KR20160131952A - An essential gene MNN14 for mannosylphosphorylation in Saccharomyces cerevisiae and a method for producing recombinant glycoprotein using a MNN14-defected microorganism - Google Patents

Abstract

The present invention relates to a recombinant yeast strain in which the activity of Mnn4 protein and protein represented by SEQ ID NO : 1 is weaker than the intrinsic activity, and a method for producing a recombinant glycoprotein having humanized oligosaccharide using the same.

Description

[0001] The present invention relates to a recombinant glycoprotein producing method using MNN14 gene and a deletion mutant thereof, which is a key gene for mannose phosphorylation activity of Saccharomyces cerevisiae yeast, and a recombinant glycoprotein using a MNN14- defected microorganism}

The present invention relates to a recombinant yeast strain in which the activity of Mnn4 protein and Mnn14 protein is weaker than that of an intrinsic activity, and a method for producing a recombinant glycoprotein having a humanized sugar chain attached thereto using the same.

Glycoproteins, which are glycosylated through glycosylation, are now leading the market, accounting for more than 60% of the global recombinant protein drug market. In particular, oligosaccharides play an important role in the therapeutic efficacy of glycoprotein drugs, persistence in the body, targeting, and immune response, and thus are becoming important factors in determining drug quality. The addition reaction in which sugar chain is largely N - O bond or a - combination glycosylation and two types of (N -linked or O -linked glycosylation) , the of the N - a sugar chain which is added via the binding glycosylation N - oligosaccharide ( N- glycan) and begins in the endoplasmic reticulum. First, Glc ₃ Man ₉ GlcNAc ₂ -PP-Dol, a glycoconjugate in the form linked to dolichol pyrophosphate (PP-Dol) present in the membrane of the endoplasmic reticulum, is formed. Oligosaccharyltransferase then transfers it to the N -glycosylation sequence of the NXS / T sequence among the proteins that are translated into ribosomal to endoplasmic reticulum by a co-translational translocation mechanism. Glucosidase and mannosidase eliminate the glucose and mannose at the end by the mechanisms responsible for the quality control of the glycoprotein folding in the endoplasmic reticulum, resulting in a Man ₈ GlcNAc ₂ structure (High-mannose type) oligosaccharide having a sugar chain attached thereto is transferred to the Golgi body.

The initial biosynthetic process of the N - glycoprotein in the above - described ER is preserved in almost the same process from the eukaryotic microorganism yeast to the mammal, the higher animal. However, the oligosaccharide transferred to the Golgi is subjected to a variety of oligosaccharide modification processes specifically for each species, and as a result, completely different types of oligosaccharides are produced in yeast, insects, plants and animals. In higher animals, oligosaccharides of the glycoprotein that enter the Golgi are polished to the Man ₅ GlcNAc ₂ form by mannosidase. After N- acetylglucosaminyltransferase (GNT) I was added, GlcNAc was added, Mannosidase II was added to remove two mannos added to the opposite branch, and trimannosyl core (Man ₃ GlcNAc ₂ ) A mixed structure in which GlcNAc is added is made. Then GNT Ⅱ acts on the branch from which mannose is removed, and GlcNAc is added to produce an oligosaccharide having two antenna structures. After that, GNT Ⅳ and Ⅴ act to create four antenna structures, and in some cases GNT Ⅵ, Ⅸ or VB acts to form 6 antenna structures. Galactosyltransferase and alpha-sialyltransferase, which are present in Golgi after action of GlcNAc is added to make the framework of the antenna, The sugar chain structure is made.

Yeast is a eukaryotic microorganism that is easy to manipulate because it is eukaryotic microorganism. It is easy to handle and can produce large amount of proteins at low cost, which not only makes it economical, but also has many advantages such that there is no possibility of contamination with viruses and plasters that infect humans. . However, the oligosaccharide structure synthesized in yeast is very different from that of human, which causes an immune response upon human body injection. Yeast has the same sugar chain biosynthetic process as the higher animal to the endoplasmic reticulum but has a yeast-specific oligosaccharide modification pathway in which mannose is further added after migration to Golgi. That is, a glycan outer chain initiation reaction occurs in which mannose is added to the Man ₈ GlcNAc ₂ oligosaccharide transferred from the endoplasmic reticulum by the OCH1 gene product through α (1,6) -binding, and α (1,6) -Bonded and? (1,2) -bonded mannose is continuously added to synthesize a sugar chain outer chain. In the case of Saccharomyces cerevisiae , a conventional yeast, 50 to 200 mannose are continuously added to the core sugar chain, and a pharmacological reaction occurs. In the case of α (1, 3) - Mannose is added by the MNN1 gene product. Also, mannose-1-phosphate to a sugar chain is added by the mannose phosphorylation (mannosylphosphorylation) is added to "mannose-1-phosphate -6- O - mannose (mannose-1-phosphate-6- O -mannose)" in the form of acid It is also known that oligosaccharides are produced. This is mainly caused by mannose phosphorylation by an enzyme expressing the MNN6 gene, and MNN4 has been proposed as a gene expressing the protein that regulates it (Odani et al., Glycobiol., 6: 805, 1996; Odani et al. , FEBS Lett., 420: 1860,1997).

As described above, the oligosaccharide attached to the glycoprotein produced by the yeast is different from that of the human, so that the oligosaccharide can not be used for medicinal purposes because it causes an immune reaction upon injection of the human body. Therefore, Methods for disrupting the glycosyltransferase genes have been proposed. In S. cerevisiae yeast, in particular, OCH1 gene and α (1,3) - to break through the MNN1 gene, such as for adding mannose presented are methods to prevent the addition of yeast-specific sugar chain (Nakayama et al, EMBO J, 11: 2511, 1992; Nakanishi-Shindo. et al., J Biol Chem, 268: 26338, 1993).

Also, since the oligosaccharide of the form of "mannose-1-phosphate-6- O -mannose" produced by addition of mannose phosphoric acid by MNN4 and MNN6 mentioned above may cause an immune response upon human injection, Protein production must be removed. Therefore, even with defects MNN4 gene known to control the addition of mannose phosphate with normal OCH1 gene and MNN1 to prevent yeast-specific sugar chain biosynthesis in S. cerevisiae yeast (Chiba et al, J Biol Chem 273:. 26298, 1998 ). However, the deletion of the MNN4 gene does not completely eliminate the addition activity of mannose phosphate (Odani et al ., Glycobiol 6: 805, 1996). Therefore, it is presumed that there is another gene having the addition activity of mannosylphosphate, but it has not yet been reported which gene is responsible for this activity.

Therefore, in the present invention, in order to completely develop a technique for completely removing the activity of adding mannose phosphate to the oligosaccharide in yeast, particularly S. cerevisiae , the Mnn14 gene is involved in mannose phosphorylation in S. cerevisiae strain, and MNN4 And that the addition of mannose phosphate is eliminated in the case of a double deletion of the gene and the MNN14 gene, thereby completing the present invention.

It is an object of the present invention to provide a recombinant yeast strain in which the addition of mannose phosphoric acid is controlled.

Another object of the present invention is to provide a method for producing a recombinant glycoprotein using the recombinant yeast strain.

It is yet another object of the present invention to provide a use of the recombinant yeast strain for use in the production of recombinant glycoproteins without addition of mannose phosphoric acid.

Yet another object of the present invention is to provide the use of the protein of SEQ ID NO: 1 for use in controlling the addition of mannose phosphate in a glycoprotein.

Another object of the present invention is to provide the use of the protein of SEQ ID NO: 1 for use in mannose phosphorylation.

This will be described in detail as follows. On the other hand, each description and embodiment disclosed in the present invention can be applied to each other description and embodiment. That is, all combinations of various elements disclosed in the present invention fall within the scope of the present invention. Further, the scope of the present invention is not limited by the detailed description described below.

In one aspect, the present invention provides a recombinant yeast strain in which the addition of mannose phosphoric acid is controlled. Specifically, the yeast strain may be generated naturally, but is not limited thereto.

Specifically, the present invention provides a recombinant yeast strain in which the activity of both the Mnn4 protein and the Mnn14 protein is weaker than the intrinsic activity.

In the present invention, the term " Mnn4 protein " is a protein involved in mannose phosphorylation of an oligosaccharide (oligosaccharide). The Mnn4 protein is known to be a putative positive regulator of mannosylphosphate transferase. The Mnn4 protein is also named YKL200C and YKL201C. The Mnn4 protein and the gene encoding the Mnn4 protein can be obtained through a database such as the US National Institutes of Health GenBank. For example, the Mnn4 protein may have the amino acid sequence of SEQ ID NO: 3 (the nucleotide sequence of SEQ ID NO: 4) But is not limited thereto.

In addition, the Mnn4 protein has not only a protein having an amino acid sequence represented by SEQ ID NO: 3 but also a protein having an amino acid sequence of 80% or more, specifically 90% or more, more specifically 95% or more, more specifically 99% A protein having amino acid sequence substantially identical to or corresponding to the Mnn4 protein and having a biological activity is included in the scope of the present invention when the amino acid sequence in which some of the sequences are deleted, This is obvious to those skilled in the art.

As used herein, the term " homology " refers to the percentage of identity between two polynucleotide or polypeptide mimetics. The homology between sequences from one moiety to another can be determined by known techniques. For example, homology can be determined by aligning the sequence information and directly aligning the sequence information between two polynucleotide molecules or two polypeptide molecules using a computer program that is readily available. The computer program may be BLAST (NCBI), CLC Main Workbench (CLC bio), MegAlign (DNASTAR Inc), and the like. In addition, homology between polynucleotides can be determined by hybridizing the polynucleotides under conditions that result in a stable double strand between homologous regions, then resolving the single-strand-specific nucleases to determine the size of the resolved fragment.

In the present invention, the term " Mnn14 protein " means a protein encoded by the MNN4 gene and the paranlog gene in S. cerevisiae . Mnn14 is also named YJR061W. In the present invention, Mnn14 is also referred to as Mnn4pa, and the terms may be used in combination with each other in this specification. The information of the Mnn14 protein can be obtained through a known database such as the US National Institutes of Health GenBank, for example, but is not limited to, a protein of NP_012595 (SEQ ID NO: 1).

In addition, in the present invention, the category of the Mnn14 protein represented by SEQ ID NO: 1 includes not only the amino acid sequence of SEQ ID NO: 1, but also the amino acid sequence of SEQ ID NO: 1 of not less than 80%, specifically not less than 90%, more specifically not less than 95% More specifically, a protein having a homology of 99% or more, which is substantially the amino acid sequence having the same or corresponding biological activity as the protein having the amino acid sequence of SEQ ID NO: 1, may be an amino acid sequence in which some of the sequences are deleted, Sequences are also included in the scope of the present invention, and these will be apparent to those skilled in the art.

The protein having the amino acid sequence of SEQ ID NO: 1 may be encoded by the nucleotide sequence of SEQ ID NO: 2, but the present invention is not limited thereto. Because of the codon degeneracy of the codon, It will be apparent to those skilled in the art.

In the present invention, the term " attenuated relative to intrinsic activity " is a concept that includes both the activity of the microorganism when the microorganism is compared with the activity of the protein in its natural state, or its activity is reduced.

The weakening may be mutated to weaken the activity of the protein, and the mutation may be generated naturally, but is not limited thereto. Specifically, in order to attenuate the activity of a protein in the present invention, a method of deleting all or a part of a gene on a chromosome encoding the protein is deleted; A method of replacing a gene mutated to reduce the activity of the protein and a gene encoding the protein on a chromosome; A method of introducing a mutation into an expression control sequence of a gene on a chromosome encoding said protein; A method of replacing the expression control sequence of the gene encoding the protein with a weak or absent sequence; Introducing an antisense oligonucleotide complementary to a transcript of the gene on the chromosome and inhibiting translation of the mRNA to a protein; A method of artificially adding a sequence complementary to the SD sequence to the front of the SD sequence of the gene encoding the protein to form a secondary structure to render the attachment of the ribosome impossible and the use of an ORF (open reading frame) And reverse transcription engineering (RTE) method in which a promoter is added at the 3 'end to reverse transcription. However, the present invention is not limited thereto, and any method that weakens the protein activity can be applied. To be clear to.

In addition, the recombinant yeast strain may be such that the activity of the Mnn1 protein, the Och1 protein, or both is weakened as compared with the intrinsic activity.

The Mnn1 protein has an alpha-1,3-mannosyltransferase activity. Since the protein can add α (1,3) -mannos which can be recognized as an antigen in the human body to the glycoprotein, the activity of the protein is attenuated as compared with the intrinsic activity, so that the addition of the yeast-specific oligosaccharide to the recombinant glycoprotein It can help to control.

