCgl0091-f, and pCgl0091-r to amplify them.
- pESC-Trp which is an expression vector of yeast, to prepare expression vectors, and pCgl1664, pCgl2451, and pCgl0091 expression vectors were prepared (FIG. 2).
- Primer (pCgl0091-f) SEQ ID NO: 15 GGATCCGATGTTTCTCACACTCTCAG
- the gene of the enzyme was obtained from Saccharomyces cerevisiae, and cDNA was transferred to Saccharomyces cerevisiae primer pMaeI-f, PCR was performed with pMaeI-r to amplify the maleic enzyme gene and introduced into pESC-Trp, which is an expression vector of yeast, to prepare an expression vector (FIG. 2).
- Example 2 Expression vector construction for expressing two or more target genes from one expression vector
- pMaeI obtained in Example 1 to include maeI
- a gene encoding a maleic enzyme a cassette from the promoter to the terminator was amplified by PCR using primers MaeI cassette-f and MaeI cassette-r. This was introduced into pAccI obtained in Example 1 to prepare an expression vector of pAccIMaeI.
- Example 3 Analysis of fatty acid production of recombinant yeast obtained by introducing the expression vector obtained in Example 1 into yeast
- the expression vector obtained in Example 1 was transformed using a yeastmaker kit as yeast, and recombinant yeast was transformed into SG-Trp media (Yeast nitrogen base (without ammonium sulfate) 1.7g / L and Amino acid supplement (overnight at 30 ° C) overnight. without Trp) 0.74g / L, Galactose 20g / L) and then incubated in 50ml SG-Trp media and incubated for 72 hours.
- SG-Trp media Yeast nitrogen base (without ammonium sulfate) 1.7g / L and Amino acid supplement (overnight at 30 ° C) overnight. without Trp
- Trp 0.74g / L
- Galactose 20g / L Galactose 20g / L
- the total fatty acid production was analyzed using an agilent 7890 GC-FID instrument using a 2.5mm, 30m HP5-MS column.
- the injection volume was 5 ⁇ l
- the injector temperature was 200 °C
- the detector temperature was The oven was set at 300 ° C. and the oven was set to increase by 10 ° C. in 1 minute from 100 ° C. to 250 ° C. after waiting for 5 minutes at 100 ° C. At 250 ° C., wait 10 minutes to allow the residue to come out.
- Example 4 Analysis of fatty acid production of recombinant yeast obtained by introducing the expression vector obtained in Example 2 into yeast
- the expression vector obtained in Example 2 was transformed using a yeastmaker kit as a yeast, and recombinant yeast was transformed into SG-Trp media (Yeast nitrogen base (without ammonium sulfate) 1.7g / L and Amino acid supplement (overnight at 30 ° C) overnight. without Trp) 0.74g / L, Galactose 20g / L) was incubated and then inoculated in 50ml SG-Trp media and incubated for 72 hours.
- SG-Trp media Yeast nitrogen base (without ammonium sulfate) 1.7g / L and Amino acid supplement (overnight at 30 ° C) overnight. without Trp) 0.74g / L, Galactose 20g / L
- the total fatty acid production was analyzed using an agilent 7890 GC-FID instrument using a 2.5mm, 30m HP5-MS column.
- the injection volume was 5 ⁇ l
- the injector temperature was 200 °C
- the detector temperature was The oven was set at 300 ° C. and the oven was set to increase by 10 ° C. in 1 minute up to 250 ° C. after 5 min. At 250 ° C., wait 10 minutes to allow the residue to come out.
- Example 5 Profiling the Compositions of C16 and C18 of Fatty Acids Analyzed in Example 4
- composition analysis was performed using 2.5mm and 30m HP5-MS column using agilent 7890 GC-FID instrument.In the analysis, injection volume was 5 ⁇ l, injector temperature was 200 °C, and detector temperature was 300 °C. The oven was set to increase the temperature by 10 ° C. in 1 minute from 100 ° C. to 250 ° C. after waiting for 5 minutes at 100 ° C. At 250 ° C., wait 10 minutes to allow the residue to come out. Composition analysis was performed by quantitatively analyzing the amounts of C16 and C18 using the above method.
- a recombinant microorganism having improved fatty acid producing ability may be industrially useful in connection with techniques for producing a fuel or a compound derived from an existing fatty acid.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Medicinal Chemistry (AREA)
- Mycology (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Oil, Petroleum & Natural Gas (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
본 발명은 지방산 생성능이 향상된 재조합 미생물 및 이를 이용한 지방산의 제조방법에 관한 것으로, 더욱 자세하게는 지방산 생합성 과정에 관여하는 아세틸-CoA-카르복실라아제를 코딩하는 유전자, 말릭 효소를 코딩하는 유전자 및 티오에스터라아제를 코딩하는 유전자가 도입된 재조합 미생물 및 이를 배양하여 지방산을 합성시키는 지방산의 제조방법에 관한 것이다. 본 발명에 따른, 지방산 생산능이 향상된 재조합 미생물은 기존의 지방산 유래의 연료 또는 화합물을 생산하기 위한 기술들과 연계되어 산업적으로 유용하게 사용될 수 있다.
