WO2016145298A1 - METHODS FOR TREATING CANCER WITH RORgamma INHIBITORS - Google Patents

METHODS FOR TREATING CANCER WITH RORgamma INHIBITORS Download PDF

Info

Publication number
WO2016145298A1
WO2016145298A1 PCT/US2016/021983 US2016021983W WO2016145298A1 WO 2016145298 A1 WO2016145298 A1 WO 2016145298A1 US 2016021983 W US2016021983 W US 2016021983W WO 2016145298 A1 WO2016145298 A1 WO 2016145298A1
Authority
WO
WIPO (PCT)
Prior art keywords
cancer
rory
cells
resistant
androgen
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2016/021983
Other languages
English (en)
French (fr)
Inventor
Hongwu CHEN
June X. Zou
Junjian WANG
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of California Berkeley
University of California San Diego UCSD
Original Assignee
University of California Berkeley
University of California San Diego UCSD
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University of California Berkeley, University of California San Diego UCSD filed Critical University of California Berkeley
Priority to JP2017547968A priority Critical patent/JP2018513123A/ja
Priority to CN201680027763.2A priority patent/CN107614062A/zh
Priority to EP16762587.0A priority patent/EP3268087A4/en
Priority to HK18109103.5A priority patent/HK1249469A1/zh
Publication of WO2016145298A1 publication Critical patent/WO2016145298A1/en
Priority to US15/701,122 priority patent/US10959984B2/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/40Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with one nitrogen as the only ring hetero atom, e.g. sulpiride, succinimide, tolmetin, buflomedil
    • A61K31/403Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with one nitrogen as the only ring hetero atom, e.g. sulpiride, succinimide, tolmetin, buflomedil condensed with carbocyclic rings, e.g. carbazole
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/16Amides, e.g. hydroxamic acids
    • A61K31/18Sulfonamides
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/185Acids; Anhydrides, halides or salts thereof, e.g. sulfur acids, imidic, hydrazonic or hydroximic acids
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/41Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
    • A61K31/41641,3-Diazoles
    • A61K31/41661,3-Diazoles having oxo groups directly attached to the heterocyclic ring, e.g. phenytoin
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/47Quinolines; Isoquinolines
    • A61K31/472Non-condensed isoquinolines, e.g. papaverine
    • A61K31/4725Non-condensed isoquinolines, e.g. papaverine containing further heterocyclic rings
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/496Non-condensed piperazines containing further heterocyclic rings, e.g. rifampin, thiothixene or sparfloxacin
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/655Azo (—N=N—), diazo (=N2), azoxy (>N—O—N< or N(=O)—N<), azido (—N3) or diazoamino (—N=N—N<) compounds
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • A61K31/713Double-stranded nucleic acids or oligonucleotides
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00Drugs for disorders of the alimentary tract or the digestive system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/16Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00Drugs for disorders of the respiratory system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P13/00Drugs for disorders of the urinary system
    • A61P13/08Drugs for disorders of the urinary system of the prostate
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P13/00Drugs for disorders of the urinary system
    • A61P13/10Drugs for disorders of the urinary system of the bladder
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P15/00Drugs for genital or sexual disorders; Contraceptives
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • A61P37/02Immunomodulators
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P5/00Drugs for disorders of the endocrine system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P5/00Drugs for disorders of the endocrine system
    • A61P5/24Drugs for disorders of the endocrine system of the sex hormones
    • A61P5/28Antiandrogens
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P7/00Drugs for disorders of the blood or the extracellular fluid
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D209/00Heterocyclic compounds containing five-membered rings, condensed with other rings, with one nitrogen atom as the only ring hetero atom
    • C07D209/56Ring systems containing three or more rings
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D401/00Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom
    • C07D401/02Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing two hetero rings
    • C07D401/12Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing two hetero rings linked by a chain containing hetero atoms as chain links
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D403/00Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, not provided for by group C07D401/00
    • C07D403/02Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, not provided for by group C07D401/00 containing two hetero rings
    • C07D403/12Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, not provided for by group C07D401/00 containing two hetero rings linked by a chain containing hetero atoms as chain links
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D405/00Heterocyclic compounds containing both one or more hetero rings having oxygen atoms as the only ring hetero atoms, and one or more rings having nitrogen as the only ring hetero atom
    • C07D405/02Heterocyclic compounds containing both one or more hetero rings having oxygen atoms as the only ring hetero atoms, and one or more rings having nitrogen as the only ring hetero atom containing two hetero rings
    • C07D405/12Heterocyclic compounds containing both one or more hetero rings having oxygen atoms as the only ring hetero atoms, and one or more rings having nitrogen as the only ring hetero atom containing two hetero rings linked by a chain containing hetero atoms as chain links
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D419/00Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen, oxygen, and sulfur atoms as the only ring hetero atoms
    • C07D419/02Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen, oxygen, and sulfur atoms as the only ring hetero atoms containing two hetero rings
    • C07D419/12Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen, oxygen, and sulfur atoms as the only ring hetero atoms containing two hetero rings linked by a chain containing hetero atoms as chain links
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70567Nuclear receptors, e.g. retinoic acid receptor [RAR], RXR, nuclear orphan receptors
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1138Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against receptors or cell surface proteins
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/14Type of nucleic acid interfering nucleic acids [NA]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00Applications; Uses
    • C12N2320/30Special therapeutic applications
    • C12N2320/31Combination therapy

Definitions

  • Cancer is a leading cause of death in the United States, and despite the development of various different treatment methods such as chemotherapy, radiation therapy, and hormone deprivation therapy, there is no 100% effective cure to these diseases.
  • One of the reasons current cancer treatment methods do not result in eradication of the cancerous tissue in afflicted individuals is through the development of drug resistance by the cancerous cells. Patients who exhibit drug resistance to a particular cancer drug will have tumors that no longer react to the drug and can continue growing despite continued treatment.
  • drug resistance can be a common outcome during the course of administering a particular cancer therapy, it is important to continue developing new drugs and to identify new targets to treat cancer.
  • PCa metastatic castration-resistant prostate cancers
  • mCRPCs metastatic castration-resistant prostate cancers
  • the most effective therapeutics such as enzalutamide and abiraterone give only a few months of overall survival benefit in a subgroup of the PCa patients.
  • the present invention provides a method for treating cancer in a subject, the method comprising administering to the subject an effective amount of a retinoic acid receptor-related orphan receptor ⁇ (RORy) inhibitor.
  • RORy retinoic acid receptor-related orphan receptor ⁇
  • the cancer is resistant to an anticancer drug.
  • anticancer drugs include anti-androgen drugs, chemotherapeutic agents, radiotherapeutic agents, antigen-specific immunotherapeutic agents, endocrine therapies, tyrosine kinase inhibitors, and combinations thereof.
  • the anti-androgen drug is selected from the group consisting of enzalutamide, bicalutamide, arbiraterone, nilutamide, flutamide, apalutamide, finasteride, dutasteride, alfatradiol, and combinations thereof.
  • the chemotherapeutic agent is tamoxifen, a taxane (e.g., paclitaxel and/or docetaxel), or combinations thereof.
  • the cancer is selected from the group consisting of a prostate cancer, lung cancer, breast cancer, liver cancer, ovarian cancer, endometrial cancer, bladder cancer, colon cancer, lymphoma, and glioma.
  • the prostate cancer is a castration-resistant prostate cancer.
  • the castration-resistant prostate cancer is resistant to an anticancer drug such as, e.g., an anti-androgen drug and/or a taxane.
  • the anti- androgen drug is selected from the group consisting of enzalutamide, bicalutamide, arbiraterone, nilutamide, flutamide, apalutamide, finasteride, dutasteride, alfatradiol, and combinations thereof.
  • the taxane is selected from the group consisting of paclitaxel, docetaxel, and combinations thereof.
  • the lung cancer is a non-small-cell lung cancer (NSCLC), K- Ras mutant lung cancer, BRAF mutant lung cancer, EGFR mutant lung cancer, tyrosine kinase inhibitor-resistant lung cancer, or small cell lung cancer (SCLC).
  • NSCLC non-small-cell lung cancer
  • K- Ras mutant lung cancer BRAF mutant lung cancer
  • EGFR mutant lung cancer tyrosine kinase inhibitor-resistant lung cancer
  • SCLC small cell lung cancer
  • the breast cancer is a triple-negative breast cancer (TNBC), tamoxifen -resistant breast cancer, radiation-resistant breast cancer, HER2-positive breast cancer, or ER-positive breast cancer.
  • the RORy inhibitor is a small molecule compound. Non- limiting examples of small molecule RORy inhibitors are shown in Table 1 and Formula I.
  • the small molecule compound selectively binds to RORy and inhibits RORy activity.
  • the subject is a mammal (e.g., human) in need of cancer treatment.
  • the present invention provides a method for treating a cancer in a subject, the method comprising administering to the subject an effective amount of a retinoic acid receptor-related orphan receptor y (RORy) inhibitor in combination with an effective amount of an anticancer drug.
  • the cancer is resistant to the anticancer drug.
  • the RORy inhibitor enhances the therapeutic effect of the anticancer drug.
  • the RORy inhibitor can reverse or reduce cancer cell resistance to the anticancer drug and/or sensitize cancer cells to the anticancer drug.
  • the cancer is selected from the group consisting of a prostate cancer, lung cancer, breast cancer, liver cancer, ovarian cancer, endometrial cancer, bladder cancer, colon cancer, lymphoma, and glioma.
  • the prostate cancer is a castration-resistant prostate cancer.
  • the castration-resistant prostate cancer is resistant to an anticancer drug such as, e.g., an anti-androgen drug and/or a taxane.
  • the anti- androgen drug is selected from the group consisting of enzalutamide, bicalutamide, arbiraterone, nilutamide, flutamide, apalutamide, finasteride, dutasteride, alfatradiol, and combinations thereof.
  • the taxane is selected from the group consisting of paclitaxel, docetaxel, and combinations thereof.
  • the lung cancer is a non-small-cell lung cancer (NSCLC), K- Ras mutant lung cancer, BRAF mutant lung cancer, EGFR mutant lung cancer, tyrosine kinase inhibitor-resistant lung cancer, or small cell lung cancer (SCLC).
  • NSCLC non-small-cell lung cancer
  • K- Ras mutant lung cancer BRAF mutant lung cancer
  • EGFR mutant lung cancer tyrosine kinase inhibitor-resistant lung cancer
  • SCLC small cell lung cancer
  • the breast cancer is a triple-negative breast cancer (TNBC), tamoxifen -resistant breast cancer, radiation-resistant breast cancer, HER2-positive breast cancer, or ER-positive breast cancer.
  • the RORy inhibitor is a small molecule compound. Non- limiting examples of small molecule RORy inhibitors are shown in Table 1 and Formula I.
  • the small molecule compound selectively binds to RORy and inhibits RORy activity.
  • the subject is a mammal (e.g., human) in need of cancer treatment.
  • the anticancer drug is selected from the group consisting of an anti-androgen drug, chemotherapeutic agent, radiotherapeutic agent, antigen-specific immunotherapeutic agent, endocrine therapy, tyrosine kinase inhibitor, and combinations thereof.
  • the anti-androgen drug is selected from the group consisting of enzalutamide, bicalutamide, arbiraterone, nilutamide, flutamide, apalutamide, finasteride, dutasteride, alfatradiol, and combinations thereof.