In addition, the Och1 protein acts as a mannose-transferase in cis-Golgi and mediates polymannose outer chain elongation of the N -linked oligosaccharide of the glycoprotein. Thus, by weakening the activity of the protein relative to the intrinsic activity, it can help control the addition of the yeast-specific oligosaccharide to the recombinant glycoprotein.

Information on the Mnn1 protein and Och1 protein described above can be obtained through databases known to those skilled in the art, such as GenBank of the National Institutes of Health as described above.

In addition, the above-mentioned contents also apply to the activity weakening of the protein.

In addition, the yeast may be saccharomycycles cerevisiae), but it may be, not limited to this, if the yeast capable of achieving a yeast-specific sugar chain controlled by the active and Mnn4 weakening of Mnn14 protein may be included in the scope of the invention.

The above described Mnn1, Och1, Mnn4 and Mnn14 the N attached to the glycoproteins of the activity of the protein of weakening, the yeast-specific sugar chain biosynthesis pathway is attenuated yeast expression-linked sugar chains are mostly have a GlcNAc ₂ structure Man ₈ have. When the above-mentioned mutant strain is transformed with an expression vector capable of expressing one or more proteins having sugar chain-modifying enzyme activity, it can be more effectively converted into a form having a structure similar to human oligosaccharide. Examples of such sugar chain modifying enzymes include alpha 1, 2-mannosidase, mannosidase A, mannosidase IB, mannosidase IC, mannosidase II, N-acetylglucosaminyltransferase I, N-acetylglucosamine Neal transferase II, galactosyltransferase, sialyltransferase, fucosyltransferase, and the like, but not limited thereto, and various genes capable of contributing to reduction and modification of mannose residues can be used .

Accordingly, in another aspect, the present invention provides a yeast mutant strain further comprising an expression vector of an oligosaccharide modifying enzyme. Preferably, the sugar chain modifying enzyme is selected from the group consisting of alpha 1, 2-mannosidase, Mannosidase I, Mannosidase IB, Mannosidase I, Mannosidase II, N-acetylglucosaminyltransferase I, N-acetylglucose Fucosyltransferase, and the like can be selected from the group consisting of the following: < RTI ID = 0.0 > lysine < / RTI >

In addition, the recombinant yeast strain may further include a gene encoding a glycoprotein.

For this purpose, a recombinant vector containing the gene encoding the glycoprotein may be introduced into the yeast strain.

The term " recombinant vector " means a DNA product containing a nucleotide sequence of a polynucleotide encoding the desired protein operably linked to a suitable regulatory sequence so as to be capable of expressing the protein of interest in a suitable host, Expression of a gene encoding a target protein can be indicated, and this vector is referred to as an expression vector.

The expression vector may be a fragment for suppressing expression, having various functions for suppressing, amplifying, or inducing expression of a target gene, a marker for selecting a transformant, a gene resistant to antibiotics, A gene encoding a signal for the purpose of expression, and a custom-made fusion factor suitable for a hung-off protein.

When the yeast strain according to the present invention comprising a gene encoding a desired glycoprotein is cultured in a culture medium and a medium suitable for expressing the desired glycoprotein to produce a glycoprotein, There is an advantage that a recombinant glycoprotein having a reduced possibility of causing an immune response to the human body can be produced by decreasing or completely controlling the addition of mannose phosphoric acid as compared with the case of producing the desired glycoprotein.

The desired glycoprotein is not particularly limited as long as it is a glycoprotein to be expressed in the yeast strain. Examples of the glycoprotein include a pathogen protein, a growth factor, a cytokine such as interferon- Interferon-beta, interferon-γ and G-CSF), chemokines, coagulation factors (eg VIII factor, factor IX, human protein C), endothelial growth factor, growth hormone releasing factor, HIV envelope protein protein, influenza virus A haemagglutinin, influenza neuraminidase, bovine enterokinase activator, bovine herpesvirus type 1 (bovine herpesvirus type 1) -1 glycoprotein D), human angiostatin, human B7-1, B7-2 and B-7 receptor CTLA-4, human tissue factor, growth factors such as platelet- , Human < RTI ID = Human α-antitrypsin, human erythropoietin, tissue plasminogen activator, plasminogen activator inhibitor-1, urokinase, plasmids, Any kind of protein can be used as long as it is a protein to be produced, such as minigen, thrombin, an antibody or an antigen-binding fragment thereof, or a fusion protein. Examples of the desired glycoprotein include Gas1 (beta-1,3-glucanosyltransferase), Glucocerebrosidase (GCase), Alpha-galactosidase, but are not limited to, alpha-glucosidase, iduronidase, Iduronidase sulfatase, and GalNAc sulfatase.

In another aspect, the present invention provides a method for producing a recombinant glycoprotein using the recombinant yeast strain.

Specifically, the present invention provides

(a) producing the glycoprotein by culturing a recombinant yeast strain in which the activity of the Mnn4 protein and the Mnn14 protein of SEQ ID NO: 1 is weaker than the intrinsic activity, comprising the gene encoding the recombinant glycoprotein; And

(b) recovering the glycoprotein produced in the step (a). The present invention also provides a method for producing a recombinant glycoprotein.

The above yeast strains, recombinant glycoprotein, Mnn4 protein, Mnn14 protein, weakening as compared with the intrinsic activity, etc. are as described above.

The culture in step (a) is preferably a culture condition and a culture medium condition capable of producing the desired glycoprotein, and can be appropriately adjusted by those skilled in the art.

The step (b) may be a step of recovering the produced glycoprotein in a cultured cell or a supernatant thereof, and may include a process such as chromatography, but the method suitable for recovery may be selected by a person skilled in the art have.

In addition, the above method may further include a step of separating and purifying the recovered protein.

In another aspect, the present invention provides the use of the recombinant yeast strain for use in the production of a recombinant glycoprotein without the addition of mannose phosphoric acid.

The glycoprotein, yeast strain and the like are as described above.

In another aspect, the present invention provides the use of the protein of SEQ ID NO: 1 for use in controlling the addition of mannose phosphate in a glycoprotein.

The protein represented by SEQ ID NO: 1 is as described above.

In another aspect, the present invention provides the use of the protein of SEQ ID NO: 1 for use in mannose phosphorylation.

The protein represented by SEQ ID NO: 1 is as described above.

By using the recombinant yeast strain according to the present invention in the production of the recombinant glycoprotein, it is possible to produce a more humanized sugar chain-attached glycoprotein which does not cause an immune response upon human injection by eliminating the addition of yeast-specific mannose phosphate.

Fig. 1 shows the results of experiments in which the MNN4 gene was deleted from the och1? Mnn1? Strain. (A) Using the Mnn4_F and Mnn4_R primers, a loxP - LEU2 - loxP cassette was amplified from pUG73 by polymerase chain reaction to obtain a 2.5 kbp DNA fragment. (B) the introduction of defects cassette prepared och1Δmnn1Δ strain and MNN4 gene by using the SC-Leu shop of the transformants selected on medium of confirmation from the genomic DNA primers Leu2-CF and Mnn4-CR is replaced with the LEU2 gene 1.8 The DNA fragment of kbp was amplified to confirm the deletion of MNN4 .
Fig. 2 shows the results of experiments in which the MNN6 gene was deleted from the och1? Mnn1? Mnn4? Strain. (A) The loxP - URA3 - loxP cassette was amplified from pUG72 using Mnn6_F and Mnn6_R primers by polymerase chain reaction to obtain a 1.7 kbp DNA fragment. (B) The prepared deletion cassette was introduced into the och1Δmnn1Δmnn4Δ strain and the MNN6 gene was replaced with the URA3 gene using genomic DNA of the transformants screened in SC-Ura medium using Mnn6-CF and Ura3-CR as confirmation primers The DNA fragment of kbp was amplified to confirm the deletion of MNN6 .
3 is obtained from the N CWMs of och1Δmnn1Δ strain and MNN4 and MNN6 gene have been added deficient strain is the result of sugar chain analysis using a DNA sequencer. For relative positioning, the maltodextrin reference profile showing the glucose unit (Dex) was shown on the first panel. Three oligosaccharide peaks of (Man-P) ₂ -Man ₈ GlcNAc ₂ , Man-P-Man ₈ GlcNAc ₂ and Man ₈ GlcNAc ₂ were mainly observed in the profiles of all defective strains ( och1Δmnn1Δ , och1Δmnn1Δmnn4Δ , och1Δmnn1Δmnn4Δmnn6Δ ). These were expressed using the symbols of the United States Consortium for Functional Glycomics (htpp: //www.functionalglycomics.org/) (blue square: GlcNAc, green circle: mannose, phosphoric acid: P). Peaks that were not identified were marked with *.
Figure 4 shows the identity and homology analysis results between the Mnn6 protein and these proteins.
Fig. 5 shows the results of experiments in which homologous genes of MNN4 and MNN6 are additionally deleted from the och1? Mnn1? Mnn4? Mnn6? Strain. (A) For the production of MNN14 , YUR1 , KTR2 , KTR4 , KTR5 and KTR7 gene-deficient cassettes, loxP - URA3 - loxP cassette was constructed from pUG72 vector using primers having homology regions 5 'and 3'- Were amplified by polymerase chain reaction to obtain a 1.7 kbp DNA fragment. (B) The prepared defective cassette was introduced into the och1Δmnn1Δmnn4Δmnn6Δ strain and genomic DNA of the transformants selected on the SC-Ura medium was amplified with a 1.2 kbp DNA fragment in which the corresponding gene was replaced with URA3 gene using a confirmation fryer Of the population.
Figure 6 is N and one strain och1Δmnn1Δmnn4Δmnn6Δ MNN4 MNN6 or homologous gene of the culture in a minimal medium were obtained from CWMs of a strain deficient in addition - the analysis of the sugar chain results. As in FIG. 3, the maltodextrin reference for relative positioning was placed on the first panel (Dex). From the next panel, the och1 ? Mnn1 ? Mnn4 ? Mnn6 ?, Och1 ? Mnn1 ? Mnn4 ? Mnn6 ? Yur1? ( - yur1? ) , och1 ? mnn1 ? mnn4 ? mnn6 ? ktr2 ? ( - ktr2? ) , och1 ? mnn1 ? mnn4 ? mnn6 ? ktr4? ( - ktr4? ) , och1 ? mnn1 ? mnn4 ? mnn6 ? ktr5 ? ( - ktr5? ) , och1 ? mnn1 ? mnn4 ? mnn6 ? ktr7? (- ktr7Δ) and och1Δ mnn1Δmnn4Δmnn6Δmnn14Δ (- mnn14Δ) - shows the oligosaccharide profile of the strain N. The oligosaccharides peaks were displayed in the same manner as in Fig.
7 is obtained from the N CWMs of a strain deficient in addition to a strain och1Δmnn1Δmnn4Δmnn6Δ and MNN4 MNN6 or homologous gene of the culture in YPD medium - the analysis of the sugar chain. The order of the panel and the oligosaccharide peaks are shown in the same manner as in Fig.
FIG. 8 shows the results of analysis of N - oligosaccharides obtained from CWMs of MNN14 gene deficient strains. As in FIG. 3, the maltodextrin reference for relative positioning was placed on the first panel (Dex). The panel in turn from the next N of och1Δmnn1Δmnn4Δ mnn6Δmnn14Δ, och1Δmnn1Δmnn4Δmnn14Δ, och1Δmnn1Δmnn14Δ strain shows the oligosaccharide profile. The oligosaccharides peaks were displayed in the same manner as in Fig.
Figure 9 is a complementation test results to see whether or not the restoration of the ability to express the mannose phosphorylation or MNN4 MNN14 genes in och1Δmnn1Δmnn4Δmnn14Δ strain was the ability to remove the phosphorylated mannose. As in FIG. 3, the maltodextrin reference for relative positioning was placed on the first panel (Dex). Shows the oligosaccharide profile - from the next panel in turn YEp352-GAP (Mock), YEp352 -Mnn4 (Mnn4) or YEp352-N Mnn14 of transformed strains as one switch (Mnn14) vector. The oligosaccharides peaks were displayed in the same manner as in Fig.
FIG. 10 shows the result of complementation experiment to see whether the mannose phosphorylation ability is restored by expressing the MNN4 or MNN14 gene in the och1Δmnn1Δmnn4Δmnn6Δmnn14Δ strain in which the mannose phosphorylation ability was removed. The order of the panel and the oligosaccharide peaks are shown in the same manner as in Fig.
FIG. 11 shows the results of the analysis of the N -glycoprotein profile of purified recombinant Gas1 protein expressed in och1Δmnn1Δmnn4Δmnn6Δ , och1Δmnn1Δmnn4Δmnn14Δ , och1Δmnn1 Δmnn4Δmnn14Δ / Mnn4, and och1Δmnn1Δmnn4Δmnn14Δ / Mnn14 . The peaks of each oligosaccharide were expressed in the same manner as in Fig.
Fig. 12 shows the results of isoelectric focusing (IEF) analysis of purified recombinant Gas1 protein expressed in och1Δmnn1Δmnn4Δmnn6Δ , och1Δmnn1Δmnn4Δmnn14Δ , och1Δmnn1Δmnn4Δmnn14Δ / Mnn4 and och1Δmnn1Δmnn4Δmnn14Δ / Mnn14 .

