WO2016182273A1 - Mnn14 gene essential in mannose phosphorylation activity of saccharomyces cerevisiae yeast, and method for preparing recombinant glycoprotein by using defective variant thereof - Google Patents

Abstract

The present invention relates to: a recombinant yeast strain in which activities of both of an Mnn4 protein and a protein represented by SEQ ID NO: 1 are weakened compared to the intrinsic activity thereof; and a method for preparing a recombinant glycoprotein having a humanized sugar chain attached thereto, by using the same.

Description

Method for producing recombinant glycoprotein using MNN14, a gene essential for mannose phosphorylation activity of Saccharomyces cerevisiae yeast, and its mutant strain

The present invention relates to a recombinant yeast strain in which both the activities of Mnn4 protein and Mnn14 protein are weakened compared to endogenous activity, and a method for producing a humanized oligosaccharide-attached recombinant glycoprotein.

Glycoproteins added by glycosylation are currently leading the market with over 60% of the global market for recombinant protein pharmaceuticals. In particular, sugar chains are emerging as a major factor in determining the quality of drugs because they play an important role in the therapeutic efficacy, glycemic sustainability, targeting and immune response of glycoprotein drugs. The addition reaction in which sugar chain is largely N - O bond or a - combination glycosylation and two types of (N -linked or O -linked glycosylation) , the of the N - a sugar chain which is added via the binding glycosylation N - oligosaccharide ( N -glycan) and starts in the endoplasmic reticulum. First, Glc ₃ Man ₉ GlcNAc ₂ -PP-Dol, which is an oligosaccharide linked to Dolichol pyrophosphate (PP-Dol) present in the endoplasmic reticulum membrane, is formed. And oligosaccharyltransferase transfers it to N -glycosylation sequence of NXS / T sequence in the protein translated from ribosomes to endoplasmic reticulum by co-translational translocation mechanism. Glucosidase and mannosidase, which are responsible for the quality control of glycoprotein folding in the endoplasmic reticulum, remove glucose and specific mannose at the end, resulting in a Man ₈ GlcNAc ₂ structure. It is transferred to the Golgi apparatus with the high-mannose type oligosaccharide attached thereto.

The initial biosynthesis of N -sugar chains in the above-mentioned endoplasmic reticulum is preserved in almost the same process from yeast, eukaryotic, to mammals, higher animals. However, the oligosaccharides that have passed to the Golgi are subjected to various oligosaccharide modification processes specific to each species, resulting in completely different forms of oligosaccharides in yeasts, insects, plants and animals. In higher animals, the sugar chains of glycoproteins entering the Golgi are trimmed to Man ₅ GlcNAc ₂ form by mannosidases. Then, N -acetylglucosaminyltransferase (GNT) I was added to add one GlcNAc, followed by mannosidase II to remove two more mannose that was added to the opposite branch, to the trimannosyl core (Man ₃ GlcNAc ₂ ) A mixed structure with one GlcNAc added is created. After that, GNT II is applied to the branch from which mannose has been removed, thereby adding another GlcNAc, thereby generating oligosaccharides having two antenna structures. Afterwards, four antenna structures, such as GNT IV and V, may be produced. In some cases, up to six antenna structures may be produced by GNT VI, V, or VB. After the GlcNAc is added to make the skeleton of the antenna, the beta-galactosyltransferase and alpha-sialyltrasnferase, which are present in the Golgi apparatus, are acted on the complex to add galactose and sialic acid on the GlcNAc. Sugar chain structure is made.

Yeasts are eukaryotic microorganisms, which are easy to handle, easy to handle, and can produce a large amount of protein at low cost, resulting in high economical efficiency and high safety as they are not likely to be contaminated with viruses and prions that infect humans. Have However, the oligosaccharide structure synthesized in yeast is very different from that of humans, causing a problem in generating an immune response when injected into the human body. Yeast has the same oligosaccharide biosynthesis process as the higher animals up to the endoplasmic reticulum, but has a yeast specific oligosaccharide modification pathway to which mannose is additionally added after migration to Golgi. That is, in the OCH1 Man ₈ GlcNAc ₂ oligosaccharide passed in ER α (1,6) by the gene product - in combination with mannose is added the reaction takes place is started oeswae oligosaccharide (glycan outer chain) which, starting this α (1,6) Mannose is continuously added by -bond and α (1,2) -bond to synthesize oligosaccharide outer chain. Saccharomyces cerevisiae , a traditional yeast, sometimes undergoes a hyperglycosylation reaction with 50-200 mannose added to the core sugar chain in succession, and α (1, 3) -mannose is added by the MNN1 gene product. Also, mannose-1-phosphate to a sugar chain is added by the mannose phosphorylation (mannosylphosphorylation) is added to "mannose-1-phosphate -6- O - mannose (mannose-1-phosphate-6- O -mannose)" in the form of acid It is also known that sugar chains are produced. This is mainly caused by mannose phosphorylation by an enzyme expressing the MNN6 gene, and MNN4 has been suggested as a gene expressing a protein controlling it (Odani et al., Glycobiol., 6: 805, 1996; Odani et al. FEBS Lett., 420: 1860, 1997).

As described above, the sugar chain attached to the glycoprotein produced by the yeast cannot be used for medical purposes because it has a different structure from that of humans and causes an immune response when injected into the human body, so that yeast-specific sugar chain is added to solve this problem. Methods have been proposed to disrupt glycotransferase genes. Especially in S. cerevisiae yeast, OCH1 gene and α (1,3) - to break through the MNN1 gene, such as for adding mannose presented are methods to prevent the addition of yeast-specific sugar chain (Nakayama et al, EMBO J, 11: 2511, 1992; Nakanishi-Shindo. et al., J Biol Chem, 268: 26338, 1993).

In addition, sugar bran branches in the form of "mannose-1-phosphate-6- O -mannose" formed by the addition of mannose phosphate by MNN4 and MNN6 mentioned above may cause an immune response when injected into the human body. To produce protein, it must be removed. Therefore, even with defects MNN4 gene known to control the addition of mannose phosphate with normal OCH1 gene and MNN1 to prevent yeast-specific sugar chain biosynthesis in S. cerevisiae yeast (Chiba et al, J Biol Chem 273:. 26298, 1998 ). However, deletion of the MNN4 gene does not completely eliminate the additive activity of mannose phosphate (Odani et al ., Glycobiol 6: 805, 1996). Therefore, it is assumed that there are other genes with the additional activity of mannose phosphate, but it is not reported yet which gene is responsible for this activity.

In the present invention, as a result of intensive efforts to completely remove the activity of adding mannose phosphate to the sugar chain in yeast, especially S. cerevisiae , Mnn14 gene in S. cerevisiae strain is involved in mannose phosphorylation, MNN4 The present invention was completed by clarifying that addition of mannose phosphate is eliminated when a double deletion of the gene and the MNN14 gene occurs.

One object of the present invention is to provide a recombinant yeast strain in which the addition of mannose phosphoric acid is controlled.

Another object of the present invention to provide a method for producing a recombinant glycoprotein using the recombinant yeast strain.

It is another object of the present invention to provide the use of said recombinant yeast strain for use in the preparation of recombinant glycoproteins without added mannose phosphoric acid.

Another object of the present invention is to provide the use of the protein represented by SEQ ID NO: 1 for use in controlling the addition of mannose phosphoric acid in glycoproteins.

Another object of the present invention is to provide a use of the protein represented by SEQ ID NO: 1 for use in mannose phosphorylation.

By using the recombinant yeast strain according to the present invention in the preparation of recombinant glycoproteins, a more humanized oligosaccharide-attached glycoprotein can be prepared by eliminating the addition of yeast-specific mannose phosphate, which does not cause an immune response during human injection.

1 is an experimental result of deletion of the MNN4 gene from the och1Δmnn1Δ strain. (A) A 2.5 kbp DNA fragment was obtained by amplifying the loxP - LEU2 - loxP cassette from pUG73 using polymerase chain reaction using Mnn4_F and Mnn4_R primers. (B) the introduction of defects cassette prepared och1Δmnn1Δ strain and MNN4 gene by using the SC-Leu shop of the transformants selected on medium of confirmation from the genomic DNA primers Leu2-CF and Mnn4-CR is replaced with the LEU2 gene 1.8 It is the result of confirming the deletion of MNN4 by amplifying the DNA fragment of kbp.