  • the chemotherapeutic agent is tamoxifen, a taxane (e.g., paclitaxel and/or docetaxel), or combinations thereof.
  • a subject with a prostate cancer that is resistant to treatment with an anti-androgen drug such as enzalutamide can be administered the anti- androgen drug with an amount of a RORy inhibitor sufficient to reverse or reduce prostate cancer cell resistance to the anti-androgen drug and/or sensitize the prostate cancer cells to the anti-androgen drug.
  • a subject with a prostate cancer that is resistant to treatment with a taxane such as docetaxel can be administered the taxane with an amount of a RORy inhibitor sufficient to reverse or reduce prostate cancer cell resistance to the taxane and/or sensitize the prostate cancer cells to the taxane.
  • a subject with a breast cancer that is resistant to treatment with a chemotherapeutic agent such as tamoxifen can be administered the chemotherapeutic agent with an amount of a RORy inhibitor sufficient to reverse or reduce breast cancer cell resistance to the chemotherapeutic agent and/or sensitize the breast cancer cells to the chemotherapeutic agent.
  • a subject with a breast cancer that is resistant to radiation treatment can be administered radiotherapy with an amount of a RORy inhibitor sufficient to reverse or reduce breast cancer cell resistance to the radiotherapy and/or sensitize the breast cancer cells to the radiotherapy.
  • the present invention provides a composition comprising a retinoic acid receptor-related orphan receptor y (RORy) inhibitor and an anticancer drug.
  • the RORy inhibitor is a small molecule compound. Non- limiting examples of small molecule RORy inhibitors are shown in Table 1 and Formula I.
  • the small molecule compound selectively binds to RORy and inhibits RORy activity.
  • the anticancer drug is selected from the group consisting of an anti-androgen drug, chemotherapeutic agent, radiotherapeutic agent, antigen-specific immunotherapeutic agent, endocrine therapy, tyrosine kinase inhibitor, and combinations thereof.
  • the anti-androgen drug is selected from the group consisting of enzalutamide, bicalutamide, arbiraterone, nilutamide, flutamide, apalutamide, finasteride, dutasteride, alfatradiol, and combinations thereof.
  • the chemotherapeutic agent is tamoxifen, a taxane (e.g., paclitaxel and/or docetaxel), or combinations thereof.
  • the composition further comprises a pharmaceutically acceptable excipient or diluent.
  • the composition is formulated for oral or parenteral (e.g., intravenous) administration.
  • the present invention provides a kit comprising a retinoic acid receptor-related orphan receptor y (RORy) inhibitor and an anticancer drug.
  • RORy retinoic acid receptor-related orphan receptor y
  • the RORy inhibitor is a small molecule compound.
  • small molecule RORy inhibitors are shown in Table 1 and Formula I.
  • the small molecule compound selectively binds to RORy and inhibits RORy activity.
  • the anticancer drug is selected from the group consisting of an anti-androgen drug, chemotherapeutic agent, radiotherapeutic agent, antigen-specific immunotherapeutic agent, endocrine therapy, tyrosine kinase inhibitor, and combinations thereof.
  • the anti-androgen drug is selected from the group consisting of enzalutamide, bicalutamide, arbiraterone, nilutamide, flutamide, apalutamide, finasteride, dutasteride, alfatradiol, and combinations thereof.
  • the chemotherapeutic agent is tamoxifen, a taxane (e.g., paclitaxel and/or docetaxel), or combinations thereof.
  • the kit further comprises a label with instructions for administering the RORy inhibitor and/or the anticancer drug to a subject.
  • the subject is a mammal (e.g., human) in need of cancer treatment.
  • FIGS. 1A-1D show that orphan nuclear receptor RORy is overexpressed in metastatic prostate cancer.
  • FIG. 1A RORC transcript levels from two Gene Expression Omnibus (GEO) data sets of Chandran UR, 2007 and Grasso CS, 2012 were queried for association with disease status (benign, primary and metastatic).
  • FIG. IB Schematic of nuclear receptor RORy structure and function.
  • FIG. 1C Immunoblotting analysis of RORy protein in prostate cancer and noncancer cell lines. Shown are representative blots.
  • FIGS. 2A-2F show that a number of different RORy antagonists display potent anticancer activities.
  • FIG. 2A Chemical structures of RORy antagonists SR2211, 8k, 7k, and 6f, and anti-androgen drug enzalutamide (ENZ).
  • FIG. 2B Cell growth of C4-2B cells treated with the indicated concentrations of ENZ and 8k ("Cmpd8k") for different days. Note: 8k is also known as El l (see, FIGS. 3A-3D) and XY011.
  • FIG. 2C Cell growth of C4-2B cells treated with the indicated concentrations of 6F, 8C and 8k for different days.
  • FIG. 2D Cell growth of CR-VCaP cells treated with the indicated concentrations of SR2211 and Cmpd8k for different days.
  • CR-VCaP is a castration-resistant subline of VCaP that was derived from a VCaP xenograft tumor that grew back in the mouse after the mouse was castrated.
  • VCaP cells were obtained initially from ATCC.
  • FIG. 2E Relative cell growth of 8k and vehicle on different cell lines.
  • FIG. 2F Relative cell apoptosis of 8k and vehicle on C4-2B and CR-VCaP cells.
  • FIGS. 3A-3D show that RORy antagonists strongly inhibit growth of enzalutamide- resistant tumors.
  • MDV3100 enzalutamide.
  • FIG. 3B Images of xenograft tumors from mice treated with Vehicle, MDV3100, SR2211, and El 1 respectively.
  • FIG. 3 A Effects of the indicated treatments (SR2211, 5 mg/kg i.p., El 1, 10 mg/kg and 20 mg/kg i.p., respectively, five times per week; or vehicle) on the growth of 22Rvl xenografts (n
  • FIGS. 4A-4B show that RORy antagonists potently inhibit the expression of aberrant androgen receptor (AR) that drives tumor progression.
  • FIG. 4A Immunoblotting of AR (full length) and AR-V7 in C4-2B treated with SR2211 and vehicle at the indicated concentrations for 72 h.
  • FIG. 4B Immunoblotting of AR (full length), AR-V7 and GR in VCaP cells treated with SR2211 and vehicle at the indicated concentrations for 72 h.
  • FIG. 5 shows that RORy antagonists potently inhibit the genome-wide association of AR.
  • FIGS. 6A-6F show that RORy overexpression associates with metastatic CRPC progression and is required for survival of prostate cancer cells.
  • FIG. 6A RORC transcript levels from two Gene Expression Omnibus (GEO) data sets of Chandran UR, 2007 and Grasso CS, 2012 were queried for association with disease status (benign, primary and metastatic).
  • GEO Gene Expression Omnibus
  • FIG. 6C Immunoblotting analysis of RORy protein in prostate cancer and noncancer cell lines. Shown are representative blots.
  • FIG. 6D C4-2B cells (left) in 9% charcoal-dextrand-stripped (cds) fetal bovine serum (FBS), plus 1% FBS medium, and VCaP cells (right) in regular FBS medium were transfected with siRNAs against RORC (siRORC-1 and siRORC-2) or control siRNA (siCont). After the indicated time points, viable cells were counted.
  • FIG. 6E C4-2B cells were treated as in FIG. 6D, and apoptosis was analyzed by measuring caspase3/7 activity.
  • FIG. 6F Immunoblotting analysis of the indicated proteins in C4-2B and VCaP cells transfected with RORC or control siRNA and incubated for 3 d.
  • FIGS. 7A-7G show that RORy antagonists potently inhibit growth of CRPC cells.
  • FIG. 7A Chemical structures of RORy antagonists SR2211and XYOl l .
  • FIG. 7B Cell viability, as measured by Cell-Titer GLO (Promega) of C4-2B cells treated with the indicated concentrations of ENZ, RORa agonist SR3335 and RORy antagonists SR2211, XYOl l and SRI 555 for 4 d. Experiments were performed with three independent experiments and sextuplicate.
  • FIG. 7C Half-maximal inhibitory concentration (IC 50 ) for SR2211 and ENZ in indicated cell lines treated for 4 days is shown.
  • FIG. 7F TU EL-positive apoptotic cells treated with vehicle or RORy antagonists (5 ⁇ ) were counted and expressed as a percentage of total cells.
  • FIGS. 8A-8C show that RORy controls AR-dependent gene programs.
  • FIG. 8A Heat map displaying the fold changes of gene expression, as detected by RNA-seq in C4-2B cells treated with either SR2211 (5 ⁇ ), XY011 (5 ⁇ ) or ENZ (20 ⁇ ) for 48 h, as compared to vehicle (DMSO). Left, genes displayed were altered in their expression with log 2 > 0.5 in at least one condition. Cluster 1, genes inhibited by both antagonists; cluster 2, genes induced by SR2211 but inhibited by XY011; cluster 3, genes induced by both antagonists; cluster 4, genes inhibited by SR2211 but induced by XY011.
  • FIG. 8B GSEA of the AR activity signature in C4-2B cells treated with 5 ⁇ of SR2211 (up) or XY011 (down), as compared to vehicle. The signature was defined by genes that underwent significant expression changes as a result of androgen stimulation in PCa cells and androgen deprivation in human tumors.
  • FIGS. 9A-9E show that RORy inhibition strongly suppresses AR and its variant expression and eliminates AR genome binding.
  • FIG. 9B qRT
  • FIG. 9C ChlP-seq summary plot of AR enrichment (average coverage; left) across AR-binding sites (ARBS) and H3K27ac enrichment (middle) across the indicated genomic distance in different treatments. Right, genome browser display of AR- binding and H3K27ac-enrichment events on enhancers and/or promoters of the AR target genes KLK2, KLK3 and CAMKK2. ChlP-seq was performed in C4-2B cells treated with either vehicle or SR221 1 (5 ⁇ ) for 24 h.
  • FIG. 9D ChlP-qPCR analysis of relative AR at the indicated gene promoter and/or enhancers in C4-2B cells treated with vehicle or 5 ⁇ of SR221 1 for 24 h.
  • FIGS. 10A-10G show that RORy directly controls AR gene expression through an exonic RORE and SRCs.
  • FIG. 10A Upper panel shows a schematic of AR gene locus with ChIP primer-pair locations indicated by horizontal short lines and their distance in kb relative to the TSS. The primer pair amplifying the RORE site is highlighted.
  • Lower panel shows ChlP-qPCR analysis of RORy occupancy at the locus in C4-2B cells treated with vehicle or 5 ⁇ SR221 1.
  • n 3. Data shown are mean ⁇ s.d.
  • FIG. 10A Upper panel shows a schematic of AR gene locus with ChIP primer-pair locations indicated by horizontal short lines and their distance in kb relative to the TSS. The primer pair amplifying the RORE site is highlighted.
  • Lower panel shows ChlP-qPCR analysis of RORy occupancy at the locus in C4-2B cells treated with vehicle or 5 ⁇ SR221 1.
  • n 3. Data shown are mean ⁇ s.d.
  • FIG. 10B Schematic diagram depicting the locations of sgRNAs targeting the AR-RORE region; of primers used for genomic DNA PCR or RT-PCR; and of predicted Cas9 cleavage sites (arrowheads). Note that because of the lack of an additional protospacer adjacent motif (PAM) sequence at or near the RORE, sgRNA 2 is the only one that can be designed to cause indel-type alterations adjacent to the RORE sequence.
