WO2016182273A1 - 사카로마이세스 세레비지애 효모의 만노스 인산화 활성에 핵심적인 유전자 mnn14 및 그 결손 변이주를 활용한 재조합 당단백질 생산 방법 - Google Patents

사카로마이세스 세레비지애 효모의 만노스 인산화 활성에 핵심적인 유전자 mnn14 및 그 결손 변이주를 활용한 재조합 당단백질 생산 방법 Download PDF

Info

Publication number
WO2016182273A1
WO2016182273A1 PCT/KR2016/004759 KR2016004759W WO2016182273A1 WO 2016182273 A1 WO2016182273 A1 WO 2016182273A1 KR 2016004759 W KR2016004759 W KR 2016004759W WO 2016182273 A1 WO2016182273 A1 WO 2016182273A1
Authority
WO
WIPO (PCT)
Prior art keywords
protein
gene
mnn4
mnn14
activity
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/KR2016/004759
Other languages
English (en)
French (fr)
Inventor
오두병
권오석
강지연
김영훈
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Korea Research Institute of Bioscience and Biotechnology KRIBB
Original Assignee
Korea Research Institute of Bioscience and Biotechnology KRIBB
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Korea Research Institute of Bioscience and Biotechnology KRIBB filed Critical Korea Research Institute of Bioscience and Biotechnology KRIBB
Publication of WO2016182273A1 publication Critical patent/WO2016182273A1/ko
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/80Vectors or expression systems specially adapted for eukaryotic hosts for fungi
    • C12N15/81Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/37Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from fungi
    • C07K14/39Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from fungi from yeasts
    • C07K14/395Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from fungi from yeasts from Saccharomyces
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/79Transferrins, e.g. lactoferrins, ovotransferrins
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P21/00Preparation of peptides or proteins
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P21/00Preparation of peptides or proteins
    • C12P21/005Glycopeptides, glycoproteins
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P21/00Preparation of peptides or proteins
    • C12P21/02Preparation of peptides or proteins having a known sequence of two or more amino acids, e.g. glutathione
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12RINDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00Microorganisms ; Processes using microorganisms
    • C12R2001/645Fungi ; Processes using fungi
    • C12R2001/85Saccharomyces
    • C12R2001/865Saccharomyces cerevisiae

