WO2019045416A2 - 에탄올 비생산성 아세토젠 균주를 에탄올 생성균주로 전환하는 방법 및 상기 에탄올 생성균주로부터 일산화탄소를 이용한 에탄올의 제조방법 - Google Patents

에탄올 비생산성 아세토젠 균주를 에탄올 생성균주로 전환하는 방법 및 상기 에탄올 생성균주로부터 일산화탄소를 이용한 에탄올의 제조방법 Download PDF

Info

Publication number
WO2019045416A2
WO2019045416A2 PCT/KR2018/009923 KR2018009923W WO2019045416A2 WO 2019045416 A2 WO2019045416 A2 WO 2019045416A2 KR 2018009923 W KR2018009923 W KR 2018009923W WO 2019045416 A2 WO2019045416 A2 WO 2019045416A2
Authority
WO
WIPO (PCT)
Prior art keywords
strain
ethanol
producing
eubacterium limosum
seq
Prior art date
Application number
PCT/KR2018/009923
Other languages
English (en)
French (fr)
Other versions
WO2019045416A3 (ko
Inventor
장인섭
정지영
박신영
최인걸
박병혁
Original Assignee
광주과학기술원
고려대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 광주과학기술원, 고려대학교 산학협력단 filed Critical 광주과학기술원
Priority to US16/643,126 priority Critical patent/US11976314B2/en
Publication of WO2019045416A2 publication Critical patent/WO2019045416A2/ko
Publication of WO2019045416A3 publication Critical patent/WO2019045416A3/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0006—Oxidoreductases (1.) acting on CH-OH groups as donors (1.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0008—Oxidoreductases (1.) acting on the aldehyde or oxo group of donors (1.2)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/02—Preparation of oxygen-containing organic compounds containing a hydroxy group
    • C12P7/04—Preparation of oxygen-containing organic compounds containing a hydroxy group acyclic
    • C12P7/06—Ethanol, i.e. non-beverage
    • C12P7/065—Ethanol, i.e. non-beverage with microorganisms other than yeasts
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/02—Preparation of oxygen-containing organic compounds containing a hydroxy group
    • C12P7/04—Preparation of oxygen-containing organic compounds containing a hydroxy group acyclic
    • C12P7/06—Ethanol, i.e. non-beverage
    • C12P7/08—Ethanol, i.e. non-beverage produced as by-product or from waste or cellulosic material substrate
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y101/00—Oxidoreductases acting on the CH-OH group of donors (1.1)
    • C12Y101/01—Oxidoreductases acting on the CH-OH group of donors (1.1) with NAD+ or NADP+ as acceptor (1.1.1)
    • C12Y101/01001—Alcohol dehydrogenase (1.1.1.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y102/00—Oxidoreductases acting on the aldehyde or oxo group of donors (1.2)
    • C12Y102/01—Oxidoreductases acting on the aldehyde or oxo group of donors (1.2) with NAD+ or NADP+ as acceptor (1.2.1)
    • C12Y102/01003—Aldehyde dehydrogenase (NAD+) (1.2.1.3)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y102/00—Oxidoreductases acting on the aldehyde or oxo group of donors (1.2)
    • C12Y102/01—Oxidoreductases acting on the aldehyde or oxo group of donors (1.2) with NAD+ or NADP+ as acceptor (1.2.1)
    • C12Y102/0101—Acetaldehyde dehydrogenase (acetylating) (1.2.1.10)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y102/00—Oxidoreductases acting on the aldehyde or oxo group of donors (1.2)
    • C12Y102/07—Oxidoreductases acting on the aldehyde or oxo group of donors (1.2) with an iron-sulfur protein as acceptor (1.2.7)
    • C12Y102/07005—Aldehyde ferredoxin oxidoreductase (1.2.7.5)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y102/00—Oxidoreductases acting on the aldehyde or oxo group of donors (1.2)
    • C12Y102/99—Oxidoreductases acting on the aldehyde or oxo group of donors (1.2) with other acceptors (1.2.99)
    • C12Y102/99002—Carbon-monoxide dehydrogenase (acceptor) (1.2.99.2)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y208/00—Transferases transferring sulfur-containing groups (2.8)
    • C12Y208/03—CoA-transferases (2.8.3)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y401/00—Carbon-carbon lyases (4.1)
    • C12Y401/01—Carboxy-lyases (4.1.1)
    • C12Y401/01001—Pyruvate decarboxylase (4.1.1.1)
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02E—REDUCTION OF GREENHOUSE GAS [GHG] EMISSIONS, RELATED TO ENERGY GENERATION, TRANSMISSION OR DISTRIBUTION
    • Y02E50/00—Technologies for the production of fuel of non-fossil origin
    • Y02E50/10—Biofuels, e.g. bio-diesel