Hereinafter, the present invention will be described in detail with reference to the following examples. However, the following examples are intended to illustrate the present invention, but the scope of the present invention is not limited by the following examples.

Example  One. S. cerevisiae och1? mnn1?  In the strain MNN4  And MNN6  Gene deficiency

1-1: S. cerevisiae Preparation of och1? mnn1? strain

S. cerevisiae och1Δmnn1Δ strains are multiple genetic defects method using a Cre / loxP system from the strain L3262 (U. Gueldener et al, 2002, Nucleic Acids Res 30: e23; JH Hegemann, SB Heick, 2011, Methods Mol Biol 765: 189-206). First, the loxP - URA3 - loxP - deficient cassette for the deletion of ScOCH1 gene was amplified from pUG72 vector using Och1_pUG72_F and Och1_pUG72_R primers. After isolating the transformed strains in SC-Ura medium supplemented with 1 M sorbitol, ScOCH1 gene deletion was confirmed by polymerase chain reaction using chromosomal DNA as template using Och1_CF and Och1_CR primers. Then, the loxP - kanMX - loxP cassette for ScMNN1 gene deletion was constructed using pUG6 as a template and Mnn1_pUG6_F and Mnn1_pUG6_R primers and transformed into the prepared och1Δ strain. The transformed strains were selected in YPD medium supplemented with 1 M sorbitol and 200 mg / L G418. The detection of ScMNN1 gene deletion was performed by using polymerase chain reaction (PCR) using Mnn1_CF and Mnn1_CR primers as chromosomal DNA template Respectively. The selectable markers for gene deletion were generated by expressing the Cre protein in SC-Leu medium supplemented with 2% galactose in place of 2% glucose and transforming the pSH68 vector as reported in the above papers Respectively. Finally, pSH68 for expression of Cre protein was removed by continuous culture in YPD medium and the final mnn1Δoch1Δ strain was selected by confirming growth on appropriate selection medium.

The sequences of the named primers were as follows.

name Sequences (5 '-> 3') SEQ ID NO: Och1_pUG72_F atgtctaggaagttgtcccacctgatcgctacaaggaaatcaaaaTACGCTGCAGGTCGACAACC 5 Och1_pUG72_R ttatttatgacctgcatttttatcagcatcttctttccagctcccACTAGTGGAT CTGATATCACC 6 Och1_CF AATGGGGAGCGCTGATTCTC 7 Och1_CR TCTACGGAAGGACGTTGAGA 8 Mnn1_pUG6_F aacgtaatcttgcggtatttaacgctagtttaagaaagtgttactgtgtaTACGCTGCA GGTCGACAACC 9 Mnn1_pUG6_R gttcacaaaggctagtaccataaacagttagaaaaaacactggttaatgcACTAGTGGA TCTGATATCACC 10 Mnn1_CF ATCATTGCGAGGTCTCAATTGG 11 Mnn1_CR GATTAGAAAAACTCATCGAGCATCAAATG 12 Case is part of the terms of the sequence homology of the OCH1 gene MNN1 Lim

1-2: S. cerevisiae The deletion of MNN4 or MNN6 gene in och1? mnn1?

A multiple gene deletion method using the Cre / loxP system from S. cerevisiae L3262 och1 ? Mnn1? Strain prepared in Example 1-1 (U. Gueldener et al, 2002, Nucleic Acids Res 30: e23; JH Hegemann, SB Heick, 2011 , Methods Mol Biol 765: 189-206) using the mannose by controlling the phosphorylation that crushed further MNN6 gene known as known MNN4 gene and mannose kinase deficient strain was produced (och1Δmnn1Δmnn4Δmnn6Δ) of the 4.

Yeast strains were cultured in YPD medium supplemented with 1 M sorbitol (1% yeast extract, 2% peptone, 2% glucose) or SC (synthetic complete) medium (0.67% yeast nitrogen nitrogen base, 2% glucose, dropout amino acid mixture, and all necessary amino acids).

First, a loxP - LEU2 - loxP- deficient cassette for MNN4 gene deletion was amplified from a pUG73 vector by a polymerase chain reaction using Mnn4_F and Mnn4_R primers (Table 2) to obtain a 2.5 kbp DNA fragment (Fig. 1 (A) . The resulting MNN4 gene-deficient cassette was transfected into och1Δmnn1Δ and transformed into SC-LEU selective medium (1 M sorbitol, 2% glucose, 0.67% yeast nitrogen base w / o amino acid, DO supplement-LEU ). ≪ / RTI > And which contains the extracted chromosomal DNA of selected transformants to confirm the loss of the MNN4 gene as a template through a polymerase chain reaction using the Leu2_CF and Mnn4_CR primers to (Fig. 1 (B)), LEU2 selection marker och1Δmnn1Δmnn4Δ The strain ( mnn1 [ Delta] :: loxP och1 [Delta] :: loxP mnn4 [Delta] :: loxP-LEU2-loxP ).

The loxP - URA3 - loxP- deficient cassette for MNN6 gene deletion was amplified from the pUG72 vector using the Mnn6_F and Mnn6_R primers (Table 2) to obtain a 1.7 kbp DNA fragment (Fig. 2 (A)). The MNN6 gene-deficient cassette thus obtained was introduced into the och1Δmnn1Δmnn4Δ strain prepared above, and the transformant was selected from SC-LEU supplemented medium supplemented with 1 M sorbitol. The chromosomal DNA of the selected transformants was extracted and PCR was performed using Mnn6_CF and Ura3_CR primers as a template to confirm the deletion of the MNN6 gene (FIG. 2 (B)), and LEU2 and URA3 selection markers The quadruple deficient och1? Mnn1 ? Mnn4? Mnn6? Strain ( mnn1? :: loxP och1? :: loxP mnn4 [Delta] :: loxP - LEU2 - loxP mnn6 [Delta] :: loxP - URA3 - loxP ).

MNN4 and the selectable marker LEU2 and URA3 for entering to the genetic defect of MNN6 are as reported in the above paper, introducing pSH67 vector for Cre protein expression in the strain, and YPDS-G418 selection medium (1 M sorbitol, The transformants were selected in 2% glucose, 1% yeast extrat, 2% peptone and 200 μg / ml G418 and then cultured in YPDS-G418 medium supplemented with 2% galactose instead of 2% Protein expression was removed. And Cre protein for the expression vector pSH47 was removed via a continuous culture in YPD medium, determine the growth in appropriate selection medium to 3 of the LEU2 marker has been removed defect och1Δmnn1Δmnn4Δ strain (mnn1Δ :: loxP och1? :: loxP mnn4A :: loxP ) and the och1Δmnn1Δmnn4Δmnn6Δ strain in which the LEU2 and URA3 selection markers were deleted ( mnn1Δ :: loxP och1Δ :: loxP mnn4Δ :: loxP mnn6Δ :: loxP ).

name Sequences (5 '-> 3') SEQ ID NO: Mnn4_F acaacgtcactattccttcacacaaataaactaattagttatgcttcagcg tacgctgcaggtcgacaacc 13 Mnn4_R aggaaaggctatagaaatgaagagattcatgaattttcagtcaggttct actagtggatctgatatcacc 14 Leu2_CF agccttgtcaagagaccaga 15 Mnn4_CR attgtttgccacttatcactggcg 16 Mnn6_F agcgttcacccaaccttttgtgccctttagtgaagataagataaggtaag tacgctgcaggtcgacaacc 17 Mnn6_R tatatattcatatgtagaagattattgttcttatacatcagtgttttgat actagtggatctgatatcacc 18 Mnn6_CF gctctcgtgagacacgagtt 19 Ura3_CR cccgtcaattagttgcacca 20 Mnn14_F atgatgttatcactgcgcaggttctccatgtacgttttgagatctctgcg tacgctgcaggtcgacaacc 21 Mnn14_R ttaatatttttggtctgaaccaaatatattgtttgaagttttcttattat actagtggatctgatatcacc 22 Yur1_F atggcaaaaggaggctcgctatacatcgttggcatattcttaccaatatg tacgctgcaggtcgacaacc 23 Yur1_R ttaaatctcgtcttgctcttcttttaagaaatatttgccgctaccgtttt actagtggatctgatatcacc 24 Ktr2_F atgcaaatctgcaaggtatttcttacacaggttaaaaaactactttttgt tacgctgcaggtcgacaacc 25 Ktr2_R ctatgaatcgtgtttgaggaagtatttaccgctgccgtccttccaccatc actagtggatctgatatcacc 26 Ktr4_F atgaggtttctttcaaaaaggatactgaaacctgtactttcagtgatcat tacgctgcaggtcgacaacc 27 Ktr4_R tcaatacatttctaactcttcctcagacatagagtgtcttatccaggttg actagtggatctgatatcacc 28 Ktr5_F atgttgctaataagaaggacgataaatgcatttctgggatgtatccattg tacgctgcaggtcgacaacc 29 Ktr5_R ctagtttccgaactgtcttagatagtcttcccttatgtgctcctccattt actagtggatctgatatcacc 30 Ktr7_F atggctataagattgaatccaaaagtcagaaggttcttgctggataagtg tacgctgcaggtcgacaacc 31 Ktr7_R ctattcaattactctaaaattttctcttctgatctcttcaatcacgtctt actagtggatctgatatcacc 32 Mnn14_CF cgaagatcaagtaagagtgcacttg 33 Yur1_CF atctgtcactgcttattcatatcatc 34 Ktr2_CF atctcttcaggtatgtgacacctata 35 Ktr4_CF caacggaacgagctctataagacg 36 Ktr5_CF acactttaagcatgcggtgtgtgga 37 Ktr7_CF gtatacatcaggctaacaatctgtga 38

Example  2. och1? mnn1?  Strain and MNN4 Wow MNN6 end  Of additional defective strains N - Sugar chain  compare

N - oligosaccharides of the och1Δmnn1Δ strain, the triple - deficient och1Δmnn1Δmnn4Δ strain and the quadruple - deficient och1Δmnn1Δmnn4Δmnn6Δ strain were compared and observed to observe changes in addition efficiency of mannose phosphate.

2-1: N -oligosaccharide analysis of yeast cell wall mannoproteins (CWMs) using DNA sequencer

First, CWMs of yeast were extracted according to the method using hot citrate buffer (20 mM sodium citrate buffer, pH 7.0) reported previously (Park et al, 2011, Appl Environ Microbiol 77: 1187-1195) and analyzed using a DNA sequencer (Laroy et al, 2006, Nat Protoc 1: 397-405).

Briefly, 2 mg of CWMs were added with 2 volumes of Membrane Denaturing buffer (MDB; 8 M Urea, 360 mM Tris-HCl (pH 8.6), 3.2 mM EDTA) and allowed to denature at 50 ° C for one hour . Then, it was activated with methanol and loaded onto MultiScreen-immobilon PVDF membrane clear plate (Millipore, Billerica, MA, USA) washed with distilled water. The MDB containing 0.1 M dithiothreitol was treated, reacted at 37 ° C for 1 hour, washed with distilled water, and MDB containing 0.1 M iodoacetic acid was added. After the reaction, it was washed with distilled water. Then, the membrane was blocked with 1% polyvinylpyrrolidone 360 dissolved in distilled water, and washed with distilled water. By cutting the sugar chain-N for 16 hours at 37 ℃ to handle; (New England Biolabs, MA, USA PNGase F) 10 mM Tris-glycosidase F-acetate (tris-acetate) peptide N a (pH 8.3) Collected, and vacuum dried. Then, 100 mM APTS (8-Aminopyrene-1,3,6-trisulfonic acid) was mixed with 1.2 M citric acid to make a final 20 mM APTS. 1 M sodium cyanoborohydride (NaCNBH 2 ) Were mixed in a ratio of 1: 1 to prepare an APTS mixed solution. Then, 5 μl of this APTS mixed solution was added to the dried oligosaccharide, and reacted at 37 ° C. for 16 hours. After the reaction, the reaction was stopped with 10 μl of HPLC distilled water. APTS was labeled by removing excess unreacted APTS using a Multiscreen Durapore membrane lined 96-well plate (Millipore, Billerica, MA, USA) packed with Sephadex G10 (GE Healthcare, Milwaukee, The oligosaccharides were separated and analyzed using DNA sequencers according to previously reported methods (Laroy et al., Nature Protocols 1: 397-405, 2006). That is, 10 μl of the oligosaccharide solution labeled with APTS was transferred to a DNA sequencer plate and analyzed using an ABI 3130 DNA sequencer equipped with a 36 cm capillary array filled with POP7-polyacrylamide linear polymer. The DNA sequencer analysis conditions are as shown in Table 3, and data analysis was performed using GeneMapper software.