Definitions

  • the present invention relates to a recombinant yeast strain in which both the activities of Mnn4 protein and Mnn14 protein are weakened compared to endogenous activity, and a method for producing a humanized oligosaccharide-attached recombinant glycoprotein.
  • glycoproteins added by glycosylation are currently leading the market with over 60% of the global market for recombinant protein pharmaceuticals.
  • sugar chains are emerging as a major factor in determining the quality of drugs because they play an important role in the therapeutic efficacy, glycemic sustainability, targeting and immune response of glycoprotein drugs.
  • the addition reaction in which sugar chain is largely N - O bond or a - combination glycosylation and two types of (N -linked or O -linked glycosylation) the of the N - a sugar chain which is added via the binding glycosylation N - oligosaccharide ( N -glycan) and starts in the endoplasmic reticulum.
  • Glc 3 Man 9 GlcNAc 2 -PP-Dol which is an oligosaccharide linked to Dolichol pyrophosphate (PP-Dol) present in the endoplasmic reticulum membrane, is formed.
  • oligosaccharyltransferase transfers it to N -glycosylation sequence of NXS / T sequence in the protein translated from ribosomes to endoplasmic reticulum by co-translational translocation mechanism.
  • Glucosidase and mannosidase which are responsible for the quality control of glycoprotein folding in the endoplasmic reticulum, remove glucose and specific mannose at the end, resulting in a Man 8 GlcNAc 2 structure. It is transferred to the Golgi apparatus with the high-mannose type oligosaccharide attached thereto.
  • N -acetylglucosaminyltransferase (GNT) I was added to add one GlcNAc, followed by mannosidase II to remove two more mannose that was added to the opposite branch, to the trimannosyl core (Man 3 GlcNAc 2 )
  • GNT II is applied to the branch from which mannose has been removed, thereby adding another GlcNAc, thereby generating oligosaccharides having two antenna structures.
  • four antenna structures, such as GNT IV and V may be produced. In some cases, up to six antenna structures may be produced by GNT VI, V, or VB.
  • the beta-galactosyltransferase and alpha-sialyltrasnferase which are present in the Golgi apparatus, are acted on the complex to add galactose and sialic acid on the GlcNAc.
  • Sugar chain structure is made.
  • Yeasts are eukaryotic microorganisms, which are easy to handle, easy to handle, and can produce a large amount of protein at low cost, resulting in high economical efficiency and high safety as they are not likely to be contaminated with viruses and prions that infect humans.
  • the oligosaccharide structure synthesized in yeast is very different from that of humans, causing a problem in generating an immune response when injected into the human body.
  • Yeast has the same oligosaccharide biosynthesis process as the higher animals up to the endoplasmic reticulum, but has a yeast specific oligosaccharide modification pathway to which mannose is additionally added after migration to Golgi.
  • mannose-1-phosphate to a sugar chain is added by the mannose phosphorylation (mannosylphosphorylation) is added to "mannose-1-phosphate -6- O - mannose (mannose-1-phosphate-6- O -mannose)" in the form of acid
  • mannose phosphorylation mannose-1-phosphate -6- O - mannose (mannose-1-phosphate-6- O -mannose)" in the form of acid
  • sugar chains are produced. This is mainly caused by mannose phosphorylation by an enzyme expressing the MNN6 gene, and MNN4 has been suggested as a gene expressing a protein controlling it (Odani et al., Glycobiol., 6: 805, 1996; Odani et al. FEBS Lett., 420: 1860, 1997).
  • the sugar chain attached to the glycoprotein produced by the yeast cannot be used for medical purposes because it has a different structure from that of humans and causes an immune response when injected into the human body, so that yeast-specific sugar chain is added to solve this problem.
  • Methods have been proposed to disrupt glycotransferase genes.
  • OCH1 gene and ⁇ (1,3) - to break through the MNN1 gene, such as for adding mannose presented are methods to prevent the addition of yeast-specific sugar chain (Nakayama et al, EMBO J, 11: 2511, 1992; Nakanishi-Shindo. et al., J Biol Chem, 268: 26338, 1993).
  • sugar bran branches in the form of "mannose-1-phosphate-6- O -mannose" formed by the addition of mannose phosphate by MNN4 and MNN6 mentioned above may cause an immune response when injected into the human body. To produce protein, it must be removed. Therefore, even with defects MNN4 gene known to control the addition of mannose phosphate with normal OCH1 gene and MNN1 to prevent yeast-specific sugar chain biosynthesis in S. cerevisiae yeast (Chiba et al, J Biol Chem 273:. 26298, 1998 ). However, deletion of the MNN4 gene does not completely eliminate the additive activity of mannose phosphate (Odani et al ., Glycobiol 6: 805, 1996). Therefore, it is assumed that there are other genes with the additional activity of mannose phosphate, but it is not reported yet which gene is responsible for this activity.
  • Mnn14 gene in S. cerevisiae strain is involved in mannose phosphorylation, MNN4
  • the present invention was completed by clarifying that addition of mannose phosphate is eliminated when a double deletion of the gene and the MNN14 gene occurs.
  • One object of the present invention is to provide a recombinant yeast strain in which the addition of mannose phosphoric acid is controlled.
  • Another object of the present invention to provide a method for producing a recombinant glycoprotein using the recombinant yeast strain.
  • Another object of the present invention is to provide the use of the protein represented by SEQ ID NO: 1 for use in controlling the addition of mannose phosphoric acid in glycoproteins.
  • Another object of the present invention is to provide a use of the protein represented by SEQ ID NO: 1 for use in mannose phosphorylation.
  • a more humanized oligosaccharide-attached glycoprotein can be prepared by eliminating the addition of yeast-specific mannose phosphate, which does not cause an immune response during human injection.
  • 1 is an experimental result of deletion of the MNN4 gene from the och1 ⁇ mnn1 ⁇ strain.
  • a 2.5 kbp DNA fragment was obtained by amplifying the loxP - LEU2 - loxP cassette from pUG73 using polymerase chain reaction using Mnn4_F and Mnn4_R primers.
  • B the introduction of defects cassette prepared och1 ⁇ mnn1 ⁇ strain and MNN4 gene by using the SC-Leu shop of the transformants selected on medium of confirmation from the genomic DNA primers Leu2-CF and Mnn4-CR is replaced with the LEU2 gene 1.8 It is the result of confirming the deletion of MNN4 by amplifying the DNA fragment of kbp.
  • Figure 2 is an experimental result of deleting the MNN6 gene from the och1 ⁇ mnn1 ⁇ mnn4 ⁇ strain.
  • a 1.7 kbp DNA fragment was obtained by amplifying the loxP - URA3 - loxP cassette from pUG72 by polymerase chain reaction using Mnn6_F and Mnn6_R primers.
  • B The prepared deletion cassette was introduced into the och1 ⁇ mnn1 ⁇ mnn4 ⁇ strain, and the MNN6 gene was replaced with the URA3 gene using Mnn6-CF and Ura3-CR, which are primers for confirmation from the genomic DNA of the transformants selected from the SC-Ura medium. This is a result of confirming the deletion of MNN6 by amplifying the DNA fragment of kbp.
  • FIG. 3 is a result of analyzing the N -sugar chains obtained from CWMs of och1 ⁇ mnn1 ⁇ strains and strains additionally deleted MNN4 and MNN6 gene using a DNA sequencer. Maltodextrin reference profiles representing glucose units were shown in the first panel for relative positioning (Dex). Three oligosaccharide peaks of (Man-P) 2 -Man 8 GlcNAc 2 , Man-P-Man 8 GlcNAc 2 and Man 8 GlcNAc 2 were principally observed in the profile of all deletion strains ( och1 ⁇ mnn1 ⁇ , och1 ⁇ mnn1 ⁇ mnn4 ⁇ , och1 ⁇ mnn1 ⁇ mnn4 ⁇ mnn6 ⁇ ).
  • FIG. 4 shows the results of identity and homology analysis between the Mnn6 protein and these proteins.
  • loxP - URA3 - loxP cassette from pUG72 vector using primers with homologous sites 5 ′ and 3′-UTR for the MNN14 , YUR1 , KTR2 , KTR4 , KTR5 and KTR7 gene deletion cassettes was amplified by polymerase chain reaction to obtain a 1.7 kbp DNA fragment.
  • FIG. 6 shows the results of analysis of the N -sugar chains obtained from CWMs of och1 ⁇ mnn1 ⁇ mnn4 ⁇ mnn6 ⁇ strains cultured in minimal medium and strains additionally deleted with homologous genes of MNN4 or MNN6 .
  • a maltodextrin reference for relative positioning was first placed in a panel (Dex).
  • FIG. 8 is an analysis result of the N- sugar chains obtained from CWMs of strains missing the MNN14 gene.
  • a maltodextrin reference for relative positioning was first placed in a panel (Dex).
  • the following panel shows the N - glycochain profiles of the och1 ⁇ mnn1 ⁇ mnn4 ⁇ mnn6 ⁇ mnn14 ⁇ , och1 ⁇ mnn1 ⁇ mnn4 ⁇ mnn14 ⁇ , and och1 ⁇ mnn1 ⁇ mnn14 ⁇ strains in turn. Oligosaccharide peaks were displayed in the same manner as in FIG. 3.
  • Figure 9 is a complementation experiment results to see whether the recovery of mannose phosphorylation ability by expressing the MNN4 or MNN14 gene in the och1 ⁇ mnn1 ⁇ mnn4 ⁇ mnn14 ⁇ strain mannose phosphorylation ability was removed.
  • a maltodextrin reference for relative positioning was first placed in a panel (Dex).
  • the next panel shows the N -sugar chain profiles of strains transformed with YEp352-GAP (Mock), YEp352-Mnn4 (Mnn4) or YEp352-Mnn14 (Mnn14) vectors in turn. Oligosaccharide peaks were displayed in the same manner as in FIG. 3.
  • Figure 10 is a complementation experiment results to see whether the recovery of mannose phosphorylation ability by expressing the MNN4 or MNN14 gene in the och1 ⁇ mnn1 ⁇ mnn4 ⁇ mnn6 ⁇ mnn14 ⁇ strain mannose phosphorylation ability was removed. Panel order and oligosaccharide peaks are shown in the same manner as in FIG. 9.
  • Figure 11 shows the N -sugar experiment profile of purified recombinant Gas1 protein secreted and expressed in och1 ⁇ mnn1 ⁇ mnn4 ⁇ mnn6 ⁇ , och1 ⁇ mnn1 ⁇ mnn4 ⁇ mnn14 ⁇ , och1 ⁇ mnn1 ⁇ mnn4 ⁇ mnn14 ⁇ / Mnn4 and och1 ⁇ mnn1 ⁇ mnn4 ⁇ mnn14 ⁇ / Mnn14 strains.
  • Each oligosaccharide peak is represented in the same manner as in FIG. 3.
  • FIG. 12 shows the recombinant isoelectric point (IoF) by purifying recombinant Gas1 protein secreted from strains och1 ⁇ mnn1 ⁇ mnn4 ⁇ mnn6 ⁇ , och1 ⁇ mnn1 ⁇ mnn4 ⁇ mnn14 ⁇ , och1 ⁇ mnn1 ⁇ mnn4 ⁇ mnn14 ⁇ / Mnn4 and och1 ⁇ mnn1 ⁇ mnn4 ⁇ mnn14 ⁇ / Mnn14 .
  • IoF isoelectric point
  • the present invention provides a recombinant yeast strain wherein the addition of mannose phosphoric acid is controlled.
  • the yeast strain may be unnaturally generated, but is not limited thereto.
  • the present invention provides recombinant yeast strains in which the activity of Mnn4 protein and Mnn14 protein are both attenuated compared to endogenous activity.
  • Mnn4 protein is a protein involved in mannose phosphorylation of oligosaccharides (also called oligosaccharides).
  • the Mnn4 protein is known as a putative positive regulator of mannosylphosphate transferase.
  • the Mnn4 protein is also named YKL200C, YKL201C.
  • the Mnn4 protein and genetic information encoding the same may be obtained through a database such as the US National Institute of Health GenBank.
  • the Mnn4 protein may have an amino acid sequence represented by SEQ ID NO: 3 (nucleotide sequence of SEQ ID NO: 4), This is not restrictive.
  • the Mnn4 protein is not only a protein having an amino acid sequence represented by SEQ ID NO: 3, but also 80% or more, specifically 90% or more, more specifically 95% or more, 99% or more with SEQ ID NO: 3
  • a protein having the above homology as long as it is an amino acid sequence having a biological activity substantially the same as or corresponding to that of the Mnn4 protein, the case where some sequences have an amino acid sequence deleted, modified, substituted or added is included in the scope of the present invention. This is apparent to those skilled in the art.
  • homology refers to the percent identity between two polynucleotide or polypeptide moieties. Homology between sequences from one moiety to another may be determined by known techniques. For example, homology can be determined by aligning sequence information and directly aligning sequence information between two polynucleotide molecules or two polypeptide molecules using readily available computer programs.
  • the computer program may be BLAST (NCBI), CLC Main Workbench (CLC bio), MegAlign TM (DNASTAR Inc), or the like.
  • homology between polynucleotides can be determined by hybridization of polynucleotides under conditions of stable double-stranding between homologous regions, followed by digestion with single-strand-specific nucleases to determine the size of the digested fragments.
  • Mnn14 protein refers to a protein encoded by MNN4 gene and paralogin gene in S. cerevisiae .
  • Mnn14 is also named YJR061W.
  • Mnn14 is also named Mnn4pa, and the terms may be used interchangeably herein.
  • the information of the Mnn14 protein may be obtained through a known database such as the US National Institute of Health GenBank.
  • the protein may be NP_012595 (SEQ ID NO: 1), but is not limited thereto.
  • the category of the Mnn14 protein represented by SEQ ID NO: 1 is not only the amino acid sequence of SEQ ID NO: 1, but also 80% or more, specifically 90% or more, more specifically 95% or more of SEQ ID NO: 1 More specifically, if a protein having a homology of 99% or more, and an amino acid sequence having the same or corresponding biological activity as a protein having the amino acid sequence of SEQ ID NO: 1, the amino acid to which some sequences are deleted, modified, substituted or added The case of having a sequence is also included in the scope of the present invention, which will be apparent to those skilled in the art.
  • the protein having the amino acid sequence of SEQ ID NO: 1 may be encoded by the base sequence represented by SEQ ID NO: 2, but is not limited thereto, and the base sequence encoding the protein due to codon degeneracy varies It will be apparent to those skilled in the art.
  • the term "attenuated compared to the intrinsic activity” is a concept that includes both the activity is reduced or inactive when compared with the activity of the protein that the microorganism has in its natural state.
  • the weakening may be a mutation to weaken the activity of the protein, the mutation may be an unnatural occurrence, but is not limited thereto.
  • attenuating the activity of a protein includes a method of deleting all or part of a gene on a chromosome encoding the protein; Replacing the gene encoding the protein on a chromosome with a mutated gene such that the activity of the protein is reduced; Introducing a mutation into an expression control sequence of a gene on a chromosome encoding said protein; Replacing the expression control sequence of the gene encoding the protein with a sequence with weak or no activity; Introducing an antisense oligonucleotide that complementarily binds to a transcript of a gene on the chromosome to inhibit translation from the mRNA to a protein; How to make a secondary structure by the addition of a sequence complementary to the SD sequence in front of the SD sequence of the gene encoding the protein to make the ribosomes
  • the recombinant yeast strain may be one in which the activity of Mnn1 protein, Och1 protein, or both is weakened compared to the intrinsic activity.
  • the Mnn1 protein has alpha-1,3-mannosyltransferase activity. Since the protein can add ⁇ (1,3) -mannose, which can be recognized as an antigen in the human body, to the glycoprotein, the yeast specific oligosaccharide is added to the recombinant glycoprotein by attenuating the activity of the protein relative to the endogenous activity. Can help control.
  • the Och1 protein acts as a mannose transferase in cis-Golgi and mediates polymannose outer chain elongation of the N -linked oligosaccharide of glycoproteins.
  • the activity of the protein relative to endogenous activity, it may be helpful to control the addition of yeast specific oligosaccharides to recombinant glycoproteins.
  • Mnn1 protein, Och1 protein described above can be obtained through a database known to those skilled in the art, such as the National Institutes of Health GenBank, as described above.
  • yeast saccharomycens (Saccharomycens) cerevisiae ), but is not limited thereto, and any yeast capable of achieving yeast specific oligosaccharide control by attenuating the activity of Mnn4 and Mnn14 proteins may be included in the scope of the present invention.
  • yeast-specific sugar chain biosynthesis pathway is attenuated yeast expression-linked sugar chains are mostly have a GlcNAc 2 structure
  • Man 8 have.
  • oligosaccharide-modifying enzymes include alpha 1,2-mannosidase, mannosidase A, mannosidase IB, mannosidase IC, mannosidase II, N-acetylglucozaminyltransferase I, and N-acetylglucozami.
  • Neiltransferase II, galactosyltransferase, sialyltransferase, fucosyltransferase, and the like but are not limited to these, and various genes may be used that may help reduce and modify mannose residues. .
  • the present invention provides a yeast variant strain further comprising an expression vector of the sugar chain modification enzyme.
  • the sugar-modifying enzyme is alpha 1, 2-mannosidase, mannosidase IA, mannosidase IB, mannosidase IC, mannosidase II, N-acetylglucosaminyltransferase I, N-acetylglucose Xaminiltransferase II, galactosyltransferase, sialyltransferase, fucosyltransferase and the like.
  • the recombinant yeast strain may further comprise a gene encoding a glycoprotein.
  • a recombinant vector comprising the gene encoding the glycoprotein may be introduced into the yeast strain.
  • the "recombinant vector” refers to a DNA product containing a nucleotide sequence of a polynucleotide encoding the target protein operably linked to a suitable control sequence to express the target protein in a suitable host, and in particular operably linked Expression of the gene encoding the protein of interest can be directed, such a vector is called an expression vector.
  • the expression vector contains fragments for suppressing expression having various functions for suppressing or amplifying or inducing the expression of a target gene, markers for selection of transformants, resistance genes against antibiotics, and secretion out of cells. Genes encoding a signal for the purpose of, may be further included a custom fusion factor suitable for the non-expressing protein.
  • the yeast strain according to the present invention comprising a gene encoding a desired glycoprotein is cultured in a culture condition and a medium suitable for expressing the desired glycoprotein to produce a glycoprotein, using a natural yeast strain Compared with the production of the desired glycoprotein, the addition of mannose phosphate is reduced or completely controlled, thereby producing a recombinant glycoprotein that is less likely to cause an immune response to the human body.
  • the desired glycoprotein is not particularly limited as long as it is a glycoprotein to be expressed in the yeast strain, pathogen protein, growth factor, cytokine (eg, interferon- ⁇ , Interferon- ⁇ , interferon- ⁇ , G-CSF, etc.), chemokine, chemokine (e.g., VIII factor, IX factor, human protein C), endothelial growth factor, growth hormone release factor, HIV envelope protein (HIV envelope) protein), influenza virus A haemagglutinin, influenza neuraminidase, bovine enterokinase activator, bovine herpes virus type 1 glycoprotein D (Bovine herpes virus type -1 glycoprotein D), human angiostatin, human B7-1, B7-2 and B-7 receptor CTLA-4, human tissue factor, growth factor (e.g., platelet-derived growth factor) , Human ⁇ - Anti-trypsin, human erythropoietin, tissue plasminogen activator, plasminogen activator inhibitor-1,
  • glycoproteins of interest include Gas1 (beta-1,3-glucanosyltransferase), Glucocerebrosidase (GCase), alpha-galactosidase, and alpha-glucosidase. alpha-glucosidase, iduronidase, iduronidase sulfatase, and GalNAc sulfatase, but are not limited thereto.
  • the present invention provides a method for producing a recombinant glycoprotein using the recombinant yeast strain.
  • step (b) providing a method for producing a recombinant glycoprotein comprising recovering the glycoprotein produced in step (a).
  • the yeast strain, recombinant glycoprotein, Mnn4 protein, Mnn14 protein, weakening compared to the intrinsic activity is as described above.
  • step (a) is preferably a culture condition and a medium condition capable of producing a desired glycoprotein, which can be appropriately adjusted by those skilled in the art.
  • the step (b) may be a step of recovering the produced glycoprotein from the cultured cells or a supernatant thereof, and may include a process such as chromatography, but is not limited thereto, and a person skilled in the art may select a suitable process for recovery. have.
  • the method may further include a process of separating and purifying the recovered protein.
  • the present invention provides the use of said recombinant yeast strain for use in the preparation of recombinant glycoproteins without added mannose phosphoric acid.
  • glycoprotein The glycoprotein, yeast strain and the like are as described above.
  • the invention provides the use of a protein represented by SEQ ID NO: 1 for use in controlling the addition of mannose phosphoric acid in a glycoprotein.
  • the protein represented by SEQ ID NO: 1 is as described above.
  • the present invention provides a use of the protein represented by SEQ ID NO: 1 for use in mannose phosphorylation.
  • the protein represented by SEQ ID NO: 1 is as described above.
  • the och1 ⁇ mnn1 ⁇ strain is a multiple gene deletion method using the Cre / loxP system from the L3262 strain (U. Gueldener et al , 2002, Nucleic Acids Res 30: e23; JH Hegemann, SB Heick, 2011, Methods Mol Biol 765: 189-206).
  • a loxP - URA3 - loxP deletion cassette for deleting the ScOCH1 gene was amplified from a pUG72 vector using Och1_pUG72_F and Och1_pUG72_R primers.
  • ScMNN1 gene deletion was identified by polymerase chain reaction using Mnn1_CF and Mnn1_CR primers based on chromosomal DNA. It confirmed using. And, markers selected for deletion of genes were removed by expressing Cre protein in SC-Leu medium transformed with pSH68 vector and added 2% galactose instead of 2% glucose as reported in the above papers. It was. Finally, pSH68 for Cre protein expression was removed through continuous culture in YPD medium, the final mnn1 ⁇ och1 ⁇ strain was selected by confirming growth in the appropriate selection medium.
  • YPD medium 1% yeast extract, 2% peptone, 2% glucose
  • SC (synthetic complete) medium 0.67% yeast nitrogen base
  • Nitrogen base 2% glucose
  • dropout amino acid mixture including all necessary amino acids
  • the loxP - LEU2 - loxP deletion cassette for MNN4 gene deletion was amplified by polymerase chain reaction from pUG73 vector using Mnn4_F and Mnn4_R primers (Table 2) to obtain a 2.5 kbp DNA fragment (FIG. 1 (A)).
  • the MNN4 gene deletion cassette thus obtained was transformed into och1 ⁇ mnn1 ⁇ , and SC-LEU selective medium (1 M sorbitol, 2% glucose, 0.67% yeast nitrogen base w / o amino acid, DO supplement -LEU added with 1 M sorbitol) was introduced. Transformants were selected.
  • the chromosomal DNA of the selected transformants was extracted and the template was used to identify the deletion of the MNN4 gene through polymerase chain reaction using Leu2_CF and Mnn4_CR primers (FIG. 1 (B)).
  • the och1 ⁇ mnn1 ⁇ mnn4 ⁇ containing the LEU2 selection marker was identified.
  • Strain ( mnn1 ⁇ :: loxP och1 ⁇ :: loxP mnn4 ⁇ :: loxP-LEU2-loxP ) was constructed.
  • the loxP - URA3 - loxP deletion cassette for MNN6 gene deletion was amplified by polymerase chain reaction from pUG72 vector using Mnn6_F and Mnn6_R primers (Table 2) to obtain a 1.7 kbp DNA fragment (FIG. 2 (A)).
  • the MNN6 gene deletion cassette thus obtained was transformed into the och1 ⁇ mnn1 ⁇ mnn4 ⁇ strain prepared above, and transformants were selected from SC-LEU selective medium to which 1 M sorbitol was added.
  • chromosomal DNA of the selected transformants was extracted and a template was used to identify the deletion of the MNN6 gene through a polymerase chain reaction using Mnn6_CF and Ura3_CR primers (FIG. 2 (B)), and the LEU2 and URA3 selection markers were included.
  • Quadruple deletion och1 ⁇ mnn1 ⁇ mnn4 ⁇ mnn6 ⁇ strain ( mnn1 ⁇ :: loxP och1 ⁇ :: loxP mnn4 ⁇ :: loxP - LEU2 - loxP mnn6 ⁇ :: loxP - URA3 - loxP ) was constructed.
  • MNN4 and the selectable marker LEU2 and URA3 for entering to the genetic defect of MNN6 are as reported in the above paper, introducing pSH67 vector for Cre protein expression in the strain, and YPDS-G418 selection medium (1 M sorbitol, 2% glucose, 1% yeast extrat, 2% peptone, 200 ⁇ g / ml G418), and transformants were cultured in YPDS-G418 medium supplemented with 2% galactose instead of 2% glucose. Protein was removed by expression.
  • pSH47 vector for Cre protein expression was removed through continuous culture in YPD medium, and confirmed by growth in an appropriate selection medium, the triple-defect och1 ⁇ mnn1 ⁇ mnn4 ⁇ strain ( mnn1 ⁇ :: loxP) with the LEU2 marker removed.
  • och1 ⁇ :: loxP mnn4 ⁇ :: loxP the triple-defect och1 ⁇ mnn1 ⁇ mnn4 ⁇ strain with the LEU2 marker removed.
  • och1 ⁇ mnn1 ⁇ mnn4 ⁇ mnn6 ⁇ strains LEU2 and URA3 selection marker is removed (mnn1 ⁇ :: loxP och1 ⁇ :: loxP mnn4 ⁇ :: loxP mnn6 ⁇ :: loxP ) was constructed.
  • the N -sugar chains of the prepared och1 ⁇ mnn1 ⁇ strain, the triple-deleted och1 ⁇ mnn1 ⁇ mnn4 ⁇ strain, and the quadruple-deleted och1 ⁇ mnn1 ⁇ mnn4 ⁇ mnn6 ⁇ strains were analyzed to observe a change in the addition efficiency of mannose phosphoric acid.
  • yeast CWMs were extracted using a method previously reported using hot citrate buffer (20 mM sodium citrate buffer, pH 7.0) (Park et al, 2011, Appl Environ Microbiol). 77: 1187-1195), and analyzed using a DNA sequencer (Laroy et al, 2006, Nat Protoc 1: 397-405).
  • Sepadex G10 (GE Healthcare, Milwaukee, WI, USA) was packed with a Multiscreen Durapore membrane lined 96-well plate (Millipore, Billerica, Mass., USA) to remove excess APTS from unreacted APTS-labeled APTS.
  • the oligosaccharides were separated and analyzed using a DNA sequencer according to previously reported methods (Laroy et al, Nature Protocols 1: 397-405, 2006). That is, 10 ⁇ l of the APTS-labeled oligosaccharide solution was transferred to a DNA sequencer plate, and analyzed using an ABI 3130 DNA sequencer equipped with a 36 cm capillary array filled with POP7-polyacrylamide linear polymer. DNA sequencer analysis conditions were as described in Table 3, and data analysis was performed using GeneMapper software.
  • Och1 ⁇ mnn1 ⁇ mnn4 ⁇ strain and och1 ⁇ mnn1 ⁇ that lack the MNN4 gene When comparing the content of oligosaccharides added with mannose phosphate in the N -sugar chain profile of the strain, there was no difference.
  • BLAST basic local alignment tool
  • MNN4 had a repeat sequence of KKKKEEEE at the C-terminal part and BLAST was excluded except for this part.
  • the hypothetical protein YJR061W (NP_012595) was selected and named MNN14 .
  • the Mnn14 protein like Mnn4, has a LicD domain that is known to be important in binding to the substrate GDP-mannose, but unlike Mnn4, it does not have a repeat sequence of KKKKEEEE at the C-terminus. Sequence identity between Mnn4 and Mnn14 proteins was 33% and homology was calculated at 44%.
  • YUR1 , KTR2 , KTR4 , KTR5 and KTR7 belonging to the KTR family were searched for genes homologous to the MNN6 gene. Identity and homology between the Mnn6 proteins and these proteins are described in FIG. 4.
  • the MNN14 , YUR1 , KTR2 , KTR4 , KTR5 and KTR7 genes were deleted.
  • the gene deletion cassette of loxP-URA3-loxP was used with each of six pairs of primers (MNN14_F / MNN14_R, Yur1_F / Yur1_R, Ktr2_F / Ktr2_R, Ktr4_F / Ktr4_R, Ktr5_F / Ktr5_R, Ktr7_F / Ktr7_R, polymerization 2); 1.7 kbp fragments were obtained by enzyme chain reaction (FIG. 5 (A)).
  • the resulting gene disruption cassettes were introduced into the och1 ⁇ mnn1 ⁇ mnn4 ⁇ mnn6 ⁇ strain by transformation, and SC-URA selective medium (1 M sorbitol, 2% glucose, 0.67% yeast nitrogen base w / o amino acid, DO supplement-with 1 M sorbitol) was added. URA) transformants were selected. Then, the chromosomal DNA of the selected transformants was extracted and used as a template. The defect of was confirmed (FIG. 5 (B)).
  • the screening marker URA3 entered for the deletion of the target gene introduced a pSH68 vector for Cre protein expression as in Example 1, and the SC-LEU selective medium containing 1 M sorbitol (1 M sorbitol, 2% glucose, 0.67%).
  • Transformants were selected from yeast nitrogen base w / o amino acid, DO supplement -LEU, and then SC-LEU selective medium (1 M sorbitol, 2% galactose, 0.67%) was added 2% galactose instead of 2% glucose.
  • Yeast nitrogen base w / o amino acid, DO supplement -LEU) was incubated with Cre protein expression.
  • the pSH68 vector was removed by continuous culture in YPD medium, and confirmed by growth in an appropriate selection medium, the fold- deleted strain och1 ⁇ mnn1 ⁇ mnn4 ⁇ mnn6 ⁇ mnn14 ⁇ with the URA3 marker removed.
  • Example 2 CWMs were obtained in the same manner as in and the N -sugar chain was analyzed (FIG. 6).
  • the MNN4 MNN14 defect - mannose in mnn14 ⁇ strain without the addition of phosphoric acid is oligosaccharide peaks single Man 8 GlcNAc 2
  • the peak of the sugar chain showed that the mannose phosphate addition ability was lost (FIG. 6).
  • the culture environment may affect the culture of CWMs after incubation at 28 ° C for 72 hours in YPD medium (1 M sorbitol, 2% galactose, 1% yeast extrat, 2% peptone) added with 1 M sorbitol. N -sugar chains were analyzed (FIG. 7).
  • results show that, regardless of the culture environment, additional deletion of the MNN14 gene can completely eliminate mannose phosphorylation activity of S. cerevisiae yeast.
  • the experiments were then performed in a minimal medium SC containing 1 M sorbitol (1 M sorbitol, 2% glucose, 0.67% yeast nitrogen base with amino acids).
  • Example 1 MNN14 gene deletion cassette prepared in Example 4 was introduced into the strains, and transformants were selected from SC-URA selective medium to which 1 M sorbitol was added. The chromosomal DNA of the selected transformants was extracted and the deletion of the MNN14 gene was confirmed by polymerase chain reaction using Mnn14_CF and Ura3_CR primers. The selection marker URA3 entered for deletion of the MNN14 gene was removed in the same manner as in Examples 1 and 4, and similarly, the pSH68 vector for Cre protein expression was also removed through continuous culture in YPD medium.
  • och1 ⁇ mnn1 ⁇ mnn4 ⁇ mnn14 ⁇ that is a representative deletion strain of the MNN4 and MNN14 genes
  • the strain was named och1 ⁇ mnn1 ⁇ mnn4 ⁇ mnn4pa ⁇ and was deposited on April 6, 2015 by the Korea Biotechnology Research Institute, an international depository organization under the Butafest Treaty, and was given an accession number of KCTC12789P.
  • Complementation experiments were performed to determine whether the mannose phosphorylation capacity was restored by expressing MNN4 or MNN14 genes in two strains och1 ⁇ mnn1 ⁇ mnn4 ⁇ mnn14 ⁇ and och1 ⁇ mnn1 ⁇ mnn4 ⁇ mnn6 ⁇ mnn14 ⁇ .
  • YEp352-Mnn4 for Mnn4 protein expression and YEp352-GAP vector, which is a control vector, were prepared as follows.
  • GAPDH promoter (0.8 kb) and terminator (0.2 kb) of S. cerevisiae were subjected to polymerase chain reaction using GAPDHp-F1 / GAPDHp-R1 and GAPDHt-F1 / GAPDHt-R1 primers from chromosomal DNA of L3262 strain. Amplified through
  • the amplified DNA fragments were inserted into pDrive vectors (QIAGEN, Germany), respectively, to prepare pDrive-GAPDHp and pDrive-GAPDHt vectors.
  • pDrive vectors QIAGEN, Germany
  • EcoR I and Kpn I cut was the GAPDH promoter from pDrive-GAPDHp, and then inserted into a vector digested with the same YEp352 recombinant enzyme was produced in the YEp352-GAPDHp vector.
  • the MNN4 gene was amplified from the chromosomal DNA of S. cerevisiae BY4741 strain using Mnn4_F and Mnn4_R primers, and the fragments treated with the restriction enzymes BamH I and Spe I were inserted into the YEp352-GAP vector treated with BamH I and Xba I and YEp352. -Mnn4 vector was constructed.
  • MNN14 gene (2.8 kb) was amplified by polymerase chain reaction using Y-Mnn14-F and Y-Mnn14-R primers from chromosomal DNA of S. cerevisiae L3262.
  • the fragment cut by treatment with the KpnI restriction enzyme was inserted into the KpnI position after the GAPDH promoter of the YEp352-GAP vector to prepare the YEp352-MNN14 vector.
  • the sequence of the primer used for the said vector production was as follows.
  • a gene expressing a protein of amino acid residues 1 to 490 from which the Gas1 protein of S. cerevisiae yeast was selected as a model glycoprotein and the C-terminal glycosylphosphatidylinositol (GPI) -anchoring motif was removed for secretion expression was Amplification using a chain reaction (Gil et al, J Biotech 2015). Genomic DNA of S. cerevisiae L3262 strain was extracted and used as a template, and amplified by first polymerase chain reaction using p-Gas1-F and p-Gas1-R-1 primers to obtain DNA fragments.
  • GPI glycosylphosphatidylinositol
  • sequences of the primers used for constructing the vector are as follows.
  • och1 ⁇ mnn1 ⁇ mnn4 ⁇ mnn14 ⁇ PD1211-Gas1p vector was introduced into the strain together with the YEp352-Mnn4 and YEp352-Mnn14 vectors prepared in Example 8 in a conventional transformation method, and selected from SC-URA and LEU selection medium to which 1 M sorbitol was added to secrete Gas1.
  • Och1 ⁇ mnn1 ⁇ mnn4 ⁇ mnn14 ⁇ / Mnn4 / Gas1 and och1 ⁇ mnn1 ⁇ mnn4 ⁇ mnn14 ⁇ / Mnn14 / Gas1 strains were prepared.
  • the four recombinant Gas1 secretion expressing yeast strains prepared above were incubated at 28 ° C. for 3 days using an appropriate selection medium (SC-URA or SC-URA, LEU) to which 1 M sorbitol was added.
  • SC-URA or SC-URA, LEU selection medium
  • the culture supernatant obtained therefrom was purified using a conventional His-tag affinity column (Gil et al, J Biotech 2015).
  • the N -sugar chains of Gas1 proteins purified through the above experiments were separated and purified as described in Lee KJ et al, 2013, Glycoconj J. Briefly, 10 mg of purified Gas1 protein is denaturated and directly treated with PNGase F (New Englad Biolabs) to favor oligosaccharides, followed by solid phase extraction using a graphitized carbon column (Alltech, Lexington, Mass., USA). Purified. The N -sugar chains thus purified were analyzed by the method using the DNA sequencer of Example 2 (FIG. 11).
  • Mnn4 when Mnn4 is expressed in the och1 ⁇ mnn1 ⁇ mnn4 ⁇ mnn14 ⁇ strain, only a small amount of oligosaccharide added with mannose phosphate is detected, whereas the intensity of oligosaccharide peak to which mannose phosphate is added increases when Mnn14 is expressed. In addition, two peaks were detected as peaks of very strong intensity in the added sugar chain. This shows that the mannose phosphate addition ability of Mnn14 is much better than Mnn4.
  • Intrinsic isoelctric points of the purified Gas1 proteins were analyzed using conventional isoelctric focusing (IEF) method. Briefly, an IEF gel (ThermoFisher Scientific, Waltham, MA, USA) is mounted in a chamber (ThermoFisher Scientific) filled with cathod and anode buffer (ThermoFisher Scientific), and a Gas1 protein sample with sample buffer (ThermoFisher Scientific) is added to the IEF gel. After loading into the wells, electrophoresis was performed according to the protocol provided by the manufacturer. After the electrophoresis was completed, the gel was reacted with fixation buffer (12% Trichloroacetic acid) for 30 minutes, followed by Coomassie blue staining to confirm the result (FIG. 12).
  • fixation buffer 12% Trichloroacetic acid
  • Mannosphosphate is negatively charged, so the more isomannose is added, the lower the isoelectric point of the protein.
  • och1 ⁇ mnn1 ⁇ mnn4 ⁇ mnn6 ⁇ Recombinant Gas1 protein secreted from the strain was mannose phosphate added a lot of the isoelectric point of the main protein band is located at pH 3 or less appeared to be attracted (first lane in Figure 12).
  • och1 ⁇ mnn1 ⁇ mnn4 ⁇ mnn14 ⁇ Recombinant Gas1 protein secreted and expressed in the strain resulted in the isoelectric point being increased as the main band was observed at pH 4 or higher (second lane in FIG.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Mycology (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Biomedical Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicinal Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Toxicology (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