Definitions

  • the present invention relates to a transformant strain having an ethanol production ability prepared by introducing a gene for producing ethanol into Eubacterium limosum , which is an ethanol-free acetogen , and a method for producing ethanol from the strain using carbon monoxide .
  • Waste gas is a mixture gas composed of carbon monoxide (CO), carbon dioxide (CO 2 ), and hydrogen (H 2 ) obtained through gasification processes of various carbon-based raw materials such as waste, coal, coke, low hydrocarbon gas, naphtha, Is referred to as syngas or waste gas.
  • the group of microorganisms that produce acetic acid by anaerobic metabolism using synthetic gas or sugar as a carbon and energy source is called 'Acetogen'.
  • Acetogen uses the waste gas as carbon and energy source, (HL Drake et al., Annals of the New York Academy of Sciences, 1125: 100, 2008).
  • organic acids such as butyric acid and bioalcohols such as ethanol and butanol.
  • the present inventors have made intensive efforts to develop an acetogenic strain capable of producing ethanol from a syngas containing carbon monoxide. As a result, they have found that a high expression of an acetogen, Eubacterium limosum KCTC13263BP, which does not produce ethanol, The present inventors have completed the present invention by confirming that the transformant strain produces ethanol through a pathway specific to a carbon monoxide substrate by preparing a transformant strain into which an aldehyde alcohol dehydrogenase gene is externally introduced so that the expression can be regulated by the promoter.
  • It is another object of the present invention is to provide an oil cake Te Solarium remote island (Eubacterium limosum) oil cake Te Solarium remote island (Eubacterium limosum) vector for expression strain containing the constitutive high expression promoter derived.
  • the present invention provides a method for producing an Eubacterium limosum having an ethanol- producing ability and a gene encoding a bifunctional aldehyde alcohol dehydrogenase is introduced into an Eubacterium limosum having no ethanol- Lt; / RTI >
  • the present invention also provides a method for producing ethanol, comprising: (a) culturing the transformed Eubacterium limosum strain in the presence of a carbon monoxide-containing gas to produce ethanol; And (b) obtaining the resultant ethanol.
  • the present invention also provides a promoter derived from Eubacterium limosum having the nucleotide sequence shown in SEQ ID NO: 2 and a vector for expressing Eubacterium limosum strain shown in SEQ ID NO: 1.
  • Figure 1 shows the process of preparing a shuttle vector embryo for the smaller size Eubacterium limosum KCTC13263BP strain by recombining the major region sequence of the pJIR418 vector.
  • FIG. 2 is a histogram of a total of 3,611 total transcripts of the genes in the genome of the strain, based on the transcript analysis results obtained during the logarithmic growth period under the three culturing conditions of the strain Eubacterium limosum KCTC13263BP , And genes with high / intermediate / low transcript expression values, respectively.
  • FIG. 3 shows the expression levels of ⁇ -glucuronidase (GUS) expression after H1, H2, M1 and L1, respectively, at the upper end of the gene having high (H) / intermediate (M) / low
  • GUS ⁇ -glucuronidase
  • FIG. 4 is a graph showing the results obtained by introducing a vector in which four kinds of autonomous promoters (H1, H2, M1, L1) are located in front of the promoter of GUS expression gene into Eubacterium limosum KCTC13263BP strain, The GUS activity was measured with the wild-type strain.
  • A is a graph showing the absorbance change of each sample at 405 nm
  • B is a graph showing the activity of GUS of the four kinds of transformant and wild-type strain-derived samples.
  • FIG. 5 shows an example of a recombinant vector (pECPH2) inserted with a gene fragment in which H2 promoter is arranged at the upper end of the expression gene of two kinds of bifunctional aldehyde alcohol dihydrogenase (AdhE1, AdhE2), using the succinic vector pELM for Eubacterium limosum KCTC13263BP as a backbone :: AdhE1 or pECPH2 :: AdhE2).
  • AdhE1, AdhE2 bifunctional aldehyde alcohol dihydrogenase
  • FIG. 6 shows that the transformants transformed with the recombinant vectors (pECPH2 :: AdhE1 and pECPH2 :: AdhE2) were transformed into the transformants of the present invention, and A was transformed with the AdhE1 and AdhE2 insertion genes B was obtained by introducing the vector extracted from each transformant into the E. coli strain and then treating the reextracted vector with the restriction enzyme , Showing the result of checking the size of the vector fragment, indicating that the transformant of Eubacterium limosum KCTC13263BP strain into which each recombinant vector was introduced was successfully obtained.
  • FIG. 7 shows the results of analysis of growth and metabolite production under glucose substrate culture conditions with the wild type Eubacterium limosum KCTC13263BP strain and the above transformant expressing AdhE1 and AdhE2, respectively, and A shows the growth and metabolism of the wild type strain B and C show the results of growth and metabolite production analysis for the transformants expressing AdhE1 and AdhE2, respectively.
  • FIG. 8 shows the results of analysis of growth and metabolite production under the condition of carbon monoxide substrate culture with the transformant strain expressing the wild type Eubacterium limosum KCTC13263BP strain and AdhE1 and AdhE2, respectively, wherein A is the growth and metabolism product of the wild type strain And B and C are the results of growth and metabolite production analysis for the transformant strain expressing AdhE1 and AdhE2, respectively.
  • A is AdhE1 enzyme Or an acetyl-CoA under the catalysis of an AdhE2 enzyme directly through acetaldehyde
  • B represents a pathway for producing ethanol by the aldehyde ferredoxin oxidoreductase (AOR; ELI_0332, ELI_1752, ELI_3389), followed by acetic acid reuse ethanol production pathway where acetaldehyde is converted to ethanol by the AdhE1 or AdhE2 enzyme.
  • metabolic engineering for producing high-value-added ethanol from carbon monoxide using ethanol-non- producing acetobenzene ( Eubacterium limosum ) KCTC13263BP was carried out.
  • Acetic acid was converted into acetaldehyde Production of Ethanol Applied to Metabolic Engineering Based on the Existence of Aldehyde Ferredoxin Oxidoreductase (AOR) Expression Gene Expressing Conversion Catalyzed Acid Aldehyde Ferredoxin Oxidoreductase (AOR) It was confirmed that ethanol was produced in an energetically favorable direction by reusing acetic acid produced by AOR while maintaining the production route.
  • the ethanol production pathway through the reuse of acetic acid produces ethanol by reusing the reduced form of ferredoxin (Fd2-), which is produced in the state of preserving ATP obtained through substrate-level phosphorylation in the initial acetic acid production, Compared to the metabolic pathways that make ethanol through acetaldehyde directly from Acetyl-CoA, ATP can be conserved to minimize energy loss.
  • Fd2- ferredoxin
  • ATP can be conserved to minimize energy loss.
  • the E. limosum strain used as an acetogen is a strain producing a useful organic acid such as acetic acid and butyric acid while being highly resistant to carbon monoxide and actively growing using carbon monoxide as a unique carbon source (Chang IS et al , J. Microbiol . Biotechnol., 8: 134, 1998, J Inoue Sup Kor J. Appl. Microbiol. Bitoechnol., 25: 1, 1997).
  • ELI_0332 ELI_1752 (SEQ ID NO: 1)
  • AOR aldehyde ferredoxin oxidoreductase
  • ELI_1752 shows very high homology with the major conserved bases and motifs on the amino acid sequence of AOR of the Pyrococcus furiosus strain that was first discovered as a catalyst of AOR. Therefore, The AOR of the strain will also play a similar role to the previously known AOR (Kletzin A et al., J Bacteriol., 177 (16): 4817-9, 1995).
  • an external gene introduction and expression system suitable for the E. coli strain E. lososum is constructed, and a gene encoding a bifunctional aldehyde alcohol dehydrogenase is introduced into the wild-type strain, Was prepared.
  • the present invention relates to a transformed E. limosum strain having an ethanol producing ability in one aspect, the aldehyde-functional gene coding for alcohol dehydrogenase transferred to E. limosum strain that does not have an ethanol producing ability is introduced.
  • the bifunctional aldehyde alcohol dehydrogenase was selected from AdhE1 and AdhE2 derived from Clostridium autoethanogenum. These were selected from the group consisting of C. ljungdahlii and C. carboxidivorans, and AdhE1 and AdhE2, It has homology.
  • GUS GUS expression gene
  • the gene encoding the bifunctional aldehyde alcohol dehydrogenase may be transcribed by a promoter represented by the nucleotide sequence of SEQ ID NO: 2.
  • Eubacterium limosum may be characterized by being a strain of Eubacterium limosum KCTC13263BP.
  • the introduction of the foreign gene into the E. limosum strain can be characterized in that it is introduced using the shuttle vector pELM represented by the nucleotide sequence of SEQ ID NO: 1.
  • the present invention provides a method for producing ethanol, comprising: (a) culturing the transformed E. limosum strain in the presence of a carbon monoxide-containing gas to produce ethanol; And (b) obtaining the resulting ethanol.
  • the transformed E. limosum strain of the present invention can be used not only for the direct conversion of acetic acid, the main metabolite of the wild type strain, to ethanol, under autotrophic CO substrate conditions, but also for the production of butanol without producing another metabolite, It was confirmed that the product can be produced as a single product.
  • Transformed E. limosum strain of the present invention consumed 11.5 mmols (milli moles) of carbon monoxide under the autotrophic substrate condition, not the heterotrophic substrate condition, without the manipulation of the separate genomic DNA, so that a significant concentration of ethanol Which is the only one produced.
  • the transformed strains containing AdhE1 obtained through the above-described method of the present invention are applied to the synthesis gas process in the future, it is possible to omit or simplify the product separation process in the down-stream of the synthesis gas process, As well as the role of
  • the present invention proposes an optimum ethanol production pathway in terms of energy acquisition efficiency under a carbon monoxide substrate condition, and in fact, it is industrially very effective that the transformant strain produces only ethanol as a single product without any other competitive metabolites, And confirmed the valuable characteristics.
  • a shuttle vector suitable to introduce foreign genes of E. limosum strain when the existing introduced in E. limosum strain, identified as being stably replicated pJIR418 vector (J Sloan et al., Elsevier, 27: 3, 1992) using the antibiotic resistance cassette, only the major gene parts in pJIR412 vector recombination as Gram-negative origin of replication, a Gram-positive origin of replication and the size is represented by the base sequence of SEQ ID NO: 1
  • a shuttle vector pELM for the reduced E. limosum strain was constructed.
  • the external gene expression vector may include a high expression promoter for the strain represented by the nucleotide sequence of SEQ ID NO: 2 and a vector backbone represented by the nucleotide sequence of SEQ ID NO: 1.
  • Electroporation was used as a transformation method for introducing a foreign gene into E. limosum strain KCTC13263BP (hereinafter referred to as "Elm strain"), and the method used by Ching Leang et al was partially modified ( Appl Environ Microbiol., 79: 1102, 2013).
  • Electro-competent cells of the Elm strain were prepared by the following procedure for transformation by electroporation.
  • the cells were inoculated into 500 ml HBBM-Glc medium of the same composition containing 20 mM DL-threonine,
  • the cultured Elm strain was washed twice with SMP buffer (270 mM sucrose, 1 mM MgCl 2, 7 mM sodium phosphate, 3.17 mM L-cysteine hydrochloride, pH 7.4) and resuspended in 5 ml of final SMP buffer. It was prepared by concentrating more than 100 times.
  • the pJIR418 vector (Sloan J et al., Elsevier, 27: 3, 1992 ) was used to recombine only the major gene part of the pJIR412 vector, such as the antibiotic resistance cassette, the gram-negative cloning start point, and the gram positive cloning start point, to generate the reduced-size shuttle vector pELM (SEQ ID NO: 1) for the Elm strain (Fig. 1).
  • Example 2 Eubacterium limosum KCTC13263BP strain self-promoter screening for high expression of ethanol producing enzyme
  • a constant promoter of a gene showing a high expression rate constantly in the Elm strain was screened to select a constant high promoter.
  • transcript analysis of each substrate was performed to determine the expression level of 4,579 genes in the genome of Elm strain.
  • Elm strains were cultured under four different substrate conditions (glucose, CO, CO / CO 2 and H 2 / CO 2 ) and were identified by mid-log phase and early- As a result, transcript analysis was performed by sampling the culture with 3 replicates in each of 8 environmental conditions. Finally, in each of these 8 conditions, the RPM of each of the 4,579 genes annotated in the Elm strain Million mapped reads values were obtained. The RPKM mean value of each gene was obtained under eight environmental conditions, and histograms were obtained to obtain a normal distribution graph (FIG. 2).
  • the standard deviation of the RPKM value for each substrate and growth condition among the genes within the upper 3% with high average RPKM value is low, and the upstream 100 bp sequence at the start codon of the gene does not overlap with the ORF of the preceding gene (ELI_4394, ELI_3815) was selected as a candidate gene having a strong endogenous promoter, and the promoter predicted region of the upstream of the ORF of the two genes was determined as a promoter region of the promoter H1 (SEQ ID NO: 3), and promoter H2 (SEQ ID NO: 2).
  • ELI_4394 and ELI_3815 As a control group for the above two genes (ELI_4394 and ELI_3815) having a high average expression value, a gene having an intermediate expression value (ELI_0016) and a gene having a low expression value (ELI_1842) were also selected as above, Promoter predicted intervals were designated as promoter M1 (SEQ ID NO: 4) and promoter L1 (SEQ ID NO: 5), respectively.
  • Promoter M1 (SEQ ID NO: 4)
  • Promoter L1 (SEQ ID NO: 5)
  • Example 3 Identification of activity of Eubacterium limosum KCTC13263BP strain-derived promoter
  • Example 2 In order to confirm the intensity of the four promoters selected in Example 2, a reporter gene assay was performed.
  • As a reporter gene ⁇ -glucuronidase (GUS) expression gene of E. coli strain BL21 was selected.
  • the shuttle vector for the Elm strain prepared in Example 1 was used as a pELM backbone and the four types of promoter candidate groups (H1, H2, M1, L1) selected in Example 2 were inserted into the GUS expression gene Gene fragments were constructed and inserted into pELM vectors, respectively (Fig. 3).
  • GUS activity was assessed by fluorometric method using 4-NPG (4-Nitrophenyl ⁇ -D-glucuronide) as a substrate using the four confirmed Elm strain transformants and a wild-type Elm strain as a control. Cells were harvested from the transformants and wild-type Elm strains of each strain to obtain a crude enzyme. The GUS assay was performed using the final 2 mM 4-NPG as a substrate (Fig. 4A) The GUS sample expressed by the promoter exhibited the highest activity (20.35 mU / mg) (Fig. 4B).
  • the GUS sample expressed by the H1 promoter showed 5.64 mU / mg activity and the wild type strain extract
  • the GUS samples expressed by the remaining M1 or L1 promoters all exhibited very low activity of less than 1 mU / mg.
  • the H2 promoter among the promoter candidate groups H1 and H2, which had a high expression value on the transcript analysis result of Example 2 was finally selected as a promoter of a high expression gene for Elm strain.
  • Example 4 Bifunctional alcohols with non-alcoholic productivity Eubacterium limosum KCTC13263BP Production of ethanol through introduction of aldehyde alcohol dihydrogenase (AdhE)
  • a gene expressing a bifunctional aldehyde alcohol dehydrogenase (AdhE1, AdhE2) gene from the acetone strain C. autoethanogenum DSM10061 CAETHG_3747, CAETHG_3748) was selected as a target gene for introduction into the strain.
  • AdhE1 and AdhE2 genes were synthesized as an insertion gene for cloning by linking with Elm gene high expression promoter H2.
  • the insert gene fragment to which the H2 promoter and the AdhE1 gene (SEQ ID NO: 6) and the AdhE2 gene (SEQ ID NO: 7) are linked is shown in Table 2 as a backbone for the Elm strain shuttle vector (pELM), and two kinds of recombinant vector pECPH2 :: AdhE1 8) and pECPH2 :: AdhE2 (SEQ ID NO: 9) (FIG. 5).
  • pECPH2 :: AdhE1 and pECPH2 :: AdhE2 were introduced into the Elm strain through the electro-invasion method, and then Elm strain transformants containing the respective recombinant vectors were selected using the same sorting method as in Example 3, and the AdhE1 gene And the presence of the AdhE2 gene were also genetically confirmed (Fig. 6).
  • FIG. 6A each of the AdhE1 and AdhE2-containing transformants was subjected to colony PCR using the other transformants containing the GUS expression gene as a control, PCR products of the desired size could be obtained only from the transformant template.
  • plasmid DNA was extracted from each of the AdhE1 and AdhE2-containing transformant cultures, and then each of the extracted vectors was back-transformed into E. coli strains, and plasmid DNA was re-extracted and extracted from each E. coli transformant culture (Fig. 6B), with the results of Fig. 6A, by applying confirmation methods such as specific restriction enzyme treatment to the vector.
  • the identified transformants were cultivated for analysis of growth characteristics and production of metabolites including ethanol in each HBBM-Glc medium supplemented with erythromycin and HBBM-CO (CO medium) medium for analysis.
  • the wild-type Elm strain as a control group was cultured in HBBM-Glc medium and HBBM-CO medium not containing erythromycin.
  • each transformant (Fig. 7B and Fig. 7C) containing AdhEl and AdhE2 produced ethanol in contrast to the wild-type strain (Fig. 7A), and the transformants containing AdhEl Producing a high concentration of ethanol.
  • Transformants containing AdhE1 consumed glucose at a concentration of 21.2 mM and produced ethanol at a concentration of up to 10.5 mM.
  • the strain growth rate and maximum growth (ODmax) showed no significant difference between the wild type strain and the transformant strain, but the production of metabolites such as ethanol and butyric acid except for acetic acid showed a great difference.
  • Acetic acid production patterns and maximum yields showed no significant differences between wild type strains and transformants.
  • Butyric acid a 4-carbon metabolite of the strain, was scarcely produced in AdhE1-containing transformants.
  • AdhE2-containing transformants a small amount of butyric acid was produced at a concentration of 1.1 mM as compared with 4.5 mM in the wild-type strain.
  • FIG. 8A The autotrophic growth of transformants and wild type strains containing AdhE1 and AdhE2, respectively, under CO substrate conditions is shown in FIG.
  • the production of ethanol was not detected in the wild type strain as in the case of the glucose substrate condition (Fig. 8A), and ethanol was produced only in the transformant strain (Fig. 8B, Fig. 8C).
  • both of the transformants containing AdhE1 and AdhE2 consumed a total of 11.5 mmols of CO to produce ethanol at a concentration of about 28 mM.
  • the transformant strain containing AdhE1 produced the highest ethanol production was faster.
  • the transforming strains clearly demonstrated the ability to produce and consume acetic acid, the major metabolite of the strain, in the CO substrate conditions.
  • acetic acid was produced at a maximum concentration of 1.8 mM only at the early stage of growth, and the acetic acid produced was gradually consumed again and production was not detected at the background level after the stationary phase.
  • AdhE2-containing transformants also showed acetic acid production and re-consumption, similar to those found in the previous AdhE1-containing transformants. However, acetic acid was slower to be consumed again than the AdhE1-containing transformants, It was not completely consumed. Both transformants did not produce any butyric acid during the growth. In addition, there was no significant difference in growth rate or maximum growth (ODmax) between the wild type strain and the transformant strain as in the case of the preceding glucose substrate condition.
  • the Elm strain produces both L-lactate and D-lactate, -form produced total lactate at a maximum of 13 mM under a 20 mM glucose substrate condition at a production rate of about 1: 1.5. Furthermore, lactate was not produced under autotrophic CO substrate conditions and was only produced under heterotrophic glucose substrate conditions. According to the genetic information in the strain, the lactate production pathway is produced from pyruvate under the catalyst of lactate dehydrogenase (LDH; ELI_3346, ELI_4443), where NADH serves as an electron donor .
  • LDH lactate dehydrogenase
  • lactate is produced for effective reductive power consumption because of NAD + / NADH balance and the like.
  • the autotrophic CO gas metabolic pathway is a consumptive reaction of NADH and ATP, it can be interpreted that lactate is not produced unlike heterotrophic substrate conditions.
  • Example 5 Ethanol production using CO substrate Ethanol production pathway and bioenergetics model in Eubacterium limosum KCTC13263BP transformant strain
  • the CO substrate-based ethanol production using the Elm transformant strain prepared in Example 4 was carried out in the same manner as in Example 4 except that the pathway for producing ethanol via acetaldehyde immediately from acetyl-CoA (FIG. 9A) and the acetate (FIG. 9B), which reuses acetaldehyde and produces ethanol.
  • the path from CO to the synthesis of acetyl-CoA and the route to produce ethanol from acetaldehyde are the same, but the routes for the synthesis of acetaldehyde from acetyl-CoA are different.
  • NADH of the same molecule is required for each molecule of acetyl-CoA in the pathway for synthesizing acetaldehyde from acetyl-CoA, and acetaldehyde is reused after acetyl-CoA is preferentially produced from acetal-
  • the pathway for the synthesis requires a reduced form of ferredoxin (Fd2-) of the same molecule per molecule of acetyl-CoA and at the same time ATP of the same molecule is produced.
  • the Elm transformant strain containing the AdhE1 expression gene under autotrophic CO substrate conditions, not only converts acetic acid, which is the main metabolite of the wild-type strain, directly to ethanol, It was confirmed that ethanol alone can be produced without production of the product butyric acid.
  • the transfected strain containing AdhE1 produced ethanol at a significant concentration of about 28 mM under the condition of heterotrophic substrate and no manipulation of genomic DNA under autotrophic substrate conditions.
  • the transformed strains containing AdhE1 obtained through the above-described method of the present invention are applied to the synthesis gas process in the future, it is possible to omit or simplify the product separation process in the down-stream of the synthesis gas process, As well as the role of
  • high value-added ethanol can be produced from carbon monoxide contained in the waste gas using Eubacterium limosum , which is an acetogen that has no ethanol-producing ability.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Medicinal Chemistry (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