Parameter Oven temperature 60 ° C Prerun  voltage 15 kV Prerun  time 180s Infection voltage 1.2V Injection time 16s Run voltage 15 kV Run time 1,000s

2-2: Interpretation of N -

Three major peaks were observed when analyzing the N - oligosaccharide of the double - deficient och1Δmnn1Δ , triple deficient och1Δmnn1Δmnn4Δ , and quadruple deficient och1Δmnn1Δmnn4Δmnn6Δ (FIG. 3). These peaks consisted of two mannose phosphorylated (Man-P) ₂ -Man ₈ GlcNAc ₂ oligosaccharides from the left, one Mann-P-Man ₈ GlcNAc ₂ oligosaccharide with mannose phosphoric acid and neutral Man ₈ GlcNAc ₂ Sugar chains.

The och1? Mnn1? Mnn4? Strain and the och1? Mnn1? There was no significant difference in the content of oligosaccharides added with mannose phosphate in the N - glycoprotein profile of the strain.

Och1Δmnn1Δmnn4Δmnn6Δ strains deficient with the MNN4 and MNN6 genes but slightly decreased the content of the phosphoric acid is added mannose oligosaccharides compared to och1Δmnn1Δ and och1Δmnn1Δmnn4Δ strain did not show such a large difference. These results suggest that genes other than MNN4 and MNN6 genes are responsible for the addition of mannose phosphate.

Example  3. MNN4 Wow MNN6  Gene and Homology  there is S. cerevisiae  gene

Results of N- MNN4 MNN6 Additional genes Deficient Since the addition activity of mannose phosphate was not completely eliminated even in och1Δmnn1Δmnn4Δ and och1Δmnn1Δmnn4Δmnn6Δ strains, studies were carried out to further defeat genes important for mannose phosphorylation activity.

For this purpose, firstly, we investigated whether genes that are homologous to MNN4 and MNN6 genes are added to S. cerevisiae yeast by using the BLAST (Basic Local Alignment Tool) in the National Center for Biotechnology Information (http://www.ncbi.nlm.com) .nih.gov).

MNN4 has a repeat sequence of KKKKEEEE at the C-terminal region, so BLAST was excluded, and the hypothetical protein YJR061W (NP_012595) was named MNN14 . The Mnn14 protein, like Mnn4, has the LicD domain, which is known to be important in binding to the substrate GDP-mannose. However, unlike Mnn4, it does not have a repeating sequence of KKKKEEEE at the C-terminus. The sequence identity between the Mnn4 and Mnn14 proteins was 33% and the homology was calculated to be 44%.

On the other hand, YUR1 , KTR2 , KTR4 , KTR5, and KTR7 belonging to the KTR family were found as genes homologous to the MNN6 gene. The identity and homology between the Mnn6 protein and these proteins are described in FIG.

Example  4. och1? mnn1? mnn4? mnn6?  In the strain MNN4 Wow MNN6  Additional deletion of homologous genes

The homologous genes of MNN4 and MNN6 , which are presumed to be related to mannosylation from the och1Δmnn1Δmnn4Δmnn6Δ strain prepared in Example 1, were further deficient.

The MNN14 , YUR1 , KTR2 , KTR4 , KTR5 and KTR7 genes were deleted in the same manner as in Example 1. For this, the gene-deficient cassette of loxP-URA3-loxP was polymerized using 6 pairs of primers (MNN14_F / MNN14_R, Yur1_F / Ytr1_R, Ktr2_F / Ktr2_R, Ktr4_F / Ktr4_R, Ktr5_F / Ktr5_R, Ktr7_F / Ktr7_R; A 1.7 kbp fragment was obtained by an enzyme chain reaction (Fig. 5 (A)).

The SC-URA selective medium (1 M sorbitol, 2% glucose, 0.67% yeast nitrogen base w / o amino acid, DO supplement - 1 M sorbitol supplemented with 1 M sorbitol was introduced into the och1Δmnn1Δmnn4Δmnn6Δ strain, URA). The chromosomal DNAs of the selected transformants were extracted and PCR was carried out using polymerase chain reaction using Mnn14_CF / Ura3_CR, Yur1_CF / Ura3_CR, Ktr2_CF / Ura3_CR, Ktr4_CF / Ura3_CR, Ktr5_CF / Ura3_CR and Ktr7_CF / Ura3_CR primers, (Fig. 5 (B)).

The selective marker URA3 for the target gene deletion was introduced into SC-LEU selective medium (1 M sorbitol, 2% glucose, 0.67%) containing 1 M sorbitol by introducing pSH68 vector for Cre protein expression as in Example 1, (1 M sorbitol, 2% galactose, 0.67%) supplemented with 2% galactose in place of 2% glucose was prepared by screening transformants from yeast nitrogen base w / o amino acid, DO supplement- yeast nitrogen base w / o amino acid, DO supplement-LEU). The pSH68 vector was removed by continuous culture in YPD medium, and the growth was confirmed in an appropriate selection medium. Thus, the URA3 marker-deleted 5-deficient strain och1Δmnn1Δmnn4Δmnn6Δmnn14Δ ( -mnn14? ), och1 ? mnn1 ? mnn4 ? mnn6 ? yur1? ( -yur1? ), och1? mnn1 ? mnn4? mnn6 ? ktr2? ( - ktr2? ), och1 ? mnn1 ? mnn4 ? mnn6 ? ktr4? ( - ktr4? ), och1 ? mnn1 ? mnn4 ? mnn6 ? ktr5? ( - ktr5? ), och1 ? mnn1 ? mnn4 ? mnn6 ? ktr7? ( - ktr7Δ ) were prepared.

Example  5. Mannose phosphorylation  Of related gene mutant defective strains N - Sugar chain  Structure analysis

The quadruple deletion strain och1Δmnn1Δmnn4Δmnn6Δ as in Example 4, more homologous genes or MNN4 MNN6 as produced a defect of the defect in 5 strains oligosaccharide - N in the (- - mnn14Δ, yur1Δ, -ktr2Δ , -ktr4Δ, -ktr5Δ, -ktr7Δ) Respectively.

First, the cells were cultured at 28 ° C for 72 hours in a minimal medium SC containing 1 M sorbitol (1 M sorbitol, 2% glucose, 0.67% yeast nitrogen base with amino acids). The cells were then washed with sterile water, CWMs were obtained and assayed for their N -oligosaccharides in the same manner as in (Fig. 6). With a homologous gene of MNN6 defect - yur1Δ, - ktr2Δ, -ktr4Δ, - ktr5Δ, - ktr7Δ strains Like och1Δmnn1Δmnn4Δmnn6Δ strain neutral sugar chain (Man ₈ GlcNAc ₂₎ and a (P-Man) ₂ -Man with mannose phosphate is added It showed the oligosaccharide profile - ₈ GlcNAc ₂ and Man-P-Man ₈ GlcNAc N is ₂ oligosaccharide peaks are detected.

On the other hand, with a homologous gene, the MNN4 MNN14 defect - mannose in mnn14Δ strain without the addition of phosphoric acid is oligosaccharide peaks single Man ₈ GlcNAc ₂ Showing the sugar chain peak, indicating that the mannose phosphoric acid addition ability was lost (FIG. 6).

(1 M sorbitol, 2% galactose, 1% yeast extrat, 2% peptone) supplemented with 1 M sorbitol for 72 hours at 28 ° C, and then cultured in CWMs N -glycoside was analyzed (Fig. 7). In this case, the homologous gene of MNN6 defect - yur1Δ, - ktr2Δ, - ktr4Δ , - ktr5Δ, - ktr7Δ strains och1Δmnn1Δmnn4Δmnn6Δ strain in the same manner as one of the mannose phosphate is added with the neutral oligosaccharide Man-P-Man ₈ GlcNAc ₂ The oligosaccharide peak was detected. However, homologous genes, the MNN14 the loss of the MNN4 - the strain mnn14Δ Man ₈ GlcNAc ₂ Only the oligosaccharide peak was detected and it was found that the mannose phosphoric acid addition ability was lost (Fig. 7).

The above results show that regardless of the culture environment, the mannose phosphorylation activity of S. cerevisiae yeast can be completely eliminated through additional deletion of the MNN14 gene. Experiments were performed in a minimal medium (1 M sorbitol, 2% glucose, 0.67% yeast nitrogen base with amino acids) containing 1 M sorbitol.

Example  6. och1? mnn1? mnn4? mnn14? Wow och1? mnn1? mnn14? Production of strain

In Example 5, the deletion of the MNN14 gene, och1? Mnn1? Mnn4? Mnn6? Mnn14? It was confirmed that the mannose phosphorylation ability was completely removed from the strain. Accordingly, MNN6 Och1? Mnn1? Mnn4? And och1? Mnn1? In a strain or the like And to investigate the effect of additional deletion of MNN14 gene on mannose phosphorylation ability.

For this, och1? Mnn1? Mnn4? And och1? Mnn1? Described and described in Example 1 The transformants were screened in SC-URA selective medium supplemented with MNN14 gene-deficient cassette prepared in Example 4 and added with 1 M sorbitol. Then, the chromosomal DNA of the selected transformants was extracted and polymerase chain reaction using Mnn14_CF and Ura3_CR primers was used as a template to confirm the deletion of the MNN14 gene. The selectable marker URA3 for the deletion of the MNN14 gene was removed in the same manner as in Examples 1 and 4, and the pSH68 vector for expressing Cre protein was also removed by continuous culture in YPD medium.

In addition, the above- mentioned deletion strains of MNN4 and MNN14 genes, och1? Mnn1? Mnn4? Mnn14? The strain was named och1Δmnn1Δmnn4Δmnn4paΔ and deposited on April 6, 2015 with the deposit number of KCTC12789P by the International Depositary under the Butafest Treaty.

Example  7. och1? mnn1? mnn4? mnn14? Wow och1? mnn1? mnn14? Strain N - Sugar chain  analysis

The och1? Mnn1? Mnn4? Mnn14? And och1? Mnn1? Mnn14? With strains Five-point deficiency och1? Mnn1? Mnn4? Mnn6? Mnn14? N -oligosaccharides of the CWMs of the strain were analyzed together (FIG. 8).

The N -glycosylation assay was performed by obtaining CWMs of cells obtained by culturing in SC medium containing 1 M sorbitol at 28 ° C for 72 hours as in Examples 2 and 5.

Experimental results showed that och1Δmnn1Δmnn4Δmnn6Δmnn14Δ and och1Δmnn1Δmnn4Δmnn14Δ The strains were grown in the absence of mannose phosphate added Man ₈ GlcNAc ₂ Showed a single peak of the oligosaccharide (Fig. 8). On the other hand, och1? Mnn1? Mnn14? (Man-P) ₂ -Man ₈ GlcNAc ₂ and Man-P-Man ₈ GlcNAc ₂ with mannose phosphate added together with Man ₈ GlcNAc ₂ oligosaccharide Showed that the oligosaccharide peaks were detected. These results suggest that MNN4 and MNN14 genes should be defective to eliminate the addition activity of mannose phosphate in yeast.

Example  8. MNN4 Wow MNN14  Gene complementation experiment

A complementation experiment was performed to determine whether the mannose phosphorylation capacity was restored by expressing the MNN4 or MNN14 gene in two strains och1Δmnn1Δmnn4Δmnn14Δ and och1Δmnn1Δmnn4Δmnn6Δmnn14Δ , which showed the disappearance of the mannose phosphorylation activity.

8-1: Production of YEp352-GAP, YEp352-Mnn4, and YEp352-Mnn14 vectors

First, YEp352-Mnn4 for Mnn4 protein expression and YEp352-GAP vector as a control vector were prepared as follows.

Specifically, the GAPDH promoter (0.8 kb) and the terminator (0.2 kb) of S. cerevisiae were subjected to polymerase chain reaction using the GAPDHp-F1 / GAPDHp-R1 and GAPDHt-F1 / GAPDHt-R1 primers from the chromosomal DNA of strain L3262 Respectively.

The amplified DNA fragments were inserted into pDrive vector (QIAGEN, Germany) to construct pDrive-GAPDHp and pDrive-GAPDHt vectors. Using recombinant enzyme EcoR I and Kpn I cut was the GAPDH promoter from pDrive-GAPDHp, and then inserted into a vector digested with the same YEp352 recombinant enzyme was produced in the YEp352-GAPDHp vector. Next, inserted on the Kpn I and YEp352-GAPDHp vector digested with the Pst I enzyme from pDrive-GAPDHt a recombinase, such as by cutting the GAPDH terminator was produced in the YEp352-GAP vector.