Description
본 발명은 지방산 생성능을 향상시키기 위해 형질전환된 재조합 미생물 및 이를 이용한 지방산의 제조방법에 관한 것으로, 더욱 자세하게는 지방산 생합성 과정에 관여하는 아세틸-CoA-카르복실라아제를 코딩하는 유전자, 말릭 효소를 코딩하는 유전자 및 티오에스터라아제를 코딩하는 유전자가 도입된 재조합 미생물 및 이를 배양하여 지방산을 합성시키는 지방산의 제조방법에 관한 것이다.
바이오매스 유래의 당을 활용할 수 있는 미생물을 이용한 지방산 생산 및 생산량 증대는 지방산 유래의 화학물질을 생산하기 위한 플랫폼 형성을 위해 연구되어 왔다. 지방산(fatty acid)은 1개의 카르복실기(-COOH)를 가지는 탄화수소 사슬의 카르복실산으로 사슬 모양의 1가의 카르복실산을 말한다. 지방을 가수분해하면 생기기 때문에 이러한 이름이 명명되었다. 지방산 분자는 탄화수소 사슬로 이루어져 있는데, 탄화수소는 탄소의 기본 골격에 곁가지로 수소가 연결되어 있고 한쪽 끝에 카르복실기가 결합 되어 있다. 생체 내에서 지방산은 지방산 대사경로에 의해서 분해되거나 합성된다. 지방산 대사경로는 탄소 2개씩의 단위로 지방산을 합성하거나 분해하므로, 자연계에 존재하는 지방산은 거의 대부분이 짝수인 탄소로 되어 있다.
미생물 생체 내에서 글루코즈로부터의 지방산 합성은 아세틸-CoA (acetyl-CoA)에서 시작하여, 그 뒤 탄소 원자가 한 번에 두 개씩 탄화수소사슬에 붙어 사슬이 길어지게 된다. 세포질에서 아세틸-CoA는 ATP 분해를 수반하며 CO2와 결합하여 카르복실화 되어서, 지방산 생합성에 있어 중요한 중간체가 되는 말로닐-CoA(malonyl-CoA)를 생산한다. 이 반응은 아세틸-CoA-카르복실라아제 복합체에 의해 촉매되는데, 이 복합체는 세 개의 효소로 구성되어 있고, 효소 활성을 위해 ATP 뿐만 아니라 Mn2
+ 및 바이오틴을 요구한다.
말로닐-CoA의 말로닐 그룹에 있는 세 개의 탄소 원자 중 두 개가 생합성 반응의 각 단계 마다 지방산 사슬에 더해진다. 이 반응은 말로닐-CoA 형성과 마찬가지로 세포질에 있고 막과 결합 되어 있지 않은 다효소 복합체가 필요하다. 개별적인 효소들로 구성되어 있는 이 복합체는 지방산 합성효소를 말한다. 이러한 지방산 합성 효소 복합체의 일부인 아실 운반 단백질(acyl carrier protein; ACP)은 지방산의 탄소 수를 증가시키기 위한 결합에 관여한다.
말로닐-CoA는 아세틸-CoA와 같이 지방산 합성효소에 의해 한 번에 C16의 팔미트산 또는 C18의 스테아르산까지 합성되지만, 이 과정은 아실 운반 단백질(ACP)이 관여한 탈카르복실기, C2단위의 축합, NADPH에 의한 환원이 반복해서 일어나는 복잡한 과정이다.
기존 연구는 지방산 생합성에 관여하는 각각의 효소들을 각자 발현하여 지방산 생산 대사경로의 flux를 증대하는 연구 방향으로 진행되거나, 지방산의 분해 대사경로를 억제하려고 한다.
최근에는 효모의 지방산 생합성 대사경로를 조절하여 지방산 생산량을 향상시키려는 연구가 많이 진행되고 있으며, 대부분 대사경로 상 지방산의 생합성 과정에 직접적으로 관여하는 효소를 과발현하는 정도로 일부 박테리아(특히 E. coli) 및 효모 등에서 주로 연구가 진행되고 있으나, co-factor인 NADPH의 불균형으로 인하여 생산량 증대에 한계가 있다.
이에, 본 발명자들은 지방산 생합성 생산량을 증가시키기 위한 재조합 미생물을 개발하고자 예의 노력한 결과, 지방산 생합성 과정에서 co-factor의 불균형을 해소하는 경우 지방산 생합성 생산량이 증대한다는 것을 확인하고, 본 발명을 완성하게 되었다.
발명의 요약
본 발명의 목적은 지방산 생산능이 향상된 재조합 미생물을 제공하는데에 있다.
본 발명의 다른 목적은 아세틸-CoA-카르복실라아제를 코딩하는 유전자, 말릭 효소를 코딩하는 유전자 및 티오에스터라아제를 코딩하는 유전자를 함유하는 재조합 벡터를 제공하는데에 있다.
본 발명의 또 다른 목적은 상기 재조합 미생물을 배양하여 지방산을 합성하는 지방산의 제조방법을 제공하는데에 있다.
상기 목적을 달성하기 위하여, 본 발명은 아세틸-CoA-카르복실라아제를 코딩하는 유전자, 말릭 효소를 코딩하는 유전자 및 티오에스터라아제를 코딩하는 유전자가 도입되어 있는 지방산 생성능을 가지는 재조합 미생물을 제공한다.
본 발명은 또한, 아세틸-CoA-카르복실라아제를 코딩하는 유전자, 말릭 효소를 코딩하는 유전자 및 티오에스터라아제를 코딩하는 유전자를 함유하는 재조합 벡터를 제공한다.