에탄올 비생성 아세토젠인 Eubacterium limosum에 에탄올 생산을 위한 외래 유전자를 도입하여 제작된 에탄올 생산능을 가지는 형질전환 균주 및 상기 균주를 이용한 에탄올의 제조방법에 관한 것으로, 본 발명에 따르면, 기존에 에탄올 생성능이 없는 아세토젠인 Eubacterium limosum를 이용하여, 폐가스에 포함된 일산화탄소로부터 고부가가치의 에탄올을 단일 생산물로써 생산할 수 있다.

Description

에탄올 비생산성 아세토젠 균주를 에탄올 생성균주로 전환하는 방법 및 상기 에탄올 생성균주로부터 일산화탄소를 이용한 에탄올의 제조방법
에탄올 비생성 아세토젠인 유박테리움 리모섬(Eubacterium limosum)에 에탄올 생산을 위한 유전자를 도입하여 제작된 에탄올 생산능을 가지는 형질전환 균주 및 상기 균주로부터 일산화탄소를 이용하여 에탄올을 제조하는 방법에 관한 것이다.
최근 부상하는 탄소자원화 기술은 화석연료 등에서 발생하는 일산화탄소, 이산화탄소, 메탄, 천연가스 등을 원료로 활용하여 자원화하는 기술로, 온실가스 감축, 에너지 자급화 등 효과가 있어 신산업 창출 아이템으로 각광받고 있다.
폐가스(합성가스)는 폐기물, 석탄, 코크스, 저급 탄화수소가스, 나프타, 중유 등 다양한 탄소 기반 원료의 가스화 공정을 통해 얻어지는 일산화탄소(CO), 이산화탄소(CO2), 수소(H2)로 구성된 혼합가스를 합성가스 또는 폐가스라고 한다. 합성가스 또는 당을 탄소 및 에너지원으로 사용하여 혐기적 대사를 통해 아세트산을 생성하는 미생물군을 '아세토젠(Acetogen)' 이라 일컬으며, 아세토젠은 폐가스를 탄소 및 에너지원으로 사용하여 주산물인 아세트산 이외에 부티르산과 같은 유기산 및 에탄올, 부탄올과 같은 바이오알코올 등의 생산 가능성을 가진다 (HL Drake et al., Annals of the New York Academy of Sciences, 1125:100, 2008).
현재 Coskata, INEOS Bio, Lanza Tech과 같은 외국 기업에서는 이미 아세토젠 균주를 이용한 바이오연료의 산업적 생산이 이루어지고 있다. 이에 따라 한국에서도 특허에 따른 사용 제약이 없는 독자적 균주 개발 및 개량을 목적으로 하는 연구의 중요성이 강조되고 있다 (B Schiel-Bengelsdorf et al., FEBS Letters, 586(15):219, 2012).
현재까지 100여 종 이상의 아세토젠 박테리아가 알려져 있으나, 폐가스를 소비해 부티르산과 같은 4탄소 유기물을 생산하는 균주는 소수에 불과하다. 또한 그람 양성 완전 혐기성 균주인 아세토젠에 적합한 유전자 조작 시스템 정립이 매우 까다로운 이유로, 특정 아세토젠 박테리아를 대상으로 대사산물 생산성 증대를 위한 대사공학이 성공적으로 수행되어 상용화로 발전한 경우는 매우 드문 실정이다.
이에, 본 발명자들은 일산화탄소를 포함하는 합성가스로부터 에탄올을 생산할 수 있는 아세토젠 균주를 개발하고자 예의 노력한 결과, 일산화탄소 이용성과 산물 생성능이 우수하나 에탄올을 생성하지 않은 아세토젠인 Eubacterium limosum KCTC13263BP 균주에 고발현용 프로모터로 발현조절되도록 외래의 알데히드 알코올 탈수소효소 유전자를 도입한 형질전환 균주를 제작하고, 상기 형질전환 균주가 일산화탄소 기질 특이적인 경로를 통해 에탄올을 생산하는 것을 확인하고, 본 발명을 완성하게 되었다.
발명의 요약
본 발명의 목적은 에탄올 생성능을 가지고 있지 않은 아세토젠에 이관능성 알데히드 알코올 디하이드로게나아제를 코딩하는 유전자를 도입하여 제작된 에탄올 생성능을 가지는 형질전환 아세토젠을 제공하는데 있다.
본 발명의 다른 목적은 상기 형질전환 아세토젠 균주를 배양하는 것을 특징으로 하는 에탄올의 제조방법을 제공하는데 있다.
본 발명의 또 다른 목적은 유박테리움 리모섬(Eubacterium limosum) 유래 항시적 고발현 프로모터를 함유하는 유박테리움 리모섬(Eubacterium limosum) 균주 발현용 벡터를 제공하는데 있다.
상기 목적을 달성하기 위하여, 본 발명은 에탄올 생성능을 가지고 있지 않은 Eubacterium limosum에 이관능성 알데히드 알코올 디하이드로게나아제를 코딩하는 유전자가 도입되어 있는 에탄올 생성능을 가지는 형질전환 유박테리움 리모섬(Eubacterium limosum) 균주를 제공한다.
본 발명은 또한, (a) 일산화탄소 함유 가스 존재 하에서 상기 형질전환 유박테리움 리모섬(Eubacterium limosum) 균주를 배양하여 에탄올을 생성시키는 단계; 및 (b) 상기 생성된 에탄올을 수득하는 단계를 포함하는 에탄올의 제조방법을 제공한다.
본 발명은 또한, 서열번호 2로 표시되는 염기서열을 가지는 유박테리움 리모섬(Eubacterium limosum) 유래 프로모터와 서열번호 1로 표시되는 유박테리움 리모섬(Eubacterium limosum) 균주 발현용 벡터를 제공한다.
도 1은 pJIR418 벡터의 주요 영역 서열을 재조합하여, 보다 작은 크기를 가지는 Eubacterium limosum KCTC13263BP 균주용 셔틀벡터 벡본을 제작하는 과정을 나타낸 것이다.
도 2는 Eubacterium limosum KCTC13263BP 균주의 3가지 배양 조건에서 대수 생장시기에 얻은 전사체 분석 결과를 바탕으로, 총 3,611 개의 상기 균주 전체게놈내 유전자들 각각의 전사체발현 평균값을 구하고 이를 히스토그램화한 그래프로, 높은/중간/낮은 전사체 발현값을 가지는 유전자들을 각각 구간으로 나타내었다.
도 3은 높은(H)/중간(M)/낮은(L) 전사체발현 값을 가지는 유전자 상단부의 프로모터 구간을 각각 H1, H2, M1 및 L1이라 명명한 후, 이들을 β-glucuronidase(GUS) 발현 유전자에 프로모터로써 연결한 각각의 삽입유전자를 구성하고, 이를 앞서 확보한 Eubacterium limosum KCTC13263BP 균주 맞춤형 셔틀 벡터 및 발현 벡터에 연결하는 클로닝 과정을 나타낸 모식도이다.
도 4는 4 종류의 자가 프로모터(H1, H2, M1, L1)가 GUS 발현 유전자의 프로모터 앞에 위치한 벡터를 Eubacterium limosum KCTC13263BP 균주에 도입한 후, 각각의 벡터를 함유하는 4 종류의 상기 형질전환체와 상기 야생형 균주를 가지고 GUS 활성을 측정한 결과를 나타낸 것이다. A는 405nm에서 각 샘플들의 흡광도 변화를 나타낸 그래프이며, B는 4종류의 상기 형질전환체 및 야생형 균주 유래 샘플의 GUS의 활성도를 그래프로 나타낸 것이다.
도 5는 Eubacterium limosum KCTC13263BP 균주용 셔특벡터 pELM을 백본으로하여, 2 종류의 이관능성 알데하이드 알코올 디하이드로게네이즈(AdhE1, AdhE2) 발현 유전자 상단부에 H2 프로모터를 배치한 유전자 절편을 삽입하여 재조합 벡터(pECPH2::AdhE1 또는 pECPH2::AdhE2)를 완성하는 클로닝 과정을 나타낸 것이다.
도 6은 재조합 벡터 (pECPH2::AdhE1 및 pECPH2::AdhE2)가 도입된 상기 균주 형질전환체를 확인한 결과로, A는 각각의 상기 균주 형질전환체 세포를 가지고 앞서 도입된 AdhE1 및 AdhE2 삽입 유전자를 대상으로한 콜로니 PCR을 진행하여 각 재조합 벡터의 성공적 도입 여부를 확인한 결과이며, B는 각각의 형질전환체에서 추출된 벡터를 E. coli 균주에 도입한 후 재추출된 벡터를 제한효소로 처리하여, 벡터 조각의 사이즈를 확인한 결과를 나타낸 것으로, 이를 통해 각각의 재조합 벡터가 도입된 Eubacterium limosum KCTC13263BP 균주의 형질전환체가 성공적으로 획득되었다는 것을 나타낸다.
도 7은 야생형 Eubacterium limosum KCTC13263BP 균주와 AdhE1 및 AdhE2를 각각 발현하는 상기 균주의 형질전환체를 가지고 글루코오스 기질 배양 조건하에 생장 및 대사산물 생산을 분석한 결과로, A는 상기 야생형 균주에 대한 생장 및 대사산물 생산 분석 결과이며, B 및 C는 AdhE1 및 AdhE2를 각각 발현하는 상기 형질전환체에 대한 생장 및 대사산물 생산 분석 결과를 나타낸 것이다.
도 8은 야생형 Eubacterium limosum KCTC13263BP 균주와 AdhE1, AdhE2를 각각 발현하는 상기 형질전환체 균주를 가지고 일산화탄소 기질 배양 조건하에 생장 및 대사산물 생산을 분석한 결과로, A는 상기 야생형 균주에 대한 생장 및 대사산물 생산 분석 결과이며, B 및 C는 각각 AdhE1, AdhE2 발현 상기 형질전환체 균주에 대한 생장 및 대사산물 생산 분석 결과이다.
도 9는 일산화탄소 기질 배양 조건하에, AdhE1 또는 AdhE2를 발현하는 상기 형질전환체 균주 내에서 가능한 2 가지 에탄올 생산 경로와 각 경로에 있어서 일산화탄소 기질 소비 대비 생산되는 ATP를 계산하여 나타낸 것으로, A는 AdhE1 효소 또는 AdhE2 효소의 촉매하에 아세틸-CoA에서 바로 아세트알데하이드를 거쳐 에탄올을 생산하는 경로를 나타낸 것이고, B는 상기 균주가 본래 가지고 있는 알데하이드 페레독신 옥시도리덕타아제(aldehyde ferredoxin oxidoreductase: AOR; ELI_0332, ELI_1752, ELI_3389)의 매개하에 아세트산 재사용을 통한 아세트알데하이드가 만들어지고 뒤이어 AdhE1 또는 AdhE2 효소에 의해 아세트알데하이드가 에탄올로 전환되는 '아세트산 재사용 에탄올 생산 경로'를 나타낸 것이다.