The MNN4 gene was amplified from the chromosomal DNA of S. cerevisiae BY4741 using Mnn4_F and Mnn4_R primers and inserted into BamH I and Xba I-treated YEp352-GAP vectors with restriction enzymes BamH I and Spe I, -Mnn4 vector.

For the YEp352-Mnn14 vector construction for expression MNN14 Mnn14 protein gene (2.8 kb) it was amplified by polymerase chain reaction using the chromosomal DNA from the F-Y-Mnn14 and Mnn14-Y-R primer of S. cerevisiae L3262. The fragment digested with KpnI restriction enzyme was inserted into the KpnI site after the GAPDH promoter of YEp352-GAP vector to construct a YEp352-MNN14 vector.

The sequences of the primers used for the vector production were as follows.

name Sequences (5 '-> 3') SEQ ID NO: GAPDHp-F1 AGTC GAATTC ATACTAGCGTTGAATGTTAGCG 39 GAPDHp-R1 AGTC GGTACC TTTGTTTGTTTATGTGTGTTTATTC 40 GAPDHt-F1 AGTC GGTACCGGATCCTCTAGA GTGAATTTACTTTAAATCTT GCAT 41 GAPDHt-R1 AGTC CTGCAG ATCCACAATGTATCAGGTATCT 42 Mnn4_F CGC GGATCC ATGCTTCAGCGAATATCATCTAAAC 43 Mnn4_R GG ACTAGT TTAATTGCTGTGCCCCTCCTC 44 Y-Mnn14-F AACACACATAAACAAACAAA GGTACC ATGATGTTATCACTGCGCAGG 45 Y-Mnn14-R AAATTCACTCTAGAGGATCC GGTACC TTAATATTTTTGGTCTGAACCAAA 46 The underlined sequence in the above is the restriction enzyme site

8-2: och1? Mnn1? Mnn4? Mnn14? Experiments to recover mannose phosphorylation of the strain

Och1? Mnn1? Mnn4? Mnn14? Without mannose phosphorylation ability YEp352-GAP, YEp352-Mnn4 and YEp352-Mnn14 vectors of Example 8-1 were introduced into the strain by a conventional transformation method. N -glycans were analyzed by obtaining CWMs of the cells obtained by culturing in SC-Ura3 medium containing 1 M sorbitol at 28 ° C for 72 hours as in Examples 2 and 5 (FIG. 9). As a result, mannose phosphorylation ability was restored in all cases when Mnn4 or Mnn14 protein was expressed. However, Mnn14 phosphorylation was significantly higher in Mnn14 than in Mnn4, suggesting that Mnn14 plays a more important role in mannosylation than Mnn4.

8-3: och1? Mnn1? Mnn4? Mnn6? Mnn14? Experiments to recover mannose phosphorylation of the strain

As in Example 8-2, och1? Mnn1? Mnn4? Mnn6? Mnn14? YEp352-GAP, YEp352-Mnn4 and YEp352-Mnn14 vectors were introduced into the strain by conventional transformation methods, and CWMs of the cells were obtained to analyze N -glycosylase (FIG. 10). As a result, the MnN4 or Mnn14 protein was restored to mannosylphosphorylation ability as in Example 8-2, and the Mnn14 phosphorylation ability was much higher when Mnn14 was expressed compared to Mnn4. These results suggest that Mnn14 plays a key role in the addition of mannose phosphate to Mnn4.

Example  9. MNN4 Wow MNN14  Expression of secreted protein by gene deletion N - Oligosaccharide  Change analysis

In the Examples 2 to 8 of the cell walls of yeast manno proteins (cell wall mannoproteins, CWMs) of N - to have analyzed the sugar chain, N of glycoprotein secreted expression from the yeast in the embodiment subsequent to the additional check-oligosaccharide Were analyzed.

9-1: Production of Gas1 protein secretion expression vector

Gas1 protein of S. cerevisiae yeast was selected as the model glycoprotein and the gene expressing the protein of amino acid residues 1 to 490 in which the C-terminal glycosylphosphatidylinositol (GPI) -anchoring motif was removed was expressed as the following polymerase And amplified using a chain reaction (Gil et al, J Biotech 2015). Genomic DNA of S. cerevisiae strain L3262 was extracted and amplified by the first polymerase chain reaction using p-Gas1-F and p-Gas1-R-1 primers as templates and DNA fragments were obtained. Then, the DNA fragment was amplified by polymerase chain reaction using pGas1-F and p-Gas1-R-2 primers as a template, and a His-tagged DNA fragment consisting of 8 His residues for purification was added to the C- . The amplified DNA was cloned into the pD1211 vector of DNA2.0 (Menlo Park, CA, USA) using the Electra method (DNA2.0) according to the protocol provided by the manufacturer, and the final constructed vector was named pD1211-Gas1p.

The sequences of the primers used for the vector production are as follows.

name Sequences (5 '-> 3') SEQ ID NO: p-Gas1-F tacacgtacttagtcgctgaagctcttctatg atgttgtttaaatccctttcaaag 47 p-Gas1-R-1 gtgatgatgatgatggtggtggtgagaaccccctccacc actggattcagttccggaacc 48 p-Gas1-R-2 aggtacgaactcgattgacggctcttctacc gtgatgatgatgatggtggtg 49 The underlined sequence is for Electra cloning and the italic sequence is His-tag and linker

9-2: Secretory expression and purification of recombinant Gas1 protein

Produced in the pD1211-Gas1p vector for Example 1, och1Δmnn1Δmnn4Δmnn6Δ strain as in Example 6 and was introduced by a conventional transformation method to och1Δmnn1Δmnn4Δmnn14Δ strain produced in, 1 M sorbitol is added SC-URA selection media (prepared in 1 M The strains were isolated from recombinant Gas1 protein by selection from sorbitol, 2% glucose, 0.67% yeast nitrogen base w / o amino acid, DO supplement-URA. Further, och1? Mnn1? Mnn4? Mnn14? The pD1211-Gas1p vector was introduced into the strain together with YEp352-Mnn4 vector and YEp352-Mnn14 vector prepared in Example 8 by a conventional transformation method and screened on SC-URA and LEU selective medium supplemented with 1 M sorbitol to secrete Gas1 The och1? Mnn1? Mnn4? Mnn14? / Mnn4 / Gas1 and och1? Mnn1? Mnn4? Mnn14? / Mnn14 / Gas1 strains were expressed.

Four yeast strains expressing recombinant Gasl secretion produced above were cultured at 28 ° C for 3 days using a suitable selective medium (SC-URA or SC-URA, LEU) supplemented with 1 M sorbitol. The culture supernatant thus obtained was purified using a conventional His-tag affinity column (Gil et al, J Biotech 2015).

9-3: N -oligosaccharide analysis of purified Gas1 protein

The N -glycosylation of the purified Gas1 proteins through the above experiment was isolated and purified as described in the existing literature (Lee KJ et al, 2013, Glycoconj J). Briefly, 10 mg of purified Gas1 protein was denaturated and directly processed with PNGase F (New Englad Biolabs) to obtain a glycoprotein. After solid phase extraction using a graphitized carbon column (Alltech, Lexington, MA, USA) Lt; / RTI > The N -glycosities thus purified were analyzed by the method using the DNA sequencer of Example 2 (Fig. 11).

Analysis showed that och1Δmnn1Δmnn4Δmnn6Δ In the recombinant Gas1 protein secreted from the strain, many oligosaccharides added with mannose phosphate adhere, whereas och1? Mnn1? Mnn4? Mnn14? In the recombinant Gas1 protein secreted from the strain, no mannose phosphate-added oligosaccharides were observed (the second and third profiles in Fig. 11). This is consistent with the results (Figs. 6 and 8) of the analysis using the N -glycosylation of CWM of yeast in Examples 5 and 7, and the addition of mannose phosphate to the oligosaccharide of the glycoprotein secreted in S. cerevisiae yeast In order to confirm that MNN4 and MNN14 genes should be defective at the same time. This fact suggests that och1? Mnn1? Mnn4? Mnn14? And the recombinant Gasl protein is secreted and expressed in strains ( och1? Mnn1? Mnn4? Mnn14? / Mnn4 and och1? Mnn1? Mnn4? Mnn14? / Mnn14) complementarily expressing Mnn4 or Mnn14 protein in the strain (fourth and fifth profiles in Fig. 11) . In both cases, the addition ability of mannose phosphoric acid is restored. In this case, when Mnn4 is expressed in the och1Δmnn1Δmnn4Δmnn14Δ strain, only a small amount of the oligosaccharide added with mannose phosphate is detected, whereas when the Mnn14 is expressed, the intensity of the oligosaccharide added with mannose phosphate increases But also two peaks were detected with strongly intense peaks in the oligosaccharide. This shows that the mannose phosphoric acid addition ability of Mnn14 is much better than that of Mnn4.

9-4: Isoelectric point electrophoresis of purified Gas1 protein

The isoelctric points of the purified Gas1 proteins were analyzed using conventional isoelectric focusing (IEF). Briefly, an IEF gel (ThermoFisher Scientific, Waltham, Mass., USA) was mounted in a chamber (ThermoFisher Scientific) filled with cathod and anode buffer (ThermoFisher Scientific) and a Gas1 protein sample with sample buffer (ThermoFisher Scientific) And electrophoresis was performed according to the protocol provided by the manufacturer. After electrophoresis, the gel was reacted with fixation buffer (12% Trichloroacetic acid) for 30 minutes, followed by Coomassie blue staining, and the result was confirmed (FIG. 12).

Since mannose phosphoric acid has a negative charge, the isoelectric point of the protein becomes lower as mannose phosphoric acid is added. Thus, och1? Mnn1? Mnn4? Mnn6? The recombinant Gas1 protein secreted from the strain was added with a lot of mannose phosphate, so that the isoelectric point of the main protein band was located below pH 3 and was attracted (the first lane of FIG. 12). On the other hand, och1? Mnn1? Mnn4? Mnn14? The recombinant Gas1 protein secreted from the strain was found to have a major band at pH 4 or higher (second lane in FIG. 12), resulting in higher isoelectric point. Thus, the addition ability of mannose phosphate in the N - The results were consistent. In addition, recombinant Gas1 proteins secreted from strains complementary to Mnn4 or Mnn14 protein expression ( och1? Mnn1? Mnn4? Mnn14? / Mnn4 and och1? Mnn1? Mnn4? Mnn14? / Mnn14) were identified as och1? Mnn1? Mnn4? Mnn14? It was confirmed that the isoelectric point was significantly lower than that of the protein secreted from the strain (the third and fourth lanes of FIG. 12). It was also confirmed that the MnN14 phosphorus addition ability of the strain complementary to the Mnn14 protein expression was higher than that of the Mnn4 complementation strain.

From the above description, it will be understood by those skilled in the art that the present invention may be embodied in other specific forms without departing from the spirit or essential characteristics thereof. In this regard, it should be understood that the above-described embodiments are to be considered in all respects as illustrative and not restrictive. The scope of the present invention should be construed as being included in the scope of the present invention without departing from the scope of the present invention as defined by the appended claims.