본 발명은 또한, 상기 재조합 미생물을 배양하여 지방산을 합성하는 지방산의 제조방법을 제공한다.
도 1은 본 발명에서 사카로마이시스 세레비지에의 지방산 생합성 대사경로를 조절하기 위하여 각 효소를 과발현함으로써 NADPH CYCLE이 원활하게 순환되는 것을 나타낸 모식도이다.
도 2는 본 발명에서 제시된 재조합 벡터 pESC-Trp, pAccI, pMaeI, pCgl1664, pCgl2451, pCgl0091, pAccIMaeI, pAccICgl1664 및 pAccIMaeICgl1664를 재조합한 개열지도를 나타낸 모식도이다.
도 3은 본 발명에서 제시된 각 재조합 효모의 지방산 생산량의 분석 결과를 나타낸 것이다.
도 4는 본 발명의 실시예 2에서 제시된 두 개 이상의 효소를 발현하는 재조합 효모로부터 분석한 C16 (팔미트산) 및 C18 (스테아르산)의 조성 분석 결과를 나타낸 것이다.
발명의 상세한 설명 및 바람직한
구현예
다른 식으로 정의되지 않는 한, 본 명세서에서 사용된 모든 기술적 및 과학적 용어들은 본 발명이 속하는 기술 분야에서 숙련된 전문가에 의해서 통상적으로 이해되는 것과 동일한 의미를 갖는다. 일반적으로, 본 명세서에서 사용된 명명법은 본 기술 분야에서 잘 알려져 있고 통상적으로 사용되는 것이다.
최근들어 미생물의 지방산 생산량을 향상시키기 위하여 효모의 대사경로를 조절하는 연구가 진행되고 있으나, 대부분 대사경로 상 지방산을 생산하는데 직접적으로 관여하는 효소를 과발현하는 정도이며, 이러한 경우, 대사경로에 직접관여하는 효소들만을 과발현 시키는 경우, 지방산 합성의 co-factor인 NADPH의 불균형으로 인한 생산량 증가에 한계가 있었다. 종래의 연구들은 각각의 효소들을 각자 발현하여 지방산 생산 대사경로의 flux를 증대하는 연구 방향으로 진행되거나, 지방산의 분해 대사경로를 억제하려하였으나, 본 발명에서는 co-factor인 NADPH를 재생하는 효소와 지방산 생합성 대사경로상 효소의 과발현이 서로 미치는 영향을 분석하여 co-factor의 불균형이 해소되는 경우, 지방산 생산이 증가할 것으로 보고, 지방산 합성 과정의 co-factor인 NADPH를 재생하는 효소인 말릭 효소와 지방산 생합성 대사경로 상의 효소의 과발현이 서로 미치는 영향을 분석하여 co-factor의 불균형이 해소되었을 때 지방산 생산량이 증가한다는 것을 확인하였다.
본 발명은 일 관점에서, 아세틸-CoA-카르복실라아제를 코딩하는 유전자, 말릭 효소를 코딩하는 유전자 및 티오에스터라아제를 코딩하는 유전자가 도입되어 있는 지방산 생성능을 가지는 재조합 미생물에 관한 것이다.
본 발명의 일 양태에서는 코리네박테리움 글루타미쿰 균주로부터 유래한 아세틸조효소A카르복시화효소의 두가지 subunit (BC 및 D1)과 putative thioesterase를 도입하였으며, 생산균주로 사용된 효모의 genomic DNA로부터 NADPH를 재생하는데 관여하는 말산 효소를 도입하여 과발현시킨 재조합 미생물의 NADPH의 재생이 지방산 생산에 미치는 영향을 분석하였으며, 그 결과, 상기 재조합 미생물이 지방산생성이 증가하는 것을 확인하였다.
본 발명에 있어서, 상기 미생물은 사카로마이시스 세레비지에, 대장균, 유산균, 바실러스 세레우스, 코리네박테리움 글루타미쿰으로 이루어진 군에서 선택된 하나인 것을 특징으로 할 수 있으나, TCA cycle, NADPH cycle 및 Fatty Acid elongation 과정으로 이루어진 지방산 생합성 경로를 가지는 미생물이라면 제한 없이 본 발명을 적용할 수 있다.
본 발명에 있어서, 상기 아세틸-CoA-카르복실라아제는 서열번호 1의 아미노산 서열을 갖는 것을 특징으로 할 수 있다.
본 발명에 있어서, 상기 말릭 효소는 서열번호 2의 아미노산 서열을 갖는 것을 특징으로 할 수 있다.
본 발명에 있어서, 상기 티오에스터라아제는 서열번호 3 내지 5 중에서 어느 하나의 아미노산 서열을 갖는 것을 특징으로 할 수 있다.
본 발명은 다른 관점에서, 아세틸-CoA-카르복실라아제를 코딩하는 유전자, 말릭 효소를 코딩하는 유전자 및 티오에스터라아제를 코딩하는 유전자를 함유하는 재조합 벡터에 관한 것이다.
본 발명의 일 양태에서는, 도 2에 기재된 개열지도를 가지는 재조합 벡터를 사용하였으나, 이에 한정되는 것은 아니다.