Figure 2 is an experimental result of deleting the MNN6 gene from the och1Δmnn1Δmnn4Δ strain. (A) A 1.7 kbp DNA fragment was obtained by amplifying the loxP - URA3 - loxP cassette from pUG72 by polymerase chain reaction using Mnn6_F and Mnn6_R primers. (B) The prepared deletion cassette was introduced into the och1Δmnn1Δmnn4Δ strain, and the MNN6 gene was replaced with the URA3 gene using Mnn6-CF and Ura3-CR, which are primers for confirmation from the genomic DNA of the transformants selected from the SC-Ura medium. This is a result of confirming the deletion of MNN6 by amplifying the DNA fragment of kbp.

3 is a result of analyzing the N -sugar chains obtained from CWMs of och1Δmnn1Δ strains and strains additionally deleted MNN4 and MNN6 gene using a DNA sequencer. Maltodextrin reference profiles representing glucose units were shown in the first panel for relative positioning (Dex). Three oligosaccharide peaks of (Man-P) ₂ -Man ₈ GlcNAc ₂ , Man-P-Man ₈ GlcNAc ₂ and Man ₈ GlcNAc ₂ were principally observed in the profile of all deletion strains ( och1Δmnn1Δ , och1Δmnn1Δmnn4Δ , och1Δmnn1Δmnn4Δmnn6Δ ). They are indicated using the symbol of US Consortium for Functional Glycomics (htpp: //www.functionalglycomics.org/) (blue boxes: GlcNAc, green circles: mannose, phosphoric acid: P). And unidentified peaks are marked with *.

Figure 4 shows the results of identity and homology analysis between the Mnn6 protein and these proteins.

5 is an experimental result of further deletion of homologous genes of MNN4 and MNN6 from the och1Δmnn1Δmnn4Δmnn6Δ strain. (A) loxP - URA3 - loxP cassette from pUG72 vector using primers with homologous sites 5 ′ and 3′-UTR for the MNN14 , YUR1 , KTR2 , KTR4 , KTR5 and KTR7 gene deletion cassettes Was amplified by polymerase chain reaction to obtain a 1.7 kbp DNA fragment. (B) The prepared deletion cassette was introduced into the och1Δmnn1Δmnn4Δmnn6Δ strain, and amplified 1.2 kbp DNA fragments in which the corresponding gene was replaced with the URA3 gene were obtained from the genomic DNAs of the transformants selected from the SC-Ura medium. This is the result of checking the deficiency.

FIG. 6 shows the results of analysis of the N -sugar chains obtained from CWMs of och1Δmnn1Δmnn4Δmnn6Δ strains cultured in minimal medium and strains additionally deleted with homologous genes of MNN4 or MNN6 . As in FIG. 3, a maltodextrin reference for relative positioning was first placed in a panel (Dex). Och1Δmnn1Δmnn4Δmnn6Δ , och1Δmnn1Δmnn4Δmnn6Δyur1Δ (- yur1Δ), och1Δmnn1Δmnn4Δmnn6Δktr2Δ (- ktr2Δ), och1Δmnn1Δmnn4Δmnn6Δktr4Δ (- ktr4Δ), och1Δmnn1Δmnn4Δmnn6Δktr5Δ (- ktr5Δ), och1Δmnn1Δmnn4Δmnn6Δktr7Δ (- ktr7Δ) and och1Δmnn1Δmnn4Δmnn6Δmnn14Δ (- mnn14Δ) - shows the oligosaccharide profile of the strain N. Oligosaccharide peaks were displayed in the same manner as in FIG. 3.

7 is an analysis result of the N -sugar chain obtained from CWMs of och1Δmnn1Δmnn4Δmnn6Δ strains cultured in YPD medium and strains additionally deleted with homologous genes of MNN4 or MNN6 . In the same manner as in FIG. 6, the panel order and oligosaccharide peaks are shown.

8 is an analysis result of the N- sugar chains obtained from CWMs of strains missing the MNN14 gene. As in FIG. 3, a maltodextrin reference for relative positioning was first placed in a panel (Dex). The following panel shows the N - glycochain profiles of the och1Δmnn1Δmnn4Δmnn6Δmnn14Δ , och1Δmnn1Δmnn4Δmnn14Δ , and och1Δmnn1Δmnn14Δ strains in turn. Oligosaccharide peaks were displayed in the same manner as in FIG. 3.

Figure 9 is a complementation experiment results to see whether the recovery of mannose phosphorylation ability by expressing the MNN4 or MNN14 gene in the och1Δmnn1Δmnn4Δmnn14Δ strain mannose phosphorylation ability was removed. As in FIG. 3, a maltodextrin reference for relative positioning was first placed in a panel (Dex). The next panel shows the N -sugar chain profiles of strains transformed with YEp352-GAP (Mock), YEp352-Mnn4 (Mnn4) or YEp352-Mnn14 (Mnn14) vectors in turn. Oligosaccharide peaks were displayed in the same manner as in FIG. 3.

Figure 10 is a complementation experiment results to see whether the recovery of mannose phosphorylation ability by expressing the MNN4 or MNN14 gene in the och1Δmnn1Δmnn4Δmnn6Δmnn14Δ strain mannose phosphorylation ability was removed. Panel order and oligosaccharide peaks are shown in the same manner as in FIG. 9.

Figure 11 shows the N -sugar experiment profile of purified recombinant Gas1 protein secreted and expressed in och1Δmnn1Δmnn4Δmnn6Δ , och1Δmnn1Δmnn4Δmnn14Δ , och1Δmnn1Δmnn4Δmnn14Δ / Mnn4 and och1Δmnn1Δmnn4Δmnn14Δ / Mnn14 strains. Each oligosaccharide peak is represented in the same manner as in FIG. 3.

FIG. 12 shows the recombinant isoelectric point (IoF) by purifying recombinant Gas1 protein secreted from strains och1Δmnn1Δmnn4Δmnn6Δ , och1Δmnn1Δmnn4Δmnn14Δ , och1Δmnn1Δmnn4Δmnn14Δ / Mnn4 and och1Δmnn1Δmnn4Δmnn14Δ / Mnn14 .

This will be described in detail as follows. In addition, each description and embodiment disclosed in this invention is applicable to each other description and embodiment. That is, all combinations of the various elements disclosed in the present invention fall within the scope of the present invention. In addition, the scope of the present invention is not to be limited by the specific description described below.

In one aspect, the present invention provides a recombinant yeast strain wherein the addition of mannose phosphoric acid is controlled. Specifically, the yeast strain may be unnaturally generated, but is not limited thereto.

Specifically, the present invention provides recombinant yeast strains in which the activity of Mnn4 protein and Mnn14 protein are both attenuated compared to endogenous activity.

As used herein, the term "Mnn4 protein" is a protein involved in mannose phosphorylation of oligosaccharides (also called oligosaccharides). The Mnn4 protein is known as a putative positive regulator of mannosylphosphate transferase. The Mnn4 protein is also named YKL200C, YKL201C. The Mnn4 protein and genetic information encoding the same may be obtained through a database such as the US National Institute of Health GenBank. For example, the Mnn4 protein may have an amino acid sequence represented by SEQ ID NO: 3 (nucleotide sequence of SEQ ID NO: 4), This is not restrictive.

In addition, the Mnn4 protein is not only a protein having an amino acid sequence represented by SEQ ID NO: 3, but also 80% or more, specifically 90% or more, more specifically 95% or more, 99% or more with SEQ ID NO: 3 As a protein having the above homology, as long as it is an amino acid sequence having a biological activity substantially the same as or corresponding to that of the Mnn4 protein, the case where some sequences have an amino acid sequence deleted, modified, substituted or added is included in the scope of the present invention. This is apparent to those skilled in the art.