Korea Biotechnology Research Institute KCTC12789P 20150406

<110> KOREA RESEARCH INSTITUTE OF BIOSCIENCE AND BIOTECHNOLOGY An essential gene MNN14 for mannosylphosphorylation in Saccharomyces cerevisiae and a method for producing recombinant glycoprotein using a MNN14-defected microorganism <130> KPA150188-KR-P1 <150> 10-2015-0064855 <151> 2015-05-08 <160> 49 <170> Kopatentin 2.0 <210> 1 <211> 935 <212> PRT <213> Saccharomyces cerevisiae <400> 1 Met Met Leu Ser Leu Arg Arg Phe Ser Met Tyr Val Leu Arg Ser Leu   1 5 10 15 Arg Leu His Phe Lys Lys Ile Ile Ile Thr Leu Leu Thr Ile Gln Leu              20 25 30 Leu Phe Ile Thr Ile Phe Val Leu Gly Gly Arg Ser Ser Ile Ile Asp          35 40 45 Gly Asn Trp Lys Ser Phe Met Ala Leu Phe Phe Lys Pro Leu Ala Tyr      50 55 60 Thr Asn Arg Asn Asn Asn His Ala Ser Phe Asp Leu Arg Ser Lys Asp  65 70 75 80 Asn Val Ala Lys Leu Tyr Glu Lys Met Asn Phe Asp Thr Ser Gly Lys                  85 90 95 Trp Ile Asp Thr Tyr Thr Leu Lys Asn Asn Leu Leu Thr Val Lys Met             100 105 110 Gly Pro Glu Lys Gly Gln Val Leu Asp Ser Val Asp Glu Leu Arg Tyr         115 120 125 Tyr Asp Asn Asp Pro Arg Leu Val Trp Ser Val Leu Leu Asp His Leu     130 135 140 Leu Glu Ser Asp Ser Asn Glu Tyr Ala Phe Ser Trp Tyr Asp Trp Ala 145 150 155 160 Asn Phe Asp Ser Thr Asn Lys Leu Ile Ala Leu Arg His Thr Asn Ile                 165 170 175 Ser Cys Gln Phe Val Cys Glu Gly Ala Phe Asp Lys Asn Val Leu Glu             180 185 190 Met Val Glu Ser Glu Val Gln Glu Pro Leu Phe Val Thr Asn Arg Asn         195 200 205 Lys Tyr Asp Glu Ser Leu Trp Tyr Asn Arg Val Val Lys Val Val Asp     210 215 220 Ser Asn Ser Val Gln Gln Ala Ile His Asp His Cys Met Asn Asn Asp 225 230 235 240 Ala Tyr Ser Asn Gly Thr Pro Phe Glu Leu Pro Phe Ile Ile Ser Glu                 245 250 255 Ile Ser Glu Arg Leu Arg Pro Glu Val Tyr Asp Leu Gln Ala Lys Asn             260 265 270 His Leu Leu Tyr Ser Asn Phe Thr Pro Leu Ser Leu Thr Val Leu Asp         275 280 285 Ser Asp Lys Asp Ala Tyr Arg Ile Asn Leu Lys Thr Thr Asp Ser Ser     290 295 300 Lys Ser Asn Ile Val Gln Thr Asn Leu Leu Gln Asn Tyr Ile Lys Arg 305 310 315 320 His Arg Asn Glu Met Val Asn Gly Asp Leu Ile Phe Asn His Thr Ser                 325 330 335 Met Phe Glu Lys Phe Leu His His Gly Ser Thr Lys Lys Arg Lys Leu             340 345 350 Asp Val Glu Ala Leu Asp Lys Thr Ile Tyr Ala Gly Glu Tyr Leu Glu         355 360 365 Leu Ser Pro Ser Asp Phe Gln Phe Asn Ala Lys Glu Arg Ile Ile Glu     370 375 380 Leu Glu Thr Arg Leu Arg Ser Glu Gly Leu Pro Ser His Asp Thr His 385 390 395 400 Tyr Leu Arg Ser Leu Lys Thr Ser Val Asn Thr Ser Pro Ala Leu Gln                 405 410 415 Gln Lys Tyr Phe Ala Glu Ala Ser Asp Ile Thr Asp Ala Thr Ala Asp             420 425 430 Gly His His Arg Asp Arg Arg Phe Phe Ser Ile Gly His Asn Leu Leu         435 440 445 Asn Asp Pro Gln Glu Phe Glu Ala Arg Leu Asn Ser Leu Ile Arg Asn     450 455 460 Phe Gln Lys Phe Val Lys Ala Asn Gly Leu Ile Ser Trp Leu Ser His 465 470 475 480 Gly Thr Leu Tyr Gly Tyr Leu Tyr Asp Gly Leu Lys Phe Pro Trp Asp                 485 490 495 Val Asp His Asp Leu Gln Met Pro Ile Lys His Leu His Tyr Leu Ser             500 505 510 Gln Tyr Phe Asn Gln Ser Leu Ile Leu Glu Asp Pro Arg Glu Gly Asn         515 520 525 Gly Arg Phe Leu Leu Asp Val Gly Ser Ala Ile Thr Val Gly Val His     530 535 540 Gly Asn Gly Glu Asn Asn Ile Asp Ala Arg Phe Ile Asp Ile Asp Ser 545 550 555 560 Gly Ile Tyr Ile Asp Ile Thr Gly Leu Ser Val Ser Ser Asp Ala Ala                 565 570 575 Lys Gln Tyr Met Ser Lys Phe Val Glu Glu Glu Ser Ser Gly Glu Ser             580 585 590 Phe Ser Ala Leu Ile Glu Asp Tyr Lys Phe Asp Glu Asn Asp Tyr Phe         595 600 605 Asp Glu Val Asp Gly Arg Glu Gly Leu Ala Lys Tyr Thr Ile His Glu     610 615 620 Leu Met Glu Trp Val Asn Ser His Pro Asp Asp Phe Thr Asp Ala Glu 625 630 635 640 Lys Asn Leu Val Thr Lys Thr Tyr Lys Lys Glu Leu Ala Ile Ser Arg                 645 650 655 Ser Asp Tyr Ala Glu Lys Asp Leu Ser Pro Lys Gln Arg Tyr Leu Val             660 665 670 Asn Glu Lys Tyr Asn Leu Tyr Asn Cys Arg Asn Gln His Phe Ser Ser         675 680 685 Leu Asn Ile Ile Ser Pro Leu Arg Asn Thr Met Phe Ser Gly Val Ser     690 695 700 Ala Phe Val Pro Asn Arg Pro Ile Ala Thr Leu Asn Asn Glu Tyr Lys 705 710 715 720 Val Pro Ala Lys Tyr Gly Leu Leu Ser Phe Gln Gly Lys Val Tyr Leu                 725 730 735 Pro Glu Phe Arg Tyr Trp Phe Ser Phe Ala Asp Met Lys Lys Phe Ala             740 745 750 Asn Leu Gln Leu Lys Glu Pro Lys Ile Thr Arg Leu Glu Ser Pro Leu         755 760 765 Asn Asp Leu Lys Phe Ser Asp Ile Ser Leu Leu Ile Thr Asn Ile Leu     770 775 780 Lys Cys Gly Phe His Ser Val Phe Ala Ser Leu Phe Asn Ser Phe Asp 785 790 795 800 Ser Thr Val Tyr Arg Leu Lys Glu Leu Glu Ile Gln Tyr Asp Pro Ser                 805 810 815 Leu Ser Glu Glu Glu Lys Ser Ser Leu Leu Lys Thr Leu Arg Arg Gly             820 825 830 Met Ser Lys Lys Ile Lys Ser Pro Glu Lys Asp Pro Ile Ile Tyr Ile         835 840 845 Tyr Glu Arg Lys Leu Trp Glu Asn Val Glu Lys Leu Leu Asn Ala Ser     850 855 860 Asn Ile Tyr Asn Ile Ala Ser Gln Val Glu Lys Glu Lys Gly Lys Glu 865 870 875 880 Phe Val Glu Arg Ser Gln Gln Val Tyr Glu Arg Asn Phe Asp Gly Phe                 885 890 895 Arg Leu Pro Asp Gly Gly Asn Ser Lys Thr Val Asn Asp Leu Asn Ser             900 905 910 Lys Gly Leu Asn Leu Phe Gly Asp Asn Lys Lys Thr Ser Asn Asn Ile         915 920 925 Phe Gly Ser Asp Gln Lys Tyr     930 935 <210> 2 <211> 2808 <212> DNA <213> Saccharomyces cerevisiae <400> 2 atgatgttat cactgcgcag gttctccatg tacgttttga gatctctgcg gcttcacttt 60 aaaaagataa tcattactct tctaactatc cagttactat tcattaccat atttgtattg 120 ggcggtcgct cgtcgattat tgacggtaac tggaagtcat tcatggcgct ctttttcaaa 180 ccgcttgctt acactaacag aaacaacaac catgcttctt tcgatctgag atcaaaagac 240 aacgtagcca aactttacga aaaaatgaat tttgatactt caggcaaatg gatcgacacg 300 tacaccttga agaataatct tctcactgtg aaaatgggtc ctgaaaaagg gcaagttctt 360 gattcggtag atgaattgag atattacgat aacgacccaa ggctggtatg gtcagtttta 420 ctagatcact tattagaatc agattccaat gaatacgcat tttcgtggta cgattgggct 480 aattttgact ctacaaacaa actcattgca ctgagacaca cgaacatatc ttgccagttc 540 gtttgcgagg gtgcctttga taaaaatgtg ctagaaatgg tagagagtga agtccaagag 600 cctttattcg tcacaaatag gaataaatat gacgaatcgc tctggtacaa cagggtaaga 660 aaggttgtcg attctaattc tgtgcagcaa gccatacatg atcactgcat gaataatgac 720 gcgtattcca atggtactcc cttcgaattg ccttttatca taagcgaaat ttctgaaagg 780 ttgaggccag aagtgtatga cttacaagcc aaaaaccact tgttatattc taactttact 840 ccactgtcat taaccgtact ggacagcgat aaagatgcat acagaatcaa tttgaagaca 900 acagactctt ccaaatcaaa tatagtacag acaaatctac tacagaatta cattaagagg 960 cacagaaatg aaatggtaaa tggcgacctc attttcaacc acacttccat gtttgaaaaa 1020 tttttacatc atggatccac taaaaaaagg aaacttgacg ttgaagcgtt ggataaaaca 1080 atatacgctg gagagtatct agaactatca ccatctgatt tccaattcaa tgcaaaagag 1140 aggatcattg aattagagac caggctcagg tctgaaggcc taccatctca tgatacccac 1200 tatttacgaa gtttaaagac gtccgtaaat acgtcccctg cattacagca aaagtatttc 1260 gcagaggcct ctgatattac ggacgcgact gccgatggtc atcatagaga caggcgattt 1320 ttctcaatcg gacataatct cctaaatgac cctcaggagt ttgaagcaag attgaattct 1380 ttgatcagaa attttcagaa atttgttaag gctaacggat taatttcctg gctatcgcat 1440 ggtacattgt atggatatct atatgatggt ctgaagtttc cctgggatgt cgaccatgat 1500 ttacagatgc ccattaaaca tttacattac ttgagtcaat atttcaacca atccctaata 1560 ttagaagatc caagagaagg taatggaaga ttcttactag atgtaggaag cgcaattacg 1620 gtaggagttc atgggaacgg cgaaaacaat attgatgctc gtttcatcga tattgactca 1680 ggtatataca ttgacatcac gggacttagc gttagttccg atgcggctaa acagtacatg 1740 tccaaatttg tagaagaaga aagctcgggc gaaagctttt ctgcccttat tgaagactat 1800 aagtttgacg aaaacgacta ttttgacgag gtggatggta gagaaggttt agctaaatat 1860 accatacatg aattaatgga atgggttaat tctcatccag acgactttac ggatgcagaa 1920 aagaatttag tcaccaaaac atacaagaaa gagcttgcaa tttcgagaag cgattatgct 1980 gaaaaagact tgtctccgaa acaaaggtat ttggtaaatg agaagtataa cctttacaat 2040 tgtagaaacc agcatttttc cagtctaaac atcatatcac ccttgagaaa tacaatgttc 2100 agcggtgtgt cagcatttgt tcctaatagg cccatagcaa cattgaataa tgagtataaa 2160 gttccggcaa aatacgggct tttgtcattc caaggtaagg tgtatttacc ggaattcaga 2220 tactggttct cgtttgcaga catgaagaag tttgcaaatt tgcagctgaa agaacccaag 2280 ataacacgac tggaaagtcc cttaaatgat ttaaaattca gcgacataag cctactgata 2340 acaaacattt taaaatgtgg gtttcactcc gtatttgcca gcttatttaa ttcttttgac 2400 agtactgttt acagactcaa agagcttgaa atacagtatg atcctagctt gagtgaggaa 2460 gaaaaaagta gtctattaaa aactctacgg cgaggaatgt caaaaaaaat aaaatcacca 2520 gaaaaagatc cgatcatata tatatacgaa agaaagttat gggaaaacgt ggaaaagttg 2580 ttgaatgcgt caaacatcta caacattgct tcacaagttg agaaggaaaa aggtaaagag 2640 tttgttgaac ggtcccagca agtatatgaa agaaactttg acggcttcag acttcccgat 2700 ggcggcaaca gtaagactgt aaatgatctg aattctaagg gcttaaatct ctttggtgat 2760 aataagaaaa cttcaaacaa tatatttggt tcagaccaaa aatattaa 2808 <210> 3 <211> 1178 <212> PRT <213> Saccharomyces cerevisiae <400> 3 Met Leu Gln Arg Ile Ser Ser Lys Leu His Arg Arg Phe Leu Ser Gly   1 5 10 15 Leu Leu Arg Val Lys His Tyr Pro Leu Arg Arg Ile Leu Leu Pro Leu              20 25 30 Ile Leu Leu Gln Ile Ile Ile Ile Thr Phe Ile Trp Ser Asn Ser Pro          35 40 45 Gln Arg Asn Gly Leu Gly Arg Asp Ala Asp Tyr Leu Leu Pro Asn Tyr      50 55 60 Asn Glu Leu Asp Ser Asp Asp Asp Ser Trp Tyr Ser Ile Leu Thr Ser  65 70 75 80 Ser Phe Lys Asn Asp Arg Lys Ile Gln Phe Ala Lys Thr Leu Tyr Glu                  85 90 95 Asn Leu Lys Phe Gly Thr Asn Pro Lys Trp Val Asn Glu Tyr Thr Leu             100 105 110 Gln Asn Asp Leu Leu Ser Val Lys Met Gly Pro Arg Lys Gly Ser Lys         115 120 125 Leu Glu Ser Val Asp Glu Leu Lys Phe Tyr Asp Phe Asp Pro Arg Leu     130 135 140 Thr Trp Ser Val Val Leu Asn His Leu Gln Asn Asn Asp Ala Asp Gln 145 150 155 160 Pro Glu Lys Leu Pro Phe Ser Trp Tyr Asp Trp Thr Thr Phe His Glu                 165 170 175 Leu Asn Lys Leu Ile Ser Ile Asp Lys Thr Val Leu Pro Cys Asn Phe             180 185 190 Leu Phe Gln Ser Ala Phe Asp Lys Glu Ser Leu Glu Ala Ile Glu Thr         195 200 205 Glu Leu Gly Glu Pro Leu Phe Leu Tyr Glu Arg Pro Lys Tyr Ala Gln     210 215 220 Lys Leu Trp Tyr Lys Ala Ala Arg Asn Gln Asp Arg Ile Lys Asp Ser 225 230 235 240 Lys Glu Leu Lys Lys His Cys Ser Lys Leu Phe Thr Pro Asp Gly His                 245 250 255 Gly Ser Pro Lys Gly Leu Arg Phe Asn Thr Gln Phe Gln Ile Lys Glu             260 265 270 Leu Tyr Asp Lys Val Arg Pro Glu Val Tyr Gln Leu Gln Ala Arg Asn         275 280 285 Tyr Ile Leu Thr Thr Gln Ser His Pro Leu Ser Ile Ser Ile Ile Glu     290 295 300 Ser Asp Asn Ser Thr Tyr Gln Val Pro Leu Gln Thr Glu Lys Ser Lys 305 310 315 320 Asn Leu Val Gln Ser Gly Leu Leu Gln Glu Tyr Ile Asn Asp Asn Ile                 325 330 335 Asn Ser Thr Asn Lys Arg Lys Lys Asn Lys Gln Asp Val Glu Phe Asn             340 345 350 His Asn Arg Leu Phe Gln Glu Phe Val Asn Asn Asp Gln Val Asn Ser         355 360 365 Leu Tyr Lys Leu Glu Ile Glu Glu Thr Asp Lys Phe Thr Phe Asp Lys     370 375 380 Asp Leu Val Tyr Leu Ser Pro Ser Asp Phe Lys Phe Asp Ala Ser Lys 385 390 395 400 Lys Ile Glu Glu Leu Glu Glu Gln Lys Lys Leu Tyr Pro Asp Lys Phe                 405 410 415 Ser Ala His Asn Glu Asn Tyr Leu Asn Ser Leu Lys Asn Ser Val Lys             420 425 430 Thr Ser Pro Ala Leu Gln Arg Lys Phe Phe Tyr Glu Ala Gly Ala Val         435 440 445 Lys Gln Tyr Lys Gly Met Gly Phe His Arg Asp Lys Arg Phe Phe Asn     450 455 460 Val Asp Thr Leu Ile Asn Asp Lys Gln Glu Tyr Gln Ala Arg Leu Asn 465 470 475 480 Ser Met Ile Arg Thr Phe Gln Lys Phe Thr Lys Ala Asn Gly Ile Ile                 485 490 495 Ser Trp Leu Ser His Gly Thr Leu Tyr Gly Tyr Leu Tyr Asn Gly Met             500 505 510 Ala Phe Pro Trp Asp Asn Asp Phe Asp Leu Gln Met Pro Ile Lys His         515 520 525 Leu Gln Leu Leu Ser Gln Tyr Phe Asn Gln Ser Leu Ile Leu Glu Asp     530 535 540 Pro Arg Gln Gly Asn Gly Arg Tyr Phe Leu Asp Val Ser Asp Ser Leu 545 550 555 560 Thr Val Arg Ile Asn Gly Asn Gly Lys Asn Asn Ile Asp Ala Arg Phe                 565 570 575 Ile Asp Val Asp Thr Gly Leu Tyr Ile Asp Ile Thr Gly Leu Ala Ser             580 585 590 Thr Ser Ala Pro Ser Arg Asp Tyr Leu Asn Ser Tyr Ile Glu Glu Arg         595 600 605 Leu Gln Glu Glu His Leu Asp Ile Asn Asn Ile Pro Glu Ser Asn Gly     610 615 620 Glu Thr Ala Thr Leu Pro Asp Lys Val Asp Asp Gly Leu Val Asn Met 625 630 635 640 Ala Thr Leu Asn Ile Thr Glu Leu Arg Asp Tyr Ile Thr Ser Asp Glu                 645 650 655 Asn Lys Asn His Lys Arg Val Val Thr Asp Thr Asp Leu Lys Asp Leu             660 665 670 Leu Lys Lys Glu Leu Glu Glu Leu Pro Lys Ser Lys Thr Ile Glu Asn         675 680 685 Lys Leu Asn Pro Lys Gln Arg Tyr Phe Leu Asn Glu Lys Leu Lys Leu     690 695 700 Tyr Asn Cys Arg Asn Asn His Phe Asn Ser Phe Glu Glu Leu Ser Pro 705 710 715 720 Leu Ile Asn Thr Val Phe His Gly Val Pro Ala Leu Ile Pro His Arg                 725 730 735 His Thr Tyr Cys Leu His Asn Glu Tyr His Val Pro Asp Arg Tyr Ala             740 745 750 Phe Asp Ala Tyr Lys Asn Thr