WO2016166480A1 - Dérives utiles dans le traitement de l'atrophie musculaire - Google Patents
Dérives utiles dans le traitement de l'atrophie musculaire Download PDFInfo
- Publication number
- WO2016166480A1 WO2016166480A1 PCT/FR2016/050864 FR2016050864W WO2016166480A1 WO 2016166480 A1 WO2016166480 A1 WO 2016166480A1 FR 2016050864 W FR2016050864 W FR 2016050864W WO 2016166480 A1 WO2016166480 A1 WO 2016166480A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- group
- advantageously
- dichlorophenyl
- alkyl group
- ethoxyimino
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/13—Amines
- A61K31/15—Oximes (>C=N—O—); Hydrazines (>N—N<); Hydrazones (>N—N=) ; Imines (C—N=C)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/16—Amides, e.g. hydroxamic acids
- A61K31/165—Amides, e.g. hydroxamic acids having aromatic rings, e.g. colchicine, atenolol, progabide
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/185—Acids; Anhydrides, halides or salts thereof, e.g. sulfur acids, imidic, hydrazonic or hydroximic acids
- A61K31/19—Carboxylic acids, e.g. valproic acid
- A61K31/195—Carboxylic acids, e.g. valproic acid having an amino group
- A61K31/197—Carboxylic acids, e.g. valproic acid having an amino group the amino and the carboxyl groups being attached to the same acyclic carbon chain, e.g. gamma-aminobutyric acid [GABA], beta-alanine, epsilon-aminocaproic acid or pantothenic acid
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/21—Esters, e.g. nitroglycerine, selenocyanates
- A61K31/215—Esters, e.g. nitroglycerine, selenocyanates of carboxylic acids
- A61K31/216—Esters, e.g. nitroglycerine, selenocyanates of carboxylic acids of acids having aromatic rings, e.g. benactizyne, clofibrate
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
- A61K31/44—Non condensed pyridines; Hydrogenated derivatives thereof
- A61K31/4402—Non condensed pyridines; Hydrogenated derivatives thereof only substituted in position 2, e.g. pheniramine, bisacodyl
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
- A61K31/44—Non condensed pyridines; Hydrogenated derivatives thereof
- A61K31/4406—Non condensed pyridines; Hydrogenated derivatives thereof only substituted in position 3, e.g. zimeldine
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
- A61K31/50—Pyridazines; Hydrogenated pyridazines
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P21/00—Drugs for disorders of the muscular or neuromuscular system
Definitions
- the present invention relates to derivatives useful for the treatment of diseases related to muscle atrophy.
- a decrease in lean body mass is known to be associated with fatigue, decreased ability to perform the tasks required for daily living, increased risk of bone fractures, increased falls and hospitalizations, impaired metabolism (glucose tolerance, insulin sensitivity) and cognitive capacity as well as decreased quality of life (Frontera WR et al., 1991, Baumgartner et al., 1998, Lloyd BD et al., 2009). ). Unlike cachexia, patients with sarcopenia can have a stable weight, but show a clear loss of muscle mass, while typically at the same time the fat mass increases.
- Sarcopenia is therefore the result of an imbalance between the degradation of proteins and their synthesis, where the exact contribution of each of the factors mentioned above varies according to the model or case studied.
- Some proteolytic systems have been described as participating in muscle breakdown such as calcium-activated proteases such as calpain and caspases; the ubiquitin-proteasome system (Hasselgren PO et al., 2002, Purintrapiban J et al., 2003).
- atrogin-1 also known as MAFbx
- MURF-1 were found to be increased and Akt / mTOR / S6K decreased.
- Myostatin produced autocrine by the muscles themselves, is also a particularly important factor, as this protein acts both by stimulating proteolysis and by inhibiting proteosynthesis. While aging is accompanied by significant hormonal changes, there is an increased secretion of myostatin (Léger et al., 2008) whose expression in adult muscles increases with the degree of atrophy.
- Myostatin also known as growth and differentiation factor-8 (GDF-8) has all the structural features common to TGF- ⁇ family proteins: a hydrophobic amino-terminal that acts as a secretion signal, nine residues of invariant cysteine, and a furin-like proteolytic processing site "RXXR".
- Proteolytic cleavage of the protein results in a C-terminal domain that forms a homodimer that is the biologically active form of myostatin (Thies et al., 2001).
- Amino acid sequence alignments of myostatin from multiple vertebrate species show that the protein is highly conserved (100% identity) between humans, monkeys, cows, dogs, mice, rats, turkey and chicken (McPherron et al., 1997). Its expression is limited mainly to skeletal muscle and adipose tissue, where it plays the role of negative regulator of skeletal muscle development (Lee LS, 2010, 10: 183-194).
- Myostatin-deficient mice and cattle have been shown to exhibit a dramatic increase in skeletal muscle mass, supporting the role of myostatin in suppressing muscle growth (Wolfman et al., 2003).
- muscle hypertrophy is due to a missense mutation in the third exon of the bovine myostatin gene (Bass et al., 1999) which is accompanied by an increase in both the number of cells or hyperplastic growth, and cell size, or hypertrophic growth, resulting in larger and heavier myofibers.
- mice genetically deficient in myostatin have low body fat accumulation (McPherron et al., 2002) compared to wild-type mice of the same age, related to a reduction in adipocyte count and size, demonstrating thus the important role of myostatin in adipogenesis, and myogenesis.