As used herein, the term “homology” refers to the percent identity between two polynucleotide or polypeptide moieties. Homology between sequences from one moiety to another may be determined by known techniques. For example, homology can be determined by aligning sequence information and directly aligning sequence information between two polynucleotide molecules or two polypeptide molecules using readily available computer programs. The computer program may be BLAST (NCBI), CLC Main Workbench (CLC bio), MegAlign ™ (DNASTAR Inc), or the like. In addition, homology between polynucleotides can be determined by hybridization of polynucleotides under conditions of stable double-stranding between homologous regions, followed by digestion with single-strand-specific nucleases to determine the size of the digested fragments.

As used herein, the term “Mnn14 protein” refers to a protein encoded by MNN4 gene and paralogin gene in S. cerevisiae . Mnn14 is also named YJR061W. In addition, in the present invention, the Mnn14 is also named Mnn4pa, and the terms may be used interchangeably herein. The information of the Mnn14 protein may be obtained through a known database such as the US National Institute of Health GenBank. For example, the protein may be NP_012595 (SEQ ID NO: 1), but is not limited thereto.

In addition, in the present invention, the category of the Mnn14 protein represented by SEQ ID NO: 1 is not only the amino acid sequence of SEQ ID NO: 1, but also 80% or more, specifically 90% or more, more specifically 95% or more of SEQ ID NO: 1 More specifically, if a protein having a homology of 99% or more, and an amino acid sequence having the same or corresponding biological activity as a protein having the amino acid sequence of SEQ ID NO: 1, the amino acid to which some sequences are deleted, modified, substituted or added The case of having a sequence is also included in the scope of the present invention, which will be apparent to those skilled in the art.

The protein having the amino acid sequence of SEQ ID NO: 1 may be encoded by the base sequence represented by SEQ ID NO: 2, but is not limited thereto, and the base sequence encoding the protein due to codon degeneracy varies It will be apparent to those skilled in the art.

In the present invention, the term "attenuated compared to the intrinsic activity" is a concept that includes both the activity is reduced or inactive when compared with the activity of the protein that the microorganism has in its natural state.

The weakening may be a mutation to weaken the activity of the protein, the mutation may be an unnatural occurrence, but is not limited thereto. Specifically, in the present invention, attenuating the activity of a protein includes a method of deleting all or part of a gene on a chromosome encoding the protein; Replacing the gene encoding the protein on a chromosome with a mutated gene such that the activity of the protein is reduced; Introducing a mutation into an expression control sequence of a gene on a chromosome encoding said protein; Replacing the expression control sequence of the gene encoding the protein with a sequence with weak or no activity; Introducing an antisense oligonucleotide that complementarily binds to a transcript of a gene on the chromosome to inhibit translation from the mRNA to a protein; How to make a secondary structure by the addition of a sequence complementary to the SD sequence in front of the SD sequence of the gene encoding the protein to make the ribosomes impossible to attach and the ORF (open reading frame) of the sequence It may be performed by a method selected from the group consisting of a reverse transcription engineering (RTE) method that adds a promoter to reverse transcription at the 3 'end, but is not limited thereto, and any method of weakening protein activity may be applied. Self-explanatory

In addition, the recombinant yeast strain may be one in which the activity of Mnn1 protein, Och1 protein, or both is weakened compared to the intrinsic activity.

The Mnn1 protein has alpha-1,3-mannosyltransferase activity. Since the protein can add α (1,3) -mannose, which can be recognized as an antigen in the human body, to the glycoprotein, the yeast specific oligosaccharide is added to the recombinant glycoprotein by attenuating the activity of the protein relative to the endogenous activity. Can help control.

In addition, the Och1 protein acts as a mannose transferase in cis-Golgi and mediates polymannose outer chain elongation of the N -linked oligosaccharide of glycoproteins. Thus, by attenuating the activity of the protein relative to endogenous activity, it may be helpful to control the addition of yeast specific oligosaccharides to recombinant glycoproteins.

Information on the Mnn1 protein, Och1 protein described above can be obtained through a database known to those skilled in the art, such as the National Institutes of Health GenBank, as described above.

In addition, the above description also applies to the weakening of the protein activity.

In addition, the yeast saccharomycens (Saccharomycens) cerevisiae ), but is not limited thereto, and any yeast capable of achieving yeast specific oligosaccharide control by attenuating the activity of Mnn4 and Mnn14 proteins may be included in the scope of the present invention.

The above described Mnn1, Och1, Mnn4 and Mnn14 the N attached to the glycoproteins of the activity of the protein of weakening, the yeast-specific sugar chain biosynthesis pathway is attenuated yeast expression-linked sugar chains are mostly have a GlcNAc ₂ structure Man ₈ have. When transforming the above-described mutants with an expression vector capable of expressing one or more proteins having oligosaccharide-modifying enzyme activity, it is possible to more effectively convert to a form having a structure similar to that of human sugar chains. These oligosaccharide-modifying enzymes include alpha 1,2-mannosidase, mannosidase A, mannosidase IB, mannosidase IC, mannosidase II, N-acetylglucozaminyltransferase I, and N-acetylglucozami. Neiltransferase II, galactosyltransferase, sialyltransferase, fucosyltransferase, and the like, but are not limited to these, and various genes may be used that may help reduce and modify mannose residues. .

Therefore, as another aspect, the present invention provides a yeast variant strain further comprising an expression vector of the sugar chain modification enzyme. Preferably, the sugar-modifying enzyme is alpha 1, 2-mannosidase, mannosidase IA, mannosidase IB, mannosidase IC, mannosidase II, N-acetylglucosaminyltransferase I, N-acetylglucose Xaminiltransferase II, galactosyltransferase, sialyltransferase, fucosyltransferase and the like.

In addition, the recombinant yeast strain may further comprise a gene encoding a glycoprotein.

To this end, a recombinant vector comprising the gene encoding the glycoprotein may be introduced into the yeast strain.

The "recombinant vector" refers to a DNA product containing a nucleotide sequence of a polynucleotide encoding the target protein operably linked to a suitable control sequence to express the target protein in a suitable host, and in particular operably linked Expression of the gene encoding the protein of interest can be directed, such a vector is called an expression vector.

The expression vector contains fragments for suppressing expression having various functions for suppressing or amplifying or inducing the expression of a target gene, markers for selection of transformants, resistance genes against antibiotics, and secretion out of cells. Genes encoding a signal for the purpose of, may be further included a custom fusion factor suitable for the non-expressing protein.

When the yeast strain according to the present invention comprising a gene encoding a desired glycoprotein is cultured in a culture condition and a medium suitable for expressing the desired glycoprotein to produce a glycoprotein, using a natural yeast strain Compared with the production of the desired glycoprotein, the addition of mannose phosphate is reduced or completely controlled, thereby producing a recombinant glycoprotein that is less likely to cause an immune response to the human body.

The desired glycoprotein is not particularly limited as long as it is a glycoprotein to be expressed in the yeast strain, pathogen protein, growth factor, cytokine (eg, interferon-α, Interferon-β, interferon-γ, G-CSF, etc.), chemokine, chemokine (e.g., VIII factor, Ⅸ factor, human protein C), endothelial growth factor, growth hormone release factor, HIV envelope protein (HIV envelope) protein), influenza virus A haemagglutinin, influenza neuraminidase, bovine enterokinase activator, bovine herpes virus type 1 glycoprotein D (Bovine herpes virus type -1 glycoprotein D), human angiostatin, human B7-1, B7-2 and B-7 receptor CTLA-4, human tissue factor, growth factor (e.g., platelet-derived growth factor) , Human α- Anti-trypsin, human erythropoietin, tissue plasminogen activator, plasminogen activator inhibitor-1, urokinase, plasma Any kind of protein may be used as long as it is a protein to be prepared, such as minogen, thrombin, an antibody or an antigen-binding fragment thereof, or a fusion protein. In addition, examples of the glycoproteins of interest include Gas1 (beta-1,3-glucanosyltransferase), Glucocerebrosidase (GCase), alpha-galactosidase, and alpha-glucosidase. alpha-glucosidase, iduronidase, iduronidase sulfatase, and GalNAc sulfatase, but are not limited thereto.

As another aspect, the present invention provides a method for producing a recombinant glycoprotein using the recombinant yeast strain.