  • FIG. IOC PCR and sequencing analysis of genomic DNA from editing- heterogenous C4-2B cells treated with the indicated sgRNAs and Cas9. Genomic DNA PCR was performed by using primers P3 and P4. The top band indicates the expected full-length PCR amplicons.
  • FIG. 10F Sequences of the wild-type and mutant form of AR- RORE linked to reporters (top). AR-RORE reporter-gene assays, with 293T cells showing the effects of mutating the RORE sequence or RORy (left), or showing the effects of the antagonists (right) on RORy activation.
  • FIGS. 11A-11D show that RORy antagonists potently inhibit tumor growth.
  • FIG. 11C Immunoblotting (left) of C4-2B xenograft tumors after 24 d of treatment with vehicle or SR2211, as in FIG. 11A. Cell lysate for each lane was from homogenized tumor tissues randomly combined from three mice of vehicle or SR2211 group. Anti-cleaved caspase3 immunohistochemistry images of tumor sections are shown at right. Scale bar, 50 ⁇ . FIG.
  • FIG. 12A-12D show that overexpression of RORy, not RORa or RORp, associates with metastatic CRPC progression.
  • FIG. 12A RORA and RORB transcript expression in two prostate cancer microarray studies from the GEO database. Data sets were analyzed for the transcript levels of RORA and RORB genes, which encode RORa and RORP proteins respectively, in benign prostate tissues, and primary or metastatic prostate tumor tissues (top). Oncoprint display from cBioPortal of the three ROR gene alterations in metastatic prostate cancer tumors from 150 patients reported in a recent study 45 (bottom). MYC and EZH2 are displayed for comparison of their alteration frequency and individual tumor relationship with the three ROR genes in the same study.
  • FIG. 12A RORA and RORB transcript expression in two prostate cancer microarray studies from the GEO database. Data sets were analyzed for the transcript levels of RORA and RORB genes, which encode RORa and RORP proteins respectively, in benign prostate tissues, and primary or metastatic prostate tumor tissues (top). Oncoprint display from cBio
  • FIG. 12C C4-2B and VCaP cells were transfected with RORC or control siRNA. Three days later, cells were harvested for immunoblotting with indicated antibodies.
  • FIGS. 13A-13E show that RORy antagonists potently inhibit growth and survival of CRPC cells.
  • FIG. 13B Representative images of colony formation of C4-2B and 22Rvl cells treated with vehicle, SR2211 or XY011 for 14 days.
  • FIG. 13C Representative images of TUNEL positive cells treated with vehicle or the antagonists (5 ⁇ ) in 22Rvl cells are shown.
  • FIG. 13A C4-2B and 22Rvl cell proliferation after RORy antagonist treatment. Cells were seeded in 6-well plates and counted after cells were treated with indicated concentrations of RORy antagonists for 0, 2, 4 and 6 days by Coulter counter. Data are shown as mean
  • FIG. 14A Heat-map display of the inhibitor-altered expression of genes involved in cell proliferation and survival in C4-2B cells treated with 5 ⁇ SR2211 or XY011 for 48 hours. Gene expression profiling was performed with RNA-sequencing.
  • FIG. 14B Venn diagrams display overlapping number of up- or down-regulated genes (>1.2 fold) in C4-2B cells between SR2211 (5 ⁇ ), XY011 (5 ⁇ ) and ENZ (20 ⁇ ) treatment. Gene expression profiling was performed after RNA-sequencing.
  • FIG. 14C Heat-map display of the altered expression of AR-V7 up-regulated genes in C4-2B cells treated as above.
  • FIG. 14D Heat- map display of the altered expression of the core 16-AR CRPC gene set in C4-2B cells treated as above.
  • FIG. 14E qRT-PCR analysis of indicated genes in C4-2B cells treated with indicated siRNA (left) or with ENZ (right) for 48 hours. Data are shown as mean ⁇ s.d. Significance was calculated using Student's t-test. ** p ⁇ 0.001.
  • FIGS. 15A-15D show that RORy controls AR and its variant expression in prostate cancer cells.
  • FIG. 15A qRT-PCR analysis of AR full-length and variant AR-V7 expression in C4-2B and VCaP cells treated with indicated siRNAs for 48 hours. Data are shown as mean ⁇ s.d. Significance was calculated using Student's t-test. ** p ⁇ 0.001.
  • FIG. 15B Immunoblotting of AR and its variants or AR-V7 in C4-2B and VCaP cells treated with vehicle or XY011 for 72 hours.
  • FIG. 15A qRT-PCR analysis of AR full-length and variant AR-V7 expression in C4-2B and VCaP cells treated with indicated siRNAs for 48 hours. Data are shown as mean ⁇ s.d. Significance was calculated using Student's t-test. ** p ⁇ 0.001.
  • FIG. 15B Immunoblotting of AR and its variants or AR-V7 in C4-2B and
  • FIG. 15C Immunoblotting of AR and its variant AR-V7 in PC346C, 22Rvl and LAPC4 cells treated with vehicle or SR2211 for 72 hours.
  • FIG. 15D Immunoblotting of AR and RORy in LNCaP cells ectopically expressing RORy and the control cells cultured in charcoal :dextran stripped (cds) serum-supplemented medium.
  • FIGS. 16A-16B show the correlation of RORy expression with the gene expression of AR and CRPC AR signature activity in clinical tumor data sets.
  • FIG. 16A Scatter plots showing correlation between RORy and AR gene expression in primary tumors or CRPC tumors. Gene expression profiles are from different clinical data sets (GSE6811, GSE70768 and GSE35988-GPL6480). Scatter plots showing correlation between RORy expression and AR expression in CRPC tumors.
  • FIG. 16B Scatter plots showing correlation between RORy and AR gene expression in primary tumors or CRPC tumors. Gene expression profiles are from different clinical data sets (GSE6811, GSE70768 and GSE35988-GPL6480). Scatter plots showing correlation between RORy expression and CRPC AR signature activity in CRPC tumors.
  • FIGS. 17A-17G show the effects of RORy inhibition on AR genome binding, histone modifications, and Pol-II recruitment.
  • FIG. 17A Immuoblotting of AR and its variants in C4-2B cells treated with vehicle or SR2211 (5 ⁇ ) for 24 hours.
  • FIG. 17B Heat-map presentation of AR enrichment (average coverage) across AR-binding sites (ARBS) and H3K27ac enrichment across the enrichment regions in cells treated with vehicle or SR2211 (5 ⁇ ) for 24 hours in cells treated as in FIG. 17A.
  • FIG. 17C Genome browser display of AR binding events on the enhancers and/or promoters of AR-target KX3.1, FKBP5 and ATAD2/ANCCA genes.
  • FIG. 17E Genome browser display of AR, H3K4me2, H3K4me3 and RNA polymerase II (Pol II) binding events on the enhancers and/or promoters of AR-target KLK2, KLK3 and CAMKK2 genes.
  • ChlP-seq of AR, H3K3K4me2/3 and RNA polymerase II (Pol II) were performed in C4-2B cells treated for 24 hours with vehicle or SR2211 (5 ⁇ ). Note: the AR ChlP-seq data shown here were obtained from an experiment separate from the data shown in FIGS. 9A-9E.
  • FIG. 17G Enrichment summary plots of AR, H3K4me2, H3K4me3 and pol II across their corresponding binding sites in different treatment groups. ChlP-seq was performed as in FIG. 17E. [0051] FIGS.
  • FIG. 18A-18B show that RORy antagonists inhibit AR function through suppression of AR expression.
  • FIG. 18A Left: 22Rvl cells in charcoal-stripped medium were transfected with 5xARE-tk-luc and AR expression construct as indicated. Sixteen hours later, cells were treated with 3 nM R1881 for 24 hours, before harvested for luciferase activity measurement. Right: 22Rvl cells were transfected as above, and then treated with R1881 and R
  • FIGS. 19A-19C show the effects of CRISPR/Cas9 editing of AR-RORE site on AR gene expression.
  • FIG. 19A Sequencing analysis of the deletion junction of the AR-RORE site. PCR products from sgRNA-2 + sgRNA-3 deleted alleles (FIG. IOC) were cloned and 19 individual clones were sequenced to determine the sequence of deletion junctions and frequency. The top row shows the wild-type sequence and the arrows indicate expected cleavage sites of Cas9.
  • FIG. 19B Quantitative analysis of RT-PCR products from AR wild type (WT) and indicated sgRNA-deleted alleles in cells treated with vehicle or RORy antagonists.
  • C4-2B cells were infected with lentivirus encoding Cas9 and indicated sgRNAs. After two days, cells were treated with vehicle or the RORy antagonists (5 ⁇ ) for another two days before harvested for semi-quantitative RT-PCR. PCR products were separated by agarose gel as shown in FIG. 10E. The experiments were repeated three times. The pixel density of DNA bands from each experiment was quantified and normalized to GAPDH.
  • FIGS. 20A-20B show the correlation between ROR inhibition, AR expression inhibition and anti-proliferation by different concentrations of a RORy antagonist.
  • FIG. 20A Scatter plot of percentage of indicated inhibitory activities of SR2211 at different concentrations. The results showed a tight correlation between RORy inhibition, AR expression inhibition and anti-proliferation by SR2211.
  • RORy inhibition was measured by reporter gene assay as in FIG. 10F.
  • Anti-proliferation/cell viability was measured by Cell- Titer GLO as in FIG. 7B.
  • AR expression inhibition was analyzed by AR immunoblotting followed by quantification of full-length AR protein bands.
  • FIG. 20B Combined plotting of AR-RORE inhibition, AR expression inhibition and anti-proliferation of SR2211 at different concentrations.
  • FIG. 21 shows the effects of RORy knockdown on the occupancy of SRCs and pol- II as well as histone modifications at the AR-RORE site.
  • ChlP-qPCR analysis of relative enrichment of RORy, H3K4me2, H3K4me3, H3K27ac, RNA polymerase II (pol II) at the AR-RORE site in C4-2B cells treated with control or RORy siRNA for 72 hours. ** p ⁇ 0.01, « 3.
  • FIGS. 22A-22C show the effects of different SRC coactivator inhibition on AR expression and SR2211 effects on histone modifications and Pol II recruitment at AR promoter.
  • FIG. 22B Left and middle: immunoblotting analysis of indicated proteins in C4-2B cells transfected with smart pool siRNA (left; see, O'Malley et al, Cancer Cell, 28:240-252 (2015)), or individual siRNA targeting different SRCs (middle) or control siRNAs, individually or in different combinations.
  • FIG. 22C ChIP- PCR analysis of relative occupancy by H3K4me2, H3K4me3, H3K27ac, Plo II and H3 at AR gene promoter in C4-2B cells treated with vehicle or SR2211 (5 ⁇ ) for 24 hours. ** p ⁇
  • FIGS. 23A-23B show the in vivo effects of RORy antagonists on growth of prostate cancer xenograft tumors and mouse body weight.
  • FIG. 23A Effects of SR2211 (5 mg/kg,
  • FIGS. 25A-25C show the in vivo effects of RORy antagonists on growth of C4-2B prostate orthotopic tumors, mouse body weight and serum PSA level.