- the present invention relates to derivatives and pharmaceutical compositions comprising them for use in the treatment and / or prevention of muscle atrophy in the mammal. Detailed description of the invention
- the present invention therefore relates to derivatives of the following general formula I:
- R 1 and R 2 represent, independently of one another, a hydrogen atom or a C 1 -C 6 alkyl group, advantageously methyl;
- R 3 represents
- a 0-group (C 3 -C 6 cycloalkyl), advantageously -O-cyclopentyl;
- a -O (C 3 -C 7 heterocyclic) group advantageously -O-tetrahydropyran-4-yl
- a -O-heteroaryl group advantageously -O-pyridyl
- a -O-aryl group advantageously -O-phenyl
- R 7 represents a hydrogen atom or a C 1 -C 6 alkyl group and R 8 represents
- a hydrogen atom a hydrogen atom
- a heteroaryl group advantageously containing one or more nitrogen atoms, in particular a pyridazinyl group or a pyridyl group;
- a C 1 -C 6 alkyl group advantageously an ethyl group, optionally substituted with a group -NR 9 R 10 in which R 9 and R 10 represent, independently of one another, a hydrogen atom or an alkyl group;
- Ci-C 6 advantageously a methyl group;
- a C 1 -C 6 alkyl group advantageously an ethyl group, optionally substituted with a group -OR 11 in which R 11 represents a hydrogen atom or a C 1 -C 6 alkyl group, advantageously a methyl group;
- R 7 and R 8 form with the nitrogen atom carrying them, a heterocycle, in particular a pyrrolidine, piperidine, morpholine, piperazine, heterocycle being optionally substituted with an alkyl group Ci-C 6, preferably a methyl group, in particular R 7 and R 8 form a methylpiperazinyl;
- R 4 represents a hydrogen atom or a C 1 -C 6 alkyl group, in particular -Me or -Et, more particularly -Et;
- R 5 and R 6 represent, independently of one another, a hydrogen, a halogen atom, advantageously Cl, or a group chosen from:
- alkyl C -C 6 alkyl preferably methyl, optionally substituted by one or more halogen atoms, preferably F, such as, for example -CF 3, a group -0 (cycloalkyl C 3 -C 6), preferably 0-cyclopropyl; or an enantiomer, diastereoisomer, hydrate, solvate, tautomer, racemic mixture or pharmaceutically acceptable salt thereof
- muscle atrophy is related to age and / or the consequences of drug therapy and / or immobilization and / or cachexia.
- muscle atrophy is age-related, such as pre-sarcopenia, sarcopenia, or severe sarcopenia.
- Muscle atrophy can also be related to the consequences of drug treatment, such as cancer treatment.
- Muscular atrophy may also be related to immobilization, in particular whatever the cause, for example due to age-related weakness, an accident or a surgical operation, such as a prosthesis of the knee or the hip.
- Muscular atrophy may be linked to cachexia, particularly for whatever cause, for example due to anorexia nervosa, cancer, heart failure, liver failure, kidney, tuberculosis or AIDS.
- the mammal may be an animal or man, advantageously it is man.
- the derivatives of formula (I) thus have an activity for the treatment and / or the prevention of muscular atrophy, in particular of age-related muscular atrophy such as pre-sarcopenia, sarcopenia , severe sarcopenia, and / or related to the consequences of drug treatment such as cancer treatment, and / or related to immobilization, in particular whatever the cause, for example the weakness related to age, an accident, a surgical operation such as the installation of a prosthesis of the knee or the hip, cachexia, and in general the pathologies related to muscular atrophy in the mammal.
- the derivatives of formula (I) are also useful for promoting the muscular growth of mammals, advantageously of the man, exercising and aiming at increasing the mass and the muscular quality, for example by preventing the appearance of sarcopenic symptoms related to age.
- the inventors have discovered that the derivatives according to the present invention make it possible to inhibit gene expression of myostatin, to increase protein synthesis in muscle cells and / or to increase the diameter of myotubes of C2C12 cells.
- the present invention further relates to the use of a derivative of formula (I) according to the invention as defined above for the manufacture of a medicament for the treatment and / or prevention of muscle atrophy in mammals and / or to limit muscular atrophy in mammals and / or to promote the muscular growth of exercising mammals to increase muscle mass and quality, thereby preventing the appearance of sarcopenic symptoms related to age or rehabilitation after muscle loss.
- It also relates to a method of treatment and / or prevention and / or prophylactic treatment and / or to delay the onset of muscle atrophy in mammals and / or to limit muscle atrophy in mammals and / or to promote the muscular increase of the mammals exercising and aiming to increase the mass and the muscular quality, in order to prevent the appearance of age-related sarcopenic symptoms or to re-educate following a muscle loss including the administration of an effective amount of a derivative of formula (I) according to the invention to a subject who needs it.
- the effective amount will be adapted according to the nature and severity of the pathology to be treated, the route of administration and also the weight and age of the subject.
- the dosage unit will vary between 0.5 mg and 2000 mg per day, in one or more doses, preferably between 1 and 1000 mg when the subject is a human.
- the derivatives of formula (I) useful in the context of the present invention are such that R 4 represents a - (C 1 -C 6 ) alkyl group, advantageously -At.