Specifically, the present invention

(a) culturing a recombinant yeast strain, wherein the activity of the Mnn4 protein and the Mnn14 protein represented by SEQ ID NO: 1, including the gene encoding the recombinant glycoprotein, is weakened relative to the intrinsic activity to produce the glycoprotein; And

(b) providing a method for producing a recombinant glycoprotein comprising recovering the glycoprotein produced in step (a).

The yeast strain, recombinant glycoprotein, Mnn4 protein, Mnn14 protein, weakening compared to the intrinsic activity is as described above.

The culturing of step (a) is preferably a culture condition and a medium condition capable of producing a desired glycoprotein, which can be appropriately adjusted by those skilled in the art.

The step (b) may be a step of recovering the produced glycoprotein from the cultured cells or a supernatant thereof, and may include a process such as chromatography, but is not limited thereto, and a person skilled in the art may select a suitable process for recovery. have.

In addition, the method may further include a process of separating and purifying the recovered protein.

In another aspect, the present invention provides the use of said recombinant yeast strain for use in the preparation of recombinant glycoproteins without added mannose phosphoric acid.

The glycoprotein, yeast strain and the like are as described above.

In another aspect, the invention provides the use of a protein represented by SEQ ID NO: 1 for use in controlling the addition of mannose phosphoric acid in a glycoprotein.

The protein represented by SEQ ID NO: 1 is as described above.

As another aspect, the present invention provides a use of the protein represented by SEQ ID NO: 1 for use in mannose phosphorylation.

The protein represented by SEQ ID NO: 1 is as described above.

Hereinafter, the present invention will be described in detail by the following examples. However, the following examples are only for illustrating the present invention, and the scope of the present invention is not limited by the following examples.

Example  One. S. cerevisiae och1Δmnn1Δ  In strain MNN4  And MNN6  Gene loss

1-1: S. cerevisiae Preparation of och1Δmnn1Δ Strains

S. cerevisiae The och1Δmnn1Δ strain is a multiple gene deletion method using the Cre / loxP system from the L3262 strain (U. Gueldener et al , 2002, Nucleic Acids Res 30: e23; JH Hegemann, SB Heick, 2011, Methods Mol Biol 765: 189-206). First, a loxP - URA3 - loxP deletion cassette for deleting the ScOCH1 gene was amplified from a pUG72 vector using Och1_pUG72_F and Och1_pUG72_R primers. After screening the transformed strains in SC-Ura medium to which 1 M sorbitol was added, ScOCH1 gene defects were identified using polymerase chain reaction using chromosomal DNA as a template using Och1_CF and Och1_CR primers. Subsequently, a loxP - kanMX - loxP cassette for ScMNN1 gene deletion was prepared using pUG6 as a template, Mnn1_pUG6_F and Mnn1_pUG6_R primers, and transformed into the och1Δ strain prepared above. Transformed strains were selected from YPD medium supplemented with 1 M sorbitol and 200 mg / L G418. ScMNN1 gene deletion was identified by polymerase chain reaction using Mnn1_CF and Mnn1_CR primers based on chromosomal DNA. It confirmed using. And, markers selected for deletion of genes were removed by expressing Cre protein in SC-Leu medium transformed with pSH68 vector and added 2% galactose instead of 2% glucose as reported in the above papers. It was. Finally, pSH68 for Cre protein expression was removed through continuous culture in YPD medium, the final mnn1Δoch1Δ strain was selected by confirming growth in the appropriate selection medium.

The sequences of the named primers were as follows.

name	Sequence (5 '-> 3')	SEQ ID NO:
Och1_pUG72_F		atgtctaggaagttgtcccacctgatcgctacaaggaaatcaaaaTACGCTGCAGGTCGACAACC	5
Och1_pUG72_R		ttatttatgacctgcatttttatcagcatcttctttccagctcccACTAGTGGAT CTGATATCACC	6
Och1_CF
AATGGGGAGCGCTGATTCTC	7
Och1_CR
TCTACGGAAGGACGTTGAGA	8
Mnn1_pUG6_F		aacgtaatcttgcggtatttaacgctagtttaagaaagtgttactgtgtaTACGCTGCA GGTCGACAACC	9
Mnn1_pUG6_R	gttcacaaaggctagtaccataaacagttagaaaaaacactggttaatgcACTAGTGGA TCTGATATCACC	10
Mnn1_CF		ATCATTGCGAGGTCTCAATTGG	11
Mnn1_CR	GATTAGAAAAACTCATCGAGCATCAAATG	12
Case is part of the terms of the sequence homology of the OCH1 gene MNN1 Lim

1-2: S. cerevisiae Deletion of the MNN4 or MNN6 Gene in the och1Δmnn1Δ Strain

Multiple gene deletion method using Cre / loxP system from S. cerevisiae L3262 och1Δmnn1Δ strain prepared in Example 1-1. (U. Gueldener et al, 2002, Nucleic Acids Res 30: e23; JH Hegemann, SB Heick, 2011 , Methods Mol Biol 765: 189-206) using the mannose by controlling the phosphorylation that crushed further MNN6 gene known as known MNN4 gene and mannose kinase deficient strain was produced (och1Δmnn1Δmnn4Δmnn6Δ) of the 4.

For cultivation of yeast strains, YPD medium (1% yeast extract, 2% peptone, 2% glucose) or SC (synthetic complete) medium (0.67% yeast nitrogen base) with 1 M sorbitol added Nitrogen base), 2% glucose, dropout amino acid mixture (including all necessary amino acids) and the like were mainly incubated at 28 ℃.

First, the loxP - LEU2 - loxP deletion cassette for MNN4 gene deletion was amplified by polymerase chain reaction from pUG73 vector using Mnn4_F and Mnn4_R primers (Table 2) to obtain a 2.5 kbp DNA fragment (FIG. 1 (A)). . The MNN4 gene deletion cassette thus obtained was transformed into och1Δmnn1Δ , and SC-LEU selective medium (1 M sorbitol, 2% glucose, 0.67% yeast nitrogen base w / o amino acid, DO supplement -LEU added with 1 M sorbitol) was introduced. Transformants were selected. The chromosomal DNA of the selected transformants was extracted and the template was used to identify the deletion of the MNN4 gene through polymerase chain reaction using Leu2_CF and Mnn4_CR primers (FIG. 1 (B)). The och1Δmnn1Δmnn4Δ containing the LEU2 selection marker was identified. Strain ( mnn1Δ :: loxP och1Δ :: loxP mnn4Δ :: loxP-LEU2-loxP ) was constructed.

The loxP - URA3 - loxP deletion cassette for MNN6 gene deletion was amplified by polymerase chain reaction from pUG72 vector using Mnn6_F and Mnn6_R primers (Table 2) to obtain a 1.7 kbp DNA fragment (FIG. 2 (A)). The MNN6 gene deletion cassette thus obtained was transformed into the och1Δmnn1Δmnn4Δ strain prepared above, and transformants were selected from SC-LEU selective medium to which 1 M sorbitol was added. In addition, the chromosomal DNA of the selected transformants was extracted and a template was used to identify the deletion of the MNN6 gene through a polymerase chain reaction using Mnn6_CF and Ura3_CR primers (FIG. 2 (B)), and the LEU2 and URA3 selection markers were included. Quadruple deletion och1Δmnn1Δmnn4Δmnn6Δ strain ( mnn1Δ :: loxP och1Δ :: loxP mnn4Δ :: loxP - LEU2 - loxP mnn6Δ :: loxP - URA3 - loxP ) was constructed.