발명의 상세한 설명 및 바람직한 구현예
본 발명에서는 에탄올 비생산성 아세토젠 유박테리움 리모섬(Eubacterium limosum) KCTC13263BP를 이용해 일산화탄소로부터 고부가가치의 에탄올을 생산하기 위한 대사 공학을 수행하였으며, 상기 균주의 유전체 상에 아세트산을 아세트알데하이드(acetaldehyde)로의 전환을 촉매하는 효소 알데하이드 페레독신 옥시도리덕테이즈(aldehyde ferredoxin oxidoreductase: AOR) 발현 유전자들이 존재하는 사실을 기반으로, 대사 공학이 적용된 에탄올 생산 상기 형질전환 균주 내에서 아세토젠의 주요 에너지 생산경로인 아세트산 생산경로를 유지한 채 AOR에 의해 생성된 아세트산을 재사용하여 에너지적으로 유익한 방향으로 에탄올을 생산함을 확인하였다. 아세트산 재사용을 통한 에탄올 생산 경로는 초기 아세트산 생산 시 기질수준 인산화를 통해 획득된 ATP를 보존한 상태에서 생산된 아세트산을 환원된 형태의 페레독신(Fd2-)을 기전력으로 재사용하여 에탄올을 만들기 때문에, 아세틸 코에이(Acetyl-CoA)에서 곧바로 아세트알데하이드를 거쳐 에탄올을 만드는 대사 경로와 비교해 ATP를 보존하여 에너지 손실을 최소화 할 수 있다. 대사공학이 적용되어 일산화탄소 기질로부터 에너지 효율적 에탄올 생산이 가능한 균주는 최종적으로 기질전달과 생산물 분리가 최적화된 반응기에 적용함으로써, 에탄올 생산을 산업적 적용 가능한 수준으로 증대시킬 수 있다.
본 발명의 일 양태에서 아세토젠으로 사용되는 E. limosum 균주는 일산화탄소에 대한 내성이 높고, 일산화탄소를 유일 탄소원으로 하여 활발히 성장하면서, 아세트산 및 부티르산 등의 유용한 유기산을 생산하는 균주이다(Chang IS et al., J.Microbiol. Biotechnol., 8:134, 1998; 장인섭 Kor. J. Appl. Microbiol. Bitoechnol., 25:1, 1997). 이에 더해, 상기 야생형 균주 자체의 유전체에 아세트산과 같은 카르복실산을 아세트알데하이드와 같은 알데하이드로의 전환을 촉매하는 가역적 효소 알데하이드 페레독신 옥시도리덕테이즈(AOR)를 발현하는 3개의 유전자(ELI_0332, ELI_1752, ELI_3389)를 가지고 있으며, 이 중 ELI_1752는 AOR의 촉매역할이 처음 밝혀진 Pyrococcus furiosus 균주가 가지고 있는 AOR의 아미노산 서열상의 주요 보존 염기 및 모티프(motif)와 매우 높은 상동성을 보이기 때문에, 이를 바탕으로 상기 균주의 AOR 역시 기존에 알려진 AOR과 동일한 역할을 수행할 것임을 충분히 가늠할 수 있다(Kletzin A et al., J Bacteriol., 177(16):4817-9, 1995).
본 발명의 일 양태에서는 먼저, 아세토젠인 E. limosum 균주에 적합한 외부 유전자 도입 및 발현 시스템을 구축하고 이를 기반으로 상기 야생형 균주에 이관능성 알데히드 알코올 디하이드로게나아제를 코딩하는 유전자가 도입하여 에탄올 생성능을 가지는 상기 형질전환 균주를 제작하였다.
따라서, 본 발명은 일 관점에서, 에탄올 생성능을 가지고 있지 않은 E. limosum 균주에 이관능성 알데히드 알코올 디하이드로게나아제를 코딩하는 유전자가 도입되어 있는 에탄올 생성능을 가지는 형질전환 E. limosum 균주에 관한 것이다.
본 발명에서, 이관능성 알데히드 알코올 디하이드로게나아제는 Clostridium autoethanogenum 유래의 AdhE1과 AdhE2를 선택하여 사용하였으며, 이들은 C. ljungdahlii, C. carboxidivorans 등 에탄올 생산 균주들이 가지고 있는 AdhE1, AdhE2와 서로 85% 이상의 높은 상동성을 가지고 있다.
본 발명의 일 양태에서는 E. limosum 균주에서 항시적 고발현 효율을 가지는 프로모터를 선택하기 위하여, 상기 균주를 여러 배양 조건에서 대수 생장시기에 얻은 전사체 분석 결과를 바탕으로, 총 4,579개의 게놈 내 유전자들 각각의 전사체발현 평균값을 구하고 높은 전사체 발현값을 가지는 유전자의 상단부의 프로모터를 선별하여 β-glucuronidase(GUS) 발현 유전자에 프로모터로써 연결한 각각의 삽입유전자를 구성하고, 이를 E. limosum 맞춤형 셔틀 벡터 및 발현 벡터에 연결하는 클로닝하여, GUS의 활성이 높은 프로모터를 확인하고, 이를 E. limosum 균주 항시적 고발현 자가 프로모터로 사용하였다.
따라서, 상기 이관능성 알데히드 알코올 디하이드로게나아제를 코딩하는 유전자는 서열번호 2의 염기서열로 표시되는 프로모터에 의해서 전사조절되는 것을 특징으로 할 수 있다.
본 발명에 있어서, Eubacterium limosum는 Eubacterium limosum KCTC13263BP균주인 것을 특징로 할 수 있다.
본 발명에 있어서, 있어서, E. limosum 균주로의 외래유전자의 도입은 서열번호 1의 염기서열로 표시되는 셔틀벡터 pELM을 이용하여 도입되는 것을 특징으로 할 수 있다.
다른 관점에서, 본 발명은 (a) 일산화탄소 함유 가스 존재 하에서 상기 형질전환 E. limosum 균주를 배양하여 에탄올을 생성시키는 단계; 및 (b) 상기 생성된 에탄올을 수득하는 단계를 포함하는 에탄올의 제조방법에 관한 것이다.
본 발명의 형질전환된 E. limosum 균주는 autotrophic CO 기질 조건하에서, 상기 야생형 균주 본래의 주된 대사산물인 아세트산을 곧바로 재사용하여 에탄올로 전환할 뿐만아니라, 또 다른 대사산물인 부티르산의 생산 또한 없이 에탄올만을 단일로 생산할 수 있다는 것을 확인하였다.
본 발명의 형질전환 E. limosum 균주 heterotrophic 기질 조건이 아닌 autotrophic 기질 조건하에서 별도의 genomic DNA의 조작 없이 11.5mmols(밀리몰수)의 일산화탄소를 소비하여, 부가적인 대사산물 없이 28mM 정도의 의미있는 농도의 에탄올을 단독으로 생산함이 판명되었다. 이러한 상기 발명을 통해 얻은 AdhE1 포함 상기 형질전환 균주가 향후 합성가스 공정에 적용될 경우, 합성가스 공정의 down-stream에서의 산물 분리과정의 생략 또는 간소화가 가능하기 때문에, 산업적 적용 측면에서 매우 유망한 생촉매로의 역할을 할 것으로 예상할 수 있다.
또한, 본 발명에서는 일산화탄소 기질 조건하에 에너지 획득 효율 면에서 최적의 에탄올 생산 경로에 대해 제시하고, 실제로 상기 형질전환 균주가 최적 경로를 통해, 다른 경쟁 대사산물 없이 에탄올만을 단일 생산물로써 생산하는 산업적으로 매우 가치 있는 특성을 확인하였다.
본 발명의 일 양태에서는 E. limosum 균주의 외래유전자 도입에 적합한 셔틀벡터를 제작하기 위하여, 기존에 E. limosum 균주에 도입되었을 때, 안정적으로 복제되는 것으로 확인된 pJIR418 벡터(Sloan J et al., Elsevier, 27:3, 1992)를 이용하여, 항생제 저항성 카세트, 그람 음성 복제 개시점, 그람 양성 복제 개시점과 같이 pJIR412 벡터 상의 주요 유전자 파트만을 재조합하여, 서열번호 1의 염기서열로 표시되는 사이즈가 감소된 E. limosum 균주용 셔틀벡터 pELM을 제작하였다.
상기 외부 유전자 발현용 벡터는 서열번호 2의 염기서열로 표시되는 상기 균주용 고발현 프로모터와 서열번호 1의 염기서열로 표시되는 벡터 백본을 함유하는 것을 특징으로 할 수 있다.
이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 예시하기 위한 것으로, 본 발명의 범위가 이들 실시예에 의해 제한되는 것으로 해석되지 않는 것은 당업계에서 통상의 지식을 가진 자에게 있어서 자명할 것이다.
실시예 1: Eubacterium limosum KCTC13263BP 균주 맞춤형 형질전환 방법 확립 및 셔틀벡터 제작
E. limosum KCTC13263BP 균주(이하, "Elm 균주"라 함)에 외래유전자를 도입시키기 위한 형질전환 방법으로 전기천공법(electroporation)을 이용하였으며, Ching Leang 등이 사용한 방법을 일부 변형하여 사용하였다(Appl Environ Microbiol.,79:1102, 2013).
전기천공법을 통한 형질전환을 위해 Elm 균주의 전기수용세포(electro-competent cell)를 다음 과정을 통해 준비하였다. 20mM의 글루코오스를 포함하는100ml의 HEPES-버퍼 기본배지(Chang IS et al., J Biosci Bioeng., 88:682, 1999)에 개시된 인산버퍼 기본배지의 조성에서 인산 버퍼를 20mM HEPES 버퍼로 바꾼 배지; HBBM-Glc)에 Elm 균주를 전배양하여 OD600 1이 되도록 배양한 뒤, 배양액을 모두 20 mM DL-threonine이 첨가된 동일 조성의 500ml HBBM-Glc 배지에 접종하여 본배양하고 OD600 0.7~0.8이 되도록 배양된 Elm 균주를 SMP 버퍼(270 mM sucrose, 1 mM MgCl2, 7 mM sodium phosphate, 3.17 mM L-Cysteine hydrochloride, pH 7.4)를 이용하여, 2차례 세척한 후 최종 5ml의 SMP 버퍼로 재현탁하여, 100배 이상 농축하는 과정을 거쳐 준비하였다.
