WO2017041054A1 - Compositions for improved nrf2 activation and methods of their use - Google Patents

Compositions for improved nrf2 activation and methods of their use Download PDF

Info

Publication number
WO2017041054A1
WO2017041054A1 PCT/US2016/050292 US2016050292W WO2017041054A1 WO 2017041054 A1 WO2017041054 A1 WO 2017041054A1 US 2016050292 W US2016050292 W US 2016050292W WO 2017041054 A1 WO2017041054 A1 WO 2017041054A1
Authority
WO
WIPO (PCT)
Prior art keywords
extract
luteolin
composition
rosemary
specified
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2016/050292
Other languages
English (en)
French (fr)
Inventor
Brooks Michael HYBERTSON
Joe Milton MCCORD
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Pathways Bioscience LLC
Original Assignee
Pathways Bioscience LLC
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to CN201680050947.0A priority Critical patent/CN108136209A/zh
Priority to CN202510745791.9A priority patent/CN120754114A/zh
Priority to MX2018002743A priority patent/MX394479B/es
Priority to HK18115518.1A priority patent/HK1256480A1/zh
Priority to JP2018531303A priority patent/JP6901787B2/ja
Priority to US15/757,270 priority patent/US11413269B2/en
Application filed by Pathways Bioscience LLC filed Critical Pathways Bioscience LLC
Publication of WO2017041054A1 publication Critical patent/WO2017041054A1/en
Anticipated expiration legal-status Critical
Priority to CONC2018/0003454A priority patent/CO2018003454A2/es
Priority to US17/866,488 priority patent/US20220354916A1/en
Priority to US19/370,063 priority patent/US20260108575A1/en
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/335Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin
    • A61K31/365Lactones
    • A61K31/366Lactones having six-membered rings, e.g. delta-lactones
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/12Ketones
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/185Acids; Anhydrides, halides or salts thereof, e.g. sulfur acids, imidic, hydrazonic or hydroximic acids
    • A61K31/19Carboxylic acids, e.g. valproic acid
    • A61K31/192Carboxylic acids, e.g. valproic acid having aromatic groups, e.g. sulindac, 2-aryl-propionic acids, ethacrynic acid 
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/335Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin
    • A61K31/35Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having six-membered rings with one oxygen as the only ring hetero atom
    • A61K31/352Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having six-membered rings with one oxygen as the only ring hetero atom condensed with carbocyclic rings, e.g. methantheline 
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/335Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin
    • A61K31/365Lactones
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/56Compounds containing cyclopenta[a]hydrophenanthrene ring systems; Derivatives thereof, e.g. steroids
    • A61K31/58Compounds containing cyclopenta[a]hydrophenanthrene ring systems; Derivatives thereof, e.g. steroids containing heterocyclic rings, e.g. danazol, stanozolol, pancuronium or digitogenin
    • A61K31/585Compounds containing cyclopenta[a]hydrophenanthrene ring systems; Derivatives thereof, e.g. steroids containing heterocyclic rings, e.g. danazol, stanozolol, pancuronium or digitogenin containing lactone rings, e.g. oxandrolone, bufalin
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K36/00Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
    • A61K36/18Magnoliophyta (angiosperms)
    • A61K36/185Magnoliopsida (dicotyledons)
    • A61K36/28Asteraceae or Compositae (Aster or Sunflower family), e.g. chamomile, feverfew, yarrow or echinacea
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K36/00Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
    • A61K36/18Magnoliophyta (angiosperms)
    • A61K36/185Magnoliopsida (dicotyledons)
    • A61K36/53Lamiaceae or Labiatae (Mint family), e.g. thyme, rosemary or lavender
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K36/00Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
    • A61K36/18Magnoliophyta (angiosperms)
    • A61K36/185Magnoliopsida (dicotyledons)
    • A61K36/68Plantaginaceae (Plantain Family)
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K36/00Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
    • A61K36/18Magnoliophyta (angiosperms)
    • A61K36/185Magnoliopsida (dicotyledons)
    • A61K36/80Scrophulariaceae (Figwort family)
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K36/00Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
    • A61K36/18Magnoliophyta (angiosperms)
    • A61K36/185Magnoliopsida (dicotyledons)
    • A61K36/81Solanaceae (Potato family), e.g. tobacco, nightshade, tomato, belladonna, capsicum or jimsonweed
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K36/00Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
    • A61K36/18Magnoliophyta (angiosperms)
    • A61K36/88Liliopsida (monocotyledons)
    • A61K36/906Zingiberaceae (Ginger family)
    • A61K36/9068Zingiber, e.g. garden ginger
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00Drugs for disorders of the metabolism
    • A61P3/02Nutrients, e.g. vitamins, minerals
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P39/00General protective or antinoxious agents
    • A61P39/02Antidotes
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P39/00General protective or antinoxious agents
    • A61P39/06Free radical scavengers or antioxidants