본 발명은 Mnn4 단백질 및 서열번호 1로 표시되는 단백질의 활성이 모두 내재적 활성에 비하여 약화된, 재조합 효모 균주 및 이를 이용하여 인간화된 당사슬이 부착된 재조합 당단백질을 제조하는 방법에 관한 것이다.

Description

사카로마이세스 세레비지애 효모의 만노스 인산화 활성에 핵심적인 유전자 MNN14 및 그 결손 변이주를 활용한 재조합 당단백질 생산 방법
본 발명은 Mnn4 단백질 및 Mnn14 단백질의 활성이 모두 내재적 활성에 비하여 약화된, 재조합 효모 균주 및 이를 이용하여 인간화된 당사슬이 부착된 재조합 당단백질을 제조하는 방법에 관한 것이다.
당질화를 통해서 당사슬이 부가되는 당단백질들은 현재 전세계 재조합 단백질 의약품 시장의 60% 이상을 차지하며 시장을 주도하고 있다. 특히, 당사슬은 당단백질 의약품의 치료 효능, 체내 지속성, 타겟팅 및 면역반응 등에서 중요한 역할을 하기에 의약품의 품질을 결정하는 주요 인자로 부각되고 있다. 당사슬이 부가되는 반응은 크게 N-결합 또는 O-결합 당질화(N-linked or O-linked glycosylation)의 두 가지 형태가 있으며, 이 중 N-결합 당질화를 통해서 부가되는 당사슬을 N-당사슬(N-glycan)이라 부르며 소포체에서 시작된다. 먼저 소포체 막에 존재하는 돌리콜 피로인산(dolichol pyrophosphate, PP-Dol)에 연결된 형태의 당사슬인 Glc3Man9GlcNAc2-PP-Dol을 형성한다. 그리고 올리고당 전이효소(oligosaccharyltransferase)가 이를 co-translational translocation 기작으로 리보좀에서 소포체로 번역되어 나오는 단백질 중에서 N-X-S/T 서열의 N-당질화 시퀀(sequon)에 전달한다. 소포체 안에 존재하는 당단백질 폴딩의 품질 제어를 담당하는 기작의 글루코시다아제(glucosidase)와 만노시다제(mannosidase)에 의해서 말단에 존재하는 포도당과 특정 만노스(mannose)가 제거되어 Man8GlcNAc2 구조를 갖는 고-만노스 형(high-mannose type) 당사슬을 부착한 상태로 골지체에 옮겨지게 된다.
상기에서 소개한 소포체에서 이루어지는 N-당사슬의 초기 생합성 과정은 진핵 미생물인 효모에서 고등동물인 포유류에 이르기까지 거의 동일한 과정으로 보존되어 있다. 그러나, 골지체로 넘어간 당사슬은 각 종에 특이적으로 다양한 당사슬 수식 과정을 거치게 되며, 그 결과로 효모, 곤충, 식물 및 동물 등에서 완전히 다른 형태의 당사슬들이 만들어지게 된다. 고등 동물에서는 골지체로 들어온 당단백질의 당사슬들은 만노시다제들에 의해서 Man5GlcNAc2 형태로 다듬어진다. 그리고 여기에 N-acetylglucosaminyltransferase (GNT) I이 작용해서 GlcNAc이 하나 부가된 후, 만노시다제 Ⅱ가 작용해서 반대편 가지에 부가되어 있던 만노스 2개를 더 제거하여 trimannosyl core (Man3GlcNAc2) 당사슬에 GlcNAc이 하나 부가되어 있는 혼합형 구조가 만들어진다. 이후 만노스가 제거된 가지에 GNT Ⅱ가 작용해서 GlcNAc이 하나 더 부가되면서 두 개의 안테나 구조를 갖는 당사슬이 생성된다. 이후에 GNT Ⅳ와 Ⅴ 등이 작용해서 네 개의 안테나 구조가 만들어지기도 하며, 일부에서는 GNT Ⅵ, Ⅸ 또는 VB 등이 작용해서 6개의 안테나 구조까지 만들어지는 경우도 있다. GlcNAc이 부가되어 안테나의 골격이 만들어진 후에 골지체에 존재하는 베타-갈락토실트랜스퍼라아제와 알파-시알산트랜스퍼라아제(alpha-sialyltrasnferase) 등이 작용해서 GlcNAc 위에 갈락토즈와 시알산이 부가된 복합형 당사슬 구조가 만들어진다.
효모는 진핵 미생물로서 유전자 조작이 용이하여 다루기 쉽고 저렴한 비용으로 대량의 단백질을 생산할 수 있어서 경제성이 높을 뿐만 아니라, 인간을 감염시키는 바이러스와 프라이온 등에 오염이 될 가능성이 없는 등 안전성 또한 매우 높다는 많은 장점들을 가지고 있다. 그러나, 효모에서 합성된 당사슬 구조는 인간의 것과 매우 상이하여 인체 주입 시 면역 반응을 일으키는 문제점이 있다. 효모는 소포체까지는 고등동물과 동일한 당사슬 생합성 과정을 가지고 있으나, 골지체(Golgi)로 이동한 후에는 만노스가 추가로 부가되는 효모 특이적인 당사슬 수식 경로를 갖는다. 즉, OCH1 유전자 산물에 의해서 소포체에서 넘어온 Man8GlcNAc2 당사슬에 α(1,6)-결합으로 만노스가 부가되는 당사슬 외쇄(glycan outer chain) 개시 반응이 일어나며, 이를 시작으로 α(1,6)-결합 및 α(1,2)-결합으로 만노스가 연속적으로 부가되어 당사슬 외쇄가 합성된다. 전통효모인 사카로마이세스 세레비지애(Saccharomyces cerevisiae)의 경우에는 핵심 당사슬에 50-200개의 만노스가 연속적으로 부가되는 과당화 반응이 일어나기도 하며, 인체에서 항원으로 인지될 수 있는 α(1,3)-만노스가 MNN1 유전자 산물에 의해서 부가된다. 또한, 당사슬에 만노스-1-인산이 추가로 부가되는 만노스인산화(mannosylphosphorylation)를 통해서 "만노스-1-인산-6-O-만노스(mannose-1-phosphate-6-O-mannose)" 형태의 산성 당사슬이 생성된다는 사실도 알려졌다. 이는 주로 MNN6 유전자가 발현하는 효소에 의해서 만노스인산화 반응에 의해서 일어나며, 이를 제어하는 단백질을 발현하는 유전자로 MNN4가 제시된 바 있다(Odani et al., Glycobiol., 6:805, 1996; Odani et al., FEBS Lett., 420:1860, 1997).
상기에서 기술한 바와 같이 효모에서 생산한 당단백질에 부착된 당사슬은 인간의 것과 구조가 달라서 인체 주입 시 면역 반응을 일으키기 때문에 의약용으로 사용할 수 없으므로, 이러한 문제를 해결하기 위해서 효모 특이적인 당사슬을 부가하는 당전이효소 유전자들을 파쇄하는 방법들이 제시되었다. 특히 S. cerevisiae 효모에서는 당사슬 외쇄 연장 반응을 개시하는 OCH1 유전자와 α(1,3)-만노스를 부가하는 MNN1 유전자 등을 파쇄하여 효모 특이적인 당사슬의 부가를 막는 방법들이 제시되었다(Nakayama et al., EMBO J, 11:2511, 1992; Nakanishi-Shindo et al., J Biol Chem, 268:26338, 1993).
또한, 상기에서 언급한 MNN4MNN6에 의해서 만노스인산이 부가되어 생기는 "만노스-1-인산-6-O-만노스" 형태의 당사슬 가지도 인체 주입 시 면역 반응을 일으킬 수 있으므로, 대부분의 의약용 당단백질 생산을 위해서는 이를 제거해 주어야 한다. 따라서 S. cerevisiae 효모에서 효모 특이적인 당사슬의 생합성을 막기 위해서 보통 OCH1MNN1 유전자와 함께 만노스인산의 부가를 제어한다고 알려진 MNN4 유전자도 함께 결손 한다(Chiba et al., J Biol Chem 273:26298, 1998). 그러나 MNN4 유전자의 결손이 만노스인산의 부가 활성을 완전히 제거하지 못한다(Odani et al., Glycobiol 6:805, 1996). 따라서 만노스인산의 부가 활성을 지니는 다른 유전자가 있다고 추정되었으나 어떤 유전자가 이러한 활성을 담당하는지는 아직까지 보고되지 않았다.
본 발명에서는 효모, 특히 S. cerevisiae에서 만노스 인산을 당사슬에 부가하는 활성을 완전히 제거하기 위한 기술을 개발하고자 예의 노력한 결과, S. cerevisiae 균주에서 Mnn14 유전자가 만노스 인산화에 관여하며, MNN4 유전자와 MNN14 유전자의 이중 결손 시에 만노스 인산의 부가가 제거되는 것을 규명하여, 본 발명을 완성하였다.
본 발명의 하나의 목적은 만노스 인산의 부가가 제어된, 재조합 효모 균주를 제공하는 것이다.
본 발명의 다른 목적은 상기 재조합 효모 균주를 이용하여 재조합 당단백질을 제조하는 방법을 제공하는 것이다.
본 발명의 또 다른 목적은 만노스 인산이 부가되지 않은 재조합 당단백질의 제조에 사용하기 위한 상기 재조합 효모 균주의 용도를 제공하는 것이다.
본 발명의 또 다른 목적은 당단백질에서 만노스 인산의 부가를 제어하는 것에 사용하기 위한, 서열번호 1로 표시되는 단백질의 용도를 제공하는 것이다.
본 발명의 또 다른 목적은 만노스인산화에 사용하기 위한, 서열번호 1로 표시되는 단백질의 용도를 제공하는 것이다.
재조합 당단백질의 제조 시 본 발명에 따른 재조합 효모 균주를 이용하면 효모 특이적인 만노스인산의 부가를 제거 함으로서 인체 주입 시 면역 반응을 유발하지 않는 보다 인간화된 당사슬이 부착된 당단백질을 제조할 수 있다.
도 1은 och1Δmnn1Δ 균주로부터 MNN4 유전자를 결손 하는 실험 결과이다. (A) Mnn4_F와 Mnn4_R 프라이머를 이용하여 pUG73으로부터 loxP - LEU2 - loxP 카세트를 중합효소 연쇄반응으로 증폭하여 2.5 kbp의 DNA 절편을 얻었다. (B) 준비된 결손 카세트를 och1Δmnn1Δ 균주에 도입하고 SC-Leu 배지에서 선별한 형질전환체들의 게노믹 DNA로부터 확인용 프라이머인 Leu2-CF와 Mnn4-CR들을 이용하여 MNN4 유전자가 LEU2 유전자로 교체된 1.8 kbp의 DNA 절편을 증폭하여 MNN4의 결손을 확인한 결과이다.
도 2는 och1Δmnn1Δmnn4Δ 균주로부터 MNN6 유전자를 결손 하는 실험 결과이다. (A) Mnn6_F와 Mnn6_R 프라이머를 이용하여 pUG72로부터 loxP - URA3 - loxP 카세트를 중합효소 연쇄반응으로 증폭하여 1.7 kbp의 DNA 절편을 얻었다. (B) 준비된 결손 카세트를 och1Δmnn1Δmnn4Δ 균주에 도입하고 SC-Ura 배지에서 선별한 형질전환체들의 게노믹 DNA로부터 확인용 프라이머인 Mnn6-CF와 Ura3-CR을 이용하여 MNN6 유전자가 URA3 유전자로 교체된 2.4 kbp의 DNA 절편을 증폭하여 MNN6의 결손을 확인한 결과이다.
도 3은 och1Δmnn1Δ 균주와 MNN4MNN6 유전자가 추가 결손 된 균주들의 CWMs로부터 얻어진 N-당사슬을 DNA 시퀀서를 이용한 분석한 결과이다. 상대적인 위치 확인을 위해서 포도당 유닛(glucose unit)을 나타내는 말토덱스트린 레퍼런스(maltodextrin reference) 프로파일을 맨 처음 패널에 보여주었다(Dex). 모든 결손 균주(och1Δmnn1Δ, och1Δmnn1Δmnn4Δ, och1Δmnn1Δmnn4Δmnn6Δ)들의 프로파일에서 (Man-P)2-Man8GlcNAc2, Man-P-Man8GlcNAc2 및 Man8GlcNAc2의 세 개의 당사슬 피크들이 주요하게 관찰되었다. 이들은 미국 Consortium for Functional Glycomics (htpp://www.functionalglycomics.org/)의 기호를 이용하여 표시하였다(청색 네모: GlcNAc, 녹색 원: 만노스, 인산: P). 그리고 동정이 되지 않은 피크들은 *로 표시하였다.
도 4는 Mnn6 단백질과 이들 단백질 사이의 동일성과 상동성 분석 결과를 나타낸 것이다.
도 5는 och1Δmnn1Δmnn4Δmnn6Δ 균주로부터 추가로 MNN4MNN6의 상동 유전자들을 결손 하는 실험 결과이다. (A) MNN14 , YUR1 , KTR2 , KTR4 , KTR5KTR7 유전자 결손 카세트 제작을 위해서 해당 유전자의 5`과 3`-UTR과 상동성 부위를 가진 프라이머들들을 이용하여 pUG72 벡터로부터 loxP - URA3 - loxP 카세트를 중합효소 연쇄반응으로 증폭하여 1.7 kbp의 DNA 절편을 얻었다. (B) 준비된 결손 카세트를 och1Δmnn1Δmnn4Δmnn6Δ 균주에 도입하고 SC-Ura 배지에서 선별한 형질전환체들의 게노믹 DNA로부터 확인용 프라이들을 이용하여 해당 유전자가 URA3 유전자로 교체된 1.2 kbp의 DNA 절편을 증폭하여 각각의 결손을 확인한 결과이다.
도 6은 최소 배지에서 배양한 och1Δmnn1Δmnn4Δmnn6Δ 균주 및 MNN4 또는 MNN6의 상동 유전자들이 추가로 결손된 균주들의 CWMs로부터 얻은 N-당사슬의 분석 결과이다. 도 3에서와 마찬가지로 상대적인 위치 확인을 위한 말토덱스트린 레퍼런스를 맨 처음 패널에 두었다(Dex). 그 다음 패널부터 차례로 och1Δmnn1Δmnn4Δmnn6Δ , och1Δmnn1Δmnn4Δmnn6Δyur1Δ (- yur1Δ), och1Δmnn1Δmnn4Δmnn6Δktr2Δ (- ktr2Δ), och1Δmnn1Δmnn4Δmnn6Δktr4Δ (- ktr4Δ), och1Δmnn1Δmnn4Δmnn6Δktr5Δ (- ktr5Δ), och1Δmnn1Δmnn4Δmnn6Δktr7Δ (- ktr7Δ) 및 och1Δmnn1Δmnn4Δmnn6Δmnn14Δ (- mnn14Δ) 균주들의 N-당사슬 프로파일을 보여준다. 당사슬 피크들은 도 3과 동일한 방식으로 표시하였다.
도 7은 YPD 배지에서 배양한 och1Δmnn1Δmnn4Δmnn6Δ 균주 및 MNN4 또는 MNN6의 상동 유전자들이 추가로 결손 된 균주들의 CWMs로부터 얻은 N-당사슬의 분석 결과이다. 도 6과 동일한 방법으로 패널의 순서와 당사슬 피크들을 나타내었다.
도 8은 MNN14 유전자가 결손 된 균주들의 CWMs로부터 얻은 N-당사슬의 분석 결과이다. 도 3에서와 마찬가지로 상대적인 위치 확인을 위한 말토덱스트린 레퍼런스를 맨 처음 패널에 두었다(Dex). 그 다음 패널부터 차례로 och1Δmnn1Δmnn4Δmnn6Δmnn14Δ , och1Δmnn1Δmnn4Δmnn14Δ , och1Δmnn1Δmnn14Δ 균주들의 N-당사슬 프로파일을 보여준다. 당사슬 피크들은 도 3과 동일한 방식으로 표시하였다.
도 9는 만노스인산화 능력이 제거되었던 och1Δmnn1Δmnn4Δmnn14Δ 균주에 MNN4 또는 MNN14 유전자를 발현하여 만노스인산화 능력의 회복 여부를 보는 complementation 실험 결과이다. 도 3에서와 마찬가지로 상대적인 위치 확인을 위한 말토덱스트린 레퍼런스를 맨 처음 패널에 두었다(Dex). 그 다음 패널부터 차례로 YEp352-GAP (Mock), YEp352-Mnn4 (Mnn4) 또는 YEp352-Mnn14 (Mnn14) 벡터로 형질전환한 균주들의 N-당사슬 프로파일을 보여준다. 당사슬 피크들은 도 3과 동일한 방식으로 표시하였다.
도 10은 만노스인산화 능력이 제거되었던 och1Δmnn1Δmnn4Δmnn6Δmnn14Δ 균주에 MNN4 또는 MNN14 유전자를 발현하여 만노스인산화 능력의 회복 여부를 보는 complementation 실험 결과이다. 도 9와 동일한 방법으로 패널의 순서와 당사슬 피크들을 나타내었다.
도 11은 och1Δmnn1Δmnn4Δmnn6Δ , och1Δmnn1Δmnn4Δmnn14Δ , och1Δmnn1Δmnn4Δmnn14Δ /Mnn4och1Δmnn1Δmnn4Δmnn14Δ / Mnn14 균주에서 분비 발현한 재조합 Gas1 단백질을 정제하여 그 N-당사슬 프로파일을 분석한 실험 결과이다. 각 당사슬 피크들은 도 3과 동일한 방식으로 표시하였다.
도 12는 och1Δmnn1Δmnn4Δmnn6Δ , och1Δmnn1Δmnn4Δmnn14Δ , och1Δmnn1Δmnn4Δmnn14Δ /Mnn4och1Δmnn1Δmnn4Δmnn14Δ / Mnn14 균주에서 분비 발현한 재조합 Gas1 단백질을 정제하여 그 등전점을 isoelectric focusing (IEF) 방법을 이용하여 분석한 결과를 보여준다.
이를 구체적으로 설명하면 다음과 같다. 한편, 본 발명에서 개시된 각각의 설명 및 실시형태는 각각의 다른 설명 및 실시 형태에도 적용될 수 있다. 즉, 본 발명에서 개시된 다양한 요소들의 모든 조합이 본 발명의 범주에 속한다. 또한, 하기 기술된 구체적인 서술에 의하여 본 발명의 범주가 제한된다고 볼 수 없다.
본 발명은 하나의 양태로서, 만노스 인산의 부가가 제어된, 재조합 효모 균주를 제공한다. 구체적으로, 상기 효모 균주는 비자연적으로 발생된 것일 수 있으나, 이에 제한되는 것은 아니다.
구체적으로, 본 발명은 Mnn4 단백질 및 Mnn14 단백질의 활성이 모두 내재적 활성에 비하여 약화된, 재조합 효모 균주를 제공한다.
본 발명에서 용어, “Mnn4 단백질”은 당사슬(올리고당[oligosaccharide]이라고도 함)의 만노스인산화에 관여하는 단백질이다. 상기 Mnn4 단백질은 만노스인산 전이효소(mannosylphosphate transferase)의 추정상의 양성 조절자(putative positive regulator)로 알려져 있다. 또한, 상기 Mnn4 단백질은 YKL200C, YKL201C로도 명명된다. 상기 Mnn4 단백질 및 이를 코딩하는 유전자 정보는 미국 국립 보건원 GenBank와 같은 데이터베이스를 통하여 얻을 수 있으며, 그 예로 상기 Mnn4 단백질은 서열번호 3으로 표시되는 아미노산 서열 (서열번호 4의 염기 서열)을 가질 수 있으나, 이에 제한되지 않는다.
또한, 상기 Mnn4 단백질은 서열번호 3으로 표시되는 아미노산 서열을 가지는 단백질뿐만 아니라, 서열번호 3과 80% 이상, 구체적으로는 90% 이상, 보다 구체적으로는 95% 이상, 보다 더욱 구체적으로는 99% 이상의 상동성을 가지는 단백질로서, 실질적으로 Mnn4 단백질과 동일하거나 상응하는 생물학적 활성을 가지는 아미노산 서열이라면, 일부 서열이 결실, 변형, 치환 또는 부가되는 아미노산 서열을 갖는 경우도 본 발명의 범주에 포함하며, 이는 당업자에게 자명하다.