본 발명에서 용어 "벡터 (vector)"는 적합한 숙주 내에서 DNA를 발현시킬 수 있는 적합한 조절 서열에 작동가능하게 연결된 DNA 서열을 함유하는 DNA 제조물을 의미한다. 벡터는 플라스미드, 파지 입자, 또는 간단하게 잠재적 게놈 삽입물일 수 있다. 적당한 숙주로 형질전환되면, 벡터는 숙주 게놈과 무관하게 복제하고 기능 할 수 있거나, 또는 일부 경우에 게놈 그 자체에 통합될 수 있다. 플라스미드가 현재 벡터의 가장 통상적으로 사용되는 형태이므로, 본 발명의 명세서에서 "플라스미드 (plasmid)" 및 "벡터 (vector)"는 때로 상호 교환적으로 사용된다. 그러나, 본 발명은 당업계에 알려진 또는 알려지게 되는 바와 동등한 기능을 갖는 벡터의 다른 형태를 포함한다.
"발현 조절 서열 (expression control sequence)"이라는 표현은 특정한 숙주생물에서 작동가능하게 연결된 코딩 서열의 발현에 필수적인 DNA 서열을 의미한다. 그러한 조절 서열은 전사를 실시하기 위한 프로모터, 그러한 전사를 조절하기 위한 임의의 오퍼레이터 서열, 적합한 mRNA 리보좀 결합 부위를 코딩하는 서열 및, 전사 및 해독의 종결을 조절하는 서열을 포함한다. 예를 들면, 원핵생물에 적합한 조절 서열은 프로모터, 오퍼레이터 서열 및 리보좀 결합 부위를 포함한다. 진핵세포는 프로모터, 폴리아데닐화 시그날 및 인핸서가 이에 포함된다. 플라스미드에서 유전자의 발현 양에 가장 영향을 미치는 인자는 프로모터이다. 고 발현용의 프로모터로서 SRα 프로모터와 사이토메가로바이러스 (cytomegalovirus) 유래 프로모터 등이 바람직하게 사용된다.
본 발명의 DNA 서열을 발현시키기 위하여, 매우 다양한 발현 조절 서열 중 어느 것이라도 벡터에 사용될 수 있다. 유용한 발현 조절서열의 예에는, SV40 또는 아데노바이러스의 초기 및 후기 프로모터들, lac 시스템, trp 시스템, TAC 또는 TRC 시스템, T3 및 T7 프로모터들, 파지 람다의 주요 오퍼레이터 및 프로모터 영역, fd 코드 단백질의 조절 영역, 3-포스포글리세레이트 키나제 또는 다른 글리콜분해 효소에 대한 프로모터, 상기 포스파타제의 프로모터들, 효모 알파-교배 시스템의 프로모터 및 원핵세포 또는 진핵 세포 또는 이들의 바이러스의 유전자의 발현을 조절하는 것으로 알려진 구성과 유도의 기타 다른 서열 및 이들의 여러 조합이 포함된다.
핵산은 다른 핵산 서열과 기능적 관계로 배치될 때 "작동가능하게 연결 (operably linked)"된다. 이것은 적절한 분자 (예를 들면, 전사 활성화 단백질)은 조절 서열(들)에 결합 될 때 유전자 발현을 가능하게 하는 방식으로 연결된 유전자 및 조절 서열(들)일 수 있다. 예를 들면, 전서열(pre-sequence) 또는 분비 리더 (leader)에 대한 DNA는 폴리펩타이드의 분비에 참여하는 전단백질로서 발현되는 경우 폴리펩타이드에 대한 DNA에 작동가능하게 연결되고, 프로모터 또는 인핸서는 서열의 전사에 영향을 끼치는 경우 코딩서열에 작동가능하게 연결되거나, 또는 리보좀 결합 부위는 서열의 전사에 영향을 끼치는 경우 코딩 서열에 작동가능하게 연결되거나; 또는 리보좀 결합 부위는 번역을 용이하게 하도록 배치되는 경우 코딩 서열에 작동가능하게 연결된다. 일반적으로, "작동가능하게 연결된"은 연결된 DNA 서열이 접촉하고, 또한 분비 리더의 경우 접촉하고 리딩 프레임 내에 존재하는 것을 의미한다. 그러나, 인핸서(enhancer)는 접촉할 필요가 없다. 이들 서열의 연결은 편리한 제한 효소 부위에서 라이게이션(연결)에 의해 수행된다. 그러한 부위가 존재하지 않는 경우, 통상의 방법에 따른 합성 올리고뉴클레오티드 어댑터 (oligonucleotide adaptor) 또는 링커(linker)를 사용한다.
본 명세서에 사용된 용어 "발현 벡터"는 통상 이종의 DNA의 단편이 삽입된 재조합 캐리어(recombinant carrier)로서 일반적으로 이중 가닥의 DNA의 단편을 의미한다. 여기서, 이종 DNA는 숙주 세포에서 천연적으로 발견되지 않는 DNA인 이형 DNA를 의미한다. 발현 벡터는 일단 숙주 세포 내에 있으면 숙주 염색체 DNA와 무관하게 복제할 수 있으며 벡터의 수 개의 카피 및 그의 삽입된 (이종) DNA가 생성될 수 있다.
당업계에 주지된 바와 같이, 숙주세포에서 형질감염 유전자의 발현 수준을 높이기 위해서는, 해당 유전자가, 선택된 발현 숙주 내에서 기능을 발휘하는 전사 및 해독 발현 조절 서열에 작동가능하도록 연결되어야만 한다. 바람직하게는 발현 조절서열 및 해당 유전자는 곰팡이 선택 마커 및 복제 개시점 (replication origin)을 같이 포함하고 있는 하나의 발현 벡터 내에 포함되게 된다.