Definitions

  • the present disclosure relates to methods and compositions for preventing or treating certain health conditions. More particularly, the present disclosure relates to compositions and methods for preventing or treating certain health conditions associated with inflammation and/or oxidative stress.
  • Nrf2 Nuclear factor-erythroid 2 related factor 2
  • ARE antioxidant-responsive element
  • Nrf2 plays a pivotal role in the ARE-driven cellular defense system against oxidative stress. See, Kensler, Wakabayashi et al. 2010; Hybertson and Gao 2014, Bocci and Valacchi 2015, Huang, Li et al. 2015, Johnson and Johnson 2015, Moon and Giaccia 2015, Petiwala and Johnson 2015, Sekhar and Freeman 2015, Suzuki and Yamamoto 2015.
  • the presently disclosed instrumentalities advance the art by providing combinations of agents that activate the Nrf2 cell signaling pathway.
  • the combinations of agents may activate the Nrf2 pathway more effectively than individual agents.
  • the combinations of agents may activate the Nrf2 pathway synergistically.
  • each ingredient may contain one or more
  • phytochemicals may be found in rosemary (Rosmarinus officinalis), ginger (Zingiber officinale), luteolin (from Sophora Japonica), milk thistle (Silybum marianum), and bacopa (Bacopa monnieri).
  • the phytochemicals components are carnosol, shogaol, luteolin, silymarin, and bacosides, which may be found in rosemary, ginger, luteolin, milk thistle, and bacopa, respectively.
  • the disclosed compositions induce ARE-regulated antioxidant genes by the Nrf2-dependent pathway.
  • PB125 specific combinations of rosemary, ashwagandha, and luteolin
  • PB127 specific combinations of rosemary, ginger, luteolin, and silymarin
  • PB129 specific combinations of rosemary, ginger, luteolin, silymarin, and bacopa
  • the combination of these agents may result in a synergistic Nrf2 activation, greater than simply the sum of their individual Nrf2 activation contributions.
  • the active agents or combinations of the agents may be candidates for possible drug development. See, e.g., Koehn and Carter 2005, Lee 2010.
  • compositions may contain rosemary (carnosol), ginger (6-shogaol and 6-gingerol), ashwagandha (withaferin A), milk thistle (silymarin), bacopa monnieri (bacosides) and luteolin.
  • compositions may be administered orally, for example in the form of a tablet, capsule, softgel, syrup, aqueous solution or suspension, alcohol-extract, or powder.
  • synergistic for example in the form of a tablet, capsule, softgel, syrup, aqueous solution or suspension, alcohol-extract, or powder.
  • compositions may be administered in the form of aerosol, for example to the lungs in the form of a fine aerosol mist or powder which is inhaled and partially deposited within the lung airways.
  • the disclosed compositions may be administered by local administration, for example, by applying to the skin in the form of a lotion, gel, ointment, aqueous spray, or within a bandage applied to the skin or to a wound.
  • the disclosed composition may contain a combination of rosemary extract (specified at 5 to 10% carnosol), ginger extract (specified at 1-10% 6-shogaol and/or 10-25% 6-gingerol), and luteolin (specified at 95-98% luteolin), in the mass ratio of 10:5: 1, respectively.
  • This formula is also referred to as PB123 in this disclosure.
  • the disclosed composition may contain a combination of rosemary extract (specified at 5 to 10% carnosol), ashwagandha extract (specified at 1-3% withaferin A), and luteolin (specified at 95-98% luteolin), in the mass ratio of 30:10:4, respectively.
  • This formula is also referred to as PB125 in this disclosure.
  • the disclosed composition may contain a combination of rosemary extract (specified at 5 to 10% carnosol), ginger extract (specified at 1-10% 6-shogaol and/or 10-25% 6-gingerol), luteolin (specified at 90- 100% luteolin), and milk thistle extract (specified at 50-90% silymarin), in the mass ratio of 10:5 :1 :30, respectively.
  • This formula is also referred to as PB127 in this disclosure.
  • the disclosed composition may contain a combination of rosemary extract (specified at 5 to 10% carnosol), ginger extract (specified at 1-10% 6-shogaol and/or 10-25% 6-gingerol), luteolin (specified at 90- 100% luteolin), milk thistle extract (specified at 50-90% silymarin), and bacopa monnieri extract (specified at 10-60% bacosides) in the mass ratio of 10:5 :1 :30:48, respectively.
  • This formula is also referred to as PB129 in this disclosure.
  • the disclosed composition may contain a combination of rosemary extract (specified at 5 to 10% carnosol), ginger extract (specified at 1-10% 6-shogaol and/or 10-25% 6-gingerol), luteolin (specified at 90- 100% luteolin), and bacopa monnieri extract (specified at 10-60% bacosides) in the mass ratio of 10:5 :1 :48, respectively.
  • This formula is also referred to as PB131 in this disclosure.
  • PB123 may be administered at 10 to 1000 mg per day as an oral administration to a human.
  • it may be administered as a pill, softgel, or capsule to induce Nrf2 activation, and/or to reduce inflammation and oxidative stress, and/or to improve overall health and wellness.
  • PB123 may be administered at 10 to 1000 mg per day as an oral administration to a human to improve protein homeostasis, and/or to prevent aging-related problems associated with protein homeostasis and/or autophagy in humans.
  • PB 125 or PB 127 or PB 129 or PB 131 may be administered at 10 to 1000 mg per day as an oral administration to a human.