본 발명에서 사용된 용어, “상동성”은 두 개의 폴리뉴클레오티드 또는 폴리펩타이드 모이티 사이의 동일성의 퍼센트를 말한다. 하나의 모이티로부터 다른 하나의 모이티까지의 서열 간 상동성은 알려진 당해 기술에 의해 결정될 수 있다. 예를 들면, 상동성을 서열정보를 정렬하고 용이하게 입수 가능한 컴퓨터 프로그램을 이용하여 두 개의 폴리뉴클레오티드 분자 또는 두 개의 폴리펩타이드 분자 간의 서열 정보를 직접 정렬하여 결정될 수 있다. 상기 컴퓨터 프로그램은 BLAST(NCBI), CLC Main Workbench(CLC bio), MegAlignTM(DNASTAR Inc) 등일 수 있다. 또한, 폴리뉴클레오티드 간 상동성은 상동 영역 간의 안정된 이중가닥을 이루는 조건 하에서 폴리뉴클레오티드의 혼성화한 후, 단일-가닥-특이적 뉴클레아제로 분해시켜 분해된 단편의 크기를 결정함으로써 결정할 수 있다.
본 발명에서 용어, “Mnn14 단백질”은 S. cerevisiae에서 MNN4 유전자와 파라로그인 유전자에 의하여 인코딩되는 단백질을 의미한다. 상기 Mnn14는 YJR061W로도 명명된다. 또한, 본 발명에서는 상기 Mnn14를 Mnn4pa로도 명명하였으며, 본 명세서에서 상기 용어들은 서로 혼용되어 사용될 수 있다. 상기 Mnn14 단백질의 정보는 미국 국립 보건원 GenBank와 같은 공지된 데이터베이스를 통하여 얻을 수 있으며, 그 예로 NP_012595인 단백질(서열번호 1)일 수 있으나, 이에 제한되지 않는다.
또한, 본 발명에서 상기 서열번호 1로 표시되는 Mnn14 단백질의 범주에는 서열번호 1의 아미노산 서열뿐만 아니라, 서열번호 1과 80% 이상, 구체적으로는 90% 이상, 보다 구체적으로는 95% 이상, 보다 더욱 구체적으로는 99% 이상의 상동성을 가지는 단백질로서, 실질적으로 서열번호 1의 아미노산 서열을 가지는 단백질과 동일하거나 상응하는 생물학적 활성을 가지는 아미노산 서열이라면, 일부 서열이 결실, 변형, 치환 또는 부가되는 아미노산 서열을 갖는 경우도 본 발명의 범주에 포함하며, 이는 당업자에게 자명하다.
상기 서열번호 1의 아미노산 서열을 가지는 단백질은 서열번호 2로 표시되는 염기서열로 인코딩되는 것일 수 있으나, 이에 제한되지 않으며, 코돈의 축퇴성(codon degeneracy)으로 인하여 상기 단백질을 코딩하는 염기 서열이 다양할 수 있음은 당업자에게 자명하다.
본 발명에서 용어, “내재적 활성에 비하여 약화된”은 상기 미생물이 천연의 상태에서 가지고 있는 단백질의 활성과 비교하였을 때, 그 활성이 감소되거나, 활성이 없는 것을 모두 포함하는 개념이다.
상기 약화는 단백질의 활성이 약화되도록 변이된 것일 수 있고, 상기 변이는 비자연적으로 발생된 것일 수 있으나, 이에 제한되는 것은 아니다. 구체적으로, 본 발명에서 단백질의 활성을 약화시키는 것은 상기 단백질을 암호화하는 염색체상의 유전자의 전체 또는 일부를 결실시키는 방법; 상기 단백질의 활성이 감소되도록 돌연변이된 유전자로, 염색체상의 상기 단백질을 암호화하는 유전자를 대체하는 방법; 상기 단백질을 암호화하는 염색체상의 유전자의 발현 조절 서열에 변이를 도입하는 방법; 상기 단백질을 암호화하는 유전자의 발현 조절 서열을 활성이 약하거나 없는 서열로 교체하는 방법; 상기 염색체상의 유전자의 전사체에 상보적으로 결합하여 상기 mRNA로부터 단백질로의 번역을 저해하는 안티센스 올리고뉴클레오티드를 도입하는 방법; 상기 단백질을 암호화하는 유전자의 SD 서열 앞단에 SD 서열과 상보적인 서열을 인위적으로 부가하여 2차 구조물을 형성시켜 리보솜(ribosome)의 부착이 불가능하게 만드는 법 및 해당 서열의 ORF(open reading frame)의 3' 말단에 역전사되도록 프로모터를 부가하는 RTE(Reverse transcription engineering) 방법으로 이루어지는 군에서 선택되는 방법으로 수행될 수 있으나, 이에 제한되지 않으며, 단백질 활성을 약화시키는 방법이라면 어떠한 것이라도 적용될 수 있음은 당업자에게 자명하다.
또한, 상기 재조합 효모 균주는 Mnn1 단백질, Och1 단백질, 또는 둘 다의 활성이 내재적 활성에 비하여 약화된 것일 수 있다.
상기 Mnn1 단백질은 알파-1,3-만노스전이효소(alpha-1,3-mannosyltransferase) 활성을 가진다. 상기 단백질은 인체에서 항원으로 인지될 수 있는 α(1,3)-만노스를 당단백질에 부가할 수 있으므로, 상기 단백질의 활성을 내재적 활성에 비하여 약화시킴으로써 재조합 당단백질에 효모 특이적 당사슬의 부가를 제어하는데 도움을 줄 수 있다.
또한, Och1 단백질은 cis-골지체에서 만노스 전이효소로 작용하며, 당단백질의 N-연결된 당사슬의 폴리만노스 당 체인 연장(polymannose outer chain elongation)을 매개한다. 따라서, 상기 단백질의 활성을 내재적 활성에 비하여 약화시킴으로써 재조합 당단백질에 효모 특이적 당사슬의 부가를 제어하는데 도움을 줄 수 있다.
상기 기술된 Mnn1 단백질, Och1 단백질에 대한 정보는 상기 기술된 바와 같이 미국 국립 보건원 GenBank와 같은 당업자에게 공지된 데이터 베이스를 통하여 얻을 수 있다.
또한, 상기 단백질의 활성 약화에 대해서도 앞서 설명한 내용이 적용된다.
또한, 상기 효모는 사카로마이세스 세레비지애 (saccharomycens cerevisiae)일 수 있으나, 이에 제한되지 않으며, Mnn4 및 Mnn14 단백질의 활성 약화로 효모 특이적 당사슬 제어를 달성할 수 있는 효모라면 본 발명의 범주에 포함될 수 있다.
상기 기술된 Mnn1, Och1, Mnn4 및 Mnn14 단백질들의 활성이 약화된, 효모 특이적 당사슬 생합성 경로가 약화된 효모가 발현하는 당단백질들에 부착된 N-당사슬들은 대부분이 Man8GlcNAc2 구조를 가질 수 있다. 당사슬 수식 효소 활성을 갖는 하나 이상의 단백질을 발현시킬 수 있는 발현 벡터로 상기한 변이주를 형질전환시키는 경우 더욱 효과적으로 인간의 당사슬과 유사한 구조를 갖는 형태로 전환시킬 수 있다. 이러한 당사슬 수식 효소로는 알파1,2-만노시다제, 만노시다제 A, 만노시다제 ⅠB, 만노시다제 ⅠC, 만노시다제Ⅱ, N-아세틸글루코자미닐트랜스퍼라제 Ⅰ, N-아세틸글루코자미닐트랜스퍼라제 Ⅱ, 갈락토실트랜스퍼라제, 사이알릴트랜스퍼라제, 퓨코실트랜스퍼라제 등이 포함되나, 반드시 이들로만 한정되는 것은 아니고, 만노스 잔기의 감소 및 변형에 일조할 수 있는 다양한 유전자를 사용할 수 있다.
따라서, 또 다른 양태로서, 본 발명은 당사슬 수식 효소의 발현 벡터를 추가로 포함하는 효모 변이주를 제공한다. 바람직하게는 당사슬 수식 효소는 알파 1, 2-만노시다제, 만노시다제 ⅠA, 만노시다제 ⅠB, 만노시다제 ⅠC, 만노시다제Ⅱ, N-아세틸글루코자미닐트랜스퍼라제 Ⅰ, N-아세틸글루코자미닐트랜스퍼라제 Ⅱ, 갈락토실트랜스퍼라제, 사이알릴트랜스퍼라제, 퓨코실트랜스퍼라제 등로 이루어진 그룹 중에서 선택될 수 있다.
또한, 상기 재조합 효모 균주는 당단백질을 코딩하는 유전자를 추가로 포함할 수 있다.
이를 위하여 상기 당단백질을 코딩하는 유전자를 포함하는 재조합 벡터가 상기 효모 균주에 도입된 것일 수 있다.
상기 “재조합 벡터”는 적합한 숙주 내에서 목적 단백질을 발현시킬 수 있도록 적합한 조절 서열에 작동 가능하게 연결된 상기 목적 단백질을 암호화하는 폴리뉴클레오티드의 염기서열을 함유하는 DNA 생산물을 의미하며, 특히 작동 가능하도록 연결된 목적 단백질을 코딩하는 유전자의 발현을 지시할 수 있는데, 이러한 벡터를 발현 벡터라고 한다.
상기 발현 벡터에는, 목적 유전자의 발현의 억제 또는 증폭, 또는 유도를 위한 각종의 기능을 가진 발현 억제용의 단편이나, 형질전환체의 선택을 위한 마커나 항생물질에 대한 내성 유전자, 균체 밖으로의 분비를 목적으로 한 시그널을 코딩하는 유전자, 난발현성 단백질에 적합한 맞춤형 융합인자 등을 추가로 포함할 수 있다.
목적하는 당단백질을 코딩하는 유전자를 포함하는 본 발명에 따른 상기 효모 균주를, 상기 목적하는 당단백질을 발현하는데 적합한 배양 조건 및 배지에서 배양하여 당단백질을 생산하는 경우, 천연형 효모 균주를 이용하여 목적하는 당단백질을 생산하는 경우에 비하여 만노스인산의 부가가 감소 또는 완전히 제어되어 인체에 대한 면역반응을 유발할 가능성이 낮은 재조합 당단백질을 제조할 수 있는 이점을 가진다.
상기 목적하는 당단백질은 상기 효모 균주에서 발현시키고자 하는 당단백질이라면 특별히 그 종류는 제한되지 않으며, 병원체 단백질(pathogen protein), 성장 인자(growth factor), 사이토카인(cytokine, 예: 인터페론-α, 인터페론-β, 인터페론-γ, G-CSF 등), 케모카인(chemokine), 응집인자(예: VⅢ 인자, Ⅸ 인자, 인간 단백질 C), 내피성장인자, 성장호르몬 방출인자, HIV 외피 단백질(HIV envelope protein), 인플루엔자 바이러스 A 헤마글루티닌(influenza virus A haemagglutinin), 인플루엔자 뉴라미니다제(influenza neuraminidase), 소의 엔테로카이네이즈(enterokinase) 활성인자, 소의 포진 바이러스 타입-1 당단백질 D(Bovine herpes virus type-1 glycoprotein D), 인간 안지오스타틴(human angiostatin), 인간 B7-1, B7-2및 B-7 수용체 CTLA-4, 인간 조직 인자(human tissue factor), 성장 인자(예: 혈소판-유래 성장 인자), 인간 α-앤티트립신(human α-antitrypsin), 인간 에리트로포이에틴, 조직플라즈미노겐 활성화인자(tissue plasminogen activator), 플라즈미노겐 활성화인자 억제인자-1(plasminogen activator inhibitor-1), 우로키나제(urokinase), 플라즈미노겐, 트롬빈, 항체 또는 이의 항원-결합 단편(antigen binding fragment), 또는 융합 단백질(fusion protein) 등 제조하고자 하는 단백질이라면 어떠한 종류라도 사용할 수 있다. 또한, 상기 목적하는 당단백질의 예로서, Gas1 (beta-1,3-glucanosyltransferase), 글루코세레브로시다제(Glucocerebrosidase, GCase), 알파-갈락토시다제(alpha-galactosidase), 알파-글루코시데이즈(alpha-glucosidase), 아이두로니데이즈(iduronidase), 아이두로네이트 설페테이즈(Iduronidase sulfatase) 및 GalNAc 설페테이즈(sulfatase) 등을 들 수 있으나, 이에 제한되지 않는다.
또 하나의 양태로서, 본 발명은 상기 재조합 효모 균주를 이용하여 재조합 당단백질을 제조하는 방법을 제공한다.
구체적으로, 본 발명은
(a) 재조합 당단백질을 코딩하는 유전자를 포함하는, Mnn4 단백질 및 서열번호 1로 표시되는 Mnn14 단백질의 활성이 모두 내재적 활성에 비하여 약화된, 재조합 효모 균주를 배양하여 상기 당단백질을 생산하는 단계; 및
(b) 상기 (a) 단계에서 생산된 당단백질을 회수하는 단계를 포함하는, 재조합 당단백질을 제조하는 방법을 제공한다.
상기 효모 균주, 재조합 당단백질, Mnn4 단백질, Mnn14 단백질, 내재적 활성에 비하여 약화 등에 대해서는 앞서 설명한 바와 같다.
상기 (a) 단계의 배양은 목적하는 당단백질을 생산할 수 있는 배양 조건 및 배지 조건임이 바람직하며, 이는 당업자가 적절히 조정할 수 있다.
상기 (b) 단계는 생산된 당단백질을 배양된 세포 또는 이의 상등액에서 회수하는 단계일 수 있으며, 크로마토그래피 등의 공정을 포함할 수 있으나, 이에 제한되지 않으며, 회수에 적절한 과정을 당업자가 선택할 수 있다.
또한, 상기 방법은 회수된 단백질을 분리 정제하는 과정 등이 추가로 포함될 수 있다.
또 하나의 양태로서, 본 발명은 만노스 인산이 부가되지 않은 재조합 당단백질의 제조에 사용하기 위한 상기 재조합 효모 균주의 용도를 제공한다.
상기 당단백질, 효모 균주 등에 대해서는 앞서 설명한 바와 같다.
또 하나의 양태로서, 본 발명은 당단백질에서 만노스 인산의 부가를 제어하는 것에 사용하기 위한, 서열번호 1로 표시되는 단백질의 용도를 제공한다.
상기 서열번호 1로 표시되는 단백질에 대해서는 앞서 설명한 바와 같다.
또 하나의 양태로서, 본 발명은 만노스인산화에 사용하기 위한, 서열번호 1로 표시되는 단백질의 용도를 제공한다.
상기 서열번호 1로 표시되는 단백질에 대해서는 앞서 설명한 바와 같다.
이하 본 발명을 하기 예에 의해 상세히 설명한다. 다만, 하기 예는 본 발명을 예시하기 위한 것일 뿐, 하기 예에 의하여 본 발명의 범위가 제한되는 것은 아니다.
실시예 1. S. cerevisiae och1Δmnn1Δ 균주에서 MNN4 MNN6 유전자의 결손
1-1: S. cerevisiae och1Δmnn1Δ 균주의 제조
S. cerevisiae och1Δmnn1Δ 균주는 L3262 균주로부터 Cre/loxP 시스템을 이용한 다중 유전자 결손 방법(U. Gueldener et al, 2002, Nucleic Acids Res 30: e23; J.H. Hegemann, S.B. Heick, 2011, Methods Mol Biol 765: 189-206)을 이용하여 제작하였다. 우선, ScOCH1 유전자를 결손하기 위한 loxP - URA3 - loxP 결손 카세트를 Och1_pUG72_F와 Och1_pUG72_R 프라이머를 이용하여 pUG72 벡터로부터 증폭하여 제작하였다. 1 M 소르비톨(sorbitol)이 첨가된 SC-Ura 배지에서 형질전환된 균주들을 선별한 후, Och1_CF과 Och1_CR 프라이머들을 이용한 염색체 DNA를 주형으로 한 중합효소 연쇄반응을 이용하여 ScOCH1 유전자 결손을 확인하였다. 이어서 ScMNN1 유전자 결손을 위한 loxP - kanMX - loxP 카세트를 pUG6를 주형으로 하고, Mnn1_pUG6_F와 Mnn1_pUG6_R 프라이머들을 이용하여 제작하였으며, 상기 제작된 och1Δ 균주에 형질전환하였다. 1 M 소르비톨(sorbitol)과 200 mg/L G418이 첨가된 YPD 배지에서 형질전환된 균주를 선별하였으며, ScMNN1 유전자 결손의 확인은 염색체 DNA를 주형으로 한, Mnn1_CF와 Mnn1_CR 프라이머들을 이용한 중합효소 연쇄반응을 이용하여 확인하였다. 그리고, 유전자들의 결손을 위해서 들어간 선별용 마커들은 상기의 논문들에 보고된 바와 같이, pSH68 벡터를 형질전환하고 2% 포도당 대신에 2% 갈락토스가 첨가된 SC-Leu 배지에서 Cre 단백질을 발현시켜서 제거하였다. 마지막으로 Cre 단백질 발현을 위한 pSH68는 YPD 배지에서 연속 배양을 통해서 제거하였으며, 적절한 선별 배지에서의 성장을 확인하여 최종 mnn1Δoch1Δ 균주를 선별하였다.
상기 명명된 프라이머의 서열들은 하기와 같았다.
이름 서열(5' -> 3') 서열번호
Och1_pUG72_F atgtctaggaagttgtcccacctgatcgctacaaggaaatcaaaaTACGCTGCAGGTCGACAACC 5
Och1_pUG72_R ttatttatgacctgcatttttatcagcatcttctttccagctcccACTAGTGGAT CTGATATCACC 6
Och1_CF AATGGGGAGCGCTGATTCTC 7
Och1_CR TCTACGGAAGGACGTTGAGA 8
Mnn1_pUG6_F aacgtaatcttgcggtatttaacgctagtttaagaaagtgttactgtgtaTACGCTGCA GGTCGACAACC 9
Mnn1_pUG6_R gttcacaaaggctagtaccataaacagttagaaaaaacactggttaatgcACTAGTGGA TCTGATATCACC 10
Mnn1_CF ATCATTGCGAGGTCTCAATTGG 11
Mnn1_CR GATTAGAAAAACTCATCGAGCATCAAATG 12
소문자는 OCH1MNN1 유전자의 측면서열과 상동성이 있는 부분임
1-2: S. cerevisiae och1Δmnn1Δ 균주에서 MNN4 또는 MNN6 유전자의 결손
상기 실시예 1-1.에서 제작하였던 S. cerevisiae L3262 och1Δmnn1Δ 균주로부터 Cre/loxP 시스템을 이용한 다중 유전자 결손 방법(U. Gueldener et al, 2002, Nucleic Acids Res 30: e23; J.H. Hegemann, S.B. Heick, 2011, Methods Mol Biol 765: 189-206)을 이용하여 만노스인산화를 제어한다고 알려진 MNN4 유전자와 만노스인산화 효소로 알려진 MNN6 유전자를 추가로 파쇄하여 4중 결손 균주(och1Δmnn1Δmnn4Δmnn6Δ)를 제작하였다.
효모 균주의 배양을 위해서는 1 M 소르비톨이 첨가된 YPD 배지(1% 효모 추출물(yeast extract), 2% 펩톤(peptone), 2% 포도당) 또는 SC(synthetic complete) 배지(0.67% 효모 질소 염기(yeast nitrogen base), 2% 포도당, 드롭아웃 아미노산 혼합물(dropout amino acid mixture), 필요한 모든 아미노산 포함) 등을 사용하여 주로 28 ℃에서 배양하였다.
먼저, MNN4 유전자 결손을 위한 loxP - LEU2 - loxP 결손 카세트를 Mnn4_F와 Mnn4_R 프라이머(표 2)를 이용하여 pUG73 벡터로부터 중합효소 연쇄반응으로 증폭하여 2.5 kbp의 DNA 절편을 얻었다(도 1 (A)). 이렇게 얻어진 MNN4 유전자 결손 카세트를 och1Δmnn1Δ에 형질전환으로 도입하였으며, 1 M sorbitol이 첨가된 SC-LEU 선택배지(1 M sorbitol, 2% glucose, 0.67% yeast nitrogen base w/o amino acid, DO supplement -LEU)에서 형질 전환체를 선별하였다. 그리고 선별된 형질전환체들의 염색체 DNA를 추출하고 이를 주형으로 하여 Leu2_CF와 Mnn4_CR 프라이머들을 이용한 중합효소 연쇄 반응을 통하여 MNN4 유전자의 결손을 확인하여(도 1 (B)), LEU2 선택 마커가 들어 있는 och1Δmnn1Δmnn4Δ 균주(mnn1Δ :: loxP och1Δ :: loxP mnn4Δ::loxP-LEU2-loxP)를 제작하였다.