상술한 발현 벡터에 의해 형질전환된 숙주 세포는 본 발명의 또 다른 측면을 구성한다. 본원 명세서에 사용된 용어 "형질전환"은 DNA를 숙주로 도입하여 DNA가 염색체 외 인자로서 또는 염색체 통합완성에 의해 복제 가능하게 되는 것을 의미한다. 모든 벡터와 발현 조절 서열이 본 발명의 DNA 서열을 발현하는데 모두 동등하게 기능을 발휘하지는 않는다는 것을 이해하여야만 한다. 마찬가지로 모든 숙주가 동일한 발현 시스템에 대해 동일하게 기능을 발휘하지는 않는다. 그러나, 당업자라면 과도한 실험적 부담없이 본 발명의 범위를 벗어나지 않는 채로 여러 벡터, 발현 조절 서열 및 숙주 중에서 적절한 선택을 할 수 있다.
예를 들어, 벡터를 선택함에 있어서는 숙주를 고려하여야 하는데, 이는 벡터가 그 안에서 복제되어야만 하기 때문이다. 벡터의 복제 수, 복제 수를 조절할 수 있는 능력 및 당해 벡터에 의해 코딩되는 다른 단백질, 예를 들어 항생제 마커의 발현도 또한 고려되어야만 한다. 발현 조절 서열을 선정함에 있어서도, 여러 가지 인자들을 고려하여야만 한다. 예를 들어, 서열의 상대적 강도, 조절가능성 및 본 발명의 DNA 서열과의 상용성 등, 특히 가능성 있는 이차 구조와 관련하여 고려하여야 한다. 단세포 숙주는 선정된 벡터, 본 발명의 DNA 서열에 의해 코딩되는 산물의 독성, 분비 특성, 단백질을 정확하게 폴딩 시킬 수 있는 능력, 배양 및 발효 요건들, 본 발명 DNA 서열에 의해 코딩되는 산물을 숙주로부터 정제하는 것의 용이성 등의 인자를 고려하여 선정되어야만 한다. 이들 변수의 범위 내에서, 당업자는 본 발명의 DNA 서열을 발효 또는 대규모 동물 배양에서 발현시킬 수 있는 각종 벡터/발현 조절 서열/숙주 조합을 선정할 수 있다. 발현 클로닝에 의해 NSP 단백질의 cDNA를 클로닝 하려고 할 때의 스크리닝법으로서 바인딩법(binding법), 페닝법(panning법), 필름에멀션법(film emulsion 법)등이 적용될 수 있다.
본 발명은 또 다른 관점에서, 상기 재조합 미생물을 배양하여 지방산을 합성하는 지방산의 제조방법에 관한 것이다.
본 발명에 있어서, 상기 지방산은 C16(팔미트산) 및 C18(스테아르산)인 것을 특징으로 할 수 있다.
아울러, 본 발명에서는 재조합 효모의 지방산 생산량을 각각 분석하여 아세틸-CoA-카르복실라아제를 코딩하는 유전자, 말릭 효소를 코딩하는 유전자 및 티오에스터라아제를 코딩하는 유전자가 도입되어 있는 재조합 미생물의 지방산 생산량이 가장 높은 것을 확인하였다.
실시예
이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로, 본 발명의 요지에 따라 본 발명의 범위가 이들 실시예에 의해 제한되지 않는다는 것은 당업계에서 통상의 지식을 가진 자에 있어서 자명할 것이다.
실시예 1: 지방산 생합성 대사경로에 관여하는 효소와 NADPH를 재생하는 효소를 코딩하는 유전자의 확보 및 벡터에의 도입
지방산의 생합성 대사경로 상 탄소 흐름의 증대를 위하여 아세틸-CoA-카르복실라아제(AccI)를 클로닝하기 위하여 코리네박테리움 글루타미쿰의 지노믹디엔에이로부터 accI 유전자의 염기서열을 참고로 하여 AccI의 subunit 중 AccBC와 AccD1을 증폭하기 위해 프라이머 accBC-f, accBC-r, accD1-f, accD1-r로 PCR을 수행하였다. 이를 효모의 발현벡터인 pESC-Trp로 각각 도입하여 발현벡터 pAccI를 제작하였다(도 2).
프라이머(accBC-f) 서열번호 7: GGATCCGATGTCAGTCGAGACTAGGAA
프라이머(accBC-r) 서열번호 8: GTCGACTTACTTGATCTCGAGGAGAA
프라이머(accD1-f) 서열번호 9: GCGGCCGCAATGACCATTTCCTCACCTTT
프라이머(accD1-r) 서열번호 10: ACTAGTGCTTACAGTGGCATGTTGCCGT
지방산의 생합성 대사경로 상 지방산의 elongation 과정으로부터 지방산의 생산량을 증대하기 위하여 putative한 티오에스터라아제의 유전자 총 3종을 후보로 선정하였으며 각각 cgl1664, cgl2451, cgl0091을 확보하였다. 이를 증폭하기 위해 프라이머 pCgl1664-f, pCgl1664-r, pCgl2451-f, pCgl2451-r, pCgl0091-f, pCgl0091-r로 PCR을 수행하였다. 이를 효모의 발현벡터인 pESC-Trp로 각각 도입하여 발현벡터를 제작하여, pCgl1664, pCgl2451, pCgl0091 발현 벡터를 제작하였다(도 2).