  • it may be administered as a pill, softgel, or capsule to induce Nrf2 activation, and/or to reduce inflammation and oxidative stress, and/or to improve overall health and wellness.
  • PB 125 or PB 127 or PB 129 or PB 131 may be administered at 10 to 1000 mg per day as an oral administration to a human to improve protein homeostasis, and/or to prevent aging-related problems associated with protein homeostasis and/or autophagy in humans.
  • Figure 1 shows the Nrf2 activation pathways and control points.
  • Figure 2 shows the "Shutdown Pathway”-Fyn-dependent deactivation of nuclear Nrf2.
  • Figure 3 shows the "Positive Feedback Loop”-Keapl degradation by Nrf2-induced gene products.
  • Figure 4 shows Nrf2 activation induced by PB123, PB125, PB127, PB129, and PB131 in a transfected breast cancer cell line.
  • Figure 5 shows Nrf2 activation induced by PB123, PB125, PB127, PB129, and PB131 in a transfected liver cancer cell line.
  • Figure 6A-6C shows the synergistic effect of Nrf2 activation induced by PB129 in HepG2 (human liver, Fig. 6A), MCF7 (human breast, Fig. 6B), and A 172 (human brain, Fig. 6C) cancer cell lines.
  • Figure 7 A-7C shows the synergistic effect of Nrf2 activation induced by PB127 in HepG2 (human liver, Fig. 7A), MCF7 (human breast, Fig. 7B), and A 172 (human brain, Fig. 7C) cancer cell lines.
  • Figure 8 shows increase of Mouse Liver HMOX1 gene expression in vivo.
  • Figure 9 shows Liver Catalase Activity Induced by PB125 in diet.
  • FIG 10 shows overlay of relative light units (RLU) observed with added luciferin after ARE-driven luciferase gene expression was induced by treatment with PB125 in stably transfected HepG2 (human liver), AREc32 (human breast), MCF7 (human breast), A549 (human lung), 293T (human kidney), and A172 (human brain) cancer cell lines. Strong Nrf2 activation was observed in liver, kidney, and breast cell lines by 5, 10, 15, 20, and 25 micrograms of PB125 per mL of culture solution.
  • RLU relative light units
  • Figure 11 shows that PB125 decreases LPS-induced expression of inflammatory genes.
  • Figure 12 shows that PB125 decreases LPS-induced expression of
  • Figure 13 shows higher GCLM gene expression as a result of PB125 administration.
  • Nrf2/ARE pathway has been implicated in the control of oxidative stress (Eggler, Gay et al. 2008, Cho and Kleeberger 2010, Huang, Li et al. 2015, Johnson and Johnson 2015).
  • Certain agents and combinations of such agents (e.g., PB125) that target the Nrf2/ARE pathway may have beneficial effects on cellular function and survival. In one embodiment, these agents and combinations thereof may alleviate inflammatory responses and oxidative stress, and may have beneficial effects on health and wellness.
  • FIG 1 shows Nrf2 activation pathways and control points A, B, C, D, and E at which low concentrations of agents that act at those control points work together to effect desired Nrf2-dependent gene expression by combinations such as PB125, PB127, and PB129.
  • Nrf2 is sequestered and kept inactive by Kelch- like ECH-associated protein 1 (Keapl), which targets Nrf2 for polyubiquitination and degradation by the proteasome.
  • Keapl Kelch- like ECH-associated protein 1
  • Nrf2 Nrf2
  • Nrf2 translocation into the nucleus enables Nrf2 to bind promotors containing the
  • Inactive cytosolic Fyn may be phosphor ylated by GSK3 , and this now active p-Fyn translocates to the nucleus, where it can phosphorylate Nrf2 at a second site resulting in nuclear export and degradation.
  • E. A "positive feedback loop" involves SESN2, SQSTMl and ULKl, gene products induced by Nrf2. SESN2, SQSTMl and ULKl collaborate to activate autophagy of Keapl , liberating more Nrf2, which induces more of these gene products, tending to maintain Nrf2 activation once this positive feedback loop has been triggered.
  • the combinations of agents gave surprisingly high Nrf2 activation levels compared to what would be predicted based on the prior art and also based on concurrent experiments examining the Nrf2 activating properties of each agent alone and what would be predicted based on adding them together.
  • the Nrf2 activation by the combination of the agents show a synergistic effect. See, e.g., Figures 6 and 7.
  • An embodiment of the present disclosure comprises combinations of dietary agents - such as in the PB125, PB127, and PB129 combinations - that act on Nrf2 activation by engagement of different, specific control points so that the combination of agents that synergistically activate the Nrf2 pathway.
  • dietary agents - such as in the PB125, PB127, and PB129 combinations - that act on Nrf2 activation by engagement of different, specific control points so that the combination of agents that synergistically activate the Nrf2 pathway.
  • Item 1 A composition comprising two or more phytochemicals selected from the group consisting of carnosol, carnosic acid, shogaol, gingerol, luteolin, and withaferin A, said one or more phytochemicals being present in the composition in an amount effective to activate the Nrf2 (Nuclear factor-erythroid 2 related factor 2) pathway.
  • Nrf2 Nuclear factor-erythroid 2 related factor 2
  • Item 2 The composition of Item 1, wherein the two or more phytochemicals exert their effects on at least two different control points of the Nrf2 activation pathway when administered to a mammal, said control points being selected from the group consisting of control points A, B, C, D and E.
  • at least one of the phytochemicals exerts its effects on one control point, while at least another phytochemical exerts its effects on a different control point of the Nrf2 activation pathway as depicted in Fig. 1.