MNN6 유전자 결손을 위한 loxP - URA3 - loxP 결손 카세트는 Mnn6_F와 Mnn6_R 프라이머(표 2)를 이용하여 pUG72 벡터로부터 중합효소 연쇄반응으로 증폭하여 1.7 kbp의 DNA 절편을 얻었다(도2 (A)). 이렇게 얻어진 MNN6 유전자 결손 카세트를 상기에서 제작한 och1Δmnn1Δmnn4Δ 균주에 형질전환으로 도입하였으며, 1 M 소르비톨이 첨가된 SC-LEU 선택배지에서 형질 전환체를 선별하였다. 그리고 선별된 형질 전환체들의 염색체 DNA를 추출하고 이를 주형으로 하여 Mnn6_CF와 Ura3_CR 프라이머들을 이용한 중합효소 연쇄 반응을 통하여 MNN6 유전자의 결손을 확인하여(도2 (B)), LEU2URA3 선택마커가 들어 있는 4중 결손 och1Δmnn1Δmnn4Δmnn6Δ 균주(mnn1Δ::loxP och1Δ :: loxP mnn4Δ :: loxP - LEU2 - loxP mnn6Δ :: loxP - URA3 - loxP)를 제작하였다.
MNN4MNN6의 유전자 결손을 위해서 들어간 선별용 마커 LEU2URA3는 상기의 논문들에 보고된 바와 같이, 해당 균주들에 Cre 단백질 발현을 위한 pSH67 벡터를 도입하고 YPDS-G418 선택배지(1 M sorbitol, 2% glucose, 1% yeast extrat, 2% peptone, 200㎍/㎖ G418)에서 형질 전환체를 선별한 후, 이를 2% 포도당 대신 2% 갈락토오스(galactose)가 첨가된 YPDS-G418 배지에서 배양하여 Cre 단백질 발현시켜서 제거하였다. 그리고 Cre 단백질 발현을 위한 pSH47 벡터는 YPD 배지에서 연속 배양을 통해서 제거하였으며, 적절한 선별 배지에서의 성장을 확인하여 LEU2 마커가 제거된 3중 결손 och1Δmnn1Δmnn4Δ균주(mnn1Δ :: loxP och1Δ :: loxP mnn4Δ ::loxP)와 LEU2URA3선택 마커가 제거된 och1Δmnn1Δmnn4Δmnn6Δ 균주(mnn1Δ ::loxP och1Δ :: loxP mnn4Δ :: loxP mnn6Δ :: loxP)를 제작하였다.
이름 서열(5' -> 3') 서열번호
Mnn4_F acaacgtcactattccttcacacaaataaactaattagttatgcttcagcgtacgctgcaggtcgacaacc 13
Mnn4_R aggaaaggctatagaaatgaagagattcatgaattttcagtcaggttctactagtggatctgatatcacc 14
Leu2_CF agccttgtcaagagaccaga 15
Mnn4_CR attgtttgccacttatcactggcg 16
Mnn6_F agcgttcacccaaccttttgtgccctttagtgaagataagataaggtaag tacgctgcaggtcgacaacc 17
Mnn6_R tatatattcatatgtagaagattattgttcttatacatcagtgttttgat actagtggatctgatatcacc 18
Mnn6_CF gctctcgtgagacacgagtt 19
Ura3_CR cccgtcaattagttgcacca 20
Mnn14_F atgatgttatcactgcgcaggttctccatgtacgttttgagatctctgcgtacgctgcaggtcgacaacc 21
Mnn14_R ttaatatttttggtctgaaccaaatatattgtttgaagttttcttattatactagtggatctgatatcacc 22
Yur1_F atggcaaaaggaggctcgctatacatcgttggcatattcttaccaatatgtacgctgcaggtcgacaacc 23
Yur1_R ttaaatctcgtcttgctcttcttttaagaaatatttgccgctaccgttttactagtggatctgatatcacc 24
Ktr2_F atgcaaatctgcaaggtatttcttacacaggttaaaaaactactttttgttacgctgcaggtcgacaacc 25
Ktr2_R ctatgaatcgtgtttgaggaagtatttaccgctgccgtccttccaccatc actagtggatctgatatcacc 26
Ktr4_F atgaggtttctttcaaaaaggatactgaaacctgtactttcagtgatcat tacgctgcaggtcgacaacc 27
Ktr4_R tcaatacatttctaactcttcctcagacatagagtgtcttatccaggttg actagtggatctgatatcacc 28
Ktr5_F atgttgctaataagaaggacgataaatgcatttctgggatgtatccattg tacgctgcaggtcgacaacc 29
Ktr5_R ctagtttccgaactgtcttagatagtcttcccttatgtgctcctccattt actagtggatctgatatcacc 30
Ktr7_F atggctataagattgaatccaaaagtcagaaggttcttgctggataagtg tacgctgcaggtcgacaacc 31
Ktr7_R ctattcaattactctaaaattttctcttctgatctcttcaatcacgtctt actagtggatctgatatcacc 32
Mnn14_CF cgaagatcaagtaagagtgcacttg 33
Yur1_CF atctgtcactgcttattcatatcatc 34
Ktr2_CF atctcttcaggtatgtgacacctata 35
Ktr4_CF caacggaacgagctctataagacg 36
Ktr5_CF acactttaagcatgcggtgtgtgga 37
Ktr7_CF gtatacatcaggctaacaatctgtga 38
실시예 2. och1Δmnn1Δ 균주 및 MNN4 MNN6 추가 결손 된 균주들의 N - 당사슬 비교
상기 제작된 och1Δmnn1Δ 균주와 3중 결손 och1Δmnn1Δmnn4Δ 균주 및 4중 결손 och1Δmnn1Δmnn4Δmnn6Δ 균주들의 N-당사슬을 비교 분석하여 만노스 인산의 부가 효율의 변화를 관찰하였다.
2-1: DNA 시퀀서를 이용한 효모 세포 벽 만노단백질(cell wall mannoproteins, CWMs)의 N-당사슬 분석
우선 효모의 CWMs을 기존에 보고된 핫 구연산 버퍼(hot citrate buffer: 20 mM sodium citrate buffer, pH 7.0)를 이용한 방법을 따라서 추출하고(Park et al, 2011, Appl Environ Microbiol 77: 1187-1195), DNA 시퀀서를 이용한 방법으로 분석하였다(Laroy et al, 2006, Nat Protoc 1: 397-405).
간단히 기술하면, 2 ㎎의 CWMs에 2 배 부피의 Membrane Denaturing 버퍼 (MDB; 8 M Urea, 360 mM Tris-HCl (pH 8.6), 3.2 mM EDTA)를 첨가한 후 50 ℃에서 한 시간 방치하여 denaturation을 시켰다. 그리고 이를 메탄올로 활성화 시키고, 증류수로 씻어준 MultiScreen-immobilon PVDF membrane clear plate (Millipore, Billerica, MA, USA)에 로딩하였다. 0.1 M 디티오트레이톨(dithiothreitol)이 녹아 있는 MDB를 처리하여 37 ℃에서 1시간 반응 후 증류수로 씻어주고, 0.1 M 아이오도아세트산(iodoacetic acid)이 있는 MDB를 첨가하여 실온의 암 상태에서 30분 반응한 후, 증류수로 씻어주었다. 이후 증류수에 녹인 1% 폴리비닐피롤리돈(polyvinylpyrrolidone) 360 이용하여 멤브레인을 블록킹한 후, 증류수로 씻어주었다. 10 mM 트리스-아세테이트(tris-acetate) (pH 8.3)에 펩타이드 N-글리코시다제 F(PNGase F; New England Biolabs, MA, USA)를 처리하여 37 ℃에서 16시간 반응하여 N-당사슬을 절단 하여 회수하고, 이를 진공 건조시켰다. 그리고 100 mM APTS(8-Aminopyrene-1,3,6-trisulfonic acid) 를 1.2 M 구연산(citric acid)과 섞어 최종 20 mM APTS를 만들고 DMSO에 녹인 1 M 소듐 시아노브롬하이드리드(sodium cyanoborohydride, NaCNBH2)를 1:1 비율로 섞은 APTS 혼합 용액을 준비하였다. 그리고 이 APTS 혼합용액을 건조된 당사슬에 5 ㎕ 첨가 하여 37 ℃에서 16시간 동안 반응시켰다. 반응 후 10 ㎕의 HPLC 증류수로 반응을 정지시켰다. Sephadex G10(GE Healthcare, Milwaukee, WI, USA) 컬럼이 패킹된 Multiscreen Durapore membrane lined 96-well plate(Millipore, Billerica, MA, USA)를 이용해서 반응을 하지 않은 과량의 APTS를 제거하여 APTS가 표지된 당사슬을 분리한 후 기존에 보고된 방법을 따라서 DNA 시퀀서를 이용하여 분석하였다(Laroy et al, Nature Protocols 1: 397-405, 2006). 즉, APTS가 표지된 당사슬 용액 10 ㎕를 DNA 시퀀서 플레이트에 옮겨 담고, POP7-polyacrylamide linear polymer로 채워진 36 cm capillary array가 장착된 ABI 3130 DNA 시퀀서를 이용하여 분석하였다. DNA 시퀀서 분석 조건은 표 3에 기재된 바와 같으며, 데이터 분석은 GeneMapper 소프트웨어를 사용하였다.
Parameter
Oven 온도 60℃
Prerun voltage 15kV
Prerun time 180s
Infection voltage 1.2V
Injection time 16s
Run voltage 15kV
Run time 1,000s
2-2 : N-당사슬 분석 결과의 해석
이중 결손 och1Δmnn1Δ, 삼중 결손 och1Δmnn1Δmnn4Δ, 사중 결손 och1Δmnn1Δmnn4Δmnn6Δ 균주들의 N-당사슬을 분석하였을 때, 모두 3개의 주요 피크들이 관찰되었다(도3). 이 피크들은 왼쪽부터 두 개의 만노스인산이 부가된 (Man-P)2-Man8GlcNAc2 당사슬, 한 개의 만노스인산이 부가된 Man-P-Man8GlcNAc2당사슬 및 중성의 Man8GlcNAc2 당사슬들이다.
MNN4 유전자를 결손한 och1Δmnn1Δmnn4Δ 균주와 och1Δmnn1Δ 균주의 N-당사슬 프로파일에서 만노스인산이 부가된 당사슬의 함량을 비교하였을 때 별다른 차이를 보이지 않았다.
MNN4MNN6 유전자를 함께 결손한 och1Δmnn1Δmnn4Δmnn6Δ 균주는 och1Δmnn1Δoch1Δmnn1Δmnn4Δ 균주에 비해서 만노스인산이 부가된 당사슬의 함량이 다소 감소하였으나 그렇게 큰 차이를 보이지는 않았다. 이러한 결과로부터 MNN4MNN6 유전자 외에 다른 유전자가 만노스인산의 부가를 담당한다고 생각되었다.
실시예 3. MNN4 MNN6 유전자와 상동성이 있는 S. cerevisiae 유전자
N-당사슬 분석결과 MNN4 MNN6 유전자가 추가로 결손된 och1Δmnn1Δmnn4Δoch1Δmnn1Δmnn4Δmnn6Δ 균주들에서도 만노스인산의 부가 활성이 완전히 제거 되지 않았기 때문에 만노스인산화 활성에 중요한 유전자들을 추가로 결손 하기 위한 연구를 수행하였다.
이를 위해서 우선 MNN4MNN6 유전자들과 상동성이 있는 유전자들이 S. cerevisiae 효모에 추가로 있는지를 BLAST(basic local alignment tool)를 이용하여 미국 National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov)의 데이터 베이스를 탐색하였다.
MNN4는 C-말단 부위에 KKKKEEEE의 반복 서열을 가지고 있어서 이 부위를 제외하고 BLAST를 하였고, 그 중 hypothetical protein YJR061W (NP_012595)를 선정하여 이를 MNN14로 명명하였다. Mnn14 단백질은 Mnn4와 마찬가지로 기질인 GDP-만노스와 결합에서 중요하다고 알려진 LicD 도메인을 가지고 있으나, Mnn4와는 다르게 C-말단에 KKKKEEEE의 반복 서열을 가지고 있지 않다. Mnn4와 Mnn14 단백질들 사이의 서열 동일성은 33%이고, 상동성은 44%로 계산되었다.
한편, MNN6 유전자와 상동성이 있는 유전자들로는 KTR family에 속하는 YUR1, KTR2 , KTR4 , KTR5KTR7 등이 검색되었다. Mnn6 단백질과 이들 단백질 사이의 동일성과 상동성은 도 4에 기재되어 있다.
실시예 4. och1Δmnn1Δmnn4Δmnn6Δ 균주에서 MNN4 MNN6 상동 유전자들의 추가 결손
실시예 1에서 제작한 och1Δmnn1Δmnn4Δmnn6Δ 균주로부터 만노스인산화와 관련이 되어 있을 것이라고 추정되는 MNN4MNN6의 상동 유전자 6종을 추가로 결손 하였다.
실시예 1에서와 동일한 방법으로 MNN14 , YUR1 , KTR2 , KTR4 , KTR5KTR7 유전자들을 결손 하였다. 이를 위해서 loxP-URA3-loxP의 유전자 결손 카세트를 각각 6쌍의 프라이머 (MNN14_F/MNN14_R, Yur1_F/Yur1_R, Ktr2_F/Ktr2_R, Ktr4_F/Ktr4_R, Ktr5_F/Ktr5_R, Ktr7_F/Ktr7_R; 표 2 참조)들을 이용하여 중합효소 연쇄반응으로 1.7 kbp 절편을 얻었다 (도 5 (A)).
이렇게 얻어진 유전자 파쇄 카세트들을 och1Δmnn1Δmnn4Δmnn6Δ 균주에 형질전환 방법으로 도입하였으며, 1 M 소르비톨이 첨가된 SC-URA 선택배지(1 M sorbitol, 2% glucose, 0.67% yeast nitrogen base w/o amino acid, DO supplement -URA)에서 형질 전환체를 선별하였다. 그리고 선별된 형질 전환체들의 염색체 DNA를 추출하고 이를 주형으로 하여 Mnn14_CF/Ura3_CR, Yur1_CF/Ura3_CR, Ktr2_CF/Ura3_CR, Ktr4_CF/Ura3_CR, Ktr5_CF/Ura3_CR 및 Ktr7_CF/Ura3_CR 프라이머들을 이용한 중합효소 연쇄반응을 통하여 해당 유전자의 결손을 확인하였다(도5 (B)).
타깃 유전자의 결손을 위해서 들어간 선별용 마커 URA3는 실시예 1에서와 같이 Cre 단백질 발현을 위한 pSH68 벡터를 도입하고, 1 M 소르비톨이 들어간 SC-LEU 선택배지 (1 M sorbitol, 2% glucose, 0.67% yeast nitrogen base w/o amino acid, DO supplement -LEU)에서 형질 전환체를 선별한 후, 이를 2% 포도당 대신 2% 갈락토오스가 첨가된 SC-LEU 선택배지 (1 M sorbitol, 2% galactose, 0.67% yeast nitrogen base w/o amino acid, DO supplement -LEU)에서 배양하여 Cre 단백질 발현 시켜서 제거하였다. 그리고 pSH68 벡터는 YPD 배지에서 연속 배양을 통해서 제거하였으며, 적절한 선별 배지에서 성장을 확인하여 URA3 마커가 제거된 5중 결손 균주 och1Δmnn1Δmnn4Δmnn6Δmnn14Δ (- mnn14Δ), och1Δmnn1Δmnn4Δmnn6Δyur1Δ (- yur1Δ), och1Δmnn1Δmnn4Δmnn6Δktr2Δ (- ktr2Δ), och1Δmnn1Δmnn4Δmnn6Δktr4Δ (- ktr4Δ), och1Δmnn1Δmnn4Δmnn6Δktr5Δ (- ktr5Δ), och1Δmnn1Δmnn4Δmnn6Δktr7Δ (- ktr7Δ)들을 제작하였다.
실시예 5. 만노스인산화 관련 유전자 다중 결손 균주들의 N - 당사슬 구조 분석
사중 결손 och1Δmnn1Δmnn4Δmnn6Δ 균주와 실시예 4에서 제작된 추가로 MNN4 또는 MNN6의 상동 유전자가 결손된 5중 결손 균주들(- mnn14Δ , - yur1Δ, -ktr2Δ, - ktr4Δ, - ktr5Δ, - ktr7Δ)의 N-당사슬을 비교 분석하였다.
우선, 1 M 소르비톨이 들어간 최소 배지 SC(1 M sorbitol, 2% glucose, 0.67% yeast nitrogen base with amino acids)에서 28℃, 72시간 배양한 후에 그 세포를 수득하여 멸균수로 씻고, 실시예 2에서와 같은 방법으로 CWMs를 얻어서 그 N-당사슬을 분석하였다(도 6). MNN6의 상동 유전자가 결손 된 - yur1Δ, - ktr2Δ , -ktr4Δ, - ktr5Δ, - ktr7Δ 균주들은 och1Δmnn1Δmnn4Δmnn6Δ 균주와 마찬가지로 중성 당사슬(Man8GlcNAc2)과 함께 만노스인산이 부가된 (Man-P)2-Man8GlcNAc2과 Man-P-Man8GlcNAc2 당사슬 피크들이 검출되는 N-당사슬 프로파일을 보여주었다.
반면에 MNN4의 상동 유전자인 MNN14가 결손 된 - mnn14Δ 균주에서 만노스인산이 부가된 당사슬 피크들 없이 단일 Man8GlcNAc2 당사슬 피크를 보여주어 만노스인산 부가 능력이 상실 된 것을 알 수 있었다(도 6).
배양 환경이 영향을 미칠 수 있으므로 1 M 소르비톨이 첨가된 YPD 배지(1 M sorbitol, 2% galactose, 1% yeast extrat, 2% peptone)에서도 28℃, 72시간 배양한 후 상기와 같은 방법으로 CWMs의 N-당사슬을 분석하였다(도 7). 이 경우 MNN6의 상동 유전자가 결손 된 - yur1Δ, - ktr2Δ , - ktr4Δ, - ktr5Δ, - ktr7Δ 균주들은 och1Δmnn1Δmnn4Δmnn6Δ 균주와 동일하게 중성 당사슬과 함께 하나의 만노스인산이 부가된 Man-P-Man8GlcNAc2 당사슬 피크가 검출되었다. 그러나, MNN4의 상동 유전자인 MNN14가 결손 된 - mnn14Δ 균주에서는 Man8GlcNAc2 당사슬 피크 만이 검출되어 만노스인산 부가 능력이 상실된 것을 알 수 있었다(도 7).