- the derivatives of formula (I) useful in the context of the present invention are such that the groups R 5 and / or R 6 represent a halogen atom, advantageously a chlorine atom.
- the derivatives of formula (I) useful in the context of the present invention are such that R 5 and R 6 represent, independently of one another, a halogen atom, advantageously Cl; particularly, R 5 and R 6 are chlorines, and R 4 represents a C 1 -C 6 alkyl group, in particular Et 2.
- the derivatives of formula (I) useful in the context of the present invention are such that R 1 and R 2 both represent a hydrogen atom.
- the derivatives of formula (I) useful in the context of the present invention are such that R 3 represents a -OH group or a -O (C 1 -C 6 alkyl) group, advantageously OE or -OiPr.
- aryl group means an aromatic ring having 5 to 8 carbon atoms or several fused aromatic rings having 5 to 14 carbon atoms.
- aryl groups can be groups monocyclic or bicyclic, preferably phenyl or naphthyl.
- it is a phenyl group (Ph).
- heteroaryl group is intended to mean any hydrocarbon aromatic group of 3 to 9 atoms containing one or more heteroatoms, in particular one or two, such as, for example, sulfur, nitrogen or oxygen atoms, in particular particularly one or more nitrogen atoms.
- the heteroaryl according to the present invention may consist of one or more fused rings. Examples of heteroaryl groups are furyl, isoxazyl, pyridyl, thiazolyl, pyrimidyl, pyridazinyl, benzimidazole, benzoxazole, benzothiazole, pyrazole.
- the heteroaryl group is chosen from pyridazinyl, pyrazole and pyridyl groups.
- halogen atom is understood to mean any halogen atom, advantageously chosen from Cl, Br, I or F, in particular chosen from F, Cl or Br, in particular F or Cl, plus particularly Cl.
- alkyl group CC 6 any alkyl group of 1 to 6 carbon atoms, linear or branched, in particular, methyl, ethyl, n-propyl, iso-propyl, n-butyl, iso-butyl, sec-butyl, t-butyl, n-pentyl, n-hexyl.
- methyl (Me), ethyl (Et), iso-propyl (iPr) or t-butyl (tBu) group in particular a methyl, ethyl or isopropyl group, more particularly a methyl or ethyl group.
- C 3 -C 6 cycloalkyl group means any saturated and hydrocarbon-based cycle comprising from 3 to 6 carbon atoms, in particular cyclopropyl, cyclobutyl, cyclopentyl or cyclohexyl.
- it is a cyclopentyl or cyclohexyl group.
- heterocyclic group means any saturated cyclic hydrocarbon group of 3 to 9 atoms containing one or more heteroatoms, such as, for example, sulfur, nitrogen or oxygen atoms, in particular atoms of nitrogen and oxygen, more particularly one or more nitrogen atoms.
- the heterocyclic group according to the present invention may consist of one or more fused rings.
- heterocyclic groups are the groups tetrahydrofuran, tetrahydropyran, pyrrolidine, piperazine, piperidine, thiolane, oxirane, oxane, thiane, thiazolidine, morpholine.
- the heterocyclic group is chosen from tetrahydropyran, piperidine, pyrrolidine, piperazine and morpholine groups.
- the term "pharmaceutically acceptable” is meant to be useful in the preparation of a pharmaceutical composition which is generally safe, non-toxic, and neither biologically nor otherwise undesirable and which is acceptable for veterinary use as well. than human pharmaceutical.
- salts of a compound means salts which are pharmaceutically acceptable, as defined herein, and which possess the desired pharmacological activity of the parent compound.
- Such salts include:
- organic bases include diethanolamine, ethanolamine, N-methylglucamine, triethanolamine, tromethamine and the like.
- organic bases acceptable include aluminum hydroxide, calcium hydroxide, potassium hydroxide, sodium carbonate and sodium hydroxide.
- solvate of a compound is understood to mean any compound obtained by adding an inert solvent molecule to the compound according to the invention, the solvate being formed because of their attractive force. mutual.
- the solvates are, for example, alcoholates of the compound.
- a hydrate is a solvate in which the inert solvent used is water. It can be mono, di or trihydrate.
- tautomer is intended to mean any constituent isomer of the compounds according to the present invention which are interconvertible by the reversible chemical reaction known as tautomerization.
- the reaction occurs by migration of a hydrogen atom accompanied by a change of localization of a double bond.
- a solution of a compound capable of tautomerization an equilibrium between the two tautomers is created.
- the ratio of tautomers is then a function of the solvent, the temperature and the pH.
- the tautomerism is therefore the transformation of one functional group into another, most often by concomitant displacement of a hydrogen atom and a ⁇ bond (double or triple bond).
- Common tautomers are, for example, aldehyde / ketone-alcohol pairs or more precisely enol pairs; amides - imidic acids; lactams - lakes; imines - enamines; enamines - enamines.
- it may include a cycle-chain tautomerism that occurs when proton motion is accompanied by the transformation of an open structure to a cycle.
- the derivatives according to the invention can be administered in the form of a pharmaceutical composition comprising a pharmaceutically acceptable excipient.
- compositions can be formulated for administration to mammals, including humans.
- the dosage varies according to the treatment and the condition in question.