  • FIG. 25A Pictures of orthotopically implanted C4-2B tumors grown in SCID mice treated with vehicle or SR2211 (5 mg/kg, i.p., 5 times a week).
  • FIG. 27A-27C show that RORy inhibition strongly suppresses AR and its variant expression and eliminates AR binding in vivo.
  • FIG. 27B ChIP analysis of relative AR occupancy at the promoter and enhancer ARE sites of KLK3 in C4- 2B xenograft tumors after treatment with vehicle or SR2211 as in FIG. 27A.
  • FIGS. 28A-28C show the in vivo effects of RORy inhibition on tumor metastasis, mouse body weight and organ weight in xenograft models.
  • FIG. 28A Mice bearing VCaP xenografts as in FIG. 11D, treated with vehicle, SR2211, ENZ or combination for 23 d, were assessed for spontaneous metastasis to the femur (bone marrow) and liver. Genomic DNA isolated from these sites was analyzed for metastasized cells by measuring human Alu sequence (by Alu-qPCR).
  • FIG. 28B Body weight of mice from different treatment groups.
  • FIG. 28C Weight of indicated tissues from mice treated with vehicle or SR2211 for 24 days as in FIG.
  • FIGS. 29A-29C show the in vivo effects of RORy antagonists on normal mouse prostate and testis.
  • FIG. 29A Representative images of seminal vesicle and prostate, and testis from mice treated with vehicle or SR2211for 24 days are shown.
  • FIG. 29B Representative H&E images of prostate, testis and liver from vehicle- or SR2211 -treated mice.
  • FIG. 29C Representative anti-AR IHC images of prostate and testis sections from mice treated with vehicle or SR2211.
  • FIGS. 30A-30B show the lack of inhibitory effects by RORy antagonists on AR expression in non-malignant, human prostate epithelial cells.
  • FIG. 30A Immunoblotting analysis of RORy and AR expression in in non-malignant, human prostate epithelial RWPE1 and PZ-HPV7 cells with the indicated treatments.
  • FIG. 30B Comparison of genomic DNA sequences at the 3' end region of AR exon 1 between different species with sequences matching the RORE motif and deviations highlighted. Note: the corresponding murine sequences (CTGGATCG) are predicted to be unfunctional as a RORE because of the two deviations (underlined) from the consensus RORE motif.
  • FIG. 31A Cell viability, as measured by Cell-Titer GLO, of different breast cancer cells treated with the indicated concentrations of SR2211 for 4 days.
  • FIG. 31B Cell viability, as measured by Cell-Titer GLO, of different breast cancer cells treated with the indicated concentrations of GSK805 for 4 days.
  • FIG. 31C Cell viability, as measured by Cell-Titer GLO, of different breast cancer cells treated with the indicated concentrations of GSK9B for 4 days.
  • FIG. 31D SR2211 and GSK805 sensitized MCF-7 TamR cells to tamoxifen (TAM) induced cell growth inhibition.
  • TAM tamoxifen
  • FIG. 31E Cell viability, as measured by Cell-Titer GLO, of MCF-7 C6 radiation resistant cells treated with the indicated concentrations of SR2211, GSK805 and GSK9b for 4 days.
  • FIG. 31F Half-maximal inhibitory concentration (IC 50 ) for SR2211, GSK805, GSK9b and G E3500 in indicated cell lines treated for 4 days.
  • FIG. 32A Cell viability, as measured by Cell-Titer GLO, of different lung cancer cells treated with the indicated concentrations of SR2211 for 4 days.
  • FIG. 32B Cell viability, as measured by Cell-Titer GLO, of different lung cancer cells treated with the indicated concentrations of GSK805 for 4 days.
  • FIG. 32C Half-maximal inhibitory concentration (IC 50 ) for SR2211 and GSK805 in indicated lung cancer cell lines treated for 4 days.
  • FIG. 33A Cell viability, as measured by Cell-Titer GLO, of ovarian cancer OVCAR420 cells treated with the indicated concentrations of SR2211, GSK9b and GSK805 for 4 days.
  • FIG. 33B Cell viability, as measured by Cell-Titer GLO, of bladder cancer T24 cells treated with the indicated concentrations of SR2211, GSK9b and GSK805 for 4 days.
  • FIG. 33C Cell viability, as measured by Cell-Titer GLO, of endometrial ECC1 cells treated with the indicated concentrations of SR2211, GSK9b and GSK805 for 4 days.
  • FIG. 33A Cell viability, as measured by Cell-Titer GLO, of ovarian cancer OVCAR420 cells treated with the indicated concentrations of SR2211, GSK9b and GSK805 for 4 days.
  • FIG. 33B Cell viability, as measured by Cell-Titer GLO, of bladder cancer T24 cells treated with the indicated concentrations of SR22
  • FIG. 33D Cell viability, as measured by Cell-Titer GLO, of liver cancer HepG2 and Hep3B cells treated with the indicated concentrations of SR2211, GSK9b and GSK805 for 4 days.
  • FIG. 33E Cell viability, as measured by Cell-Titer GLO, of glioblastoma T98G cells treated with the indicated concentrations of SR2211, GSK9b and GSK805 for 4 days.
  • FIG. 33F Cell viability, as measured by Cell-Titer GLO, of leukemia SUDHL4 and SUDHL6 cells treated with the indicated concentrations of SR2211, GSK9b and GSK805 for 4 days.
  • FIG. 33G Cell viability, as measured by Cell-Titer GLO, of colon cancer HCT116 cells treated with the indicated concentrations of SR2211, GSK9b and GSK805 for 4 days.
  • FIG. 33H Cell viability, as measured by Cell-Titer GLO, of C4-2B docetaxel-resistant cells treated with the SR2211 and GSK805 for 4 days.
  • FIG. 331 Half-maximal inhibitory concentration (IC 50 ) for SR2211, GSK9b and GSK805 in indicated cell lines treated for 4 days.
  • the present disclosure relates to inhibitors of a nuclear receptor known as retinoic acid receptor-related orphan receptor ⁇ (RORy or RORgamma).
  • RORy retinoic acid receptor-related orphan receptor ⁇
  • RORy inhibitors are useful in the treatment of cancer.
  • RORy inhibitors can reverse or reduce cancer cell resistance to different classes of anticancer drugs and/or sensitize drug-resistant cancer cells to such anticancer drugs.
  • Non-limiting examples of anticancer drugs that can be administered in combination with RORy inhibitors to enhance the therapeutic effect of the anticancer drug include anti-androgen drugs (e.g., bicalutamide, enzalutamide, arbiraterone, etc.), chemotherapeutic agents (e.g., tamoxifen and/or taxanes such as docetaxel), and combinations thereof.
  • RORy inhibitors include compounds that inhibit RORy transcription, translation, stability, and/or activity. Inhibition of RORy activity can include inhibition of recruitment of coactivators such as SRC-1 and/or SRC-3 to an androgen receptor (AR) ROR response element (RORE).
  • inhibition of RORy activity can include inhibition of transcription of the AR gene and/or a variant thereof such as AR-V7.
  • mCRPC metastatic castration-resistant prostate cancer
  • PCa prostate cancer
  • a major proportion of human PCa tumors was also found to overexpress RORy protein.
  • RORy is the androgen receptor (AR), which expression and function are strongly inhibited by the RORy-specific small molecules and siRNA silencing.
  • AR protein is aberrantly overexpressed and plays a pivotal role in tumors of PCa including mCRPCs.
  • the present inventors have also found that small molecule inhibitors of RORy strongly inhibit the growth and survival of cancer cells of numerous other cancer types including lung cancer, breast cancer, liver cancer, ovarian cancer, endometrial cancer, bladder cancer, colon cancer, lymphoma, and glioblastoma multiforme.
  • lung cancer breast cancer, liver cancer, ovarian cancer
  • endometrial cancer bladder cancer
  • colon cancer lymphoma
  • lymphoblastoma multiforme glioblastoma multiforme.
  • the RORy protein a member of the nuclear receptor family type of transcription factor, has so far never been implicated to play a direct function in any type of human cancers. Therefore, its function and expression in human cancers are almost completely unknown.
  • the inhibitory small molecules of RORy (not those of RORa) or the RORy gene silencing siRNAs have a mechanism of action (MO A) in inhibition of PCa cells or tumors that is very different from current PCa therapeutics being used in the clinic (e.g., bicalutamide, enzalutamide, abiratoerone) or being developed (e.g., ARN509, EPI-001, ASC- J9, niclosamide).
  • MO A mechanism of action
  • RORy protein Small molecules with potential therapeutic value demonstrated in preclinical PCa models have a direct target, namely, RORy protein, which is defined in PCa tumor cells. In contrast, other small molecules such as ASC-J9 or niclosamide that show tumor inhibition of PCa models do not have well defined protein or other cellular targets. 4.
  • RORy By targeting one protein target, namely RORy, two most important PCa tumor-driving pathways are potently inhibited.
  • One pathway is the AR gene/protein itself. The findings described in the Examples indicate that RORy directly activates the AR gene transcription in the same cancer cell and that the RORy inhibitors strongly suppress the AR expression.
  • the other pathway is the tumor androgen biosynthesis pathway where multiple key androgen synthesis enzyme genes are inhibited by the RORy inhibitors.
  • Targeting RORy in tumor cells actually targets the root cause of advanced PCa problems, namely the aberrant expression of AR (i.e., both full-length AR and spliced AR variants) in PCa tumor cells. Numerous clinical and preclinical studies indicate that aberrant AR is the major driver of PCa progression and therapeutic resistance. 6.
  • Different small molecule inhibitors of RORy are effective in strongly inhibiting the growth and survival of human cancer cells from numerous cancer types that are resistant to different therapies including chemotherapeutic agents, radiation, and targeted therapies such as tamoxifen.
  • the RORy inhibitors can also sensitize the resistant cancer cells to therapeutic drugs such as tamoxifen.
  • RORy refers to either or both isoforms encoded by the RORC (RAR- related orphan receptor C) gene, namely RORy (also referred to as RORyl or RORC1) and RORyt (also known as RORy2 or RORC2).
  • the terms "subject”, "patient” or “individual” are used herein interchangeably to include a human or animal.
  • the animal subject may be a mammal, a primate (e.g., a monkey), a livestock animal ⁇ e.g., a horse, a cow, a sheep, a pig, or a goat), a companion animal ⁇ e.g., a dog, a cat), a laboratory test animal ⁇ e.g., a mouse, a rat, a guinea pig, a bird), an animal of veterinary significance, or an animal of economic significance.
  • a primate e.g., a monkey
  • livestock animal ⁇ e.g., a horse, a cow, a sheep, a pig, or a goat
  • a companion animal e.g., a dog, a cat
  • a laboratory test animal ⁇ e.g., a mouse, a rat, a guinea pig,
  • an effective amount includes a dosage sufficient to produce a desired result with respect to the indicated disorder, condition, or mental state.
  • the desired result may comprise a subjective or objective improvement in the recipient of the dosage.
  • an effective amount of a RORy inhibitor includes an amount sufficient to alleviate the signs, symptoms, or causes of a cancer such as prostate cancer, e.g. CRPC.
  • an effective amount can be an amount that slows or reverses tumor growth, increases mean time of survival, inhibits tumor progression or metastasis, or sensitizes a cancer cell to an anticancer drug to which it has become or is resistant.