프라이머(pCgl1664-f) 서열번호 11: GGATCCGATGAAAACTATTGAAGATATTTTGAC
프라이머(pCgl1664-r) 서열번호 12: GTCGACTTAGTCTTTGCGCATCGG
프라이머(pCgl2451-f) 서열번호 13: GGACTTGATGGCAGCCAACAATGT
프라이머(pCgl2451-r) 서열번호 14: GTCGACCTACTTTTCTAGAGCTTCCT
프라이머(pCgl0091-f) 서열번호 15: GGATCCGATGTTTCTCACACTCTCAG
프라이머(pCgl0091-r) 서열번호 16: GTCGACCTAGACGGCGTCGAGA
지방산의 생합성 대사경로 상 불균형을 이루고 있는 NADPH를 재생하기 위한 효소인 말릭 효소를 클로닝하기 위하여 사카로마이시스 세레비지에로부터 효소의 유전자를 확보하였으며, 사카로마이시스 세레비지에 cDNA를 프라이머 pMaeI-f, pMaeI-r로 PCR을 수행하여 말릭 효소 유전자를 증폭하고, 이를 효모의 발현벡터인 pESC-Trp로 각각 도입하여 발현벡터를 제작하였다(도 2).
프라이머(pMaeI-f) 서열번호 17: GGATCCGATGCTTAGAACCAGACTAT
프라이머(pMaeI-r) 서열번호 18: GTCGACCTACAATTGGTTGGTGTGC
실시예 2: 하나의 발현벡터로부터 두 가지 이상의 타겟 유전자를 발현하기 위한 발현 벡터 제작
실시예 1에서 확보한 pMaeI으로부터 말릭 효소를 코딩하는 유전자인 maeI을 포함하도록 하여 promoter부터 terminator까지 포함하는 cassette를 프라이머 MaeI cassette-f, MaeI cassette-r를 사용하여 PCR을 통해 증폭하였다. 이를 실시예 1에서 확보한 pAccI에 도입하여 pAccIMaeI의 발현 벡터를 제작하였다.
프라이머(MaeI cassette-f) 서열번호 19: GGTACCGCAGATCCGCTCTAACC
프라이머(MaeI cassette-r) 서열번호 20: GCTAGCCCTACAATTGGTTGGTGTG
실시예 1에서 확보한 pCgl1664로부터 putative 티오에스터라아제를 코딩하는 유전자인 cgl1664를 포함하도록 하여 promoter부터 terminator까지 포함하는 cassette를 프라이머 Cgl1664 cassette-f, Cgl1664 cassette-f를 사용하여 PCR을 통해 증폭하였다. 이를 실시예 1에서 확보한 pAccI에 도입하여 pAccICgl1664의 발현 벡터를 제작하였다.
프라이머(Cgl1664 cassette-f) 서열번호 21: ACTAGTACAATTCTTCGCCAGAGGTTT
프라이머(Cgl1664 cassette-r) 서열번호 22: GTCGACTTAGTCTTTGCGCATCGGAATT
실시예 3: 실시예 1에서 확보한 발현 벡터를 효모로 도입하여 확보한 재조합 효모의 지방산 생산량 분석
실시예 1에서 확보한 발현 벡터는 효모로 Yeastmaker kit을 이용하여 형질전환되었으며, 재조합 효모는 30℃에서 overnight으로 SG-Trp media (Yeast nitrogen base (without ammonium sulfate) 1.7g/L, Amino acid supplement (without Trp) 0.74g/L, Galactose 20g/L)를 기반으로 배양하였으며, 이후 50㎖의 SG-Trp media에 접종하여 72시간 동안 배양하였다. 지방산 생산량 분석시 agilent 7890 GC-FID 기기를 활용하여 2.5mm, 30m의 HP5-MS column을 이용하여 total fatty acid의 생산량을 분석하였으며 분석시 injection volume은 5㎕, injector 온도는 200℃, detector 온도는 300℃로 하였으며 oven은 100℃에서 5분간 대기 후 100℃부터 시작하여 250℃까지 1분에 10℃씩 증가하도록 설정하였다. 250℃에서는 잔여물이 다 나올 수 있도록 10분간 대기하도록 하였다.
그 결과를 도 3(왼쪽)에 나타내었으며, 말산 효소가 과발현된 재조합 효모에서 높은 지방산 생산량을 확인하였다.
실시예 4: 실시예 2에서 확보한 발현 벡터를 효모로 도입하여 확보한 재조합 효모의 지방산 생산량 분석
실시예 2에서 확보한 발현 벡터는 효모로 Yeastmaker kit을 이용하여 형질전환되었으며, 재조합 효모는 30℃에서 overnight으로 SG-Trp media (Yeast nitrogen base (without ammonium sulfate) 1.7g/L, Amino acid supplement (without Trp) 0.74g/L, Galactose 20g/L)를 기반으로 배양되었으며, 이후 50㎖의 SG-Trp media에 접종하여 72시간 동안 배양하였다. 지방산 생산량 분석시 agilent 7890 GC-FID 기기를 활용하여 2.5mm, 30m의 HP5-MS column을 이용하여 total fatty acid의 생산량을 분석하였으며 분석시 injection volume은 5㎕, injector 온도는 200℃, detector 온도는 300℃로 하였으며 oven은 100℃에서 5분간 대기 후 100℃부터 시작하여 250℃까지 1분에 10℃씩 증가하도록 설정하였다. 250℃에서는 잔여물이 다 나올 수 있도록 10분간 대기하도록 하였다.