  • Item 3 The composition of any of the preceding Items, wherein the two or more phytochemicals have a synergistic effect on Nrf2 activation when administered to a mammal.
  • Item 4 The composition of any of the preceding Items, wherein the composition comprises at least two ingredients selected from the group consisting of rosemary, ginger, luteolin, and ashwagandha.
  • Item 5 The composition of any of the preceding Items, wherein the composition also comprises one or more phytochemicals selected from the group consisting of milk thistle and bacopa.
  • Item 6 The composition of any of the preceding Items, wherein the composition comprises rosemary extract, ginger extract, and luteolin, said rosemary extract being specified at 5-10% carnosol, said ginger extract being specified at 10-20% 6-shogaol, said luteolin being specified at 95-99% luteolin, wherein the ratio between rosemary extract, ginger extract, and luteolin in the composition is approximately 10:5 :1 (w/w).
  • Item 7 The composition of any of the preceding Items, wherein the composition comprises rosemary extract, ashwagandha extract, and luteolin, said rosemary extract being specified at 5-10% carnosol, said ashwagandha extract being specified at 1-3% withaferin A, said luteolin being specified at 95-99% luteolin, wherein the ratio between said rosemary extract, ashwagandha extract, and luteolin in the composition is approximately 30:10:4 (w/w).
  • Item 8 The composition of any of the preceding Items, wherein the composition comprises rosemary extract, ginger extract, and luteolin, and wherein the ratio between said rosemary extract, ginger extract, and luteolin is approximately 10:5:1 (w/w).
  • Item 9 The composition of any of the preceding Items, wherein the composition comprises rosemary extract, ashwagandha extract, and luteolin, the ratio between said rosemary extract, ashwagandha extract, and luteolin being approximately 30: 10:4 (w/w).
  • Item 10 The composition of any of the preceding Items, wherein the composition comprises rosemary extract, ginger extract, luteolin and milk thistle extract, the ratio between said rosemary extract, ginger extract, luteolin and milk thistle extract being approximately 10:5 :1 :30 (w/w).
  • Item 11 The composition of any of the preceding Items, wherein the composition comprises rosemary extract, ginger extract, luteolin, milk thistle extract, and bacopa monnieri extract, the ratio between said rosemary extract, ginger extract, luteolin, milk thistle extract and bacopa monnieri extract being approximately 10:5:1 :30:48 (w/w).
  • Item 12 The composition of any of the preceding Items, wherein the composition comprises rosemary extract, ginger extract, luteolin, and bacopa monnieri extract, the ratio between said rosemary extract, ginger extract, luteolin, and bacopa monnieri extract being approximately 10:5:1 :48 (w/w).
  • Item 13 The composition of any of the preceding Items, wherein the composition is used to prevent and/or treat a disease or a condition selected from the group consisting of oxidative stress, detoxification, inflammation, cancer, or a related disease or condition.
  • Item 14 The composition of any of the preceding Items, wherein the composition is used as a nutritional supplement.
  • Item 15 The composition of any of the preceding Items, wherein the composition is in the form of a tablet, a capsule, a soft gel, a liquid, a lotion, a gel, a powder, an ointment, or an aerosol.
  • Item 16 A method of treating and/or preventing a disease or condition, comprising the step of administering a composition to a mammal, the composition comprising one or more phytochemicals selected from the group consisting of carnosol, carnosic acid, shogaol, gingerol, luteolin, and withaferin A, said one or more phytochemicals being present in the composition in an amount effective to activate the Nrf2 (NF-E2 related factor 2) pathway.
  • a composition comprising one or more phytochemicals selected from the group consisting of carnosol, carnosic acid, shogaol, gingerol, luteolin, and withaferin A, said one or more phytochemicals being present in the composition in an amount effective to activate the Nrf2 (NF-E2 related factor 2) pathway.
  • Item 17 The method of any of the preceding Items, wherein the composition comprises rosemary extract, ashwagandha extract, and luteolin, wherein the rosemary extract is specified at 5-10% carnosol, the ashwagandha extract is specified at 1-3% withaferin A, and the luteolin is specified at 95-99% luteolin, the ratio between said rosemary extract, ashwagandha extract, and luteolin being approximately 30: 10:4 (w/w).
  • Item 18 The method of Item 17, wherein the composition comprises rosemary extract, ginger extract, and luteolin, wherein the rosemary extract is specified at 5-10% carnosol, the ginger extract is specified at 10-20% 6-shogaol, and the luteolin is specified at 95-99% luteolin, the ratio between said rosemary extract, ginger extract, and luteolin being approximately 10:5:1 (w/w).
  • Item 19 The method of any of Items 17-18, wherein the composition is administered orally to a human at 10-1000 mg per day.
  • Item 20 The method of any of Items 17-19, wherein the composition comprises at least two phytochemicals selected from the group consisting of carnosol, carnosic acid, shogaol, gingerol, luteolin, and withaferin A, wherein the at least two phytochemicals exert their effects on at least two different control points of the Nrf2 activation pathway, said control points being selected from the group consisting of control points A, B, C, D and E.