상기의 결과들은 배양 환경에 상관 없이, MNN14 유전자의 추가 결손을 통해서 S. cerevisiae 효모의 만노스인산화 활성을 완전히 제거할 수 있음을 보여준다. 이후 실험들은 모두 1 M 소르비톨이 들어간 최소 배지 SC (1 M sorbitol, 2% glucose, 0.67% yeast nitrogen base with amino acids)에서 실험이 수행되었다.
실시예 6. och1Δmnn1Δmnn4Δmnn14Δ och1Δmnn1Δmnn14Δ 균주의 제조
실시예 5에서 MNN14 유전자가 추가 결손 된 och1Δmnn1Δmnn4Δmnn6Δmnn14Δ 균주에서 만노스 인산화 능력이 완전히 제거된 것을 확인하였다. 이에 따라 MNN6 유전자가 결손 되지 않은 och1Δmnn1Δmnn4Δoch1Δmnn1Δ 균주 등에서 MNN14 유전자의 추가 결손이 만노스인산화 능력에 어떠한 영향을 주는 지를 알아보고자 했다.
이를 위해서 실시예 1에서 기술하고 제작한 och1Δmnn1Δmnn4Δoch1Δmnn1Δ 균주들에 실시예 4에서 제작하였던 MNN14 유전자 결손 카세트를 도입하고 1 M sorbitol이 첨가된 SC-URA 선택배지에서 형질전환체를 선별하였다. 그리고 선별된 형질전환체들의 염색체 DNA를 추출하고 이를 주형으로 하여 Mnn14_CF와 Ura3_CR 프라이머들을 이용한 중합효소 연쇄반응을 통하여 MNN14 유전자의 결손을 확인하였다. MNN14 유전자의 결손을 위해서 들어간 선별용 마커 URA3는 실시예 1과 4에서와 같은 방법으로 제거하였으며, 마찬가지로 Cre 단백질 발현을 위한 pSH68 벡터도 YPD 배지에서 연속 배양을 통해서 제거하였다.
또한, 상기 MNN4MNN14 유전자들의 대표 결손 균주인 상기 och1Δmnn1Δmnn4Δmnn14Δ 균주를 och1Δmnn1Δmnn4Δmnn4paΔ로 명명하여 부타페스트 조약 하의 국제 기탁 기관인 한국 생명공학연구원에 2015년 4월 6일자로 기탁하여 KCTC12789P의 수탁번호를 부여받았다.
실시예 7. och1Δmnn1Δmnn4Δmnn14Δ och1Δmnn1Δmnn14Δ 균주의 N - 당사슬 분석
실시예 6에서 제작한 och1Δmnn1Δmnn4Δmnn14Δoch1Δmnn1Δmnn14Δ 균주들과 오중 결손 och1Δmnn1Δmnn4Δmnn6Δmnn14Δ 균주의 CWMs의 N-당사슬을 함께 분석하였다(도 8).
N-당사슬의 분석은 실시예 2 및 5에서와 같이 1 M sorbitol이 들어간 SC 배지에서 28℃, 72시간 배양하여 얻은 세포들의 CWMs를 얻어서 실시하였다.
실험 결과 och1Δmnn1Δmnn4Δmnn6Δmnn14Δoch1Δmnn1Δmnn4Δmnn14Δ 균주는 만노스인산이 부가된 당사슬 없이 Man8GlcNAc2 당사슬의 단일 피크를 보여주었다(도 8). 반면에 och1Δmnn1Δmnn14Δ 균주는 Man8GlcNAc2 당사슬과 함께 만노스인산이 부가된 (Man-P)2-Man8GlcNAc2과 Man-P-Man8GlcNAc2 당사슬 피크들이 검출되는 프로파일을 보여주었다. 이러한 결과는 효모에서 만노스인산의 부가 활성을 제거하기 위해서는 MNN4MNN14 유전자가 모두 결손 되어야 한다는 것을 보여준다.
실시예 8. MNN4 MNN14 유전자의 complementation 실험
만노스인산화 활성의 제거가 확인된 두 균주 och1Δmnn1Δmnn4Δmnn14Δoch1Δmnn1Δmnn4Δmnn6Δmnn14ΔMNN4 또는 MNN14 유전자를 발현하여 만노스인산화 능력의 회복 여부를 보는 complementation 실험을 수행하였다.
8-1: YEp352-GAP, YEp352-Mnn4, 및 YEp352-Mnn14 벡터의 제작
먼저, Mnn4 단백질 발현을 위한 YEp352-Mnn4와 control 벡터인 YEp352-GAP 벡터를 하기와 같이 제작하였다.
구체적으로, S. cerevisiae의 GAPDH 프로모터(0.8 kb) 및 터미네이터(0.2 kb)는 L3262 균주의 염색체 DNA로부터 GAPDHp-F1/GAPDHp-R1와 GAPDHt-F1/GAPDHt-R1 프라이머들을 이용하여 중합효소 연쇄반응을 통해서 증폭하였다.
증폭된 DNA 절편은 pDrive 벡터(QIAGEN, Germany)에 각각 삽입하여 pDrive-GAPDHp와 pDrive-GAPDHt 벡터들을 제작하였다. 재조합효소 EcoRI과 KpnI을 사용하여 pDrive-GAPDHp으로부터 GAPDH 프로모터를 절단하였으며, 같은 재조합 효소로 절단된 YEp352 벡터에 삽입하여 YEp352-GAPDHp 벡터를 제작하였다. 다음으로 KpnI과 PstI 효소를 사용하여 pDrive-GAPDHt로부터 GAPDH 터미네이터를 절단하여 같은 재조합 효소로 절단된 YEp352-GAPDHp 벡터에 삽입하여 YEp352-GAP 벡터를 제작하였다.
MNN4 유전자는 S. cerevisiae BY4741 균주의 염색체 DNA로부터 Mnn4_F와 Mnn4_R 프라이머를 이용하여 증폭하였으며, 제한효소 BamHI와 SpeI를 처리한 절편을 BamHI와 XbaI을 처리한 YEp352-GAP 벡터에 삽입하여 YEp352-Mnn4 벡터를 제작하였다.
Mnn14 단백질 발현을 위한 YEp352-Mnn14 벡터 제작을 위해서 MNN14 유전자(2.8 kb)는 S. cerevisiae L3262의 염색체 DNA로부터 Y-Mnn14-F와 Y-Mnn14-R 프라이머를 이용한 중합효소 연쇄반응으로 증폭하였다. 여기에 KpnI 제한 효소를 처리하여 절단한 단편을 YEp352-GAP 벡터의 GAPDH 프로모터 뒤의 KpnI 위치에 삽입하여 YEp352-MNN14 벡터를 제작하였다.
상기 벡터 제작에 사용한 프라이머의 서열은 하기와 같았다.
이름 서열(5'->3') 서열번호
GAPDHp-F1 AGTCGAATTCATACTAGCGTTGAATGTTAGCG 39
GAPDHp-R1 AGTCGGTACCTTTGTTTGTTTATGTGTGTTTATTC 40
GAPDHt-F1 AGTCGGTACCGGATCCTCTAGAGTGAATTTACTTTAAATCTT GCAT 41
GAPDHt-R1 AGTCCTGCAGATCCACAATGTATCAGGTATCT 42
Mnn4_F CGCGGATCCATGCTTCAGCGAATATCATCTAAAC 43
Mnn4_R GGACTAGTTTAATTGCTGTGCCCCTCCTC 44
Y-Mnn14-F AACACACATAAACAAACAAAGGTACCATGATGTTATCACTGCGCAGG 45
Y-Mnn14-R AAATTCACTCTAGAGGATCCGGTACCTTAATATTTTTGGTCTGAACCAAA 46
상기에서 밑줄 친 서열은 제한효소 위치임
8-2: och1Δmnn1Δmnn4Δmnn14Δ 균주의 만노스인산화 회복 실험
만노스인산화 능력이 없는 och1Δmnn1Δmnn4Δmnn14Δ 균주에 실시예 8-1의 YEp352-GAP, YEp352-Mnn4와 YEp352-Mnn14 벡터를 통상적인 형질전환 방법으로 도입하였다. 그리고 이를 실시예 2 및 5에서와 같이 1 M 소르비톨이 들어간 SC-Ura3 배지에서 28℃, 72시간 배양하여 얻은 세포들의 CWMs를 얻어서 N-당사슬을 분석하였다(도 9). 그 결과 Mnn4 또는 Mnn14 단백질을 발현한 경우 모두에서 만노스인산화 능력이 회복되었다. 그러나 Mnn4를 발현한 경우에 비해서 Mnn14를 발현했을 때 만노스인산의 부가 능력이 훨씬 높아서 Mnn4보다 Mnn14가 만노스인산화에 있어서 보다 핵심적인 역할을 수행한다는 것을 추정할 수 있었다.
8-3: och1Δmnn1Δmnn4Δmnn6Δmnn14Δ 균주의 만노스인산화 회복 실험
실시예 8-2에서와 같이 만노스인산화 능력이 없는 och1Δmnn1Δmnn4Δmnn6Δmnn14Δ 균주에 YEp352-GAP, YEp352-Mnn4와 YEp352-Mnn14 벡터를 통상적인 형질전환 방법으로 도입하고, 그 세포들의 CWMs를 얻어서 N-당사슬을 분석하였다(도 10). 그 결과 실시예 8-2에서와 마찬가지로 Mnn4 또는 Mnn14 단백질을 발현한 경우 만노스인산화 능력이 회복되었으며, Mnn4에 비해서 Mnn14를 발현했을 때 만노스인산화 능력이 훨씬 높아졌다. 이러한 결과들로부터 Mnn14가 Mnn4에 비해서 만노스인산의 부가에서 보다 핵심적인 역할을 수행한다는 것을 추정할 수 있었다.
실시예 9. MNN4 MNN14 유전자 결손에 따른 분비 발현 단백질의 N - 당사슬의 변화 분석
상기의 실시예 2 내지 8에서는 효모의 세포 벽 만노단백질(cell wall mannoproteins, CWMs)의 N-당사슬을 분석한 것으로, 추가 확인을 위해서 이후의 실시예에서는 효모로부터 분비 발현되는 당단백질의 N-당사슬을 분석하는 실험을 수행하였다.
9-1: Gas1 단백질 분비 발현 벡터 제작
모델 당단백질로서 S. cerevisiae 효모의 Gas1 단백질을 선택하고, 분비 발현을 위하여 C-말단의 glycosylphosphatidylinositol (GPI)-anchoring motif가 제거된 1 - 490번 아미노산 잔기의 단백질을 발현하는 유전자를 아래와 같은 중합효소 연쇄반응을 이용하여 증폭하였다(Gil et al, J Biotech 2015). S. cerevisiae L3262 균주의 genomic DNA를 추출한 후 이를 주형으로 하고 p-Gas1-F와 p-Gas1-R-1 프라이머를 사용하여 첫 번째 중합효소 연쇄반응으로 증폭하여 DNA 절편을 얻었다. 그리고 이를 다시 주형으로 하여 pGas1-F와 p-Gas1-R-2 프라이머를 이용하여 중합효소 연쇄반응으로 증폭하여 C-말단에 정제를 위한 8개의 His 잔기로 이루어진 His-tag을 첨가된 DNA 절편을 얻었다. 상기 증폭된 DNA는 DNA2.0 (Menlo Park, CA, 미국)의 pD1211 벡터에 Electra 방법(DNA2.0)으로 제조사에서 제공하는 프로토콜에 따라서 클로닝하였으며, 최종 제작된 벡터는 pD1211-Gas1p로 명명하였다.
상기 벡터 제작에 사용한 프라이머의 서열들은 하기와 같다.
이름 서열(5'->3') 서열번호
p-Gas1-F tacacgtacttagtcgctgaagctcttctatg atgttgtttaaatccctttcaaag 47
p-Gas1-R-1 gtgatgatgatgatggtggtggtgagaaccccctccacc actggattcagttccggaacc 48
p-Gas1-R-2 aggtacgaactcgattgacggctcttctacc gtgatgatgatgatggtggtg 49
상기에서 밑줄 친 서열은 Electra 클로닝을 위한 부분이며, italic으로 표시된 서열은 His-tag 및 linker 부분임
9-2: 재조합 Gas1 단백질의 분비 발현 및 정제
상기에서 제작된 pD1211-Gas1p 벡터를 실시예 1에서 제작한 och1Δmnn1Δmnn4Δmnn6Δ 균주와 실시예 6에서 제작한 och1Δmnn1Δmnn4Δmnn14Δ 균주에 통상적인 형질전환 방법으로 도입하고, 1 M 소르비톨이 첨가된 SC-URA 선택배지(1 M sorbitol, 2% glucose, 0.67% yeast nitrogen base w/o amino acid, DO supplement -URA)에서 선별하여 재조합 Gas1 단백질을 분비 발현하는 균주들을 제작하였다. 또한, och1Δmnn1Δmnn4Δmnn14Δ 균주에 실시예 8에서 제작한 YEp352-Mnn4와 YEp352-Mnn14 벡터와 함께 pD1211-Gas1p 벡터를 통상적인 형질전환 방법으로 도입하고 1 M 소르비톨이 첨가된 SC-URA, LEU 선택배지에서 선별하여 Gas1을 분비 발현하는 och1Δmnn1Δmnn4Δmnn14Δ/Mnn4/Gas1와 och1Δmnn1Δmnn4Δmnn14Δ/Mnn14/Gas1 균주들을 제작하였다.
상기에서 제작한 4종의 재조합 Gas1 분비 발현 효모 균주들을 1 M 소르비톨이 첨가된 적절한 선택배지 (SC-URA 또는 SC-URA, LEU)를 사용하여 28℃ 에서 3일 동안 배양하였다. 그리고 이를 통해서 얻은 배양 상등액을 통상의 His-tag 친화 컬럼을 사용하여 정제하였다(Gil et al, J Biotech 2015).
9-3: 정제된 Gas1 단백질의 N-당사슬 분석
상기의 실험을 통해서 정제한 Gas1 단백질들의 N-당사슬은 기존 문헌(Lee KJ et al, 2013, Glycoconj J)에 기술 된 바와 같이 분리 정제하였다. 간략히 기술하면, 10 mg의 정제된 Gas1 단백질을 denaturation하고 직접 PNGase F (New Englad Biolabs)를 처리하여 당사슬을 유리한 후에 graphitized carbon 컬럼(Alltech, Lexington, MA, USA)을 이용한 solid phase extraction 방법을 이용하여 정제하였다. 이렇게 정제한 N-당사슬들은 실시예 2의 DNA 시퀀서를 이용한 방법으로 분석하였다(도 11).
분석 결과 och1Δmnn1Δmnn4Δmnn6Δ 균주에서 분비 발현한 재조합 Gas1 단백질에는 만노스인산이 부가된 당사슬들이 많은 양 부착되는 데 반하여, och1Δmnn1Δmnn4Δmnn14Δ 균주에서 분비 발현한 재조합 Gas1 단백질에는 만노스인산이 부가된 당사슬들이 관찰되지 않았다(도 11의 두 번째와 세 번째 프로파일). 이는 실시예 5와 7에서 효모의 CWM의 N-당사슬을 이용하여 분석한 결과들과(도 6과 8) 일치하며, S. cerevisiae 효모에서 분비 발현하는 당단백질의 당사슬에 만노스인산이 부가되지 않게 하기 위해서는 MNN4MNN14 유전자를 동시에 결손 해야 한다는 것을 확인해준다. 이러한 사실은 och1Δmnn1Δmnn4Δmnn14Δ 균주에 Mnn4 또는 Mnn14 단백질을 발현하여 complementation한 균주들(och1Δmnn1Δmnn4Δmnn14Δ/Mnn4와 och1Δmnn1Δmnn4Δmnn14Δ/Mnn14)에서 재조합 Gas1 단백질을 분비 발현한 실험을 통해서 더욱 확실하게 확인할 수 있다(도 11의 네 번째와 다섯 번째 프로파일). 두 경우 모두 만노스인산의 부가 능력이 회복되는 것을 확인할 수 있다. 이 경우에 주목 할 점은 Mnn4를 och1Δmnn1Δmnn4Δmnn14Δ 균주에서 발현 시켰을 때에는 만노스인산이 하나 부가된 당사슬만이 적은 양 검출되는 데 반하여, Mnn14를 발현 시켰을 때 만노스인산이 하나 부가된 당사슬 peak의 세기가 증가할 뿐 만 아니라 두 개가 부가된 당사슬에 매우 강한 세기의 peak로 검출되었다는 것이다. 이는 Mnn14의 만노스인산 부가 능력이 Mnn4보다 훨씬 우수하다는 것을 보여준다.
9-4: 정제된 Gas1 단백질의 등전점 전기영동
상기의 정제된 Gas1 단백질들의 고유 등전점(isoelctric point)을 통상의 등전점 전기영동(isoelctric focusing: IEF) 방법을 이용하여 분석하였다. 간략히 기술하면 IEF 겔(ThermoFisher Scientific, Waltham, MA, USA)을 cathod와 anode 버퍼(ThermoFisher Scientific)로 채워진 챔버(ThermoFisher Scientific)에 장착하고, sample 버퍼(ThermoFisher Scientific)가 첨가된 Gas1 단백질 시료를 IEF 겔의 well에 로딩한 후 제조사에서 제공하는 프로토콜을 따라서 전기영동을 수행하였다. 전기영동이 끝난 겔은 fixation 버퍼(12% Trichloroacetic acid)에 30분 동안 반응 한 후, 쿠마시블루 염색을 진행하여 그 결과를 확인하였다(도 12).
만노스인산은 음 전하를 띄고 있어서 만노스인산이 부가될 수록 단백질의 등전점은 더 낮아진다. 따라서 och1Δmnn1Δmnn4Δmnn6Δ 균주에서 분비 발현한 재조합 Gas1 단백질은 만노스인산이 많이 부가되어서 주요 단백질 band의 등전점이 pH 3 이하에 위치하며 끌리듯이 나타났다(도 12의 첫 번째 lane). 반면에, och1Δmnn1Δmnn4Δmnn14Δ 균주에서 분비 발현한 재조합 Gas1 단백질은 주요 band가 pH 4 이상에서 관찰되어(도 12의 두 번째 lane) 등전점이 높아지는 결과를 얻어서, 도 11의 N-당사슬 분석에서 만노스인산의 부가 능력이 제거된 것과 일치하는 결과를 얻었다. 또한 Mnn4 또는 Mnn14 단백질 발현을 complementation한 균주들(och1Δmnn1Δmnn4Δmnn14Δ/Mnn4와 och1Δmnn1Δmnn4Δmnn14Δ/Mnn14)에서 분비 발현한 재조합 Gas1 단백질들은 och1Δmnn1Δmnn4Δmnn14Δ 균주에서 분비 발현한 단백질에 비해서 등전점이 확연히 낮아지는 것을 확인할 수 있었다(도 12의 세 번째와 네 번째 lane). 여기서도 Mnn14 단백질 발현을 complementation한 균주가 Mnn4 complementation 균주에 비해서 등전점이 더 낮아지는 것으로부터 Mnn14의 만노스인산 부가 능력이 보다 우수함을 확인할 수 있었다.
이상의 설명으로부터, 본 발명이 속하는 기술분야의 당업자는 본 발명이 그 기술적 사상이나 필수적 특징을 변경하지 않고서 다른 구체적인 형태로 실시될 수 있다는 것을 이해할 수 있을 것이다. 이와 관련하여, 이상에서 기술한 실시 예들은 모든 면에서 예시적인 것이며 한정적인 것이 아닌 것으로서 이해해야만 한다. 본 발명의 범위는 상기 상세한 설명보다는 후술하는 특허 청구범위의 의미 및 범위 그리고 그 등가 개념으로부터 도출되는 모든 변경 또는 변형된 형태가 본 발명의 범위에 포함되는 것으로 해석되어야 한다.
Figure PCTKR2016004759-appb-I000001