그 결과를 도 3(오른쪽)에 나타내었으며, 말산 효소와 아세틸-CoA-카르복실라아제 및 티오에스터라아제가 과발현된 재조합 효모에서 가장 높은 지방산 생산량을 확인하였다.
실시예 5: 실시예 4에서 분석한 지방산의 C16 및 C18의 조성을 profiling
지방산 생산량 분석시 agilent 7890 GC-FID 기기를 활용하여 2.5mm, 30m의 HP5-MS column을 이용하여 C16 및 C18 조성을 각각 분석하였으며 분석시 injection volume은 5㎕, injector 온도는 200℃, detector 온도는 300℃로 하였으며 oven은 100℃에서 5분간 대기 후 100℃부터 시작하여 250℃까지 1분에 10℃씩 증가하도록 설정하였다. 250℃에서는 잔여물이 다 나올 수 있도록 10분간 대기하도록 하였다. 상기 방법을 활용하여 각각의 C16 및 C18의 양을 정량하여 분석함으로써 조성 분석을 진행하였다.
그 결과를 도 4에 나타내었으며, 말산 효소와 아세틸-CoA-카르복실라아제 및 티오에스터라아제가 과발현된 재조합 효모에서 C16 및 C18 지방산의 생산이 모두 증가한 것을 확인하였다.
본 발명에 따른, 지방산 생산능이 향상된 재조합 미생물은 기존의 지방산 유래의 연료 또는 화합물을 생산하기 위한 기술들과 연계되어 산업적으로 유용하게 사용될 수 있다.
이상으로 본 발명 내용의 특정한 부분을 상세히 기술하였는 바, 당업계의 통상의 지식을 가진 자에게 있어서, 이러한 구체적 기술은 단지 바람직한 실시양태일 뿐이며, 이에 의해 본 발명의 범위가 제한되는 것이 아닌 점은 명백할 것이다. 따라서 본 발명의 실질적인 범위는 첨부된 청구항들과 그것들의 등가물에 의하여 정의된다고 할 것이다.
전자파일 첨부하였음.
Claims (8)
- 아세틸-CoA-카르복실라아제를 코딩하는 유전자, 말릭 효소를 코딩하는 유전자 및 티오에스터라아제를 코딩하는 유전자가 도입되어 있는 지방산 생성능을 가지는 재조합 미생물.
- 제1항에 있어서, 상기 아세틸-CoA-카르복실라아제는 서열번호 1 내지 2 중에서 어느 하나의 아미노산 서열을 갖는 것을 특징으로 하는 재조합 미생물.
- 제1항에 있어서, 상기 말릭 효소는 서열번호 3의 아미노산 서열을 갖는 것을 특징으로 하는 재조합 미생물.
- 제1항에 있어서, 상기 티오에스터라아제는 서열번호 4 내지 6 중에서 어느 하나의 아미노산 서열을 갖는 것을 특징으로 하는 재조합 미생물.
- 제1항에 있어서, 상기 미생물은 사카로마이시스 세레비지에, 대장균, 유산균, 바실러스 세레우스 및 코리네박테리움 글루타미쿰으로 구성된 군에서 선택된 하나인 것을 특징으로 하는 재조합 미생물.
- 아세틸-CoA-카르복실라아제를 코딩하는 유전자, 말릭 효소를 코딩하는 유전자 및 티오에스터라아제를 코딩하는 유전자를 함유하는 재조합 벡터.
- 다음 단계를 포함하는 지방산의 제조방법(a) 제1항 내지 제5항 중 어느 한 항의 재조합 미생물을 배양하여 지방산을 생성시키는 단계; 및(b) 상기 생성된 지방산을 회수하는 단계.