  • Nrf2 activation is induced by the PB123, PB125, PB127, PB129, and PB131 combinations in transfected cancer cell lines independent of tissue type (breast and liver cell data are shown).
  • control points include, but are not limited to, Control point A: release of Nrf2 from binding and inhibition by Keapl ; Control point B: action on Nrf2 by enzymes such as kinases that phosphorylate and activate Nrf2; Control point C: activation of other transcription factors that improve the gene expression profile; Control point D: action on mechanisms such as Fyn that control the export of Nrf2 from the nucleus; and Control point E: degradation of Keapl and mTOR inhibition by SESN2/SQSTM1/ULK1. See Figure 1. For example the PB125 combination that includes rosemary (carnosol), ashwagandha (withaferin A), and luteolin acts at multiple control points in the Nrf2 activation pathway.
  • PB125 appears to block the pathway, permitting Nrf2 activation by a smaller amount of the PB125 dietary supplement combination.
  • a combination of agents such as PB123 or PB125, along with related combinations based on the core Nrf2 activator triads in PB123 or PB125, such as PB127, PB129, or PB131 give an improved Nrf2 activation and gene regulation response and do so at lower doses than would be predicted based on known properties of the active agents in the
  • rosemary: ashwagandha: luteolin increased Nrf2-dependent gene expression in mice fed 35 days of PB125 added to mouse chow. See Figures 8 and 9.
  • the PB125 phytochemical components are standardized, with rosemary extract (specified at 6% carnosol), ashwagandha extract (specified at 1 % withaferin A), and luteolin (specified at 98% purity), so 100 ppm equates to 6.83 x 10-5 mg rosemary extract, 2.27 x 10-5 mg ashwagandha extract, and 9.43 x 10-6 mg luteolin per g of diet.
  • PB125 in mouse diet activates the Nrf2 pathway (e.g., increased hmoxl gene expression in mouse liver) and increases catalase activity.
  • the PB125 dosages were well tolerated by mice as evidenced by no change compared to control diet in weight stability, consistent food intake, and no noticeable GI distress or changes in behavior.
  • the 100 ppm PB125 diet produced significant increases in liver hmoxl gene expression in mice (measured after 35 days of diet consumption)( Figure 8).
  • PB125, PB127, and PB129 have a long history of human consumption and proven safety in both humans and in animal studies (Sailer, Meier et al. 2001, Roodenrys, Booth et al. 2002, Aggarwal, Takada et al. 2004, Boon and Wong 2004, Anadon, Martinez-Larranaga et al. 2008, Zick, Djuric et al. 2008, Johnson 2011 , Chandrasekhar, Kapoor et al. 2012, Theoharides, Asadi et al. 2012, Taliou, Zintzaras et al. 2013, Zhang, Gan et al. 2013, Gonzalez- Vallinas, Reglero et al.
  • rosemary has a long history of use in traditional therapies for the treatment of a variety of disorders [1], with emphasis on anti-inflammatory (Emami, Ali-Beig et al. 2013), antioxidant (Klancnik, Guzej et al. 2009, Raskovic, Milanovic et al. 2014, Ortuno, Serrano et al. 2015), and antimicrobial benefits (Del Campo, Amiot et al. 2000, Bozin, Mimica-Dukic et al. 2007). Ashwagandha
  • Ginger has a long history of safe usage for pain, GI, and aging-related conditions, with evidence of benefit against oxidative stress (Wang, Zhang et al. 2014, Lakhan, Ford et al. 2015, Wilson 2015). Silymarin has a good safety profile (Sailer, Meier et al. 2001, Jacobs, Dennehy et al. 2002) even in those with cirrhosis, and even at high doses (up to 900mg a day) that are much higher than used in PB127 or PB129.
  • Luteolin is a bioflavanoid flavone compound commonly consumed in the human diet from multiple food sources (e.g., onions, tea, apples, broccoli, olives, celery, spinach, oranges, oregano, etc.), resulting in a typical dietary intake of approximate 1 mg/day from normal from food sources (Chun, Chung et al. 2007, Seelinger, Merfort et al. 2008, Jun, Shin et al. 2015, Kim, Park et al.
  • Luteolin is frequently utilized as a dietary supplement with emphasis on its antioxidant (Sun, Sun et al. 2012), neurological (Xu, Wang et al. 2014), and anti-inflammatory benefits (Seelinger, Merfort et al. 2008, Taliou, Zintzaras et al. 2013, Paredes-Gonzalez, Fuentes et al. 2015).
  • PB125 As an example of properties of PB125, we cultured cell lines that had been stably transfected with constructs of the luciferase gene driven in its promoter region by copies of the ARE Nrf2 -binding sequence, known as promoter-reporter constructs (Simmons, Fan et al. 2011, Shukla, Huang et al. 2012). Briefly, the stably transfected cells of types HepG2 (human liver), AREc32 (human breast), MCF7 (human breast), A549 (human lung), 293T (human kidney), and A172 (human brain) were seeded at low density in 24-well plates and incubated at 37°C with 10% C02. After 24 h various concentrations of PB125 were added to the cells.
  • HepG2 human liver
  • AREc32 human breast
  • MCF7 human breast
  • A549 human lung
  • 293T human kidney
  • A172 human brain
  • the cells were lysed in their wells with 100 ⁇ of a lysing buffer that contains 3.5 mM sodium pyrophosphate to stabilize light output by luciferase.
  • a 20 ⁇ aliquot of cell lysate was added to a small test tube, placed in a BD Monolight 3010 luminometer for background luminescence, and then 50 ⁇ of 1 mM luciferin was injected into the tube.
  • Relative Light Units integrated for 10 sec were measured for each sample.
  • the liver, breast, brain, and kidney cell types tested exhibited Nrf2 gene activation and luciferase expression by treatment with PB100- series combinations with ( Figure 10).