Ala Tyr Leu Pro Glu Phe Arg Phe Trp         755 760 765 Phe Asp Tyr Asp Gly Leu Lys Lys Cys Ser Asn Ile Asn Ser Trp Tyr     770 775 780 Pro Asn Ile Pro Ser Ile Asn Ser Trp Asn Pro Asn Leu Leu Lys Glu 785 790 795 800 Ile Ser Ser Thr Lys Phe Glu Ser Lys Leu Phe Asp Ser Asn Lys Val                 805 810 815 Ser Glu Tyr Ser Phe Lys Asn Leu Ser Met Asp Asp Val Arg Leu Ile             820 825 830 Tyr Lys Asn Ile Pro Lys Ala Gly Phe Ile Glu Val Phe Thr Asn Leu         835 840 845 Tyr Asn Ser Phe Asn Val Thr Ala Tyr Arg Gln Lys Glu Leu Glu Ile     850 855 860 Gln Tyr Cys Gln Asn Leu Thr Phe Ile Glu Lys Lys Lys Leu Leu His 865 870 875 880 Gln Leu Arg Ile Asn Val Ala Pro Lys Leu Ser Ser Pro Ala Lys Asp                 885 890 895 Pro Phe Leu Phe Gly Tyr Glu Lys Ala Met Trp Lys Asp Leu Ser Lys             900 905 910 Ser Met Asn Gln Thr Thr Leu Asp Gln Val Thr Lys Ile Val His Glu         915 920 925 Glu Tyr Val Gly Lys Ile Ile Asp Leu Ser Glu Ser Leu Lys Tyr Arg     930 935 940 Asn Phe Ser Leu Phe Asn Ile Thr Phe Asp Glu Thr Gly Thr Thr Leu 945 950 955 960 Asp Asp Asn Thr Glu Asp Tyr Thr Pro Ala Asn Thr Val Glu Val Asn                 965 970 975 Pro Val Asp Phe Lys Ser Asn Leu Asn Phe Ser Ser Asn Ser Phe Leu             980 985 990 Asp Leu Asn Ser Tyr Gly Leu Asp Leu Phe Ala Pro Thr Leu Ser Asp         995 1000 1005 Val Asn Arg Lys Gly Ile Gln Met Phe Asp Lys Asp Pro Ile Ile Val    1010 1015 1020 Tyr Glu Asp Tyr Ala Tyr Ala Lys Leu Leu Glu Glu Arg Lys Arg Arg 1025 1030 1035 1040 Glu Lys Lys Lys Lys Glu Glu Glu Glu Lys Lys Lys Lys Glu Glu Glu                1045 1050 1055 Glu Lys Lys Lys Lys Glu Glu Glu Glu Lys Lys Lys Lys Glu Glu Glu            1060 1065 1070 Glu Lys Lys Lys Lys Glu Glu Glu Glu Lys Lys Lys Lys Glu Glu Glu        1075 1080 1085 Glu Lys Lys Lys Gln Glu Glu Glu Glu Lys Lys Lys Lys Glu Glu Glu    1090 1095 1100 Glu Lys Lys Lys Gln Glu Glu Gly Glu Lys Met Lys Asn Glu Asp Glu 1105 1110 1115 1120 Glu Asn Lys Lys Asn Glu Asp Glu Glu Lys Lys Lys Asn Glu Glu Glu                1125 1130 1135 Glu Lys Lys Lys Gln Glu Glu Lys Asn Lys Lys Asn Glu Asp Glu Glu            1140 1145 1150 Lys Lys Lys Gln Glu Glu Glu Glu Lys Lys Lys Asn Glu Glu Glu Glu        1155 1160 1165 Lys Lys Lys Gln Glu Glu Gly His Ser Asn    1170 1175 <210> 4 <211> 3534 <212> DNA <213> Saccharomyces cerevisiae <400> 4 atgcttcagc gaatatcatc taaacttcac aggcggttct tatctggcct gctgcgtgtc 60 aagcactacc cattaaggcg cattctcctt ccactgattc tactgcagat catcattata 120 acgtttatct ggtcaaattc accgcagcgt aacggacttg ggcgggacgc tgattacctt 180 ctaccaaatt acaacgaact tgacagtgat gatgattcct ggtatagcat cctgacttcg 240 tctttcaaaa acgatcgcaa gatccagttc gctaagacat tatacgaaaa tttaaaattc 300 ggcaccaacc ctaaatgggt caatgaatat actctgcaaa atgacctgct ctcggtcaaa 360 atgggccctc gaaagggcag taagctcgaa tccgtggatg agttgaagtt ttacgacttc 420 gaccctcgtc tcacgtggtc cgttgtgctg aaccatttgc aaaataatga cgcagatcag 480 ccagaaaagt tacccttttc atggtacgac tggacaacct tccacgagct gaataagctg 540 atttccatag ataaaactgt tctgccctgc aattttcttt tccagtccgc tttcgacaaa 600 gagtctttag aggccattga gacagagctc ggcgaacctt tgttcctata cgaaagacca 660 aagtacgcgc agaaactgtg gtacaaggcc gctagaaacc aggacagaat caaagactca 720 aaggaactaa aaaagcattg ttccaagcta ttcactccag acgggcatgg ctctcctaag 780 ggtttaagat ttaatacgca atttcaaata aaggagctgt atgataaagt tagacccgaa 840 gtttaccaat tgcaggcaag aaactacatt ttgactacac agtcgcatcc actatccatt 900 tccatcatcg aatcagataa ttccacgtat caagtcccct tgcaaactga aaaatcaaaa 960 aacttggtgc aatccggcct gttgcaggaa tatattaatg ataacattaa ttctacgaac 1020 aagagaaaga aaaataaaca ggacgtagaa ttcaaccata acaggctttt ccaggaattc 1080 gtcaataacg accaagttaa ctccctatac aaactggaaa ttgaagaaac tgataaattc 1140 acttttgata aagatttggt ttatttatcc ccttcggatt tcaagttcga tgcctccaaa 1200 aaaattgaag agttagagga acagaagaaa ctctatccgg acaaattttc cgctcataat 1260 gagaattatc tgaacagttt gaagaattcc gtaaagacaa gccctgcatt gcaaagaaag 1320 ttcttctatg aggctggtgc cgtgaagcaa tataaaggta tggggttcca tcgtgacaag 1380 aggttcttca atgttgatac attaatcaat gataaacaag aataccaggc tagattgaac 1440 tcaatgatca gaacattcca aaagtttact aaagccaacg gcatcatatc ttggttgtct 1500 cacggaacgc tgtacggcta tctttacaat ggaatggctt tcccttggga taacgatttc 1560 gacttgcaaa tgcccattaa gcatttacaa ttgctcagtc aatacttcaa ccaatctctt 1620 atattggaag acccaagaca gggtaatgga cgttatttcc tagacgtcag cgactccttg 1680 acagtaagaa ttaacggtaa cggtaaaaac aatatcgatg caagattcat tgacgtcgac 1740 accggccttt acattgatat taccggtcta gctagcactt ctgcccctag tagggattac 1800 ttgaattctt atattgaaga gcggttgcaa gaggaacatt tggatatcaa taatatccct 1860 gaatcgaacg gtgagaccgc tactttgccc gacaaagtag atgatgggtt agtcaatatg 1920 gctacactaa acatcactga gctacgtgat tacattacca gcgacgaaaa taaaaatcat 1980 aaaagagtcc ccactgatac tgatttgaaa gatcttttga aaaaggaact ggaagagtta 2040 ccaaagtcta agaccattga aaacaagttg aatcctaaac aaagatattt tctcaacgaa 2100 aaacttaaac tttacaattg tagaaacaac cattttaact cgttcgagga actatctccc 2160 ttaatcaata ctgttttcca tggtgtgcca gcgttgattc ctcacagaca tacctactgc 2220 ttgcacaatg aatatcatgt acctgataga tatgcatttg atgcttacaa aaatactgct 2280 tatttgcccg aatttagatt ttggttcgac tatgacgggt taaagaaatg cagtaatatt 2340 aattcatggt atccaaacat ccccagtatt aattcatgga atccgaacct cttgaaagaa 2400 atatcgtcta cgaaatttga gtcgaaactt tttgattcca acaaagtctc tgaatactct 2460 ttcaaaaacc tatccatgga tgatgttcgc ttaatttata aaaatattcc aaaagctggc 2520 tttatcgagg tatttactaa cttgtacaat tccttcaatg tcactgcata taggcaaaag 2580 gaattggaaa ttcaatactg ccaaaacctg acatttattg aaaaaaagaa attattacat 2640 caattgcgca ttaatgttgc tcctaagtta agctcccctg caaaggaccc atttcttttt 2700 ggttatgaaa aagctatgtg gaaggattta tcaaaatcta tgaaccagac tacattagat 2760 caagttacca agattgttca tgaagaatat gtcggaaaaa ttattgatct gtccgaaagt 2820 ttgaaataca ggaatttttc acttttcaac attacttttg atgaaactgg aacaactcta 2880 gatgataaca cagaagatta tactcctgct aatactgttg aagtaaatcc tgtggatttt 2940 aaatcaaatt taaactttag tagcaactcc tttttggatt taaattcata tggtttagac 3000 ctttttgcgc caactttatc cgacgttaac agaaagggta ttcaaatgtt tgataaggac 3060 cctattattg tatacgagga ctatgcttat gccaagttac ttgaagaaag aaagcggagg 3120 gagaagaaga agaaggagga agaggagaag aagaagaagg aagaagagga aaagaagaag 3180 aaggaagaag aagaaaagaa aaagaaggaa gaggaagaga agaaaaagaa ggaagaagaa 3240 gagaagaaaa agaaggaaga agaagaaaag aagaagcagg aggaagagga gaaaaagaag 3300 aaggaagaag aagagaagaa gaagcaggaa gaaggagaaa agatgaagaa tgaagatgaa 3360 gaaaataaga agaatgaaga tgaagaaaag aagaagaacg aagaagagga aaaaaagaag 3420 caggaagaga aaaacaagaa gaatgaagat gaagaaaaga agaagcagga agaggaagaa 3480 aagaagaaga acgaagaaga ggaaaaaaag aagcaggagg aggggcacag caat 3534 <210> 5 <211> 65 <212> DNA <213> Artificial Sequence <220> <223> Och1_pUG72_F <400> 5 atgtctagga agttgtccca cctgatcgct acaaggaaat caaaatacgc tgcaggtcga 60 caacc 65 <210> 6 <211> 66 <212> DNA <213> Artificial Sequence <220> <223> Och1_pUG72_R <400> 6 ttatttatga cctgcatttt tatcagcatc ttctttccag ctcccactag tggatctgat 60 atcacc 66 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Och1_CF <400> 7 aatggggagc gctgattctc 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Och1_CR <400> 8 tctacggaag gacgttgaga 20 <210> 9 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> Mnn1_pUG6_F <400> 9 aacgtaatct tgcggtattt aacgctagtt taagaaagtg ttactgtgta tacgctgcag 60 gtcgacaacc 70 <210> 10 <211> 71 <212> DNA <213> Artificial Sequence <220> <223> Mnn1_pUG6_R <400> 10 gttcacaaag gctagtacca taaacagtta gaaaaaacac tggttaatgc actagtggat 60 ctgatatcac c 71 <210> 11 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Mnn1_CF <400> 11 atcattgcga ggtctcaatt gg 22 <210> 12 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> Mnn1_CR <400> 12 gattagaaaa actcatcgag catcaaatg 29 <210> 13 <211> 71 <212> DNA <213> Artificial Sequence <220> <223> Mnn4_F <400> 13 acaacgtcac tattccttca cacaaataaa ctaattagtt atgcttcagc gtacgctgca 60 ggtcgacaac c 71 <210> 14 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> Mnn4_R <400> 14 aggaaaggct atagaaatga agagattcat gaattttcag tcaggttcta ctagtggatc 60 tgatatcacc 70 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Leu2_CF <400> 15 agccttgtca agagaccaga 20 <210> 16 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Mnn4_CR <400> 16 attgtttgcc acttatcact ggcg 24 <210> 17 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> Mnn6_F <400> 17 agcgttcacc caaccttttg tgccctttag tgaagataag ataaggtaag tacgctgcag 60 gtcgacaacc 70 <210> 18 <211> 71 <212> DNA <213> Artificial Sequence <220> <223> Mnn6_R <400> 18 tatatattca tatgtagaag attattgttc ttatacatca gtgttttgat actagtggat 60 ctgatatcac c 71 <210> 19 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Mnn6_CF <400> 19 gctctcgtga gacacgagtt 20 <210> 20 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Ura3_CR <400> 20 cccgtcaatt agttgcacca 20 <210> 21 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> Mnn14_F <400> 21 atgatgttat cactgcgcag gttctccatg tacgttttga gatctctgcg tacgctgcag 60 gtcgacaacc 70 <210> 22 <211> 71 <212> DNA <213> Artificial Sequence <220> <223> Mnn14_R <400> 22 ttaatatttt tggtctgaac caaatatatt gtttgaagtt ttcttattat actagtggat 60 ctgatatcac c 71 <210> 23 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> Yur1_F <400> 23 atggcaaaag gaggctcgct atacatcgtt ggcatattct taccaatatg tacgctgcag 60 gtcgacaacc 70 <210> 24 <211> 71 <212> DNA <213> Artificial Sequence <220> <223> Yur1_R <400> 24 ttaaatctcg tcttgctctt cttttaagaa atatttgccg ctaccgtttt actagtggat 60 ctgatatcac c 71 <210> 25 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> Ktr2_F <400> 25 atgcaaatct gcaaggtatt tcttacacag gttaaaaaac tactttttgt tacgctgcag 60 gtcgacaacc 70 <210> 26 <211> 71 <212> DNA <213> Artificial Sequence <220> <223> Ktr2_R <400> 26 ctatgaatcg tgtttgagga agtatttacc gctgccgtcc ttccaccatc actagtggat 60 ctgatatcac c 71 <210> 27 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> Ktr4_F <400> 27 atgaggtttc tttcaaaaag gatactgaaa cctgtacttt cagtgatcat tacgctgcag 60 gtcgacaacc 70 <210> 28 <211> 71 <212> DNA <213> Artificial Sequence <220> <223> Ktr4_R <400> 28 tcaatacatt tctaactctt cctcagacat agagtgtctt atccaggttg actagtggat 60 ctgatatcac c 71 <210> 29 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> Ktr5_F <400> 29 atgttgctaa taagaaggac gataaatgca tttctgggat gtatccattg tacgctgcag 60 gtcgacaacc 70 <210> 30 <211> 71 <212> DNA <213> Artificial Sequence <220> <223> Ktr5_R <400> 30 ctagtttccg aactgtctta gatagtcttc ccttatgtgc tcctccattt actagtggat 60 ctgatatcac c 71 <210> 31 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> Ktr7_F <400> 31 atggctataa gattgaatcc aaaagtcaga aggttcttgc tggataagtg tacgctgcag 60 gtcgacaacc 70 <210> 32 <211> 71 <212> DNA <213> Artificial Sequence <220> <223> Ktr7_R <400> 32 ctattcaatt actctaaaat tttctcttct gatctcttca atcacgtctt actagtggat 60 ctgatatcac c 71 <210> 33 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Mnn14_CF <400> 33 cgaagatcaa gtaagagtgc acttg 25 <210> 34 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Yur1_CF <400> 34 atctgtcact gcttattcat atcatc 26 <210> 35 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Ktr2_CF <400> 35 atctcttcag gtatgtgaca cctata 26 <210> 36 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Ktr4_CF <400> 36 caacggaacg agctctataa gacg 24 <210> 37 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Ktr5_CF <400> 37 acactttaag catgcggtgt gtgga 25 <210> 38 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Ktr7_CF <400> 38 gtatacatca ggctaacaat ctgtga 26 <210> 39 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> GAPDHp-F1 <400> 39 agtcgaattc atactagcgt tgaatgttag cg 32 <210> 40 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> GAPDHp-R1 <400> 40 agtcggtacc tttgtttgtt tatgtgtgtt tattc 35 <210> 41 <211> 46 <212> DNA <213> Artificial Sequence <220> <223> GAPDHt-F1 <400> 41 agtcggtacc ggatcctcta gagtgaattt actttaaatc ttgcat 46 <210> 42 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> GAPDHt-R1 <400> 42 agtcctgcag atccacaatg tatcaggtat ct 32 <210> 43 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> Mnn4_F <400> 43 cgcggatcca tgcttcagcg aatatcatct aaac 34 <210> 44 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> Mnn4_R <400> 44 ggactagttt aattgctgtg cccctcctc 29 <210> 45 <211> 47 <212> DNA <213> Artificial Sequence <220> <223> Y-Mnn14-F <400> 45 aacacacata aacaaacaaa ggtaccatga tgttatcact gcgcagg 47 <210> 46 <211> 50 <212> DNA <213> Artificial Sequence <220> <223> Y-Mnn14-R <400> 46 aaattcactc tagaggatcc ggtaccttaa tatttttggt ctgaaccaaa 50 <210> 47 <211> 56 <212> DNA <213> Artificial Sequence <220> <223> p-Gas1-F <400> 47 tacacgtact tagtcgctga agctcttcta tgatgttgtt taaatccctt tcaaag 56 <210> 48 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> p-Gas1-R-1 <400> 48 gtgatgatga tgatggtggt ggtgagaacc ccctccacca ctggattcag ttccggaacc 60                                                                           60 <210> 49 <211> 52 <212> DNA <213> Artificial Sequence <220> <223> p-Gas1-R-2 <400> 49 aggtacgaac tcgattgacg gctcttctac cgtgatgatg atgatggtgg tg 52