- These pharmaceutical compositions are suitable for administration by any suitable route, for example orally (including oral and sublingual), rectally, nasally, topically (including transdermal), vaginal, intraocular or parenteral (including subcutaneous). intramuscular or intravenous).
- pharmaceutical compositions are suitable for oral administration.
- These formulations may be prepared using any of the methods known to those skilled in the art by combining the active ingredients with the appropriate pharmaceutically acceptable excipients.
- the unit forms of orally appropriate administrations include tablets, capsules, powders, granules and oral solutions or suspensions in aqueous or non-aqueous liquids, edible or edible foams, or liquid water-in-water emulsions. oil or oil-in-water.
- a solid composition in tablet form is prepared, the main active ingredient, advantageously in powder form, is mixed with a suitable pharmaceutical excipient such as gelatin, starch, lactose, magnesium stearate, talc, gum arabic or the like.
- the tablets can be coated with sucrose or other suitable materials or they can be treated in such a way that they have prolonged or delayed activity and continuously release a predetermined amount of active ingredient.
- a preparation in capsules is obtained by mixing the active ingredient, advantageously in powder form, with a diluent and pouring the resulting mixture into soft or hard capsules, in particular gelatin capsules.
- Lubricants such as, for example, talc, magnesium stearate, calcium stearate or polyethylene glycol in solid form can be added to the composition before it is filled into capsules.
- a disintegrant or a solubilizer such as for example calcium carbonate or sodium carbonate may also be added to improve the availability of the drug after taking the capsule.
- Suitable binders may be for example starch, gelatin, natural sugars such as for example glucose or beta-lactose, sweetening agents made from corn, synthetic or natural rubber such as acacia for example or sodium alginate, carboxymethylcellulose, polyethylene glycol, waxes and the like.
- Lubricants useful in these dosage forms include sodium oleate, sodium stearate, magnesium stearate, sodium benzoate, sodium acetate, sodium chloride and the like.
- Disintegrants include starch, methylcellulose, agar, bentonite, xanthan gum and the like.
- the tablets are formulated for example by preparing a powder mixture, granulating or dry pressing the mixture, adding a lubricant and a disintegrant and pressing the mixture to give the tablets.
- a powder mixture is prepared by mixing the active ingredient suitably added with a diluent or a base and optionally with a binder such as, for example, carboxymethylcellulose, alginate, gelatin or polyvinylpyrrolidone, a dissolution retarder such as paraffin, an absorption accelerator such as, for example, a quaternary salt and / or an absorbent such as, for example, bentonite, kaolin or dicalcium phosphate.
- a binder such as, for example, carboxymethylcellulose, alginate, gelatin or polyvinylpyrrolidone
- a dissolution retarder such as paraffin
- an absorption accelerator such as, for example, a quaternary salt and / or an absorbent such as, for example, bentonite, kaolin or di
- the powder mixtures can be granulated by wetting with a binder such as for example a syrup, a starch paste, acacia mucilage or solutions of cellulose or polymeric materials and squeezing through a sieve.
- a binder such as for example a syrup, a starch paste, acacia mucilage or solutions of cellulose or polymeric materials and squeezing through a sieve.
- the granules may be lubricated by the addition of stearic acid, stearate salt, talc or mineral oil so as to prevent them from sticking to the molds for making the tablets.
- the lubricated mixture is then pressed to give the tablets.
- An opaque or transparent protective layer consisting of a shellac layer, a layer of sugar or polymeric materials is optionally present. Dyes may be added to these coatings to differentiate them from other tablets.
- a syrup or elixir preparation may contain the active ingredient together with a sweetener, an antiseptic, as well as a flavoring agent and a suitable colorant.
- the syrup preparations are obtained by dissolving the compound in an aqueous solution with an agent giving appropriate taste while the elixirs are prepared using a nontoxic alcoholic vehicle.
- the water-dispersible powders or granules may contain the active ingredient in admixture with dispersing agents or wetting agents, or suspending agents, such as for example ethoxylated isostearyl alcohols and polyoxyethylene sorbitol ethers. , and with taste correctors or sweeteners.
- dispersing agents or wetting agents such as for example ethoxylated isostearyl alcohols and polyoxyethylene sorbitol ethers.
- suspending agents such as for example ethoxylated isostearyl alcohols and polyoxyethylene sorbitol ethers.
- taste correctors or sweeteners such as for example ethoxylated isostearyl alcohols and polyoxyethylene sorbitol ethers.
- sweeteners such as for example ethoxylated isostearyl alcohols and polyoxyethylene sorbitol ethers.
- suppositories are used which are prepared with binders melting at the rectal
- aqueous suspensions for parenteral, intranasal or intraocular administration, aqueous suspensions, isotonic saline solutions or sterile and injectable solutions containing dispersing agents and / or pharmacologically compatible wetting agents are used.
- the active ingredient may also be formulated as microcapsules, optionally with one or more additive carriers.
- compositions adapted for topical administration may be formulated as a cream, ointment, suspension, lotion, powder, solution, paste, gel, spray, aerosol or oil. .
- compositions adapted for nasal administration in which the carrier vehicle is in a solid state include powders having particle sizes, for example in the range of 20 to 500 microns, administered by inhalation from a carrier. container containing the powder arranged near the nose.
- compositions adapted for vaginal administration can be administered in the form of a buffer, cream, gel, paste, foam or spray.