상기 준비한 Elm 균주의 전기수용세포 500㎕에 2ng의 도입할 벡터 DNA를 첨가하고, 3kV/cm, 400Ω, 25μF 조건하에 펄스를 가하여 전기청공법을 진행하였다. 펄스를 가한 전기수용세포와 벡터 혼합물은 5 ml HBBM-Glc에 접종하여 하룻밤 배양하였다. Elm 균주 형질전환체는 벡터에 위치하는 선택마커에 부합하는 특정 항생제가 포함된 HBBM-Glc 액체 배양액에 3%로 접종 또는 고체 아가(agar) 플레이트(plate)에 도말하여 선택하였다.
Elm 균주로의 외래 유전자의 안정적인 도입 및 발현을 위한 유전자 벡터를 제작하기 위하여, Elm 균주로 도입되었을 때, 안정적으로 복제되는 것이 확인된 pJIR418 벡터(Sloan J et al., Elsevier, 27:3, 1992)를 이용하여, 항생제 저항성 카세트, 그람 음성 복제 개시점, 그람 양성 복제 개시점과 같이 pJIR412 벡터 상의 주요 유전자 파트만을 재조합하여, 사이즈가 감소된 Elm 균주용 셔틀벡터 pELM(서열번호 1)를 제작하였다(도 1).
실시예 2: 에탄올 생산 효소 고발현용 Eubacterium limosum KCTC13263BP 균주 자가 프로모터 스크리닝
본 실시예에서는 Elm 균주에서의 외래유전자의 발현효율을 높이기 위하여, Elm 균주에서 항시적으로 높은 발현율을 나타내는 유전자의 프로모터를 스크리닝하여, 항시적 고발현 프로모터(constitutive strong promoter)를 선별하였다.
먼저, Elm 균주의 게놈 내의 4,579개 유전자 각각의 발현정도를 파악하기 위한 기질별 전사체 분석을 진행하였다. Elm 균주를 4 종류의 기질조건(glucose, CO, CO/CO2, H2/CO2)에서 배양하고 각 기질조건에서의 2가지 생장시기(mid-log phase, early-stationary) 별로 구별하여, 결과적으로 8가지 환경조건에서 각각 3반복으로 배양액의 샘플링을 시도하여 전사체 분석을 수행하였으며, 최종적으로 이들 8가지 조건에서 Elm 균주 내 annotation 된 4,579개 유전자들 각각의 RPKM (Reads Per Kilobase of transcript per Million mapped reads) 값을 획득하였으며, 8가지 환경조건에서 각각의 유전자가 갖는 RPKM 평균값을 구해 이를 히스토그램화하여 정규분포형 그래프를 얻었다(도 2).
이를 바탕으로 높은 RPKM 평균값을 갖는 상위 3% 이내의 유전자들 중 각 기질 및 생장 조건에의 RPKM 값의 표준편차가 낮으며, 해당 유전자의 시작코돈에서 업스트림 100bp의 서열이 앞선 유전자의 ORF와 겹치지 않고 프로모터 추정 구간으로써 확보될 수 있는지 여부를 판단하여 최종적으로 2 종류의 유전자(ELI_4394, ELI_3815)를 강한 항시적 프로모터를 가지는 유전자 후보군으로써 선별하였고, 이 두 유전자의 ORF의 업스트림의 프로모터 예상 구간을 각각 프로모터 H1 (서열번호 3), 프로모터 H2(서열번호 2)라 명명하였다. 높은 평균 발현값을 갖는 상기 2 유전자(ELI_4394 및 ELI_3815)에 대한 대조군으로, 중간 발현값을 갖는 유전자(ELI_0016)와 낮은 발현값을 갖는 유전자(ELI_1842)도 위와 같은 기준으로 각각 선별하여, 이들의 업스트림 프로모터 예상 구간을 각각 프로모터 M1(서열번호 4), 프로모터 L1(서열번호 5)으로 명명하였다.
프로모터 H1(서열번호 3)
TTTTTTTATGTAAAAAAGTTAGTTAAAAATAACAAAATTAATGATAATCAAAGAAAAAGTGGGTATAATTAAAGATAGCGAAATAGGAAACCAATACAGGAGGAAAAAGA
프로모터 H2(서열번호 2)
TTTTCCGTTTAAAGTTTAAAAATTGTGGTATAATTAATTATATCATTAAGCGGATAAGTGGGTTACACGGACTGCTCAAAATTATATTTGGACTATAGGAGGTCTTTATT
프로모터 M1(서열번호 4)
GCTTTTGCCTATCTTTTTAATTATATAATACTATTTGCCAAACTCATTCCACTAAAGTACAATAGAATCATCAAATCTCACACAAAGGATTTTTAT
프로모터 L1(서열번호 5)
GTATTTGGATGGGGATCTTCCTTGACGCTTTAAGGGGACTCCGATATGATGAAATCAACCAAACAGACAAATCTCAAGATTAAGAAGGAGACACATATTC
실시예 3: Eubacterium limosum KCTC13263BP 균주 유래 자가 프로모터의 활성 확인
실시예 2에서 선별된 4 종류의 프로모터의 강도를 확인하기 위하여, 리포터 유전자 에세이(report gene assay)를 수행하였다. 리포터 유전자로는 E. coli BL21 균주의 β-glucuronidase(GUS) 발현 유전자를 선택하였다. 실시예 1에서 제작한 Elm 균주용 셔틀벡터를 pELM 벡본(backbone)으로하고, 실시예 2에서 선별한 4종류의 프로모터 후보군들(H1, H2, M1, L1)을 각각 GUS 발현 유전자와 연결하여 삽입 유전자 단편을 구성하고 이를 각각 pELM 벡터에 삽입하여 클로닝하였다(도 3).
클로닝을 통해 제작된 4 종류의 벡터를 각각 실시예 1의 형질전환 방법을 통해 Elm 균주에 도입시켰으며, 생성된 각각의 Elm 균주 형질전환체는 최종 120㎍/ml 농도의 에리쓰로마이신(erythromycin)을 포함하는 HBBM-Glc 액체 또는 고체 배지상에서 선별하였다. 선별된은 각각의 형질전환체는 야생형 Elm 균주를 대조군으로 하여 콜로니 PCR 및 플라스미드 DNA 추출 후 E. coli 균주로의 back-transformation, E. coli 균주를 통한 플라스미드 DNA 재추출, 추출된 벡터에 특정 제한효소 처리와 같은 확인 방법들을 적용하여 유전자가 성공적으로 도입된 형질전환체인지 확인하였다.
확인된 4 종류의 Elm 균주 형질전환체와 대조군으로 야생형 Elm 균주를 사용하여, 4-NPG (4-Nitrophenyl β-D-glucuronide)를 기질로하여 fluorometric 방법으로 GUS 활성을 평가하였다. 각각의 형질전환체 및 야생형 Elm 균주 배양액으로부터 균주의 대수증식기에 세포를 수확하여 조효소(crude enzyme)를 추출한 후, 최종 2 mM 4-NPG를 기질로써 GUS 에세이를 수행한 결과(도 4A), H2 프로모터에 의해 발현된 GUS 샘플이 20.35mU/mg으로 가장 높은 활성을 나타내었으며(도 4B), 다음으로 H1 프로모터에 의해 발현된 GUS 샘플이 5.64mU/mg의 활성을 나타내었고, 야생형 균주 추출액을 포함한 나머지 M1 또는 L1 프로모터에 의해 발현된 GUS 샘플들은 모두 1 mU/mg 이하의 매우 낮은 활성을 나타내었다. 상기 결과를 통하여, 실시예 2의 전사체 분석 결과상에 높은 발현값을 가졌던 프로모터 후보군 H1 및 H2 중 H2 프로모터를 Elm 균주용 유전자 고발현용 자가 프로모터로 최종적으로 선별하였다.
실시예 4: 알코올 비생산성 Eubacterium limosum KCTC13263BP 균주로의 이관능성 알데하이드 알코올 디하이드로게네이즈(AdhE) 도입을 통한 에탄올 생산
본 실시예에서는 알코올 비생산성 Elm 균주를 에탄올 생산이 가능한 형질전환 균주로 만들기 위하여, 에탄올 생산능이 검증된 아세토젠 균주 C. autoethanogenum DSM10061으로부터 이관능성 알데하이드 알코올 디하이드로게네이즈(AdhE1, AdhE2) 발현 유전자(CAETHG_3747, CAETHG_3748)를 상기 균주에 도입용 타겟 유전자로써 선정하였다.
선정된 각각의 AdhE1 유전자 및 AdhE2 유전자는 Elm 균주용 유전자 고발현용 자가 프로모터 H2와 연결하여, 클로닝을 위한 삽입 유전자로써 합성하였다.
H2 프로모터와 각각의 AdhE1 유전자(서열번호 6) 및 AdhE2 유전자(서열번호 7) 가 연결된 삽입 유전자 절편은 Elm 균주용 셔틀벡터(pELM)를 백본으로, 2 종류의 재조합 벡터 pECPH2::AdhE1(서열번호 8) 및 pECPH2::AdhE2(서열번호 9)를 제작하였다(도 5).
pECPH2::AdhE1 및 pECPH2::AdhE2는 전기침공법을 통하여 Elm 균주에 도입한 후 실시예 3과 동일한 선별방법을 사용하여, 각각의 재조합 벡터를 포함하는 Elm 균주 형질전환체를 선별하였으며, AdhE1 유전자 및 AdhE2 유전자의 존재 여부 또한 유전적으로 확인하였다(도 6). GUS 발현 유전자를 포함하는 다른 형질전환체를 대조군으로하여 각 AdhE1, AdhE2를 포함하는 형질전환체를 가지고 삽입 유전자를 대상으로한 colony PCR을 진행한 결과 도 6A에 나타난 것과 같이 각 AdhE1, AdhE2 포함 형질전환체 템플릿으로부터만 원하는 사이즈의 PCR 산물을 얻을 수 있었다. 이와 함께, 각 AdhE1, AdhE2 포함 형질전환체 배양액을 가지고 플라스미드 DNA를 추출 후 추출된 각각의 벡터를 E. coli 균주로 back-transformation하고, 각 E. coli 형질전환체 배양액으로부터 플라스미드 DNA 재추출, 추출된 벡터에 특정 제한효소 처리와 같은 확인방법들을 적용하여 도 6A의 결과와 함께 각 AdhE1, AdhE2 포함 상기 균주 형질전환체가 성공적 획득되었는지 유전적으로 확인하였다 (도 6B).