Claims (6)

Wherein the activity of the Mnn4 protein and the Mnn14 protein of SEQ ID NO: 1 are all weaker than the intrinsic activity.
The method according to claim 1,
Wherein said weakening of said intrinsic activity comprises deleting all or part of the gene on the chromosome encoding said protein; A method of replacing a gene mutated to reduce the activity of the protein and a gene encoding the protein on a chromosome; A method of introducing a mutation into an expression control sequence of a gene on a chromosome encoding said protein; A method of replacing the expression control sequence of the gene encoding the protein with a weak or absent sequence; Introducing an antisense oligonucleotide complementary to a transcript of the gene on the chromosome and inhibiting translation of the mRNA to a protein; A method of artificially adding a sequence complementary to the SD sequence to the front of the SD sequence of the gene encoding the protein to form a secondary structure to render the attachment of the ribosome impossible and the use of an ORF (open reading frame) And a reverse transcription engineering (RTE) method in which a promoter is added to the 3 'end to reverse transcribe the recombinant yeast strain.
The recombinant yeast strain according to claim 1, wherein the yeast is saccharomycens cerevisiae .
The recombinant yeast strain according to claim 1, wherein the recombinant yeast strain is attenuated in activity of Mnn1 protein, Och1 protein, or both, compared with the intrinsic activity.
The recombinant yeast strain according to claim 1, wherein the recombinant yeast strain further comprises a gene encoding a glycoprotein.
(a) producing the glycoprotein by culturing a recombinant yeast strain in which the activity of the Mnn4 protein and the Mnn14 protein of SEQ ID NO: 1 is weaker than the intrinsic activity, comprising the gene encoding the recombinant glycoprotein; And
(b) recovering the glycoprotein produced in the step (a).

Images