- the pharmaceutical composition according to the present invention further comprises another active agent, advantageously having a complementary or synergistic effect.
- This second active agent can be administered in the same pharmaceutical composition as the derivative of formula (I) of the present invention. It can also be administered separately, either at the same time or over time.
- FIG. 1 represents the visualization of muscle fiber diameter (in ⁇ ) in the presence of the vehicle (control: Ctrl), of compound 1 at a concentration of 10 ⁇ , of dexamethasone (DEX) at a concentration of 10 ⁇ , and of IGF1 at a concentration of 10 ng / ml.
- C2C12 myoblastic cells (ATCC CRL-1772) are seeded in 24-well plates at the density of 30,000 cells per well and cultured in DMEM medium (Dulbecco's Modified Eagle Medium) containing glucose at 4.5 g / L and supplemented with fetal calf serum (10%) and antibiotics (penicillin and streptomycin). Forty-eight hours later, the myoblasts are differentially induced by partial deprivation in serum (2% instead of 10%) for 5 days.
- DMEM medium Dulbecco's Modified Eagle Medium
- DMEM glucose-depleted medium
- IGF-1 test molecules or references
- mRNAs messenger RNAs
- the cells are lysed in a solution of trizol (Sigma T9424) containing a strong acid and phenol.
- MRNAs are separated from the proteins by adding chloroform and centrifugation. They are then precipitated in isopropanol and then suspended at the concentration of 1 g / ml in an ultra pure water freed of the Nases and DNAses.
- the mRNA is then converted by reverse transcription into complementary DNA by the AMV enzyme in the presence of a primer and a mixture of nucleotides according to the protocol given by the supplier (Applied Biosystems 4368814).
- Gene expression is investigated by a polymerase enzyme-initiated chain reaction and commonly termed PCR under quantitative conditions, hence the precise name of qPCR.
- the qPCRs are performed on a 7900HT Fast Real-Time PCR Detection System (Applied Biosystems).
- the programming conditions are standard and consist of 1 cycle at 95 ° C for 15 min, followed by 40 cycles at 95 ° C for 15 s and 60 ° C for 1 min and ended with a melt curve step of 60 ° C and 95 ° C.
- the analyzed samples all contain 100 ng of cDNA, a qPCR buffer including the enzyme, the oligonucleotide mixture and the intercalant (sybergreen), and the pair of specific primers of the studied gene, strategically chosen between two sequences. exonates and at the final concentration of 200 nM.
- Fluorescent probes bind to the double-stranded DNA and fluoresce only once attached to the DNA.
- a fluorescence threshold is established by the program of the machine. When the amount of DNA allows the fluorescent probe to exceed this threshold, a PCR cycle number called "Ct" is obtained for "Cycle Threshold” or threshold cycle. It is this value that underlies the calculations to quantify the DNA relatively.
- the primers used are recorded in the following table:
- Atrogine ind GTGAGGCCTTTGAAGGCAG 19 60 human: NM 058229 beta-actin d CTCTAGACTTCGAGCAGGAG 20 62
- mice X03672 beta-actin ind GGTACCACCAGAGACTACT 19 60
- the cells are counted and inoculated at a density of 20000 cells per well in a 24-well plate in a DMEM medium containing glucose at 4.5 g / L and supplemented with fetal calf serum (10%) and antibiotics (penicillin and streptomycin). Forty-eight hours later, the myoblasts are differentially induced by partial deprivation in serum (2% instead of 10%) for 5 days. The cells are then placed in medium without glucose or leucine (Krebs medium) for 1 hour at 37 ° C. and then incubated for 2 hours 30 min in the presence of the products to be tested or reference (IGF-1, 100 ng / ml) in serum free DM EM medium.
- Krebs medium medium without glucose or leucine
- IGF-1 100 ng / ml
- the C2C12 myoblastic cells (ATCC C L-1772) were seeded into glycerol-treated 8-well plates at a density of 10,000 cells per well and cultured in a DMEM medium containing glucose at 4.5 g / L and supplemented. in fetal calf serum (10%) and in antibiotics (penicillin and streptomycin).
- the myoblasts are differentially induced by partial deprivation in serum (2% instead of 10%) for 3 days.
- the cells are then placed in glucose-depleted medium (DM EM containing 1 g / L of glucose) and devoid of serum in the presence of the test molecules or references (IGF-1 at a concentration of 10 ng / mL or dexamethasone 10 ⁇ M) for 3 days.
- DM EM glucose-depleted medium
- IGF-1 at a concentration of 10 ng / mL or dexamethasone 10 ⁇ M
- the cells are rinsed and fixed with 2.5% Glutaraldehyde / 0.1% Triton solution for 1 h at room temperature.
- the cell layer is covered with DAPI (fluorescent labeling of the cell nucleus). After storage in the dark for 16h in the cold, the slides are observed under a fluorescence microscope (Cari Zeiss, AxioVert 200) and the images analyzed using the Axio
- results are expressed as a percentage of myostatin gene expression in cells in contact with the molecules related to expression in the control cells.
- the product is assumed to be active if this ratio is less than or close to 70%, the average value of IGF-1 found at the concentration of 100 ng / mL in this test, considered as reference.
- Compounds 1 and 3 significantly inhibit the expression of myostatin.