  • RNA was extracted from the HepG2 cells by using the RNeasy Total RNA Isolation Kit (QIAGEN Inc. Valencia, California, USA). The concentration of each sample was determined based on the absorbance at 260 nm (A260). The purity of each sample was determined based on the ratio of A260 to A280. A range of 1.9-2.1 was considered adequately pure. The integrity of Total RNA samples was verified by Agilent 2200 Tape Station. Total RNA (250ng) was converted to double- stranded cDNA (ds-cDNA) by using the cDNA synthesis kit (Affymetrix). An oligo-dT primer containing a T7 RNA polymerase promoter was utilized.
  • the ds-cDNA was then purified and recovered by using purification beads (Affymetrix).
  • in vitro transcription was performed to generate biotin-labeled cRNA using a RNA Transcript Labeling Kit (Affymetrix).
  • Biotin-labeled cRNA was purified using an RNeasy affinity column (Qiagen). To ensure optimal hybridization to the oligonucleotide array, the cRNA was fragmented. Fragmentation was performed such that the cRNA fragments are between 50-200 bases in length by incubating the cRNA at 94°C for 35 min in a fragmentation buffer.
  • Hybridization was performed by incubating 200 uL of the sample to the Affymetrix GeneChip® Prime ViewTM human gene expression array (Affymetrix Inc., Santa Clara, California, USA) at 45 °C for 16 hours using a GeneChip® Hybridization Oven 640 (Affymetrix).
  • genes upregulated by PB125 included a variety of Nrf2-regulated antioxidant, antiinflammatory, cell stress response and other protective genes. These genes include, for example, genes involved in GSH production and regeneration, iron sequestration, GSH utilization, thioredoxin (TXN) production, regeneration and ultilization, etc. Table 1 lists relevant example genes that are upregulated by PB125. In summary, this example supports that the mechanism of cellular protection by PB125 involves activation of the Nrf2 cell signaling pathway.
  • TNFa tumor necrosis factor-alpha
  • IL- ⁇ inter leukin- 1 beta
  • rosemary: ashwagandha: luteolin increased Nrf2-dependent gene expression of the GCLM gene in buccal cell samples from a human subject taking 60 mg of PB125 daily p.o., compare to buccal cell samples two normal control subjects (assayed by quantitative RT-PCR on purified RNA, using human GCLM specific primers (Forward Primer: TTGCCTCCTGCTGTGTGATG (SEQ ID NO. 1), Reverse Primer: GTGCGCTTGAATGTCAGGAA) (SEQ ID NO. 2), normalized to GAPDH, with relative fold change calculated by the 2 A (delta delta Ct) method. See Figure 13.
  • luciferase RLU measured 17, 24, 41, and 48 hours after treatment of HepG2 cells in which the PB125 treatment at 0-10 ug/mL and 0-50 ug/mL ranges was washed off after 2 hours of exposure time and replaced by fresh cell culture media showed that Nrf2-driven production of luciferase was highest at 17 h, then rapidly decreased to approximately baseline levels by 48 hours after treatment.
  • LPS stimulation induced the expression of inflammation-related genes, and this upregulation was attenuated by treatment with PB 123 or PB125.
  • Table 2 shows the 40 genes most highly upregulated by LPS treatment, and shows that both PB123 treatment and PB125 treatment attenuated LPS-induced gene expression.
  • LPS stimulation increased the release of pro-inflammatory interleukin-6 (IL6) protein from the HPAEC cells, and this increase was attenuated by treatment with PB125. See Figure 12.
  • IL6 pro-inflammatory interleukin-6
  • One embodiment of the present disclosure is a combination of rosemary extract (specified at 5 to 50% carnosol), ashwagandha extract (specified at 0.5-10% withaferin A), and luteolin (specified at 10-100% luteolin), in the mass ratios of 30:10:6, 30:10:5, 30:10:4, or 30:10:1 with a daily human dose of the combination ranging from 42 to 1050 mg as shown in Table 3.
  • Table 3. Composition with specifications for the ingredients and the daily dose ranges of PB125 for human
  • Another embodiment of the present disclosure is a PB127 combination of rosemary extract (specified at 5 to 10% carnosol), ginger extract (specified at 1- 10% 6-shogaol and/or 10-25% 6-gingerol), luteolin (specified at 90-100% luteolin), and milk thistle extract (specified at 50-90% silymarin), in the mass ratio of
  • Another embodiment of the present disclosure is a PB129 combination of rosemary extract (specified at 5 to 10% carnosol), ginger extract (specified at 1-10% 6-shogaol and/or 10-25% 6-gingerol), luteolin (specified at 90- 100% luteolin), milk thistle extract (specified at 50-90% silymarin), and bacopa monnieri extract (specified at 10-60% bacosides) in the mass ratio of 10:5:1:30:48, respectively, with a daily human dose of the combination ranging from 94 to 1820 mg as shown in Table 5.
  • Another embodiment of the present disclosure is a PB123 combination of rosemary extract (specified at 5 to 10% carnosol), ginger extract (specified at 1-10% 6-shogaol and/or 10-25% 6-gingerol), luteolin (specified at 90- 100% luteolin) in the mass ratio of 10:5:1, respectively, with a daily human dose of the combination ranging from 16 to 320 mg as shown in Table 6.
  • Another embodiment of the present invention is a PB 131 combination of rosemary extract (specified at 5 to 10% carnosol), ginger extract (specified at 1-10% 6-shogaol and/or 10-25% 6-gingerol), luteolin (specified at 90- 100% luteolin) and bacopa monnieri extract (specified at 10-60% bacosides) in the mass ratio of 10:5:1 :48, respectively, with a daily human dose of the combination ranging from 64 to 1220 mg as shown in Table 7.
  • Emami F., H. Ali-Beig, S. Farahbakhsh, N. Mojabi, B. Rastegar-Moghadam, S.