MNN4 and the selectable marker LEU2 and URA3 for entering to the genetic defect of MNN6 are as reported in the above paper, introducing pSH67 vector for Cre protein expression in the strain, and YPDS-G418 selection medium (1 M sorbitol, 2% glucose, 1% yeast extrat, 2% peptone, 200µg / ml G418), and transformants were cultured in YPDS-G418 medium supplemented with 2% galactose instead of 2% glucose. Protein was removed by expression. In addition, pSH47 vector for Cre protein expression was removed through continuous culture in YPD medium, and confirmed by growth in an appropriate selection medium, the triple-defect och1Δmnn1Δmnn4Δ strain ( mnn1Δ :: loxP) with the LEU2 marker removed. och1Δ :: loxP mnn4Δ :: loxP) and och1Δmnn1Δmnn4Δmnn6Δ strains LEU2 and URA3 selection marker is removed (mnn1Δ :: loxP och1Δ :: loxP mnn4Δ :: loxP mnn6Δ :: loxP ) was constructed.

name	Sequence (5 '-> 3')	SEQ ID NO:
Mnn4_F	acaacgtcactattccttcacacaaataaactaattagttatgcttcagcg tacgctgcaggtcgacaacc	13
Mnn4_R	aggaaaggctatagaaatgaagagattcatgaattttcagtcaggttct actagtggatctgatatcacc	14
Leu2_CF	agccttgtcaagagaccaga	15
Mnn4_CR		attgtttgccacttatcactggcg	16
Mnn6_F	agcgttcacccaaccttttgtgccctttagtgaagataagataaggtaag tacgctgcaggtcgacaacc	17
Mnn6_R	tatatattcatatgtagaagattattgttcttatacatcagtgttttgat actagtggatctgatatcacc	18
Mnn6_CF		gctctcgtgagacacgagtt	19
Ura3_CR		cccgtcaattagttgcacca	20
Mnn14_F	atgatgttatcactgcgcaggttctccatgtacgttttgagatctctgcg tacgctgcaggtcgacaacc	21
Mnn14_R	ttaatatttttggtctgaaccaaatatattgtttgaagttttcttattat actagtggatctgatatcacc	22
Yur1_F	atggcaaaaggaggctcgctatacatcgttggcatattcttaccaatatg tacgctgcaggtcgacaacc	23
Yur1_R	ttaaatctcgtcttgctcttcttttaagaaatatttgccgctaccgtttt actagtggatctgatatcacc	24
Ktr2_F	atgcaaatctgcaaggtatttcttacacaggttaaaaaactactttttgt tacgctgcaggtcgacaacc	25
Ktr2_R	ctatgaatcgtgtttgaggaagtatttaccgctgccgtccttccaccatc actagtggatctgatatcacc	26
Ktr4_F	atgaggtttctttcaaaaaggatactgaaacctgtactttcagtgatcat tacgctgcaggtcgacaacc	27
Ktr4_R	tcaatacatttctaactcttcctcagacatagagtgtcttatccaggttg actagtggatctgatatcacc	28
Ktr5_F	atgttgctaataagaaggacgataaatgcatttctgggatgtatccattg tacgctgcaggtcgacaacc	29
Ktr5_R	ctagtttccgaactgtcttagatagtcttcccttatgtgctcctccattt actagtggatctgatatcacc	30
Ktr7_F	atggctataagattgaatccaaaagtcagaaggttcttgctggataagtg tacgctgcaggtcgacaacc	31
Ktr7_R	ctattcaattactctaaaattttctcttctgatctcttcaatcacgtctt actagtggatctgatatcacc	32
Mnn14_CF		cgaagatcaagtaagagtgcacttg	33
Yur1_CF		atctgtcactgcttattcatatcatc	34
Ktr2_CF		atctcttcaggtatgtgacacctata	35
Ktr4_CF	caacggaacgagctctataagacg	36
Ktr5_CF		acactttaagcatgcggtgtgtgga	37
Ktr7_CF		gtatacatcaggctaacaatctgtga	38

Example  2. och1Δmnn1Δ  Strains and MNN4 Wow MNN6 end  Of additional missing strains N - Our hair  compare

The N -sugar chains of the prepared och1Δmnn1Δ strain, the triple-deleted och1Δmnn1Δmnn4Δ strain, and the quadruple-deleted och1Δmnn1Δmnn4Δmnn6Δ strains were analyzed to observe a change in the addition efficiency of mannose phosphoric acid.

2-1: N -sugar Chain Analysis of Yeast Cell Wall Mannoproteins (CWMs) Using DNA Sequencers

First, yeast CWMs were extracted using a method previously reported using hot citrate buffer (20 mM sodium citrate buffer, pH 7.0) (Park et al, 2011, Appl Environ Microbiol). 77: 1187-1195), and analyzed using a DNA sequencer (Laroy et al, 2006, Nat Protoc 1: 397-405).

Briefly, denaturation was performed by adding 2 volumes of Membrane Denaturing Buffer (MDB; 8 M Urea, 360 mM Tris-HCl (pH 8.6), 3.2 mM EDTA) to 2 mg CWMs followed by one hour at 50 ° C. I was. And it was activated with methanol and loaded on a MultiScreen-immobilon PVDF membrane clear plate (Millipore, Billerica, MA, USA) washed with distilled water. Treat MDB dissolved in 0.1 M dithiothreitol, wash it with distilled water after reaction at 37 ° C for 1 hour, and add MDB with 0.1 M iodoacetic acid for 30 minutes at room temperature After the reaction, the mixture was washed with distilled water. After blocking the membrane using 1% polyvinylpyrrolidone (polyvinylpyrrolidone) 360 dissolved in distilled water, and washed with distilled water. 10 mM tris-acetate (pH 8.3) was treated with peptide N -glycosidase F (PNGase F; New England Biolabs, MA, USA) and reacted at 37 ° C. for 16 hours to cleave N -sugar chains. Recovered and dried in vacuo. And 100 mM APTS (8-Aminopyrene-1,3,6-trisulfonic acid) mixed with 1.2 M citric acid to form the final 20 mM APTS and dissolved in 1 M sodium cyanoborohydride (NaCNBH2). ) Was prepared in a 1: 1 mixture of APTS mixed solution. 5 µl of the mixed APTS solution was added to the dried oligosaccharides and reacted at 37 ° C for 16 hours. After the reaction, the reaction was stopped with 10 μl of HPLC distilled water. Sepadex G10 (GE Healthcare, Milwaukee, WI, USA) was packed with a Multiscreen Durapore membrane lined 96-well plate (Millipore, Billerica, Mass., USA) to remove excess APTS from unreacted APTS-labeled APTS. The oligosaccharides were separated and analyzed using a DNA sequencer according to previously reported methods (Laroy et al, Nature Protocols 1: 397-405, 2006). That is, 10 μl of the APTS-labeled oligosaccharide solution was transferred to a DNA sequencer plate, and analyzed using an ABI 3130 DNA sequencer equipped with a 36 cm capillary array filled with POP7-polyacrylamide linear polymer. DNA sequencer analysis conditions were as described in Table 3, and data analysis was performed using GeneMapper software.

Parameter
Oven temperature	60 ℃
Prerun  voltage	15 kV
Prerun  time	180 s
Infection voltage	1.2 V
Injection time	16s
Run voltage	15 kV
Run time	1,000 s

2-2: Interpretation of N -Chain Chain Analysis Results

When analyzing the N -sugar chains of the double-deleted och1Δmnn1Δ , triple-deleted och1Δmnn1Δmnn4Δ , and quadruple-deleted och1Δmnn1Δmnn4Δmnn6Δ strains, all three major peaks were observed (FIG. 3). These peaks are from the left with (Man-P) ₂ -Man ₈ GlcNAc ₂ oligosaccharide added with two mannose phosphates, Man-P-Man ₈ GlcNAc ₂ oligosaccharide added with one mannose phosphate and neutral Man ₈ GlcNAc ₂ These are the sugar chains.

Och1Δmnn1Δmnn4Δ strain and och1Δmnn1Δ that lack the MNN4 gene When comparing the content of oligosaccharides added with mannose phosphate in the N -sugar chain profile of the strain, there was no difference.

Och1Δmnn1Δmnn4Δmnn6Δ strains deficient with the MNN4 and MNN6 genes but slightly decreased the content of the phosphoric acid is added mannose oligosaccharides compared to och1Δmnn1Δ and och1Δmnn1Δmnn4Δ strain did not show such a large difference. From these results, it was thought that other genes besides MNN4 and MNN6 genes are responsible for the addition of mannose phosphate.

Example  3. MNN4 Wow MNN6  Gene and Homology  there is S. cerevisiae  gene

N-Our Chain Analysis With MNN4 MNN6 Additional genes Missing In addition, och1Δmnn1Δmnn4Δ and och1Δmnn1Δmnn4Δmnn6Δ strains did not completely remove the mannose phosphate, so a study was performed to further delete genes important for mannose phosphorylation activity.