- results are expressed as a percentage increase in S6K phosphorylation in muscle cells. This percentage is considered significant when it is greater than 120%, the average value of IGF-1 at the concentration of 100 ng / mL in this test, considered as a reference.
- Compound 1 significantly increases protein synthesis in muscle cells at a concentration of 0.5 ⁇ .
- C2C12 cells are differentiated and treated with compound 1 for the last three days of differentiation. The results are shown in Figure 1.
Landscapes
- Health & Medical Sciences (AREA)
- Pharmacology & Pharmacy (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- General Health & Medical Sciences (AREA)
- Animal Behavior & Ethology (AREA)
- Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Epidemiology (AREA)
- Emergency Medicine (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Physical Education & Sports Medicine (AREA)
- General Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Neurology (AREA)
- Orthopedic Medicine & Surgery (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)
- Pyridine Compounds (AREA)
- Organic Low-Molecular-Weight Compounds And Preparation Thereof (AREA)
Priority Applications (10)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| RU2017139915A RU2715553C2 (ru) | 2015-04-16 | 2016-04-14 | Производные, применяемые для лечения мышечной атрофии |
| ES16729310T ES2741012T3 (es) | 2015-04-16 | 2016-04-14 | Derivados utilizados en el tratamiento de atrofia muscular |
| KR1020177033178A KR20170137201A (ko) | 2015-04-16 | 2016-04-14 | 근육 위축 치료에 사용되는 유도체 |
| US15/566,955 US10350184B2 (en) | 2015-04-16 | 2016-04-14 | Derivatives used in the treatment of muscle atrophy |
| PL16729310T PL3283064T3 (pl) | 2015-04-16 | 2016-04-14 | Pochodne do zastosowania w atrofii mięśni |
| CA2988625A CA2988625A1 (en) | 2015-04-16 | 2016-04-14 | (3,4-dichlorophenyl)-4- alkylimino compounds useful in the treatment of muscle atrophy and sarcopenia |
| CN201680034525.4A CN107735082B (zh) | 2015-04-16 | 2016-04-14 | 用于治疗肌肉萎缩的衍生物 |
| EP16729310.9A EP3283064B1 (fr) | 2015-04-16 | 2016-04-14 | Dérives utiles dans le traitement de l'atrophie musculaire |
| JP2017554365A JP6669774B2 (ja) | 2015-04-16 | 2016-04-14 | 筋萎縮の治療に有用な誘導体 |
| DK16729310.9T DK3283064T3 (da) | 2015-04-16 | 2016-04-14 | Derivater til anvendelse i behandling af muskelatrofi |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| FR1553410 | 2015-04-16 | ||
| FR1553410A FR3035105A1 (fr) | 2015-04-16 | 2015-04-16 | Derives utiles dans le traitement de l'atrophie musculaire |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2016166480A1 true WO2016166480A1 (fr) | 2016-10-20 |
Family
ID=53758355
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/FR2016/050864 Ceased WO2016166480A1 (fr) | 2015-04-16 | 2016-04-14 | Dérives utiles dans le traitement de l'atrophie musculaire |
Country Status (13)
| Country | Link |
|---|---|
| US (1) | US10350184B2 (cg-RX-API-DMAC7.html) |
| EP (1) | EP3283064B1 (cg-RX-API-DMAC7.html) |
| JP (1) | JP6669774B2 (cg-RX-API-DMAC7.html) |
| KR (1) | KR20170137201A (cg-RX-API-DMAC7.html) |
| CN (1) | CN107735082B (cg-RX-API-DMAC7.html) |
| CA (1) | CA2988625A1 (cg-RX-API-DMAC7.html) |
| DK (1) | DK3283064T3 (cg-RX-API-DMAC7.html) |
| ES (1) | ES2741012T3 (cg-RX-API-DMAC7.html) |
| FR (1) | FR3035105A1 (cg-RX-API-DMAC7.html) |
| PL (1) | PL3283064T3 (cg-RX-API-DMAC7.html) |
| PT (1) | PT3283064T (cg-RX-API-DMAC7.html) |
| RU (1) | RU2715553C2 (cg-RX-API-DMAC7.html) |
| WO (1) | WO2016166480A1 (cg-RX-API-DMAC7.html) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| FR3078252A1 (fr) * | 2018-02-28 | 2019-08-30 | Biophytis | Phytoecdysones pour leur utilisation dans la prevention de la perte de force musculaire lors d’une immobilisation |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| FR3055548B1 (fr) * | 2016-09-05 | 2018-09-28 | Metabrain Research | Utilisation de metabolites du tryptophane dans le traitement de l'atrophie musculaire |
| CN111253246B (zh) * | 2020-03-16 | 2023-03-17 | 中国医学科学院基础医学研究所 | 酰基酸类衍生物及其制备方法和医药用途 |
| CN114533731B (zh) * | 2022-02-25 | 2024-06-04 | 上海大学 | 一种氨基吡啶衍生物在制备肌肉萎缩抑制剂中的应用 |