Claims (6)

  1. Mnn4 단백질 및 서열번호 1로 표시되는 Mnn14 단백질의 활성이 모두 내재적 활성에 비하여 약화된, 재조합 효모 균주.
  2. 제1항에 있어서,
    상기 내재적 활성의 약화는 상기 단백질을 암호화하는 염색체상의 유전자의 전체 또는 일부를 결실시키는 방법; 상기 단백질의 활성이 감소되도록 돌연변이된 유전자로, 염색체상의 상기 단백질을 암호화하는 유전자를 대체하는 방법; 상기 단백질을 암호화하는 염색체상의 유전자의 발현 조절 서열에 변이를 도입하는 방법; 상기 단백질을 암호화하는 유전자의 발현 조절 서열을 활성이 약하거나 없는 서열로 교체하는 방법; 상기 염색체상의 유전자의 전사체에 상보적으로 결합하여 상기 mRNA로부터 단백질로의 번역을 저해하는 안티센스 올리고뉴클레오티드를 도입하는 방법; 상기 단백질을 암호화하는 유전자의 SD 서열 앞단에 SD 서열과 상보적인 서열을 인위적으로 부가하여 2차 구조물을 형성시켜 리보솜(ribosome)의 부착이 불가능하게 만드는 법 및 해당 서열의 ORF(open reading frame)의 3' 말단에 역전사되도록 프로모터를 부가하는 RTE(Reverse transcription engineering) 방법으로 이루어지는 군에서 선택되는 방법으로 수행되는 것인, 재조합 효모 균주.
  3. 제1항에 있어서, 상기 효모는 사카로마이세스 세레비지애 (saccharomycens cerevisiae)인, 재조합 효모 균주.
  4. 제1항에 있어서, 상기 재조합 효모 균주는 Mnn1 단백질, Och1 단백질, 또는 둘 다의 활성이 내재적 활성에 비하여 약화된, 재조합 효모 균주.
  5. 제1항에 있어서, 상기 재조합 효모 균주는 당단백질을 코딩하는 유전자를 추가로 포함하는, 재조합 효모 균주.
  6. (a) 재조합 당단백질을 코딩하는 유전자를 포함하는, Mnn4 단백질 및 서열번호 1로 표시되는 Mnn14 단백질의 활성이 모두 내재적 활성에 비하여 약화된, 재조합 효모 균주를 배양하여 상기 당단백질을 생산하는 단계; 및
    (b) 상기 (a) 단계에서 생산된 당단백질을 회수하는 단계를 포함하는, 재조합 당단백질을 제조하는 방법.
PCT/KR2016/004759 2015-05-08 2016-05-04 사카로마이세스 세레비지애 효모의 만노스 인산화 활성에 핵심적인 유전자 mnn14 및 그 결손 변이주를 활용한 재조합 당단백질 생산 방법 Ceased WO2016182273A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR20150064855 2015-05-08
KR10-2015-0064855 2015-05-08