To do this, we first use the basic local alignment tool (BLAST) to determine whether additional genes homologous to the MNN4 and MNN6 genes are present in S. cerevisiae yeast (US National Center for Biotechnology Information (http: //www.ncbi.nlm)). .nih.gov).

MNN4 had a repeat sequence of KKKKEEEE at the C-terminal part and BLAST was excluded except for this part. Among them, the hypothetical protein YJR061W (NP_012595) was selected and named MNN14 . The Mnn14 protein, like Mnn4, has a LicD domain that is known to be important in binding to the substrate GDP-mannose, but unlike Mnn4, it does not have a repeat sequence of KKKKEEEE at the C-terminus. Sequence identity between Mnn4 and Mnn14 proteins was 33% and homology was calculated at 44%.

Meanwhile, YUR1 , KTR2 , KTR4 , KTR5 and KTR7 belonging to the KTR family were searched for genes homologous to the MNN6 gene. Identity and homology between the Mnn6 proteins and these proteins are described in FIG. 4.

Example  4. och1Δmnn1Δmnn4Δmnn6Δ  In strain MNN4 Wow MNN6  Additional Deletion of Homologous Genes

From the och1Δmnn1Δmnn4Δmnn6Δ strain prepared in Example 1, six homologous genes of MNN4 and MNN6 , which are thought to be related to mannose phosphorylation, were further deleted.

In the same manner as in Example 1, the MNN14 , YUR1 , KTR2 , KTR4 , KTR5 and KTR7 genes were deleted. For this purpose, the gene deletion cassette of loxP-URA3-loxP was used with each of six pairs of primers (MNN14_F / MNN14_R, Yur1_F / Yur1_R, Ktr2_F / Ktr2_R, Ktr4_F / Ktr4_R, Ktr5_F / Ktr5_R, Ktr7_F / Ktr7_R, polymerization 2); 1.7 kbp fragments were obtained by enzyme chain reaction (FIG. 5 (A)).

The resulting gene disruption cassettes were introduced into the och1Δmnn1Δmnn4Δmnn6Δ strain by transformation, and SC-URA selective medium (1 M sorbitol, 2% glucose, 0.67% yeast nitrogen base w / o amino acid, DO supplement-with 1 M sorbitol) was added. URA) transformants were selected. Then, the chromosomal DNA of the selected transformants was extracted and used as a template. The defect of was confirmed (FIG. 5 (B)).

The screening marker URA3 entered for the deletion of the target gene introduced a pSH68 vector for Cre protein expression as in Example 1, and the SC-LEU selective medium containing 1 M sorbitol (1 M sorbitol, 2% glucose, 0.67%). Transformants were selected from yeast nitrogen base w / o amino acid, DO supplement -LEU, and then SC-LEU selective medium (1 M sorbitol, 2% galactose, 0.67%) was added 2% galactose instead of 2% glucose. Yeast nitrogen base w / o amino acid, DO supplement -LEU) was incubated with Cre protein expression. In addition, the pSH68 vector was removed by continuous culture in YPD medium, and confirmed by growth in an appropriate selection medium, the fold- deleted strain och1Δmnn1Δmnn4Δmnn6Δmnn14Δ with the URA3 marker removed. (- mnn14Δ), och1Δmnn1Δmnn4Δmnn6Δyur1Δ (- yur1Δ), och1Δmnn1Δmnn4Δmnn6Δktr2Δ (- ktr2Δ), och1Δmnn1Δmnn4Δmnn6Δktr4Δ (- ktr4Δ), och1Δmnn1Δmnn4Δmnn6Δktr5Δ (- ktr5Δ), och1Δmnn1Δmnn4Δmnn6Δktr7Δ It was made of - (ktr7Δ).

Example  5. Mannose phosphorylation  Of related gene multiple deletion strains N - Our hair  Structural analysis

The quadruple deletion strain och1Δmnn1Δmnn4Δmnn6Δ as in Example 4, more homologous genes or MNN4 MNN6 as produced a defect of the defect in 5 strains oligosaccharide - N in the (- mnn14Δ, - yur1Δ, -ktr2Δ , - ktr4Δ, - - ktr5Δ, ktr7Δ) Was analyzed comparatively.

First, after incubation for 72 hours at 28 ℃ in minimal medium SC containing 1 M sorbitol (1 M sorbitol, 2% glucose, 0.67% yeast nitrogen base with amino acids), the cells were obtained and washed with sterile water, Example 2 CWMs were obtained in the same manner as in and the N -sugar chain was analyzed (FIG. 6). With a homologous gene of MNN6 defect - yur1Δ, - ktr2Δ, -ktr4Δ, - ktr5Δ, - ktr7Δ strains Like och1Δmnn1Δmnn4Δmnn6Δ strain neutral sugar chain (Man ₈ GlcNAc ₂₎ and a (P-Man) ₂ -Man with mannose phosphate is added _{The 8-} GlcNAc ₂ and Man-P-Man ₈ GlcNAc ₂ oligosaccharide peaks showed the N -glycol profile detected.

On the other hand, with a homologous gene, the MNN4 MNN14 defect - mannose in mnn14Δ strain without the addition of phosphoric acid is oligosaccharide peaks single Man ₈ GlcNAc ₂ The peak of the sugar chain showed that the mannose phosphate addition ability was lost (FIG. 6).

The culture environment may affect the culture of CWMs after incubation at 28 ° C for 72 hours in YPD medium (1 M sorbitol, 2% galactose, 1% yeast extrat, 2% peptone) added with 1 M sorbitol. N -sugar chains were analyzed (FIG. 7). In this case, the homologous gene of MNN6 defect - yur1Δ, - ktr2Δ, - ktr4Δ , - ktr5Δ, - ktr7Δ strains och1Δmnn1Δmnn4Δmnn6Δ strain in the same manner as one of the mannose phosphate is added with the neutral oligosaccharide Man-P-Man ₈ GlcNAc ₂ An oligosaccharide peak was detected. However, homologous genes, the MNN14 the loss of the MNN4 - the strain mnn14Δ Man ₈ GlcNAc ₂ Only the oligosaccharide peak was detected and it was found that the mannose phosphate addition ability was lost (FIG. 7).

The results show that, regardless of the culture environment, additional deletion of the MNN14 gene can completely eliminate mannose phosphorylation activity of S. cerevisiae yeast. The experiments were then performed in a minimal medium SC containing 1 M sorbitol (1 M sorbitol, 2% glucose, 0.67% yeast nitrogen base with amino acids).

Example  6. och1Δmnn1Δmnn4Δmnn14Δ Wow och1Δmnn1Δmnn14Δ Preparation of the strain

Och1Δmnn1Δmnn4Δmnn6Δmnn14Δ with additional deletion of the MNN14 gene in Example 5 It was confirmed that the mannose phosphorylation ability was completely removed from the strain. Accordingly, och1Δmnn1Δmnn4Δ and och1Δmnn1Δ without MNN6 gene deletion In strains We wanted to determine how the additional deletion of the MNN14 gene affects mannose phosphorylation capacity.

For this purpose, och1Δmnn1Δmnn4Δ and och1Δmnn1Δ described and fabricated in Example 1 MNN14 gene deletion cassette prepared in Example 4 was introduced into the strains, and transformants were selected from SC-URA selective medium to which 1 M sorbitol was added. The chromosomal DNA of the selected transformants was extracted and the deletion of the MNN14 gene was confirmed by polymerase chain reaction using Mnn14_CF and Ura3_CR primers. The selection marker URA3 entered for deletion of the MNN14 gene was removed in the same manner as in Examples 1 and 4, and similarly, the pSH68 vector for Cre protein expression was also removed through continuous culture in YPD medium.

In addition, the och1Δmnn1Δmnn4Δmnn14Δ that is a representative deletion strain of the MNN4 and MNN14 genes The strain was named och1Δmnn1Δmnn4Δmnn4paΔ and was deposited on April 6, 2015 by the Korea Biotechnology Research Institute, an international depository organization under the Butafest Treaty, and was given an accession number of KCTC12789P.