  • an effective amount of a RORy inhibitor includes an amount sufficient to cause a substantial improvement in a subject having cancer when administered to the subject.
  • the amount will vary with the type of cancer being treated, the stage of advancement of the cancer, the type and concentration of composition applied, and the amount of anticancer drug ⁇ e.g., anti-androgen drug) that is also administered to the subject.
  • an effective amount of a RORy inhibitor can include an amount that is effective in enhancing the therapeutic activity of anticancer drugs such as anti- androgen drugs (e.g., bicalutamide, enzalutamide, arbiraterone, etc.) and/or chemotherapeutic agents (e.g., tamoxifen and/or taxanes such as docetaxel).
  • anticancer drugs such as anti- androgen drugs (e.g., bicalutamide, enzalutamide, arbiraterone, etc.) and/or chemotherapeutic agents (e.g., tamoxifen and/or taxanes such as docetaxel).
  • the term "treating" includes, but is not limited to, methods and manipulations to produce beneficial changes in a recipient's health status, e.g., a patient's cancer status.
  • the changes can be either subjective or objective and can relate to features such as symptoms or signs of the cancer being treated. For example, if the patient notes decreased pain, then successful treatment of pain has occurred. For example, if a decrease in the amount of swelling has occurred, then a beneficial treatment of inflammation has occurred. Similarly, if the clinician notes objective changes, such as reducing the number of cancer cells, the growth of the cancer cells, the size of cancer tumors, or the resistance of the cancer cells to another cancer drug, then treatment of cancer has also been beneficial.
  • Treating also includes administering a RORy inhibitor alone or in combination with an anticancer drug to a subject having cancer.
  • the cancer is prostate cancer, lung cancer, breast cancer, liver cancer, ovarian cancer, endometrial cancer, bladder cancer, colon cancer, lymphoma, or glioblastoma multiforme.
  • administering includes activities associated with providing a patient an amount of a compound described herein, e.g., one or more RORy inhibitors.
  • Administering includes providing unit dosages of compositions set forth herein to a patient in need thereof.
  • Administering includes providing effective amounts of compounds, e.g., RORy inhibitors, for a specified period of time, e.g., for about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 or more days, or in a specified sequence, e.g., administration of one or more RORy inhibitors followed by the administration of one or more anticancer drugs, or vice versa.
  • co-administering includes sequential or simultaneous administration of two or more structurally different compounds.
  • two or more structurally different pharmaceutically active compounds can be co-administered by administering a pharmaceutical composition adapated for oral administration that contains two or more structurally different active pharmaceutically active compounds.
  • two or more structurally different compounds can be co-administered by administering one compound and then administering the other compound.
  • the co-administered compounds are administered by the same route.
  • the co-administered compounds are administered via different routes.
  • one compound can be administered orally, and the other compound can be administered, e.g., sequentially or simultaneously, via intravenous or intraperitoneal injection.
  • cancer refers to conditions including solid cancers, lymphomas, and leukemias.
  • cancers include, but are not limited to, prostate cancer, lung cancer (e.g., non-small cell lung cancer or NSCLC), ovarian cancer, colorectal cancer, liver cancer (i.e., hepatocarcinoma), renal cancer (i.e., renal cell carcinoma), bladder cancer, breast cancer, thyroid cancer, pleural cancer, pancreatic cancer, uterine cancer, cervical cancer, testicular cancer, anal cancer, bile duct cancer, gastrointestinal carcinoid tumors, esophageal cancer, gall bladder cancer, appendix cancer, small intestine cancer, stomach (gastric) cancer, cancer of the central nervous system, skin cancer, choriocarcinoma, head and neck cancer, blood cancer, endometrial cancer, osteogenic sarcoma, fibrosarcoma, neuroblastoma, glioma, melanoma, B-cell lymphoma, non-Hodgkin's lymphoma, Burkitt's lymphoma
  • the cancer can be metastatic.
  • the cancer is prostate cancer, lung cancer, breast cancer, liver cancer, ovarian cancer, endometrial cancer, bladder cancer, colon cancer, lymphoma, or a glioma such as glioblastoma multiforme.
  • the cancer can be resistant to an anticancer drug, e.g., an anti-androgen-resistant cancer, a taxane-resistant cancer (e.g., docetaxel- resistant cancer), a tamoxifen-resistant cancer, a radiation-resistant cancer, or a tyrosine kinase inhibitor-resistant cancer.
  • prostate cancer or “prostate cancer cell” refer to a cancer cell or cells that reside in prostate tissue.
  • the prostate cancer can be benign, malignant, or metastatic.
  • the prostate cancer can be androgen-insensitive, hormone-resistant, or castrate-resistant.
  • the prostate cancer can be "advanced stage prostate cancer” or "advanced prostate cancer.”
  • Advanced stage prostate cancer includes a class of prostate cancers that has progressed beyond early stages of the disease. Typically, advanced stage prostate cancers are associated with a poor prognosis.
  • Types of advanced stage prostate cancers include, but are not limited to, metastatic prostate cancer, drug-resistant prostate cancer such as anti-androgen-resistant prostate cancer (e.g., enzalutamide-resistant prostate cancer, abiraterone-resistant prostate cancer, bicalutamide-resistant prostate cancer, etc.), taxane-resistant prostate cancer (e.g., docetaxel-resistant prostate cancer) and the like, hormone refractory prostate cancer, castration-resistant prostate cancer (CRPC), metastatic castration-resistant prostate cancer, AR-V7-induced drug-resistant prostate cancer such as AR-V7-induced anti-androgen-resistant prostate cancer (e.g., AR-V7-induced enzalutamide- resistant prostate cancer), AKR1C3 -induced drug-resistant prostate cancer such as AKR1C3- induced anti-androgen-resistant prostate cancer (e.g., AKR1C3 -induced enzalutamide- resistant prostate cancer), and combinations thereof.
  • the advanced stage prostate cancers do not generally respond, or are resistant, to treatment with one or more of the following conventional prostate cancer therapies: enzalutamide, abiraterone, bicalutamide, and docetaxel.
  • Compounds, compositions, and methods of the present invention are provided for treating prostate cancer, such as advanced stage prostate cancer, including any one or more (e.g., two, three, four, five, six, seven, eight, nine, ten, or more) of the types of advanced stage prostate cancers disclosed herein.
  • enhancing the therapeutic effects includes any of a number of subjective or objective factors indicating a beneficial response or improvement of the condition being treated as discussed herein.
  • enhancing the therapeutic effects of an anticancer drug such as an anti-androgen drug (e.g., enzalutamide, abiraterone, or bicalutamide) or a chemotherapeutic agent such as tamoxifen or a taxane (e.g., docetaxel) includes reversing or reducing cancer cell resistance and/or sensitizing a drug-resistant cancer to anticancer drug therapy.
  • enhancing the therapeutic effects of an anticancer drug includes altering drug-resistant cancer cells so that the cells are not resistant to the anticancer drug.
  • enhancing the therapeutic effects of an anticancer drug includes additively or synergistically improving or increasing the activity of the anticancer drug.
  • the enhancement includes a one-fold, two-fold, three-fold, five-fold, ten-fold, twenty-fold, fifty-fold, hundred-fold, or thousand-fold increase in the therapeutic activity of an anticancer drug used to treat cancer.
  • the phrase “reversing cancer cell resistance” includes altering or modifying a cancer cell that is resistant to anticancer drug therapy so that the cell is no longer resitant to anticancer drug therapy.
  • the phrase “reducing cancer cell resistance” includes increasing the therapeutic activity of an anticancer drug towards cancer cells that are, or previously were, resistant to anticancer drug therapy.
  • the phrase “sensitizing cancer cell resistance” includes inducing sensitization towards anticancer drug therapy in cancer cells which are resistant to anticancer drug therapy. Sensitization as used herein includes inducing the ability of a cancer cell to be effectively treated with an anticancer drug. Sensitization also includes reducing the dosage required to achieve a beneficial effect with an anticancer drug.
  • anti-androgen drug includes anti-androgen compounds that alter the androgen pathway by blocking the androgen receptors, competing for binding sites on the cell's surface, or affecting or mediating androgen production.
  • Anti-androgen drugs are useful for treating several diseases including, but not limited to, prostate cancer.
  • Anti-androgen drugs include, but are not limited to, enzalutamide, abiraterone, bicalutamide, flutamide, nilutamide, apalutamide, finasteride, dutasteride, alfatradiol, and combinations thereof.
  • AR androgen receptor
  • AREs Androgen Response Elements
  • AR variant includes a splice variant of full-length AR.
  • Various AR variants are known. See, Guo et al., Cancer Res., 69(6):2305-13 (2009).
  • Exemplary AR variants include, but are not limited to, variants lacking a functional ligand binding domain (LBD).
  • LBD functional ligand binding domain
  • An example of an AR variant that lacks an LBD is AR-V7.
  • AR- V7 includes androgen receptor splice variant 7, a contituitively active variant of an AR that lacks a functional ligand binding domain (LBD). See, e.g., Hu et al, Cancer Research, 69(1): 16-22 (2009).
  • “Pharmaceutically acceptable” or “therapeutically acceptable” includes a substance which does not interfere with the effectiveness or the biological activity of the active ingredients and which is not toxic to the hosts in the amounts used, and which hosts may be either humans or animals to which it is to be administered.
  • Alkyl refers to a straight or branched, saturated, aliphatic radical having the number of carbon atoms indicated. Alkyl can include any number of carbons, such as C 1-2 , Ci-3, Ci-4, Ci-5, Ci-6, Ci-7, Ci-8, Ci-9, Ci-io, C 2 . 3 , C 2 . 4 , C 2 -5, C 2 -6, C 3 - 4, C 3 - 5, C 3 - 6, C 4 -5, C4 -6 and C5-6.
  • Ci -6 alkyl includes, but is not limited to, methyl, ethyl, propyl, isopropyl, butyl, isobutyl, sec-butyl, tert-butyl, pentyl, isopentyl, hexyl, etc.
  • Alkyl can also refer to alkyl groups having up to 20 carbons atoms, such as, but not limited to heptyl, octyl, nonyl, decyl, etc. Alkyl groups can be substituted or unsubstituted.
  • Alkylene refers to a straight or branched, saturated, aliphatic radical having the number of carbon atoms indicated, and linking at least two other groups, i.e., a divalent hydrocarbon radical.
  • the two moieties linked to the alkylene can be linked to the same atom or different atoms of the alkylene group.
  • a straight chain alkylene can be the bivalent radical of -(CH 2 ) n - , where n is 1, 2, 3, 4, 5 or 6.
  • Representative alkylene groups include, but are not limited to, methylene, ethylene, propylene, isopropylene, butylene, isobutylene, sec-butylene, pentylene and hexylene.
  • Alkylene groups can be substituted or unsubstituted.
  • Alkenyl refers to a straight chain or branched hydrocarbon having at least 2 carbon atoms and at least one double bond. Alkenyl can include any number of carbons, such as C 2 , C 2- 3, C 2- 4, C 2 -5, C 2- 6, C 2- 7, C 2- 8, C 2- 9, C 2- io, C 3 , C 3 . 4 , C 3 - 5 , C 3 - 6 , C 4 , C 4 - 5 , C 4 -6, C 5 , C5-6, and C 6 . Alkenyl groups can have any suitable number of double bonds, including, but not limited to, 1, 2, 3, 4, 5 or more.