Landscapes

  • Health & Medical Sciences (AREA)
  • Natural Medicines & Medicinal Plants (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • General Health & Medical Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Medicinal Chemistry (AREA)
  • Epidemiology (AREA)
  • Engineering & Computer Science (AREA)
  • Alternative & Traditional Medicine (AREA)
  • Microbiology (AREA)
  • Mycology (AREA)
  • Botany (AREA)
  • Biotechnology (AREA)
  • Medical Informatics (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Organic Chemistry (AREA)
  • Toxicology (AREA)
  • Pain & Pain Management (AREA)
  • Biochemistry (AREA)
  • Rheumatology (AREA)
  • Hematology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Diabetes (AREA)
  • Obesity (AREA)
  • Nutrition Science (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines Containing Plant Substances (AREA)
  • Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)
  • Coloring Foods And Improving Nutritive Qualities (AREA)
PCT/US2016/050292 2015-09-03 2016-09-02 Compositions for improved nrf2 activation and methods of their use Ceased WO2017041054A1 (en)

Priority Applications (9)

Application Number Priority Date Filing Date Title
CN202510745791.9A CN120754114A (zh) 2015-09-03 2016-09-02 用于改进nrf2激活的组合物和其使用方法
MX2018002743A MX394479B (es) 2015-09-03 2016-09-02 Composiciones para activación de nrf2 mejorada y sus métodos de uso.
HK18115518.1A HK1256480A1 (zh) 2015-09-03 2016-09-02 用於改进nrf2激活的组合物和其使用方法
JP2018531303A JP6901787B2 (ja) 2015-09-03 2016-09-02 改善されたnrf2活性化のための組成物及びその使用方法
US15/757,270 US11413269B2 (en) 2015-09-03 2016-09-02 Compositions for improved NRF2 activation and methods of their use
CN201680050947.0A CN108136209A (zh) 2015-09-03 2016-09-02 用于改进nrf2激活的组合物和其使用方法
CONC2018/0003454A CO2018003454A2 (es) 2015-09-03 2018-03-27 Composiciones que contienen productos fitoquímicos y sus métodos de uso
US17/866,488 US20220354916A1 (en) 2015-09-03 2022-07-16 Compositions for improved nrf2 activation and methods of their use
US19/370,063 US20260108575A1 (en) 2015-09-03 2025-10-27 Compositions for improved nrf2 activation and methods of their use

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US201562214175P 2015-09-03 2015-09-03
US62/214,175 2015-09-03
US201662355810P 2016-06-28 2016-06-28
US62/355,810 2016-06-28

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US15/757,270 A-371-Of-International US11413269B2 (en) 2015-09-03 2016-09-02 Compositions for improved NRF2 activation and methods of their use
US17/866,488 Continuation-In-Part US20220354916A1 (en) 2015-09-03 2022-07-16 Compositions for improved nrf2 activation and methods of their use

Publications (1)

Publication Number Publication Date
WO2017041054A1 true WO2017041054A1 (en) 2017-03-09

Family

ID=58188643

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2016/050292 Ceased WO2017041054A1 (en) 2015-09-03 2016-09-02 Compositions for improved nrf2 activation and methods of their use

Country Status (9)

Country Link
US (1) US11413269B2 (https=)
JP (1) JP6901787B2 (https=)
CN (2) CN120754114A (https=)
CL (1) CL2018000573A1 (https=)
CO (1) CO2018003454A2 (https=)
HK (1) HK1256480A1 (https=)
MX (2) MX394479B (https=)
PE (1) PE20190380A1 (https=)
WO (1) WO2017041054A1 (https=)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2018197394A1 (en) * 2017-04-27 2018-11-01 Dsm Ip Assets B.V. Use of withania somnifera extract to protect against air pollution related diseases

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20220354916A1 (en) * 2015-09-03 2022-11-10 Pathways Bioscience, Llc Compositions for improved nrf2 activation and methods of their use
IL264076B (en) * 2016-07-11 2022-07-01 The State Of Israel Ministry Of Agriculture & Rural Development Agricultural Res Organization Aro Vo Treatment of follicular tonsillitis using plant extracts containing carnosic acid

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20090304823A1 (en) * 2006-04-03 2009-12-10 Nestec S.A. Nutritional compositions for promotion of bone growth and maintenance of bone health and methods regarding same
US20140271944A1 (en) * 2004-03-23 2014-09-18 Lifeline Nutraceuticals Compositions for Alleviating Inflammation and Oxidative Stress in a Mammal
US20140287071A1 (en) * 2013-01-17 2014-09-25 Lifevantage Corporation Veterinary supplements
WO2014151891A1 (en) * 2013-03-14 2014-09-25 Walley Darlene Topical products
WO2016037971A1 (en) * 2014-09-08 2016-03-17 Bios Line S.P.A. Compositions comprising glucosinolates precursors of sulforaphane in combination with extracts of rosemary