Example  7. och1Δmnn1Δmnn4Δmnn14Δ Wow och1Δmnn1Δmnn14Δ Strain N - Our hair  analysis

Och1Δmnn1Δmnn4Δmnn14Δ and och1Δmnn1Δmnn14Δ produced in Example 6 With the strains Quintile deficiency och1Δmnn1Δmnn4Δmnn6Δmnn14Δ The N -sugar chains of the strain's CWMs were analyzed together (FIG. 8).

Analysis of the N -sugar chain was performed by obtaining CWMs of cells obtained by incubating at 28 ° C. for 72 hours in SC medium containing 1 M sorbitol as in Examples 2 and 5.

Experimental Results och1Δmnn1Δmnn4Δmnn6Δmnn14Δ and och1Δmnn1Δmnn4Δmnn14Δ Strains were prepared without the sugar chain added with mannose phosphate Man ₈ GlcNAc ₂ Single peak of oligosaccharide was shown (FIG. 8). Och1Δmnn1Δmnn14Δ on the other hand Strains (Man-P) ₂ -Man ₈ GlcNAc ₂ and Man-P-Man ₈ GlcNAc ₂ added with mannose phosphate together with Man ₈ GlcNAc ₂ oligosaccharide It showed a profile in which oligosaccharide peaks are detected. These results show that both the MNN4 and MNN14 genes must be deleted in order to eliminate the additional activity of mannose phosphate in yeast.

Example  8. MNN4 Wow MNN14  Complementation experiment of gene

Complementation experiments were performed to determine whether the mannose phosphorylation capacity was restored by expressing MNN4 or MNN14 genes in two strains och1Δmnn1Δmnn4Δmnn14Δ and och1Δmnn1Δmnn4Δmnn6Δmnn14Δ .

8-1: Construction of YEp352-GAP, YEp352-Mnn4, and YEp352-Mnn14 Vectors

First, YEp352-Mnn4 for Mnn4 protein expression and YEp352-GAP vector, which is a control vector, were prepared as follows.

Specifically, GAPDH promoter (0.8 kb) and terminator (0.2 kb) of S. cerevisiae were subjected to polymerase chain reaction using GAPDHp-F1 / GAPDHp-R1 and GAPDHt-F1 / GAPDHt-R1 primers from chromosomal DNA of L3262 strain. Amplified through

The amplified DNA fragments were inserted into pDrive vectors (QIAGEN, Germany), respectively, to prepare pDrive-GAPDHp and pDrive-GAPDHt vectors. Using recombinant enzyme EcoR I and Kpn I cut was the GAPDH promoter from pDrive-GAPDHp, and then inserted into a vector digested with the same YEp352 recombinant enzyme was produced in the YEp352-GAPDHp vector. Next, inserted on the Kpn I and YEp352-GAPDHp vector digested with the Pst I enzyme from pDrive-GAPDHt a recombinase, such as by cutting the GAPDH terminator was produced in the YEp352-GAP vector.

The MNN4 gene was amplified from the chromosomal DNA of S. cerevisiae BY4741 strain using Mnn4_F and Mnn4_R primers, and the fragments treated with the restriction enzymes BamH I and Spe I were inserted into the YEp352-GAP vector treated with BamH I and Xba I and YEp352. -Mnn4 vector was constructed.

To construct the YEp352-Mnn14 vector for Mnn14 protein expression, MNN14 gene (2.8 kb) was amplified by polymerase chain reaction using Y-Mnn14-F and Y-Mnn14-R primers from chromosomal DNA of S. cerevisiae L3262. The fragment cut by treatment with the KpnI restriction enzyme was inserted into the KpnI position after the GAPDH promoter of the YEp352-GAP vector to prepare the YEp352-MNN14 vector.

The sequence of the primer used for the said vector production was as follows.

name	Sequence (5 '-> 3')	SEQ ID NO:
GAPDHp-F1	AGTC GAATTC ATACTAGCGTTGAATGTTAGCG	39
GAPDHp-R1	AGTC GGTACC TTTGTTTGTTTATGTGTGTTTATTC	40
GAPDHt-F1	AGTC GGTACCGGATCCTCTAGA GTGAATTTACTTTAAATCTT GCAT	41
GAPDHt-R1	AGTC CTGCAG ATCCACAATGTATCAGGTATCT	42
Mnn4_F	CGC GGATCC ATGCTTCAGCGAATATCATCTAAAC	43
Mnn4_R	GG ACTAGT TTAATTGCTGTGCCCCTCCTC	44
Y-Mnn14-F	AACACACATAAACAAACAAA GGTACC ATGATGTTATCACTGCGCAGG	45
Y-Mnn14-R	AAATTCACTCTAGAGGATCC GGTACC TTAATATTTTTGGTCTGAACCAAA	46
Underlined sequences are restriction enzyme positions

8-2: och1Δmnn1Δmnn4Δmnn14Δ Mannose Phosphorylation Recovery Experiment

Och1Δmnn1Δmnn4Δmnn14Δ without mannose phosphorylation ability In the strain, the YEp352-GAP, YEp352-Mnn4 and YEp352-Mnn14 vectors of Example 8-1 were introduced by a conventional transformation method. And N -sugar chains were analyzed by obtaining CWMs of cells obtained by incubating at 28 ° C. for 72 hours in SC-Ura3 medium containing 1 M sorbitol as in Examples 2 and 5 (FIG. 9). As a result, the mannose phosphorylation ability was restored in all cases expressing the Mnn4 or Mnn14 protein. However, when Mnn14 was expressed, the added ability of mannose phosphate was much higher than that of Mnn4, suggesting that Mnn14 plays a more important role in mannose phosphorylation than Mnn4.

8-3: och1Δmnn1Δmnn4Δmnn6Δmnn14Δ Mannose Phosphorylation Recovery Experiment

Och1Δmnn1Δmnn4Δmnn6Δmnn14Δ without mannose phosphorylation capability as in Example 8-2 YEp352-GAP, YEp352-Mnn4 and YEp352-Mnn14 vectors were introduced into the strain by a conventional transformation method, and the N -glycosides were analyzed by obtaining CWMs of the cells (FIG. 10). As a result, as in Example 8-2, mannose phosphorylation ability was restored when Mnn4 or Mnn14 protein was expressed, and mannose phosphorylation ability was much higher when Mnn14 was expressed compared to Mnn4. These results suggest that Mnn14 plays a more important role in the addition of mannose phosphate than Mnn4.

Example  9. MNN4 Wow MNN14  Of secreted expression proteins according to gene deletion N - Our chain  Change analysis

In the Examples 2 to 8 of the cell walls of yeast manno proteins (cell wall mannoproteins, CWMs) of N - to have analyzed the sugar chain, N of glycoprotein secreted expression from the yeast in the embodiment subsequent to the additional check-oligosaccharide An experiment was conducted to analyze.

9-1: Construction of Gas1 Protein Secretion Expression Vector

A gene expressing a protein of amino acid residues 1 to 490 from which the Gas1 protein of S. cerevisiae yeast was selected as a model glycoprotein and the C-terminal glycosylphosphatidylinositol (GPI) -anchoring motif was removed for secretion expression was Amplification using a chain reaction (Gil et al, J Biotech 2015). Genomic DNA of S. cerevisiae L3262 strain was extracted and used as a template, and amplified by first polymerase chain reaction using p-Gas1-F and p-Gas1-R-1 primers to obtain DNA fragments. Using this as a template, amplified by polymerase chain reaction using pGas1-F and p-Gas1-R-2 primers, a DNA fragment containing His-tag consisting of eight His residues at the C-terminus was purified. Got it. The amplified DNA was cloned into the pD1211 vector of DNA2.0 (Menlo Park, CA, USA) according to the protocol provided by the manufacturer by the Electra method (DNA2.0), and the final produced vector was named pD1211-Gas1p.

The sequences of the primers used for constructing the vector are as follows.

name	Sequence (5 '-> 3')	SEQ ID NO:
p-Gas1-F	tacacgtacttagtcgctgaagctcttctatg atgttgtttaaatccctttcaaag	47
p-Gas1-R-1	gtgatgatgatgatggtggtggtgagaaccccctccacc actggattcagttccggaacc	48
p-Gas1-R-2	aggtacgaactcgattgacggctcttctacc gtgatgatgatgatggtggtg	49
The underlined sequences above are for Electra cloning and the sequences marked italic are His-tag and linker parts.