  • alkenyl groups include, but are not limited to, vinyl (ethenyl), propenyl, isopropenyl, 1-butenyl, 2-butenyl, isobutenyl, butadienyl, 1-pentenyl, 2-pentenyl, isopentenyl, 1,3-pentadienyl, 1,4-pentadienyl, 1-hexenyl, 2-hexenyl, 3-hexenyl, 1,3-hexadienyl, 1,4-hexadienyl, 1,5-hexadienyl, 2,4-hexadienyl, or 1,3,5-hexatrienyl.
  • Heteroalkyl refers to an alkyl group of any suitable length and having from 1 to 3 heteroatoms such as N, O and S. Additional heteroatoms can also be useful, including, but not limited to, B, Al, Si and P. The heteroatoms can also be oxidized, such as, but not limited to, -S(O)- and -S(0) 2 -.
  • heteroalkyl can include ethers, thioethers and alkyl-amines.
  • the heteroatom portion of the heteroalkyl can replace a hydrogen of the alkyl group to form a hydroxy, thio or amino group.
  • the heteroartom portion can be the connecting atom, or be inserted between two carbon atoms.
  • Haloalkyl refers to an alkyl group, where some or all of the hydrogen atoms are replaced with halogen atoms.
  • alkyl group haloalkyl groups can have any suitable number of carbon atoms, such as Ci -6 .
  • haloalkyl includes trifluoromethyl, flouromethyl, etc.
  • perfluoro can be used to define a compound or radical where all the hydrogens are replaced with fluorine.
  • perfluoromethyl refers to 1,1, 1 -trifluoromethyl.
  • Alkoxy refers to an alkyl group having an oxygen atom that connects the alkyl group to the point of attachment: alkyl-O-.
  • alkyl group alkoxy groups can have any suitable number of carbon atoms, such as Ci -6 .
  • Alkoxy groups include, for example, methoxy, ethoxy, propoxy, iso-propoxy, butoxy, 2-butoxy, iso-butoxy, sec-butoxy, tert-butoxy, pentoxy, hexoxy, etc.
  • the alkoxy groups can be further substituted with a variety of substituents described within. Alkoxy groups can be substituted or unsubstituted.
  • Aryl refers to an aromatic ring system having any suitable number of ring atoms and any suitable number of rings.
  • Aryl groups can include any suitable number of ring atoms, such as, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or 16 ring atoms, as well as from 6 to 10, 6 to 12, or 6 to 14 ring members.
  • Aryl groups can be monocyclic, fused to form bicyclic or tricyclic groups, or linked by a bond to form a biaryl group.
  • Representative aryl groups include phenyl, naphthyl and biphenyl. Other aryl groups include benzyl, having a methylene linking group.
  • aryl groups have from 6 to 12 ring members, such as phenyl, naphthyl or biphenyl. Other aryl groups have from 6 to 10 ring members, such as phenyl or naphthyl. Some other aryl groups have 6 ring members, such as phenyl.
  • Aryl groups can be substituted or unsubstituted.
  • Heteroaryl refers to a monocyclic or fused bicyclic or tricyclic aromatic ring assembly containing 5 to 16 ring atoms, where from 1 to 5 of the ring atoms are a heteroatom such as N, O or S. Additional heteroatoms can also be useful, including, but not limited to, B, Al, Si and P. The heteroatoms can also be oxidized, such as, but not limited to, -S(O)- and -S(0) 2 -. Heteroaryl groups can include any number of ring atoms, such as, 3 to 6, 4 to 6, 5 to 6, 3 to 8, 4 to 8, 5 to 8, 6 to 8, 3 to 9, 3 to 10, 3 to 11, or 3 to 12 ring members.
  • heteroaryl groups can have from 5 to 8 ring members and from 1 to 4 heteroatoms, or from 5 to 8 ring members and from 1 to 3 heteroatoms, or from 5 to 6 ring members and from 1 to 4 heteroatoms, or from 5 to 6 ring members and from 1 to 3 heteroatoms.
  • the heteroaryl group can include groups such as pyrrole, pyridine, imidazole, pyrazole, triazole, tetrazole, pyrazine, pyrimidine, pyridazine, triazine (1,2,3-, 1,2,4- and 1,3,5-isomers), thiophene, furan, thiazole, isothiazole, oxazole, and isoxazole.
  • heteroaryl groups can also be fused to aromatic ring systems, such as a phenyl ring, to form members including, but not limited to, benzopyrroles such as indole and isoindole, benzopyridines such as quinoline and isoquinoline, benzopyrazine (quinoxaline), benzopyrimidine (quinazoline), benzopyridazines such as phthalazine and cinnoline, benzothiophene, and benzofuran.
  • Other heteroaryl groups include heteroaryl rings linked by a bond, such as bipyridine. Heteroaryl groups can be substituted or unsubstituted.
  • Cycloalkyl refers to a saturated or partially unsaturated, monocyclic, fused bicyclic or bridged poly cyclic ring assembly containing from 3 to 12 ring atoms, or the number of atoms indicated. Cycloalkyl can include any number of carbons, such as C 3 . 6 , C 4 . 6 , C5-6, C 3-8 , C 4-8 , C 5-8 , C 6-8 , C 3 .9, C3.1t), C 3 - i i, and C 3 . 12 .
  • Saturated monocyclic cycloalkyl rings include, for example, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, and cyclooctyl.
  • Saturated bicyclic and polycyclic cycloalkyl rings include, for example, norbornane, [2.2.2] bicyclooctane, decahydronaphthalene and adamantane. Cycloalkyl groups can also be partially unsaturated, having one or more double or triple bonds in the ring.
  • Representative cycloalkyl groups that are partially unsaturated include, but are not limited to, cyclobutene, cyclopentene, cyclohexene, cyclohexadiene (1,3- and 1,4-isomers), cycloheptene, cycloheptadiene, cyclooctene, cyclooctadiene (1,3-, 1,4- and 1,5-isomers), norbornene, and norbornadiene.
  • exemplary groups include, but are not limited to cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl and cyclooctyl.
  • exemplary groups include, but are not limited to cyclopropyl, cyclobutyl, cyclopentyl, and cyclohexyl. Cycloalkyl groups can be substituted or unsubstituted.
  • Heterocycloalkyl refers to a saturated or partially unsaturated ring system having from 3 to 13 ring members and from 1 to 4 heteroatoms of N, O and S. Heterocycloalkyl groups can include fused bi- or tri- cyclic systems, and can include one or more points of unsaturation. Additional heteroatoms can also be useful, including, but not limited to, B, Al, Si and P. The heteroatoms can also be oxidized, such as, but not limited to, -S(O)- and -S(0) 2 -.
  • Heterocycloalkyl groups can include any number of ring atoms, such as, 3 to 6, 4 to 6, 5 to 6, 3 to 8, 4 to 8, 5 to 8, 6 to 8, 3 to 9, 3 to 10, 3 to 11, 3 to 12 or 3 to 13 ring members. Any suitable number of heteroatoms can be included in the heterocycloalkyl groups, such as 1, 2, 3, or 4, or 1 to 2, 1 to 3, 1 to 4, 2 to 3, 2 to 4, or 3 to 4.
  • the heterocycloalkyl group can include groups such as aziridine, azetidine, pyrrolidine, piperidine, azepane, azocane, quinuclidine, pyrazolidine, imidazolidine, piperazine (1,2-, 1,3- and 1,4-isomers), oxirane, oxetane, tetrahydrofuran, oxane (tetrahydropyran), oxepane, thiirane, thietane, thiolane (tetrahydrothiophene), thiane (tetrahydrothiopyran), oxazolidine, isoxazolidine, thiazolidine, isothiazolidine, dioxolane, dithiolane, or morpholine.
  • groups such as aziridine, azetidine, pyrrolidine, piperidine, azepane, azocane, quinuclidine, pyr
  • heterocycloalkyl groups can also be fused to aromatic or non-aromatic ring systems to form members including, but not limited to, indoline.
  • Heterocycloalkyl groups can be unsubstituted or substituted.
  • the heterocycloalkyl groups can be linked via any position on the ring.
  • piperidine can be 1-, 2-, 3- or 4-piperidine
  • pyrazolidine can be 1-, 2-, 3-, or 4- pyrazolidine
  • imidazolidine can be 1-, 2-, 3- or 4-imidazolidine
  • piperazine can be 1-, 2-, 3- or 4-piperazine
  • morpholine can be 1-, 2-, 3- or 4-morpholine.
  • compositions, methods, and kits comprising one or more RORy inhibitors, alone or in combination with one or more anticancer drugs, such as an anti-androgen drug, that are useful for treating cancer, e.g. , prostate cancer, such as castration-resistant prostate cancer (CRPC), and numerous other types of cancer including lung cancer, breast cancer, liver cancer, ovarian cancer, endometrial cancer, bladder cancer, colon cancer, lymphoma, and glioma.
  • cancer e.g., prostate cancer, such as castration-resistant prostate cancer (CRPC)
  • CRPC castration-resistant prostate cancer
  • numerous other types of cancer including lung cancer, breast cancer, liver cancer, ovarian cancer, endometrial cancer, bladder cancer, colon cancer, lymphoma, and glioma.
  • RORy inhibitors include compounds that inhibit retinoic acid receptor-related orphan receptor y (RORy) transcription, translation, stability, and/or activity.
  • RORy inhibitors bind to RORy and inhibit the activity of the receptor.
  • RORy inhibitors selectively bind to RORy and inhibit RORy activity relative to RORa and/or RORp.
  • inhibition of RORy activity can include inhibition of recruitment of coactivators such as SRC-1 and/or SRC-3 to an androgen receptor (AR) ROR response element (RORE).
  • inhibition of RORy activity can include inhibition of transcription of the AR gene and/or a variant thereof such as AR-V7.
  • RORy inhibitors include inverse agonists that bind to RORy and decrease its activity below a constitutive (e.g., intrinsic or basal) level activity in the absence of any ligand.
  • RORy inhibitors include pharmaceutically acceptable salts, derivatives, analogs, isomers, racemates, prodrugs, co-crystalline complexes, hydrates, and solvates thereof.
  • the RORy inhibitor is a small molecule compound.
  • the RORy inhibitor is a small organic molecule, either naturally occurring or synthetic, that has a molecular weight of more than about 50 Daltons and less than about 2500 Daltons, e.g., between about 100 to about 2000 Daltons, between about 100 to about 1000 Daltons, between about 200 to about 1000 Daltons, or between about 200 to about 500 Daltons.
  • the RORy inhibitor has a half-maximal inhibitory concentration (IC50) value of from about 100 nM to about 100 ⁇ , e.g., from about 100 nM to about 50 ⁇ , from about 100 nM to about 25 ⁇ , from about 100 nM to about 10 ⁇ , from about 500 nM to about 100 ⁇ , from about 500 nM to about 50 ⁇ , from about 500 nM to about 25 ⁇ , from about 500 nM to about 10 ⁇ , from about 1 ⁇ to about 100 ⁇ , from about 1 ⁇ to about 50 ⁇ , from about 1 ⁇ to about 25 ⁇ , from about 1 ⁇ to about 10 ⁇ , or about 100 nM, 200 nM, 300 nM, 400 nM, 500 nM, 600 nM, 700 nM, 800 nM, 900 nM, 1 ⁇ , 2 ⁇ , 3 ⁇ , 4 ⁇ , 5 ⁇ , 6 ⁇ , 7 ⁇ , 8
  • the IC50 value for a specific RORy inhibitor is measured using an in vitro assay in cancer cells that have been incubated with the RORy inhibitor.