| CN117205215B (zh) * | 2023-11-08 | 2024-01-26 | 广州喜鹊医药有限公司 | 川芎嗪硝酮衍生物在制备预防或治疗肌少症药物中的应用 |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| FR2204406A1 (en) * | 1972-10-26 | 1974-05-24 | Delalande Sa | 1-Phenyl-3-aminocarbonylpropan-1-one oxime carbamates - with analgesic, antiinflammatory, hypotensive and sedative activities etc. |
| WO1998009940A1 (en) * | 1996-09-04 | 1998-03-12 | Warner-Lambert Company | Biphenyl butyric acids and their derivatives as inhibitors of matrix metalloproteinases |
| US20020161050A1 (en) * | 1999-07-12 | 2002-10-31 | Warner-Lambert Company | Benzene butyric acids and their derivatives as inhibitors of matrix metalloproteinases |
| WO2010011302A1 (en) | 2008-07-22 | 2010-01-28 | Chdi, Inc. | Certain kynurenine-3-monooxygenase inhibitors, pharmaceutical compositions, and methods of use thereof |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AU783393B2 (en) * | 2000-03-20 | 2005-10-20 | N-Gene Research Laboratories Inc. | Propenecarboxylic acid amidoxime derivatives, a process for the preparation thereof, and pharmaceutical compositions containing the same |
| EP1945632B1 (en) * | 2005-11-08 | 2013-09-18 | Vertex Pharmaceuticals Incorporated | Heterocyclic modulators of atp-binding cassette transporters |
| WO2017044551A1 (en) * | 2015-09-11 | 2017-03-16 | Mitobridge, Inc. | Ppar-alpha agonists for treating mitochondrial diseases |
-
2015
- 2015-04-16 FR FR1553410A patent/FR3035105A1/fr not_active Ceased
-
2016
- 2016-04-14 RU RU2017139915A patent/RU2715553C2/ru active
- 2016-04-14 PL PL16729310T patent/PL3283064T3/pl unknown
- 2016-04-14 CA CA2988625A patent/CA2988625A1/en active Pending
- 2016-04-14 US US15/566,955 patent/US10350184B2/en active Active
- 2016-04-14 CN CN201680034525.4A patent/CN107735082B/zh active Active
- 2016-04-14 KR KR1020177033178A patent/KR20170137201A/ko not_active Abandoned
- 2016-04-14 DK DK16729310.9T patent/DK3283064T3/da active
- 2016-04-14 PT PT16729310T patent/PT3283064T/pt unknown
- 2016-04-14 WO PCT/FR2016/050864 patent/WO2016166480A1/fr not_active Ceased
- 2016-04-14 ES ES16729310T patent/ES2741012T3/es active Active
- 2016-04-14 JP JP2017554365A patent/JP6669774B2/ja active Active
- 2016-04-14 EP EP16729310.9A patent/EP3283064B1/fr active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| FR2204406A1 (en) * | 1972-10-26 | 1974-05-24 | Delalande Sa | 1-Phenyl-3-aminocarbonylpropan-1-one oxime carbamates - with analgesic, antiinflammatory, hypotensive and sedative activities etc. |
| WO1998009940A1 (en) * | 1996-09-04 | 1998-03-12 | Warner-Lambert Company | Biphenyl butyric acids and their derivatives as inhibitors of matrix metalloproteinases |
| US20020161050A1 (en) * | 1999-07-12 | 2002-10-31 | Warner-Lambert Company | Benzene butyric acids and their derivatives as inhibitors of matrix metalloproteinases |
| WO2010011302A1 (en) | 2008-07-22 | 2010-01-28 | Chdi, Inc. | Certain kynurenine-3-monooxygenase inhibitors, pharmaceutical compositions, and methods of use thereof |
Non-Patent Citations (15)
| Title |
|---|
| CHAI RJ ET AL., PLOS ONE, vol. 6, 2011, pages E28090 |
| FARNFIELD MM ET AL., APPL PHYSIOL NUTR METAB, vol. 37, 2012, pages 21 - 30 |
| FRONTERA W R ET AL., JOURNAL OF APPLIED PHYSIOLOGY, vol. 71, no. 2, 1991, pages 644 - 50 |
| HASSELGREN PO ET AL., BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS, vol. 290, no. 1, 2002, pages 1 - 10 |
| LEE SJ, IMMUNOL ENDOCR METAB AGENTS MED CHEM., vol. 10, 2010, pages 183 - 194 |
| LÉGER B ET AL., REJUVENATION RES, vol. 11, no. 1, 2008, pages 163 - 175 |
| LI ZB ET AL., J. BIOL. CHEM., vol. 283, no. 28, 2008, pages 19371 - 19378 |
| LLOYD BD ET AL., J GERONTOL A BIOL SCI MED SCI., vol. 4, no. 5, 6 May 2009 (2009-05-06), pages 599 - 609 |
| MCPHERRON AC ET AL., J CLIN INVEST., vol. 109, 2002, pages 595 - 601 |
| MCPHERRON AC ET AL., PROC. NATL. ACAD. SCI. USA, vol. 94, 1997, pages 12457 - 12461 |
| MORLEY J E ET AL., CURRENT PHARMACEUTICAL DESIGN, vol. 13, no. 35, 2007, pages 3637 - 3647 |
| O'NEILL ED ET AL., AGE (DORDR, vol. 32, 2010, pages 209 - 22 |
| PURINTRAPIBAN J ET AL., COMPARATIVE BIOCHEMISTRY AND PHYSIOLOGY B-BIOCHEMISTRY & MOLECULAR BIOLOGY, vol. 136, no. 3, 2003, pages 393 - 401 |
| THIES RS ET AL., GROWTH FACT., vol. 18, 2001, pages 251 - 259 |