확인된 형질전환체는 에리쓰로마이신이 첨가된 각각의 HBBM-Glc 배지와 HBBM-CO(CO를 기질로하는 배지)배지에서 생장 특성 및 에탄올을 포함한 대사산물 생산을 분석을 위해 배양하였다. 이때, 대조군으로 야생형 Elm 균주를 에리쓰로마이신이 포함되지 않은 HBBM-Glc 배지와 HBBM-CO 배지에서 배양하였다.
글루코오스 기질 조건에서 각각의 AdhE1 및 AdhE2 포함 형질전환체와 야생형 균주의 heterotrophic 생장을 분석한 결과를 도 7에 나타내었다. 예상대로 AdhE1 및 AdhE2를 포함하는 각각의 형질전환체(도 7B 및 도 7C)는 야생형 균주(도 7 A)와 대조적으로 에탄올을 생산하였으며, 두 형질전환 균주 사이에서도 AdhE1을 포함하는 형질전환체가 더욱 높은 농도의 에탄올을 생산하였다. AdhE1을 포함하는 형질전환체는 21.2 mM 농도의 글루코오스를 소비하고, 최대 10.5mM 농도의 에탄올을 생산하였다. 균주 생장 속도나 최대 생장(ODmax)은 야생형 균주와 형질전환 균주들 사이에서 특별한 차이를 보이지 않았으나, 아세트산을 제외한 에탄올 및 부티르산과 같은 대사산물 생산에는 매우 큰 차이를 보였다.
아세트산 생산 패턴 및 최대 생산량은 야생형 균주와 형질전환체들 사이에 큰 차이를 보이지 않았다. 상기 균주의 4탄소 대사산물인 부티르산은 AdhE1 포함 형질전환체에서는 거의 생산되지 않았으며, AdhE2 포함 형질전환체에서는 야생형 균주에서 4.5 mM이 생산된 것과 비교해 1.1 mM 농도로 소량의 부티르산이 생산되었다. 이러한 결과는, 이화 대사경로(catabolic pathway)에 중심적 중간물질(intermediate)인 acetyl-CoA로부터 에탄올을 생산하는 경로와 부티르산을 생산하는 경로가 서로 경쟁적일 것임을 시사한다. 이 때 AdhE1 또는 AdhE2 포함 형질전환체에서의 에탄올은 acetyl-CoA로부터 곧바로 acetaldehyde를 거치는 경로에 의해 생산될 것이다.
CO 기질조건에서 AdhE1 및 AdhE2를 각각 포함하는 형질전환체와 야생형 균주의 autotrophic 생장을 분석한 결과를 도 8에 나타내었다. 글루코오스 기질 조건과 마찬가지로 상기 야생형 균주에서는 에탄올의 생산이 감지되지 않았으며 (도 8A), 오직 형질전환체 균주에서만 에탄올이 생산되었다(도 8B, 도 8C). 같은 형질전환체 균주로써, AdhE1와 AdhE2를 포함하는 두 형질전환 균주 모두 총 11.5 mmols의 CO를 소비해 최대 28mM 정도의 농도로 에탄올을 생산하였으며, 이 중에서도 AdhE1을 포함하는 형질전환 균주가 에탄올 생산 최대치에 도달하는 속도가 더 빨랐다. 흥미로운 점으로, CO 기질 조건에서는 글루코오스 기질 조건과 달리 형질전환 균주들이 모두 상기 균주의 주된 대사산물인 아세트산을 생산하고 다시 소비하는 특성을 명확하게 나타내었다. AdhE1을 포함하는 형질전환 균주에서 생장 초기에만 아세트산이 최대 1.8 mM 농도로 생산되었고, 이렇게 생산된 아세트산이 점점 다시 소비되고 안정기(stationary phase) 이후에는 백그라운드 값 수준으로 생산이 감지되지 않았다. 이와 같은 결과는, 아세트산이 생장 초기 이후에 생산되지 않은 것이 아니라, 생장 초기 이후로의 아세트산의 생산속도와 비교해서 아세트산 재사용을 통한 에탄올 생산 속도가 동일하거나 더욱 빠르기 때문에 생장 초기 이후의 아세트산 생산이 감지되지 않은 것으로 해석된다.
AdhE2 포함 형질전환 균주 또한 앞선 AdhE1 포함 형질전환 균주에서 볼 수 있었던 특성과 같이 아세트산이 생산되고 다시 소비됨을 보였으나, AdhE1 포함 형질전환 균주와 비교해 아세트산이 다시 소비되는 속도가 느렸으며, 안정기 이후에도 아세트산이 완전히 소비되지는 않았다. 또한 두 형질전환체 모두가 생장도중 부티르산을 전혀 생산하지 않았다. 그 밖에, 생장 속도나 최대 생장(ODmax)은 앞선 글루코오스 기질 조건에서와 같이 야생형 균주와 형질전환체 균주 사이에 특별한 차이가 없었다.
Elm 균주로 진행된 이전의 연구들에서, Elm 균주의 락테이트 생산에 대하여, 언급되거나 분석된 바가 없으나, 본 발명에서는 Elm 균주가 L-lactate와 D-lactate를 모두 생산하며, 이들 L-form과 D-form이 1:1.5 정도의 생산비율로 20mM 글루코오스 기질 조건하에 최대 13 mM 정도의 총 락테이트를 생산한다는 사실을 확인하였다. 더욱이, 락테이트가 autotrophic CO 기질 조건에서는 생산되지 않으며, heterotrophic 글루코오스 기질 조건에서만 생산되는 것을을 확인하였다. 상기 균주 내의 유전적 정보에 의하면, 락테이트 생산 경로는 락테이트 디하이드로게나아제(lactate dehydrogenase, LDH; ELI_3346, ELI_4443)의 촉매 하에 피루베이트로부터 생산되며, 이 때 NADH가 전자 공여체로써의 역할을 한다. 즉, 피루베이트로부터 락테이트의 생산은 NADH와 같은 환원력만이 요구되며, 어떠한 에너지 보존도 연계되지 않은 반응이다. Heterotrophic 글루코오스 기질 조건에서는 해당과정을 통해 ATP 및 환원된 형태의 NADH가 충분히 생산되기 때문에 NAD+/NADH 균형 등의 이유로 효과적 환원력 소모를 위해 락테이트가 생산되는 것으로 해석할 수 있다. 반면, autotrophic CO 가스 대사경로는 NADH 및 ATP의 소비성 반응이기 때문에 heterotrophic 기질 조건과 달리 락테이트가 생산되지 않는 것으로 해석할 수 있다.
실시예 5: CO 기질 이용 에탄올 생산 Eubacterium limosum KCTC13263BP 형질전환 균주에서의 에탄올 생산 경로와 생물 에너지학(bioenergetics) 모델
실시예 4에서 제작된 Elm 형질전환 균주를 이용해 CO 기질 기반 에탄올 생산은 아세틸-CoA로부터 곧바로 아세트알데하이드를 거쳐 에탄올을 생산하는 경로(도 9A)와 아세테이트를 먼저 생산한 후 AOR의 매개하에 생산된 아세테이트를 재사용해 아세트알데하이드를 합성하고 에탄올을 생산하는 경로(도 9B)의 두 가지 경로를 통해 가능하다. 두 경로 모두 CO로부터 아세틸-CoA를 합성하기까지의 경로와 아세트알데하이드로부터 에탄올을 생산하는 경로는 동일하나, 아세틸-CoA로부터 아세트알데하이드를 합성하는 경로가 서로 상이하다.
도 9A와 같이 아세틸-CoA로부터 아세트알데하이드를 합성하는 경로에는 아세틸-CoA 한 분자당 동일 분자의 NADH가 요구되며, 도 9B에서와 같이 아세틸-CoA로부터 우선적으로 아세테이트가 생산된 후 재사용되어 아세트알데하이드를 합성하는 경로에는 아세틸-CoA 한 분자당 동일 분자의 환원형 페레독신(Fd2-)이 요구되며 동시에 동일 분자의 ATP가 생산된다. 이화 대사경로 상에서 reducing equivalent로써 NADH 대신 Fd2-가 사용될 경우, 산화환원 밸런싱의 개념으로 chemiosmotic energy conservation(CEC)의 일환으로써 Rnf complex에서의 Fd2-의 산화 반응이 더 적게 일어나게 된다. 따라서, 이에 따른 NAD+환원 반응과 ion(Na+ or H+)-motive force 생성 또한 더 적게 일어나게 되어, 결국은 NADH가 reducing equivalent로써 사용되었을 경우(도 9A)와 비교해 Fd2-가 사용될 경우(도 9B) CEC 메커니즘에 의한 ATP는 더 적게 생산된다. 그러나, 도 9B 경로와 같이 아세테이트 재사용을 통한 에탄올 생산의 경우, 아세테이트를 생산함을 통해 기질수준 인산화에 의한 ATP 확보가 가능하기 때문에, CEC 메커니즘에 의해 생산된 ATP 양이 도 9A 경로에 비해 적더라도 total ATP 생산량은 더욱 많다. 결론적으로, 아세테이트 재사용을 통한 에탄올의 생산은 아세틸-CoA로부터 아세테이트가 합성되는 도중에 기질수 준인산화를 통한 ATP의 확보가 가능하기 때문에, 에너지적으로 더욱 유리한 방법이다.
본 발명의 가장 의미있는 결과로써, AdhE1 발현 유전자를 포함하는 Elm 형질전환 균주가 autotrophic CO 기질 조건하에서, 상기 야생형 균주 본래의 주된 대사산물인 아세트산을 곧바로 재사용하여 에탄올로 전환할 뿐만아니라, 또 다른 대사산물인 부티르산의 생산 또한 없이 에탄올만을 단일로 생산할 수 있다는 것을 확인하였다.
또한 AdhE1 포함 상기 형질전환 균주가 heterotrophic 기질 조건이 아닌 autotrophic 기질 조건하에서 별도의 genomic DNA의 조작 없이 28mM 정도의 의미있는 농도의 에탄올을 생산함이 판명되었다. 이러한 상기 발명을 통해 얻은 AdhE1 포함 상기 형질전환 균주가 향후 합성가스 공정에 적용될 경우, 합성가스 공정의 down-stream에서의 산물 분리과정의 생략 또는 간소화가 가능하기 때문에, 산업적 적용 측면에서 매우 유망한 생촉매로의 역할을 할 것으로 예상할 수 있다.
본 발명에 따르면, 기존에 에탄올 생성능이 없는 아세토젠인 유박테리움 리모섬(Eubacterium limosum)을 이용하여, 폐가스에 포함된 일산화탄소로 부터 고부가가치의 에탄올을 생산할 수 있다.
이상으로 본 발명 내용의 특정한 부분을 상세히 기술하였는바, 당업계의 통상의 지식을 가진 자에게 있어서 이러한 구체적 기술은 단지 바람직한 실시태양일 뿐이며, 이에 의해 본 발명의 범위가 제한되는 것이 아닌 점은 명백할 것이다. 따라서, 본 발명의 실질적인 범위는 첨부된 청구항들과 그것들의 등가물에 의하여 정의된다고 할 것이다.
전자파일 첨부하였음.