  • the IC50 value can be determined based on the effect of the RORy inhibitor in inhibiting the survival of cancer cells such as cells from a cancer cell line or primary tumor cells.
  • the RORy inhibitor has an inhibitor constant (Ki) that is essentially the same numerical value as the IC50 value, or is about one-half the value of the IC50 value.
  • RORy inhibitors include, but are not limited to, the small molecule compounds disclosed in Table 1.
  • RORy inhibitors include, but are not limited to, 2-oxo-l,2- dihydrobenzo[cd]indole-6-sulfonamide derivatives such as those compounds described in, e.g., Zhang et al., Eur. J. Med. Chem., 6;78:431-41 (2014), the contents of which are herein incorporated by reference in their entirety for all purposes.
  • the RORy inhibitors include compounds represented by Formula I:
  • Ri is selected from the group consisting of H, Ci -8 alkyl, C2- 8 alkeyl, -C(0)R a , -C(0) HR a , Ci-sheteroalkyl, Ci -8 alkyleneC(0)R a , and Ci -8 alkyleneC(0) HR a ;
  • each R a is independently selected from the group consisting of H, Ci -8 alkyl, C 2-5 alkeyl, alkyoxy, -OH, and -SH;
  • R 2 is selected from the group consisting of H, Ci -8 alkyl, -C(0)R b , -C(0) HR b , Ci.
  • R b is selected from the goup consisting of H, Ci-salkyl, alkoxy, -OH, -SH, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, wherein the cycloalkyl, heterocycloalkyl, aryl, and heteroaryl group can be optionally substituted with 1-3 R c substituents;
  • each R c is independently selected from the group consisting of Ci -8 alkyl, Ci. shaloalkyl, Ci -8 heteroalkyl, -OH, -SH, - HR a , -C(0)R a , -C(0) HR a , Ci -8 heteroalkyl, Ci. 8 alkyleneC(0)R a , and Ci -8 alkyleneC(0)NHR a ;
  • R 3 is selected from the group consisting of cycloalkyl, heterocycloalkyl, aryl, heteroaryl, Ci -8 alkylenecycloalkyl, Ci -8 alkyleneheterocycloalkyl, Ci -8 alkylenearyl, Ci. 8 alkyleneheteroaryl, wherein the cycloalkyl, heterocycloalkyl, aryl, heteroaryl group can be optionally substituted with 1-5 R d substituents;
  • each R d is independently selected from the group consisting of halo, Ci -8 alkyl, alkoxy, Ci-ehaloalkyl, Ci -8 heteroalkyl, oxo, thioxo, aryl, heteroaryl, -OR e , -SR e , - HR e , -C(0)R e , - C(0) HR e , - HC(0)R e , diazenyl-R e , Ci -3 alkylenearyl, Ci -3 alkyleneheteroaryl; and
  • each R e is independently selected from the group consisting of H, Ci -8 alkyl, C 2-
  • Ri is selected from the group consisting of H and C 1-3 alkyl.
  • R 2 is selected from the group consisting of H and C(0)R b , wherein R b is an optionally substituted heteroaryl.
  • R 3 is selected from the group consisting of the substituents shown in Table 2.
  • the squiggly line represents the point of attachment to the remainder of the molecule.
  • variable groups Ri, R 2 , and R 3 are as defined in International Patent Publication No. WO 2015/096771, the contents of which are herein incorporated by reference in their entirety for all purposes.
  • the compound of Formula I comprises N-(3',4'- dimethoxyphenyl)- 1 -ethyl-2-oxo- 1 ,2-dihydrobenzo[cd]indole-6-sulfonamide (known as XY011, El l, and 8k).
  • the compound of Formula I comprises (E)-l- ethyl-2-oxo-N-(4'-(phenyldiazenyl)phenyl)-l,2-dihydrobenzo[cd]indole-6-sulfonamide (known as 7k).
  • the compound of Formula I comprises 1-Ethyl-N- (isoquinolin-7'-yl)-2-oxo-l,2-dihydrobenzo[cd]indole-6-sulfonamide (known as 6f). See, Zhang et al., Eur. J. Med. Chem., 6;78:431-41 (2014), the contents of which are herein incorporated by reference in their entirety for all purposes.
  • the RORy inhibitors include the thiazolopyrrolidine inhibitors ⁇ e.g., compounds comprising a 5,6-dihydro-4H-pyrrolo[3,4-d]thiazole core) described in International Patent Publication No. WO 2014/179564, the contents of which are herein incorporated by reference in their entirety for all purposes.
  • the RORy inhibitors include the dihydropyrrolopyridine inhibitors ⁇ e.g., compounds comprising a 6,7-dihydro-5H-pyrrolo[3,4-b]pyridine core) described in International Patent Publication No. WO 2015/116904, the contents of which are herein incorporated by reference in their entirety for all purposes.
  • the dihydropyrrolopyridine inhibitor is VTP-43742.
  • the RORy inhibitors include the bicyclic heterocyclic inhibitors ⁇ e.g., compounds comprising a thieno[3,2-b]pyrrole or thieno[3,2-c]pyrazole core) described in International Patent Publication No. WO 2015/008234, the contents of which are herein incorporated by reference in their entirety for all purposes. See, Gege, Expert Opinion on Therapeutic Patents, 25: 10, 1215-1221, DOI: 10.1517/13543776.2015.1065816 (2015), the contents of which are herein incorporated by reference in their entirety for all purposes.
  • RORy inhibitors include, but are not limited to, the aryl and heteroaryl amide compounds described in International Patent Publication No. WO 2013/171729, the 4-heteroaryl substituted benzoic acid compounds described in International Patent Publication No. WO 2014/028589, the N-alkylated indole and indazole compounds described in International Patent Publication No. WO 2014/028591, the 3-cyclohexenyl and cyclohexyl substituted indole and indazole compounds described in International Patent Publication No. WO 2014/028597, the 3-aminocycloalkyl compounds described in International Patent Publication No.
  • WO 2014/028600 the keto-imidazopyridine derivatives described in International Patent Publication No. WO 2015/036411, the fused pyridine and pyrimidine derivatives described in International Patent Publication No. WO 2015/083130, the fused thiophene and thiazole derivatives described in International Patent Publication No. WO 2015/101928, the compounds described in International Patent Publication Nos. WO 2012/100734, WO 2012/106995, WO 2013/160418, WO 2015/061515, WO 2015/082533, and WO 2013/019682, the ⁇ -sultam compounds described in Fauber et al, J. Med.
  • RORy inhibitors can be tested for their effect on any type of cancer using in vitro assays that assess the viability, apoptosis, growth, and/or colony formation of cancer cell lines or primary cancer ⁇ e.g., tumor) cells. See, Example 1 below for exemplary protocols of cell viability, apoptosis, growth, and colony formation assays.
  • known and candidate RORy inhibitors can be tested for their effect on any type of cancer using in vivo animal models such as xenograft tumor models. See, Example 1 below for exemplary protocols of xenograft tumor models and treatment with RORy inhibitors.
  • the RORy inhibitors of the present invention can be used in combination with an anticancer drug to reduce or reverse cancer cell resistance to the anticancer drug by sensitizing the cancer cell to the anticancer drug.
  • Non-limiting examples of anticancer drugs include anti-androgen drugs, chemotherapeutic agents, radiotherapeutic agents, antigen-specific immunotherapeutic agents, endocrine therapies, tyrosine kinase inhibitors, and combinations thereof.
  • Anti-androgen drugs are compounds that inhibit the transcription, translation, stability, and/or activity of androgen receptors (AR) or variants thereof ⁇ e.g. AR-V7). Inhibition of AR activity can include inhibition of recruitment of AR to Androgen Response Elements (AREs). In some embodiments, inhibition of AR activity can include inhibition of recruitment of AR to the PSA promoter. In some embodiments, inhibition of AR activity can include inhibition of AR-induced activation of the PSA promoter. In some embodiments, inhibition of AR activity can include inhibition of AR-induced PSA production. For example, inhibition of AR can include inhibition of production of PSA in the absence of DHT.
  • AR androgen receptors
  • Anti-androgen drugs include, but are not limited to, enzalutamide, abiraterone, bicalutamide, fiutamide, nilutamide, apalutamide, finasteride, dutasteride, alfatradiol, and combinations thereof.
  • the present invention provides a composition comprising one or more RORy inhibitors in combination with one or more anti-androgen drugs.
  • the composition further comprises a pharmaceutically acceptable excipient or diluent.
  • the composition is formulated for oral or parenteral administration.
  • the present invention provides a method for treating cancer in a subject comprising administering to the subject an effective amount of one or more RORy inhibitors in combination with one or more anti-androgen drugs.
  • the effective amount of one or more RORy inhibitors is an amount sufficient to sensitize an anti-androgen drug-resistant cancer such as anti-androgen drug-resistant prostate cancer (e.g., castration-resistant prostate cancer) to anti-androgen drug treatment.
  • the RORy inhibitors and anti-androgen drugs can be delivered to a subject via the same route of administration (e.g., orally or parenterally) or via different routes of administration (e.g., intravenously for RORy inhibitors and orally for anti-androgen drugs, or vice versa).
  • Chemotherapeutic agents include, but are not limited to, anthracenediones (anthraquinones) such as anthracyclines (e.g., daunorubicin (daunomycin; rubidomycin), doxorubicin, epirubicin, idarubicin, and valrubicin), mitoxantrone, and pixantrone; platinum-based agents (e.g., cisplatin, carboplatin, oxaliplatin, satraplatin, picoplatin, nedaplatin, triplatin, and lipoplatin); tamoxifen and metabolites thereof such as 4-hydroxytamoxifen (afimoxifene) and N-desmethyl-4-hydroxytamoxifen (endoxifen); taxanes such as paclitaxel (taxol), docetaxel, cabazitaxel, hongdoushan A, hongdous
  • the present invention provides a composition comprising one or more RORy inhibitors in combination with one or more chemotherapeutic agents.
  • the composition further comprises a pharmaceutically acceptable excipient or diluent.
  • the composition is formulated for oral or parenteral administration.
  • the present invention provides a method for treating cancer in a subject comprising administering to the subject an effective amount of one or more RORy inhibitors in combination with one or more chemotherapeutic agents.
  • the effective amount of one or more RORy inhibitors is an amount sufficient to sensitize a chemotherapy drug-resistant cancer such as a tamoxifen-resistant cancer (e.g., tamoxifen-resistant breast cancer) or a taxane-resistant cancer (e.g., docetaxel-resistant prostate cancer) to chemotherapy drug treatment.
  • a chemotherapy drug-resistant cancer such as a tamoxifen-resistant cancer (e.g., tamoxifen-resistant breast cancer) or a taxane-resistant cancer (e.g., docetaxel-resistant prostate cancer) to chemotherapy drug treatment.
  • the RORy inhibitors and chemotherapeutic agents can be delivered to a subject via the same route of administration (e.g., orally or parenterally) or via different routes of administration (e.g., intravenously for RORy inhibitors and orally for chemotherapeutic agents, or vice versa).