- 제7항에 있어서, 상기 지방산은 C16 (지방산) 및/또는 C18(지방산)인 것을 특징으로 하는 지방산의 제조방법.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR10-2015-0190682 | 2015-12-31 | ||
| KR1020150190682A KR101743210B1 (ko) | 2015-12-31 | 2015-12-31 | 지방산 생산능이 향상된 재조합 미생물 및 이를 이용한 지방산의 제조방법 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2017115993A1 true WO2017115993A1 (ko) | 2017-07-06 |
Family
ID=59222398
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/KR2016/012439 Ceased WO2017115993A1 (ko) | 2015-12-31 | 2016-11-01 | 지방산 생산능이 향상된 재조합 미생물 및 이를 이용한 지방산의 제조방법 |
Country Status (2)
| Country | Link |
|---|---|
| KR (1) | KR101743210B1 (ko) |
| WO (1) | WO2017115993A1 (ko) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20210205785A1 (en) * | 2018-06-01 | 2021-07-08 | Dow Global Technologies Llc | Ziegler-natta catalyst system having a thermally treated magnesium chloride component |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2015013674A2 (en) * | 2013-07-25 | 2015-01-29 | The Regents Of The University Of California | A yeast cell modified to overproduce fatty acid and fatty acid-derived compounds |
-
2015
- 2015-12-31 KR KR1020150190682A patent/KR101743210B1/ko active Active
-
2016
- 2016-11-01 WO PCT/KR2016/012439 patent/WO2017115993A1/ko not_active Ceased
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2015013674A2 (en) * | 2013-07-25 | 2015-01-29 | The Regents Of The University Of California | A yeast cell modified to overproduce fatty acid and fatty acid-derived compounds |
Non-Patent Citations (7)
| Title |
|---|
| DATABASE Protein [O] 12 August 2015 (2015-08-12), XP055399067, Database accession no. WP011013826.1 * |
| DATABASE Protein [O] 15 May 2013 (2013-05-15), XP055400080, Database accession no. WP_011014521.1 * |
| DATABASE Protein [O] 18 July 2013 (2013-07-18), XP055400087, Database accession no. WP_011013382.1 * |
| DATABASE Protein [O] 22 August 2014 (2014-08-22), XP055400079, Database accession no. NP_012896.1 * |
| DATABASE Protein [O] 24 May 2013 (2013-05-24), XP055399099, Database accession no. WP_011013833.1 * |
| DATABASE Protein [O] 7 May 2013 (2013-05-07), XP055400085, Database accession no. WP_004567531.1 * |
| RUNGUPHAN ET AL.: "Metabolic Engineering of Saccharomyces Cerevisiae for Production of Fatty Acid-derived Biofuels and Chemicals", METABOLIC ENGINEERING, vol. 21, 2014, pages 103 - 113, XP055279281 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20210205785A1 (en) * | 2018-06-01 | 2021-07-08 | Dow Global Technologies Llc | Ziegler-natta catalyst system having a thermally treated magnesium chloride component |
| US11857935B2 (en) * | 2018-06-01 | 2024-01-02 | Dow Global Technologies Llc | Ziegler-Natta catalyst system having a thermally treated magnesium chloride component |
Also Published As
| Publication number | Publication date |
|---|---|
| KR101743210B1 (ko) | 2017-06-02 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| BR112019020229B1 (pt) | Composições compreendendo tagatose-bifosfato aldolase e métodos para produzir tagatose | |
| Prell et al. | Adaptive laboratory evolution accelerated glutarate production by Corynebacterium glutamicum | |
| CN102851307B (zh) | 在蜂房哈夫尼菌中稳定的重组表达质粒载体及其应用 | |
| WO2011140342A1 (en) | Mutations and genetic targets for enhanced l-tyrosine production | |
| CN104561077A (zh) | 重组工程介导的谷氨酸棒杆菌atcc 13032的基因敲除方法 | |
| CN102168098A (zh) | 胆固醇氧化酶基因和工程菌及应用 | |
| CN109486845B (zh) | 一种精准调控谷氨酸棒杆菌基因表达的方法 | |
| KR102106280B1 (ko) | 바이오매스에서 유래한 탄소원의 고성능 대사를 위한 신규 미생물 균주 | |
| WO2017115993A1 (ko) | 지방산 생산능이 향상된 재조합 미생물 및 이를 이용한 지방산의 제조방법 | |
| WO2017122931A1 (ko) | L-시스테인 생산용 변이미생물 및 이를 이용한 l-시스테인의 제조방법 | |
| WO2017065529A1 (ko) | O-아세틸호모세린 설피드릴라제 변이체 및 이를 이용한 l-메치오닌 제조 방법 | |
| WO2015105233A1 (ko) | 미세조류의 바이오매스와 지질 생산성을 증가시키기 위한 재조합 벡터 및 이의 용도 | |
| CN111471631A (zh) | 发酵产生l-赖氨酸的方法 | |
| WO2015182941A1 (ko) | 신규 카탈라아제 신호서열 및 이를 이용한 카탈라아제 발현방법 | |
| KR102683624B1 (ko) | 기능적 dna 서열의 안정화된 카피 수를 갖는 미생물 및 관련 방법 | |
| WO2023003118A1 (ko) | 이타콘산을 생산하는 신규 대사 경로 및 이를 이용한 이타콘산의 생산 방법 | |
| WO2014171635A1 (ko) | 신규 d-솔비톨 탈수소화효소 및 이를 이용한 l-소르보스의 생산방법 | |
| WO2012008810A2 (en) | Microorganism with enhanced l-lysine productivity and method for producing l-lysine using the same | |
| WO2017065457A1 (ko) | L-쓰레오닌 생산능을 가지는 미생물 및 그를 이용하여 l-쓰레오닌을 생산하는 방법 | |
| WO2025135685A1 (ko) | 1,4-부탄디올 생산능이 향상된 변이 미생물 및 이를 이용한 1,4-부탄디올의 생산 방법 | |
| Stierhof et al. | Heterologous biosynthetic crosstalk with the native mansouramycin cluster in Streptomyces albus Del14 reveals unexpected metabolites | |
| Daniel et al. | Clostridium scindens: an endocrine keystone species in the mammalian gut | |
| WO2022231049A1 (ko) | L-라이신 생산능이 향상된 코리네박테리움 글루타미쿰 변이주 및 이를 이용한 l-라이신의 생산 방법 | |
| Chen et al. | Deciphering the Regioselective Acylation Modification in Bipentaromycin | |
| CN116445515B (zh) | 一种参与利普斯他汀及其结构类似物合成的基因簇及其应用 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 16881946 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 16881946 Country of ref document: EP Kind code of ref document: A1 |