Claims (8)

  1. 에탄올 생성능을 가지고 있지 않은 유박테리움 리모섬(Eubacterium limosum)에 이관능성 알데히드 알코올 디하이드로게나아제를 코딩하는 유전자가 도입되어 있는 에탄올 생성능을 가지는 형질전환 유박테리움 리모섬(Eubacterium limosum) 균주.
  2. 제1항에 있어서, 이관능성 알데히드 알코올 디하이드로게나아제를 코딩하는 유전자는 클로스트리듐 오토아세타노게눔 유래의 AdhE1 또는 AdhE2인 것을 특징으로 하는 형질전환 유박테리움 리모섬(Eubacterium limosum) 균주.
  3. 제1항에 있어서, 상기 이관능성 알데히드 알코올 디하이드로게나아제를 코딩하는 유전자는 서열번호 2의 염기서열로 표시되는 프로모터에 의해서 전사조절되는 것을 특징으로 하는 형질전환 유박테리움 리모섬(Eubacterium limosum) 균주.
  4. 제1항에 있어서, 상기 Eubacterium limosum는 Eubacterium limosum KCTC13263BP 균주인 것을 특징으로 하는 형질전환 유박테리움 리모섬(Eubacterium limosum) 균주.
  5. 제1항에 있어서, 상기 유전자의 도입은 서열번호 1의 염기서열로 표시되는 셔틀벡터 pELM을 이용하여 도입되는 것을 특징으로 하는 형질전환 유박테리움 리모섬(Eubacterium limosum) 균주.
  6. 다음 단계를 포함하는 에탄올의 제조방법:
    (a) 일산화탄소 함유 가스 존재 하에서 제1항 내지 제5항 중 어느 한 항의 형질전환 유박테리움 리모섬(Eubacterium limosum) 균주를 배양하여 에탄올을 생성시키는 단계; 및
    (b) 상기 생성된 에탄올을 수득하는 단계.
  7. 서열번호 2 또는 서열번호 3으로 표시되는 염기서열을 가지는 유박테리움 리모섬(Eubacterium limosum) 유래 항시 고발현 프로모터.
  8. 제7항에 있어서, 서열번호 2 또는 서열번호 3의 염기서열로 표시되는 프로모터와 서열번호 1의 염기서열로 표시되는 셔틀벡터 백본을 함유하는 유박테리움 리모섬(Eubacterium limosum) 균주 발현용 벡터.
PCT/KR2018/009923 2017-08-29 2018-08-28 에탄올 비생산성 아세토젠 균주를 에탄올 생성균주로 전환하는 방법 및 상기 에탄올 생성균주로부터 일산화탄소를 이용한 에탄올의 제조방법 WO2019045416A2 (ko)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US16/643,126 US11976314B2 (en) 2017-08-29 2018-08-28 Method for converting non-ethanol producing, acetogenic strain to ethanol-producing strain and method for producing ethanol from same ethanol-producing strain by using carbon monoxide