| WOLFMAN NM ET AL., PROC. NATL. ACAD. SCI. USA, vol. 100, 2003, pages 15842 - 15846 |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| FR3078252A1 (fr) * | 2018-02-28 | 2019-08-30 | Biophytis | Phytoecdysones pour leur utilisation dans la prevention de la perte de force musculaire lors d’une immobilisation |
| WO2019166717A1 (fr) * | 2018-02-28 | 2019-09-06 | Biophytis | Phytoecdysones pour leur utilisation dans la prévention de la perte de force musculaire lors d'une immobilisation |
| JP2021516228A (ja) * | 2018-02-28 | 2021-07-01 | ビオフィティス | 固定中の筋力低下の防止に使用する植物エクジソン |
| JP7386798B2 (ja) | 2018-02-28 | 2023-11-27 | ビオフィティス | 固定中の筋力低下の防止に使用する植物エクジソン |
Also Published As
| Publication number | Publication date |
|---|---|
| US20180303780A1 (en) | 2018-10-25 |
| CN107735082B (zh) | 2021-07-27 |
| PL3283064T3 (pl) | 2019-12-31 |
| CN107735082A (zh) | 2018-02-23 |
| RU2017139915A (ru) | 2019-05-17 |
| CA2988625A1 (en) | 2016-10-20 |
| EP3283064B1 (fr) | 2019-05-08 |
| RU2715553C2 (ru) | 2020-03-02 |
| DK3283064T3 (da) | 2019-08-12 |
| FR3035105A1 (fr) | 2016-10-21 |
| RU2017139915A3 (cg-RX-API-DMAC7.html) | 2019-06-06 |
| JP6669774B2 (ja) | 2020-03-25 |
| PT3283064T (pt) | 2019-08-21 |
| JP2018513162A (ja) | 2018-05-24 |
| ES2741012T3 (es) | 2020-02-07 |
| KR20170137201A (ko) | 2017-12-12 |
| EP3283064A1 (fr) | 2018-02-21 |
| US10350184B2 (en) | 2019-07-16 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP3283064B1 (fr) | Dérives utiles dans le traitement de l'atrophie musculaire | |
| EP3145942B1 (fr) | Composés chimiques et leur utilisation pour l'amélioration de la qualité musculaire | |
| EP3615035B1 (fr) | Utilisation de 20-hydroxyecdysone et ses dérivés dans le traitement des myopathies | |
| MXPA04010170A (es) | Medicamento para prevenir y/o tratar el rechazo cronico. | |
| CN1947717A (zh) | 治疗神经和非神经痛的方法 | |
| EP3506901B1 (fr) | Utilisation de l'acide kynurénique dans le traitement de l'atrophie musculaire | |
| EP4684781A1 (en) | Use of small-molecule compound having naphthylamine structure | |
| EP0060179A1 (fr) | Compositions pharmaceutiques à action anorexigène | |
| CA3005527C (fr) | Mirabegron pour le traitement de maladies retiniennes | |
| EP1017385B1 (fr) | Utilisation de tetrahydropyridines 4-substituees pour fabriquer des medicaments agissant sur le tgf-beta1 | |
| FR3069434A1 (fr) | Acide anthranilique dans le traitement de l'atrophie musculaire | |
| EP3353165B1 (fr) | 1,4-di-(4-methylthiophenyl)-3-phtaloylazetidine-2-one et ses derives | |
| WO1999040911A1 (fr) | Utilisation de composes selenies dans la prevention et le traitement de la maladie d'alzheimer | |
| AU2007209704A1 (en) | Novel salts of substituted 5-membered azacycle and use thereof in the treatment of diseases related to protein aging | |
| RU2806346C2 (ru) | Использование метаболитов триптофана для лечения мышечной атрофии | |
| JP2014506868A (ja) | フラボノイド配糖体による神経発生の刺激 | |
| EP3634957A1 (fr) | Modulateurs de recepteurs nmda, compositions les comprenant et utilisation de ces composés dans le traitement de maladies impliquant le systeme nerveux central | |
| Pérez-Castillo et al. | Skeletal muscle memory | |
| FR2460671A1 (fr) | Nouvelles compositions pharmaceutiques a base d'un derive de l'indole et d'une benzodiazepine | |
| HK1238578A1 (en) | Methods of inhibiting muscle atrophy | |
| WO2009044006A2 (fr) | L'acide 5-(4-chlorophenyl)-1-(2,4-dichlorophenyl)-4-methylpyrazole-3-carboxylique, ses esters, ses sels pharmaceutiquement acceptables et leurs solvates pour leur utilisation comme medicament | |
| HK40011096B (zh) | 使用色氨酸代谢物治疗肌肉萎缩 | |
| WO2001047468A2 (fr) | Association de deoxyfructosazine et d'un antidiabetique inhibiteur d'alpha-glucosidase |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 16729310 Country of ref document: EP Kind code of ref document: A1 |
|
| ENP | Entry into the national phase |
Ref document number: 2017554365 Country of ref document: JP Kind code of ref document: A |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 20177033178 Country of ref document: KR Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2017139915 Country of ref document: RU |
|
| ENP | Entry into the national phase |
Ref document number: 2988625 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 15566955 Country of ref document: US |