Publications (1)

Publication Number Publication Date
WO2016182273A1 true WO2016182273A1 (ko) 2016-11-17

Family

ID=57249204

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2016/004759 Ceased WO2016182273A1 (ko) 2015-05-08 2016-05-04 사카로마이세스 세레비지애 효모의 만노스 인산화 활성에 핵심적인 유전자 mnn14 및 그 결손 변이주를 활용한 재조합 당단백질 생산 방법

Country Status (2)

Country Link
KR (2) KR101782938B1 (ko)
WO (1) WO2016182273A1 (ko)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2024123691A1 (en) * 2022-12-05 2024-06-13 Danisco Us Inc. Increased ethanol production by yeast in high dissolved solids

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102428938B1 (ko) * 2019-11-01 2022-08-04 한국생명공학연구원 N-말단 결손으로 만노스인산화 효율이 증대된 재조합 Mnn14 효소

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JPH09266792A (ja) * 1996-03-29 1997-10-14 Agency Of Ind Science & Technol 酵母のマンノース−1−リン酸転移を正に制御する遺伝子ならびにこの遺伝子の欠損変異株を利用する高マンノース型中性糖鎖の製造方法

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE60032370T2 (de) * 1999-08-19 2007-10-11 Kirin Beer K.K. Hefevarianten und verfahren zur herstellung von glykoprotein enthaltenden zuckerketten vom säugetiertyp

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JPH09266792A (ja) * 1996-03-29 1997-10-14 Agency Of Ind Science & Technol 酵母のマンノース−1−リン酸転移を正に制御する遺伝子ならびにこの遺伝子の欠損変異株を利用する高マンノース型中性糖鎖の製造方法

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
BATES, STEVEN ET AL.: "Role of the Candida Albicans MNN1 Gene Family in Cell Wall Structure and Virulence", BMC RESEARCH NOTES, vol. 6, no. 1, 26 July 2013 (2013-07-26), pages 1 - 9, XP021161979 *
CONDE, RAUL ET AL.: "Screening for New Yeast Mutants Affected in Mannosylphosphorylation of Cell Wall Mannoproteins", YEAST, vol. 20, no. 14, 2003, pages 1189 - 1211, XP055328626 *
DATABASE NCBI [O] 24 December 1996 (1996-12-24), "ORF YJR061w [Saccharomyces cerevisiae]", XP055329514, retrieved from NCBI Database accession no. AAB39287.1 *
ODANI, TETSUJI ET AL.: "Cloning and Analysis of the MNN4 Gene Required for Phosphorylation of N-Linked Oligosaccharides in Saccharomyces Cerevisiae", GLYCOBIOLOGY, vol. 6, no. 8, 1996, pages 805 - 810, XP002944838 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2024123691A1 (en) * 2022-12-05 2024-06-13 Danisco Us Inc. Increased ethanol production by yeast in high dissolved solids

Also Published As

Publication number Publication date
KR20170107948A (ko) 2017-09-26
KR101782938B1 (ko) 2017-09-29
KR101863892B1 (ko) 2018-06-01
KR20160131952A (ko) 2016-11-16

Similar Documents

Publication Publication Date Title
Stagljar et al. New phenotype of mutations deficient in glucosylation of the lipid-linked oligosaccharide: cloning of the ALG8 locus.
WO2012030068A2 (ko) 1-데옥시노지리마이신 합성관련 폴리펩타이드 및 이의 용도
WO2019117671A1 (ko) 5'-이노신산을 생산하는 미생물 및 이를 이용한 5'-이노신산의 생산 방법
Spirig et al. The STT3 protein is a component of the yeast oligosaccharyltransferase complex
CN102725396A (zh) 在缺乏二肽基氨肽酶活性的巴斯德毕赤酵母中生产治疗性蛋白的方法
WO2020022547A1 (ko) 신규 5'-이노신산 디하이드로게나아제 및 이를 이용한 5'-이노신산 제조방법
WO2023121427A1 (ko) 당전이 효소 변이체 및 이를 이용한 스테비올 배당체의 제조방법
WO2020196993A1 (ko) 변이형 포스포리보실피로포스페이트 아미도트랜스퍼라아제 및 이를 이용한 퓨린 뉴클레오티드 제조방법
WO2019035612A1 (ko) 마이코스포린 유사 아미노산을 생산하는 미생물 및 이를 이용한 마이코스포린 유사 아미노산의 생산방법
WO2022239953A1 (ko) 3-메틸-2-옥소뷰타노에이트 하이드록시 메틸트랜스퍼라아제의 활성이 강화된 미생물, 및 이의 용도
WO2016182273A1 (ko) 사카로마이세스 세레비지애 효모의 만노스 인산화 활성에 핵심적인 유전자 mnn14 및 그 결손 변이주를 활용한 재조합 당단백질 생산 방법
Puccia et al. Disruption of the processing α-mannosidase gene does not prevent outer chain synthesis in Saccharomyces cerevisiae
Welsh et al. Localization of genes for the double-stranded RNA killer virus of yeast.
Li et al. Secretory production of N-glycan-deleted glycoprotein in Aspergillus oryzae
WO2021182808A1 (ko) 야로위아 속 변이체 및 이를 이용한 지방의 제조 방법
WO2021125867A1 (ko) 화합물을 생산하는 미생물 및 이를 이용한 화합물의 생산 방법
KR100915670B1 (ko) 야로위아 리폴리티카 유래의 신규 YlMPO1 유전자 및이의 파쇄 균주를 이용한 만노스 인산이 제거된 당단백질생산 방법
KR100604994B1 (ko) 알파1,6-만노실트랜스퍼라제를 코딩하는 한세눌라폴리모르파 기원의 신규 유전자 및 상기 유전자가 결손된한세눌라 폴리모르파 변이주를 이용한 재조합 당단백질생산 방법
WO2012141547A2 (ko) 활성이 증진된 변이 베타-글루코시다제 및 이를 이용한 바이오 에탄올의 제조방법
JP2770010B2 (ja) 酵母のマンノース−1−リン酸転移を正に制御する遺伝子ならびにこの遺伝子の欠損変異株を利用する高マンノース型中性糖鎖の製造方法
WO2015199441A1 (ko) 피키아 파스토리스 균주 유래의 목적단백질 분비생산용 단백질융합인자 및 이의 용도
WO2016048046A1 (ko) YlMpo1 과발현을 이용한 만노스인산화 증대 방법
WO2011132890A2 (ko) 바이오 에탄올 생산 향상용 형질전환체 및 그 균주를 이용한 에탄올 생성방법
WO2022019560A1 (ko) N-당질화 돌연변이 벼, 이의 제조방법 및 이를 이용한 단백질 생산용 벼의 제조방법
Miyata et al. Biosynthesis of rice seed alpha-amylase: proteolytic processing and glycosylation of precursor polypeptides by microsomes.

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 16792919

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 16792919

Country of ref document: EP

Kind code of ref document: A1