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR20170109483 2017-08-29
KR10-2017-0109483 2017-08-29

Publications (2)

Publication Number Publication Date
WO2019045416A2 true WO2019045416A2 (ko) 2019-03-07
WO2019045416A3 WO2019045416A3 (ko) 2019-05-09

Family

ID=65527504

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2018/009923 WO2019045416A2 (ko) 2017-08-29 2018-08-28 에탄올 비생산성 아세토젠 균주를 에탄올 생성균주로 전환하는 방법 및 상기 에탄올 생성균주로부터 일산화탄소를 이용한 에탄올의 제조방법

Country Status (3)

Country Link
US (1) US11976314B2 (ko)
KR (1) KR102073308B1 (ko)
WO (1) WO2019045416A2 (ko)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112175890A (zh) * 2019-07-02 2021-01-05 深伦生物科技（深圳）有限公司 一种以食用菌分泌乙醇脱氢酶的基因工程菌

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102244489B1 (ko) * 2020-07-17 2021-04-27 광주과학기술원 유박테리움 칼란데리용 유전체 편집 벡터, 이를 이용한 유박테리움 칼란데리 유전체 편집 방법 및 이를 이용하여 형질전환 된 유박테리움 칼란데리 균주
KR102507457B1 (ko) 2020-08-24 2023-03-07 포항공과대학교 산학협력단 일산화탄소로부터 유기산을 고효율로 생산하기 위한 상호공생 미생물 컨소시엄을 포함하는 조성물 및 이를 이용한 방법

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101076042B1 (ko) * 2007-12-20 2011-10-21 한국과학기술원 에탄올 및 부탄올 생성능이 증가된 재조합 미생물 및 이를이용한 에탄올과 부탄올의 제조방법
EP2245137B1 (en) 2008-01-22 2017-08-16 Genomatica, Inc. Methods and organisms for utilizing synthesis gas or other gaseous carbon sources and methanol
US20110236941A1 (en) * 2010-10-22 2011-09-29 Lanzatech New Zealand Limited Recombinant microorganism and methods of production thereof
EA201892627A1 (ru) * 2016-05-14 2019-04-30 Ланцатек, Инк. Микроорганизм с модифицированной активностью альдегид:ферредоксин оксидоредуктазы и связанные способы

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112175890A (zh) * 2019-07-02 2021-01-05 深伦生物科技（深圳）有限公司 一种以食用菌分泌乙醇脱氢酶的基因工程菌

Also Published As

Publication number Publication date
US11976314B2 (en) 2024-05-07
KR20190024783A (ko) 2019-03-08
KR102073308B1 (ko) 2020-02-05
WO2019045416A3 (ko) 2019-05-09
US20230193325A1 (en) 2023-06-22

Similar Documents

Publication Publication Date Title
Cheng et al. Metabolic engineering of Clostridium carboxidivorans for enhanced ethanol and butanol production from syngas and glucose
US8039239B2 (en) Recombinant microorganisms having modified production of alcohols and acids
KR101444968B1 (ko) 높은 수율로 ｎ-부탄올을 생물학적으로 생산하는 방법
AU2006243052B2 (en) Thermophilic microorganisms with inactivated lactate dehydrogenase gene (LDH) for ethanol production
US7691620B2 (en) Ethanol production
Abo-Hashesh et al. Metabolic engineering in dark fermentative hydrogen production; theory and practice
WO2019045416A2 (ko) 에탄올 비생산성 아세토젠 균주를 에탄올 생성균주로 전환하는 방법 및 상기 에탄올 생성균주로부터 일산화탄소를 이용한 에탄올의 제조방법
KR20130009808A (ko) 신규한 에탄올생성 클로스트리듐 종, 클로스트리듐 코스카티
JP2010508013A (ja) グリセロールから１，３−プロパンジオールを高収量で生物学的に製造する方法
BR112013003644B1 (pt) isolado biologicamente puro de uma bactéria clostridium autoethanogenum
Sinha et al. Genomic and proteomic approaches for dark fermentative biohydrogen production
US9284538B2 (en) Genes encoding key catalyzing mechanisms for ethanol production from syngas fermentation
JP2010504747A (ja) エタノール生成のための好熱性微生物
Li et al. Comparative transcriptome analysis of Clostridium tyrobutyricum expressing a heterologous uptake hydrogenase
US9045760B2 (en) Genes encoding key catalyzing mechanisms for ethanol production from syngas fermentation
TWI450963B (zh) 具高木醣消耗率之分離酵母菌株及使用該菌株製造酒精之方法
US9127323B2 (en) Isolated yeast strain having high xylose consumption rate and process for production of ethanol using the strain
US10533192B2 (en) Production of isoprene by methane-producing archaea
WO2009157736A2 (ko) 갈락토오스 이용이 억제된 미생물을 이용한 타가토오즈 제조방법
WO2022085848A1 (ko) 에탄올을 포함하는 합성 가스로부터 2,3-부탄디올 제조용 배지 조성물 및 이를 이용한 2,3-부탄디올 생산 방법
BRPI0709758A2 (pt) organismos termofÍlicos para conversço de biomassa lignocelulàsica em etanol
US9790522B2 (en) Compositions and methods for the conversion of short-chained carboxylic acids to alcohols using clostridial enzymes
WO2024107846A1 (en) Engineered syntrophic microbial consortia and uses thereof

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 18851889

Country of ref document: EP

Kind code of ref document: A2

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 18851889

Country of ref document: EP

Kind code of ref document: A2

32PN Ep: public notification in the ep bulletin as address of the adressee cannot be established

Free format text: NOTING OF LOSS OF RIGHTS PURSUANT TO RULE 112(1) EPC (EPO FORM 1205A DATED 01/02/2021)

122 Ep: pct application non-entry in european phase

Ref document number: 18851889

Country of ref document: EP

Kind code of ref document: A2