9-2: Secretion Expression and Purification of Recombinant Gas1 Protein

Produced in the pD1211-Gas1p vector for Example 1, och1Δmnn1Δmnn4Δmnn6Δ strain as in Example 6 and was introduced by a conventional transformation method to och1Δmnn1Δmnn4Δmnn14Δ strain produced in, 1 M sorbitol is added SC-URA selection media (prepared in 1 M sorbitol, 2% glucose, 0.67% yeast nitrogen base w / o amino acid, DO supplement -URA) were prepared to secrete and express recombinant Gas1 protein. In addition, och1Δmnn1Δmnn4Δmnn14Δ PD1211-Gas1p vector was introduced into the strain together with the YEp352-Mnn4 and YEp352-Mnn14 vectors prepared in Example 8 in a conventional transformation method, and selected from SC-URA and LEU selection medium to which 1 M sorbitol was added to secrete Gas1. Och1Δmnn1Δmnn4Δmnn14Δ / Mnn4 / Gas1 and och1Δmnn1Δmnn4Δmnn14Δ / Mnn14 / Gas1 strains were prepared.

The four recombinant Gas1 secretion expressing yeast strains prepared above were incubated at 28 ° C. for 3 days using an appropriate selection medium (SC-URA or SC-URA, LEU) to which 1 M sorbitol was added. The culture supernatant obtained therefrom was purified using a conventional His-tag affinity column (Gil et al, J Biotech 2015).

9-3: N -sugar Chain Analysis of Purified Gas1 Protein

The N -sugar chains of Gas1 proteins purified through the above experiments were separated and purified as described in Lee KJ et al, 2013, Glycoconj J. Briefly, 10 mg of purified Gas1 protein is denaturated and directly treated with PNGase F (New Englad Biolabs) to favor oligosaccharides, followed by solid phase extraction using a graphitized carbon column (Alltech, Lexington, Mass., USA). Purified. The N -sugar chains thus purified were analyzed by the method using the DNA sequencer of Example 2 (FIG. 11).

Analysis result och1Δmnn1Δmnn4Δmnn6Δ In the recombinant Gas1 protein secreted and expressed by the strain, oligosaccharides added with mannose phosphate were attached in large amounts, whereas och1Δmnn1Δmnn4Δmnn14Δ Recombinant Gas1 protein secreted and expressed in the strain was not observed oligosaccharide added mannose phosphate (second and third profiles of Figure 11). This is consistent with the results analyzed using N -sugar chain of yeast CWM in Examples 5 and 7 (Figs. 6 and 8), so that mannose phosphate is not added to the glycoprotein secreted and expressed in S. cerevisiae yeast. This confirms that the MNN4 and MNN14 genes must be deleted simultaneously. This fact is och1Δmnn1Δmnn4Δmnn14Δ The strains expressing the Mnn4 or Mnn14 proteins in the strains and complementating the strains ( och1Δmnn1Δmnn4Δmnn14Δ / Mnn4 and och1Δmnn1Δmnn4Δmnn14Δ / Mnn14) can be more reliably confirmed (the fourth and fifth profiles of FIG. 11). . In both cases, it can be seen that the mannose phosphate added ability is restored. It should be noted that in this case, when Mnn4 is expressed in the och1Δmnn1Δmnn4Δmnn14Δ strain, only a small amount of oligosaccharide added with mannose phosphate is detected, whereas the intensity of oligosaccharide peak to which mannose phosphate is added increases when Mnn14 is expressed. In addition, two peaks were detected as peaks of very strong intensity in the added sugar chain. This shows that the mannose phosphate addition ability of Mnn14 is much better than Mnn4.

9-4: Isoelectric Electrophoresis of Purified Gas1 Protein

Intrinsic isoelctric points of the purified Gas1 proteins were analyzed using conventional isoelctric focusing (IEF) method. Briefly, an IEF gel (ThermoFisher Scientific, Waltham, MA, USA) is mounted in a chamber (ThermoFisher Scientific) filled with cathod and anode buffer (ThermoFisher Scientific), and a Gas1 protein sample with sample buffer (ThermoFisher Scientific) is added to the IEF gel. After loading into the wells, electrophoresis was performed according to the protocol provided by the manufacturer. After the electrophoresis was completed, the gel was reacted with fixation buffer (12% Trichloroacetic acid) for 30 minutes, followed by Coomassie blue staining to confirm the result (FIG. 12).

Mannosphosphate is negatively charged, so the more isomannose is added, the lower the isoelectric point of the protein. Thus och1Δmnn1Δmnn4Δmnn6Δ Recombinant Gas1 protein secreted from the strain was mannose phosphate added a lot of the isoelectric point of the main protein band is located at pH 3 or less appeared to be attracted (first lane in Figure 12). On the other hand, och1Δmnn1Δmnn4Δmnn14Δ Recombinant Gas1 protein secreted and expressed in the strain resulted in the isoelectric point being increased as the main band was observed at pH 4 or higher (second lane in FIG. 12), and the additional ability of mannose phosphate was removed in the N -sugar chain analysis of FIG. 11. A matching result was obtained. In addition, recombinant Gas1 proteins secreted and expressed in strains complementary to Mnn4 or Mnn14 protein expression ( och1Δmnn1Δmnn4Δmnn14Δ / Mnn4 and och1Δmnn1Δmnn4Δmnn14Δ / Mnn14) were och1Δmnn1Δmnn4Δmnn14Δ It was confirmed that the isoelectric point is significantly lower than the protein secreted and expressed in the strain (third and fourth lanes of FIG. 12). Here too, it was confirmed that Mnn14's ability to add mannose phosphate was better because Mn14 protein expression complementation strains had lower isoelectric point than Mnn4 complementation strains.

From the above description, those skilled in the art will appreciate that the present invention can be implemented in other specific forms without changing the technical spirit or essential features. In this regard, the embodiments described above are to be understood in all respects as illustrative and not restrictive. The scope of the present invention should be construed that all changes or modifications derived from the meaning and scope of the following claims and equivalent concepts rather than the detailed description are included in the scope of the present invention.

Claims (6)

1. A recombinant yeast strain in which the activity of both the Mnn4 protein and the Mnn14 protein represented by SEQ ID NO: 1 is weakened compared to the endogenous activity.
2. The method of claim 1,

   The impairment of intrinsic activity may include deleting all or part of a gene on a chromosome that encodes the protein; Replacing the gene encoding the protein on a chromosome with a mutated gene such that the activity of the protein is reduced; Introducing a mutation into an expression control sequence of a gene on a chromosome encoding said protein; Replacing the expression control sequence of the gene encoding the protein with a sequence with weak or no activity; Introducing an antisense oligonucleotide that complementarily binds to a transcript of a gene on the chromosome to inhibit translation from the mRNA to a protein; How to make a secondary structure by the addition of a sequence complementary to the SD sequence in front of the SD sequence of the gene encoding the protein to make the ribosomes impossible to attach and the ORF (open reading frame) of the sequence Recombinant yeast strain that is performed by a method selected from the group consisting of a reverse transcription engineering (RTE) method to add a promoter to reverse transcription at the 3 'end.
3. The recombinant yeast strain of claim 1, wherein the yeast is saccharomycens cerevisiae .
4. The recombinant yeast strain of claim 1, wherein the recombinant yeast strain has attenuated activity compared to endogenous activity of Mnn1 protein, Och1 protein, or both.
5. The recombinant yeast strain of claim 1, wherein the recombinant yeast strain further comprises a gene encoding a glycoprotein.
6. (a) culturing a recombinant yeast strain, wherein the activity of the Mnn4 protein and the Mnn14 protein represented by SEQ ID NO: 1, including the gene encoding the recombinant glycoprotein, is weakened relative to the intrinsic activity to produce the glycoprotein; And

   (b) recovering the glycoprotein produced in step (a), the method of producing a recombinant glycoprotein.

Images