Family Cites Families (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5888514A (en) * 1997-05-23 1999-03-30 Weisman; Bernard Natural composition for treating bone or joint inflammation
WO2006073042A1 (ja) * 2005-01-05 2006-07-13 Toagosei Co., Ltd. Nrf2依存遺伝子の活性化剤
EP2265126A4 (en) 2008-03-10 2011-06-29 Univ Louisville Res Found PROCESS AND COMPOSITIONS FOR THE CONTROLLED DELIVERY OF PHYTOCHEMICALS
CN102164508B (zh) 2008-07-31 2015-04-01 嘉康利公司 具有增加的抗氧化活性的麝香葡萄组合物
JP2011057654A (ja) 2009-09-14 2011-03-24 Iwate Univ メタボリックシンドローム治療又は予防薬、及び脂肪細胞分化抑制方法
CA2785581A1 (en) 2009-12-24 2011-06-30 Stanley Kubow Compositions and methods for preventing and treating diseases and environmentally induced health disorders
KR101254847B1 (ko) * 2010-05-27 2013-04-15 한림대학교 산학협력단 실리비닌(silibinin)을 포함하는 골다공증 치료 및 예방용 조성물
WO2012142511A2 (en) 2011-04-15 2012-10-18 Md Matrix Health Llc Dba Md Matrix Health Inc Orthomolecular compositions and their use in stabilizing the extracellular matrix
CN104540513B (zh) * 2012-01-16 2019-04-05 赫克托·德·杰休斯·维莱斯-里韦拉 用于治疗与关节疾病相关疼痛的植物组合物
JP2013209351A (ja) * 2012-03-30 2013-10-10 Sunstar Inc 抗酸化機能亢進剤
CA2917921C (en) * 2013-07-17 2021-08-03 Council Of Scientific & Industrial Research Pharmaceutical composition for the treatment of diminution of bone tissue

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20140271944A1 (en) * 2004-03-23 2014-09-18 Lifeline Nutraceuticals Compositions for Alleviating Inflammation and Oxidative Stress in a Mammal
US20090304823A1 (en) * 2006-04-03 2009-12-10 Nestec S.A. Nutritional compositions for promotion of bone growth and maintenance of bone health and methods regarding same
US20140287071A1 (en) * 2013-01-17 2014-09-25 Lifevantage Corporation Veterinary supplements
WO2014151891A1 (en) * 2013-03-14 2014-09-25 Walley Darlene Topical products
WO2016037971A1 (en) * 2014-09-08 2016-03-17 Bios Line S.P.A. Compositions comprising glucosinolates precursors of sulforaphane in combination with extracts of rosemary

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2018197394A1 (en) * 2017-04-27 2018-11-01 Dsm Ip Assets B.V. Use of withania somnifera extract to protect against air pollution related diseases
CN110545831A (zh) * 2017-04-27 2019-12-06 帝斯曼知识产权资产管理有限公司 Withania somnifera提取物提供针对空气污染相关疾病的保护的用途

Also Published As

Publication number Publication date
US20180250264A1 (en) 2018-09-06
MX2018002743A (es) 2018-06-06
JP6901787B2 (ja) 2021-07-14
PE20190380A1 (es) 2019-03-08
MX394479B (es) 2025-03-24
JP2018529763A (ja) 2018-10-11
CO2018003454A2 (es) 2018-08-31
MX2022009446A (es) 2022-09-05
CN108136209A (zh) 2018-06-08
US11413269B2 (en) 2022-08-16
HK1256480A1 (zh) 2019-09-27
CL2018000573A1 (es) 2019-01-11
CN120754114A (zh) 2025-10-10

Similar Documents

Publication Publication Date Title
Girisa et al. Xanthohumol from Hop: Hope for cancer prevention and treatment
Grabowska et al. Let food be your medicine: nutraceutical properties of lycopene
Lum et al. Protective effect of natural products against Huntington’s disease: an overview of scientific evidence and understanding their mechanism of action
Barboza et al. An overview on the anti‐inflammatory potential and antioxidant profile of eugenol
Meybodi et al. Phytochemicals in cancer prevention: a review of the evidence.
Aggarwal et al. Prevention and treatment of colorectal cancer by natural agents from mother nature
Wang et al. Recent advances in natural therapeutic approaches for the treatment of cancer
Fahmideh et al. The role of natural products as inhibitors of JAK/STAT signaling pathways in glioblastoma treatment
Roy et al. Anti-inflammatory effects of different dietary antioxidants
Yang et al. Plant foods and their bioactives as dietary enhancers for colon cancer treatment with 5-fluorouracil
Ralhan et al. Nuclear factor-kappa B links carcinogenic and chemopreventive agents
Ravichandra et al. Anticancer plants: chemistry, pharmacology, and potential applications
US11413269B2 (en) Compositions for improved NRF2 activation and methods of their use
Zhang et al. From laboratory to clinic: opportunities and challenges of functional food active ingredients in cancer therapy
Mattathi et al. Exploring the potential of dietary phytochemicals in cancer therapeutics: Modulating apoptosis and autophagy
Cassé Molecular mechanisms of Annona muricata anti-proliferative/anti-cancer properties
US20260108575A1 (en) Compositions for improved nrf2 activation and methods of their use
Shobha et al. Oxidative stress and antioxidant herbs and spices in cancer prevention
Singh et al. Combinatorial approaches utilizing nutraceuticals in cancer chemoprevention and therapy: a complementary shift with promising acuity
Das et al. Nutraceuticals for Prevention and Treatment of Cancer
Leo et al. Functional Foods and Chemoprevention in Cancer
Öner et al. Novel natural compounds for hepatocellular carcinoma treatment
Przerwa et al. Selected substances of natural origin with anticancer activity
Chen Ursolic Acid Inhibited Proliferation and Invasion of MDA-MB-231 Human Breast Cancer Cells via Regulating Cellular Signal Transduction Pathways
Alam et al. Flavonoids in the Treatment of Gastrointestinal Tract Cancer

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 16843154

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2018531303

Country of ref document: JP

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 000340-2018

Country of ref document: PE

Ref document number: MX/A/2018/002743

Country of ref document: MX

Ref document number: 15757270

Country of ref document: US

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 16843154

Country of ref document: EP

Kind code of ref document: A1