  • Radiotherapeutic agents are well known in the art and can comprise external-beam radiation therapy and/or internal radiation therapy.
  • External beam radiation therapy delivers radioactive beams of high energy X-rays and/or gamma rays to a patient's tumor
  • internal radiation therapy delivers radioactive atoms to a patient' s tumor.
  • Both external beam radiation therapy and internal radiation therapy are used to suppress tumor growth or kill cancer cells by delivering a sufficient quantity of radioactivity to the target site.
  • the radiotherpaeutic agent comprises a radioactive atom and is complexed with a biologic or synthetic agent to increase delivery to the target site.
  • biologic or synthetic agents are known in the art.
  • Suitable radioactive atoms for use with the RORy inhibitors of the present invention include any of the radionuclides described herein, or any other isotope which emits enough energy to destroy a targeted tissue or cell.
  • radiotherapeutic agents may be coupled to targeting moieties, such as antibodies, to improve the localization of radiotherapeutic agents to cancerous cells.
  • radioactivity refers to the radiation, including alpha particles, beta particles, nucleons, electrons, positrons, neutrinos, and gamma rays, emitted by a radioactive substance.
  • radionuclides suitable for use in the present invention include, but are not limited to, fluorine 18 ( 18 F), fluorine 19 ( 19 F), phosphorus 32 ( 32 P), scandium 47 ( 47 Sc), cobalt 55 ( 55 Co), copper 60 ( 60 Cu), copper 61 ( 61 Cu), copper 62 ( 62 Cu), copper 64 ( 64 Cu), gallium 66 ( 66 Ga), copper 67 ( 67 Cu), gallium 67 ( 67 Ga), gallium 68 ( 68 Ga), rubidium 82 ( 82 Rb), yttrium 86 ( 86 Y), yttrium 87 ( 87 Y), strontium 89 ( 89 Sr), yttrium 90 ( 90 Y), rhodium 105 ( 105 Rh), silver 111 ( lu Ag), indium 111 ( U1 ln), iodine 124 ( 124 I), iodine 125 ( 125 I), iodine 131 ( 131 I), tin 1
  • the "m” in 117m Sn and 99m Tc stands for the meta state.
  • naturally-occurring radioactive elements such as uranium, radium, and thorium, which typically represent mixtures of radioisotopes, are suitable examples of radionuclides.
  • 0, Cu, 13 % l Lu, and i60 Re are beta- and gamma-emitting radionuclides.
  • Bi is an alpha- and beta-emitting radionuclide.
  • 211 At is an alpha-emitting radionuclide.
  • 32 P, 47 Sc, 89 Sr, 90 Y, 105 Rh, m Ag, 117m Sn, 149 Pm, 153 Sm, 166 Ho, and 188 Re are examples of beta- emitting radionuclides.
  • 67 Ga, U1 ln, 99m Tc, and 201 T1 are examples of gamma-emitting radionuclides.
  • 55 Co, 60 Cu, 61 Cu, 62 Cu, 66 Ga, 68 Ga, 82 Rb, and 86 Y are examples of positron- emitting radionuclides.
  • 64 Cu is a beta- and positron-emitting radionuclide.
  • the present invention provides a composition comprising one or more RORy inhibitors in combination with one or more radiotherapeutic agents.
  • the composition further comprises a pharmaceutically acceptable excipient or diluent.
  • the composition is formulated for oral or parenteral administration.
  • the present invention provides a method for treating cancer in a subject comprising administering to the subject an effective amount of one or more RORy inhibitors in combination with one or more radiotherapeutic agents.
  • the effective amount of one or more RORy inhibitors is an amount sufficient to sensitize a radiation-resistant cancer such as a radiation-resistant breast cancer to radiation treatment.
  • the RORy inhibitors and radiotherapeutic agents can be delivered to a subject via the same route of administration (e.g., orally or parenterally) or via different routes of administration (e.g., intravenously for RORy inhibitors and orally for radiotherapeutic agents, or vice versa).
  • Endocrine therapy is the manipulation of the endocrine system through the administration of specific hormones or drugs which inhibit or decrease the production or activity of targeted hormones or alter the gene expression pattern of targeted cells. Endocrine therapy is particularly useful in certain types of cancer, including breast cancer. Any known hormone antagonist or modulator may be used in the present invention.
  • Endocrine therapies useful in the present invention include, but are not limited to, aromatase inhibitors (e.g. letrozole), megestrol acetate, flutamide, tamoxifen, raloxifene, lasofoxifene, apeledoxifene, thaledoxifene/conjugated estrogens, and combinations thereof.
  • the present invention provides a composition comprising one or more RORy inhibitors in combination with one or more endocrine therapies.
  • the composition further comprises a pharmaceutically acceptable excipient or diluent.
  • the composition is formulated for oral or parenteral administration.
  • the present invention provides a method for treating cancer in a subject comprising administering to the subject an effective amount of one or more RORy inhibitors in combination with one or more endocrine therapies.
  • the effective amount of one or more RORy inhibitors is an amount sufficient to sensitize an endocrine therapy -resistant cancer such as a tamoxifen-resistant breast cancer to endocrine therapy.
  • the RORy inhibitors and endocrine therapies can be delivered to a subject via the same route of administration (e.g., orally or parenterally) or via different routes of administration (e.g., intravenously for RORy inhibitors and orally for endocrine therapies, or vice versa).
  • Tyrosine kinase inhibitors are small molecules that inhibit tyrosine kinase proteins.
  • Tyrosine kinases are enzymes that activate many proteins in cellular signal transduction cascades by addition of a phosphate group to the protein. High expression and aberrant activation, of tyrosine kinase proteins can cause undesirable "switching on" of cellular signaling pathways that can result in uncontrolled cellular proliferation associated with cancerous cellular phenotypes.
  • Various forms of cancer are currently treated by inhibiting or reducing the activity of poorly regulated tyrosine kinase proteins with tyrosine kinase inhibitors.
  • Treatment regimens with tyrosine kinase inhibitors can suppress, reduce the incidence, reduce the severity, or inhibit the progression of cancer.
  • tyrosine kinase inhibitors include, but are not limited to, gefitinib, erlotinib, sorafenib, sunitinib, dasatinib, lapatinib, nilotinib, bortezomib, salinomycin, and combinations thereof.
  • the present invention provides a composition comprising one or more RORy inhibitors in combination with one or more tyrosine kinase inhibitors.
  • the composition further comprises a pharmaceutically acceptable excipient or diluent.
  • the composition is formulated for oral or parenteral administration.
  • the present invention provides a method for treating cancer in a subject comprising administering to the subject an effective amount of one or more RORy inhibitors in combination with one or more tyrosine kinase inhibitors.
  • the effective amount of one or more RORy inhibitors is an amount sufficient to sensitize a tyrosine kinase inhibitor-resistant cancer such as a tyrosine kinase inhibitor- resistant non-small-cell lung cancer (NSCLC) to tyrosine kinase inhibitor therapy.
  • NSCLC non-small-cell lung cancer
  • the RORy inhibitors and tyrosine kinase inhibitors can be delivered to a subject via the same route of administration (e.g., orally or parenterally) or via different routes of administration (e.g., intravenously for RORy inhibitors and orally for tyrosine kinase inhibitors, or vice versa).
  • routes of administration e.g., orally or parenterally
  • routes of administration e.g., intravenously for RORy inhibitors and orally for tyrosine kinase inhibitors, or vice versa.
  • antigen-specific immunotherapeutic agents include compounds and compositions designed to stimulate the immune system to specifically recognize antigens expressed or overexpressed by cancerous cells.
  • antigen-specific immunotherapeutic agents include compounds and compositions that will specifically recognize antigens expressed or overexpressed by cancerous cells.
  • Non-limiting examples of antigen-specific immunotherapeuti c agents include vaccines (e.g., peptide vaccines), antibodies, cytotoxic T cell lymphocytes (CTLs), chimeric antigen receptor T cells (CAR-T cells), immune checkpoints (e.g., CTLA-4, PD-1, and PD-L1), immune modulating cytokines (e.g., IL-6 and IL-17), and combinations thereof.
  • the antigens presented by cancerous cells are highly specific to each cancer type, and the vaccines, antibodies, CTLs, and/or CAR-T cells used is dependent on the cancer type being treated.
  • a vaccine can stimulate the immune system to specifically recognize and attack antigens presented by cancerous cells.
  • Vaccines can comprise one or more peptides, peptide fragments, fusion peptides, DNA, RNA, other biologic or non-biologic material or combinati ons thereof,
  • one or more peptides, peptide fragments, or fusion peptides may be used for a peptide vaccine.
  • the peptides may be harvested from an endogenous source or chemically synthesized.
  • the peptides chosen are specific for the type of cancer being treated. For example, when targeting cancer cells, some commonly targeted proteins include GM-CSF, IL-13Ra2, EphA2, and Survivin; however, specific cancer types will have specifically preferred peptides used for targeting afflicted cells.
  • the one or more peptides in the peptide vaccine are free soluble peptides.
  • the one or more peptides in the peptide vaccine are tethered together using any means known in the art.
  • vaccines include cancer vaccines such as, e.g., tecemotide (L-BLP25), oncophage, sipuleucel-T, and combinations thereof.
  • Tecemotide (L-BLP25) is a liposomal antigen-specific cancer immunotherapy that contains 25 amino acids from the immunogenic tandem-repeat region of MUC 1 (see, e.g., Mehta NR et al , Clin. Cancer Res., 18:2861-2871 (2012)).
  • Antibodies can recognize antigens expressed or overexpressed by cancerous cells. Antigens recognized by these antibodies can be proteins expressed, activated, or overexpressed on the cell surface or proteins secreted into the extracellular fluid.
  • antibodies can be used to target human effector cells ⁇ e.g., macrophages) against, the cancerous cells.
  • antibodies are used to inhibit the normal function of cell surface receptors.
  • antibodies bind to the ligands of cel l surface receptors to block the cel lular signaling cascade.
  • Antibodies used as antigen- specific irnmunotherapeutic agents can be monoclonal or polyclonal antibodies as well as chimeric, humanized, or human antibodies, and can be previously isolated from the patient or produced from another biologic source. Methods of producing antibodies are well known in the art, and may be made by any known means.
  • antibodies described herein can be produced by conventional monoclonal antibody methodology e.g., the standard somatic cell hybridization technique of Kohler and Milstein, Nature 256: 495 (1975), the contents of which are herein incorporated by reference for all purposes.
  • antibodies useful in the treatment of cancer include immune checkpoint inhibitors.
  • antibodies useful in the treatment of cancer include, but are not limited to, alemtuzumab. bevacizumab, cetuximab, ipilimumab, nivolumab, ofatumumab, panitumumab, pembrolizumab, atezolizumab, rituximab, trastuzumab, and combinations thereof.
  • CTLs and CAR-T cells are used as antigen-specific irnmunotherapeutic agents.
  • Adoptive T cell transfer therapy is a technique that can boost the natural immune system's ability to combat cancer by enriching for and/or designing T cells that are able to effectively recognize, bind, and kill a diseased cell.
  • CTLs can recognize and bind cancerous cells using T-cell receptors (TCR).
  • TCRs contain a highly variable binding region that allow them to recognize a large range of antigens.
  • TCRs bind to the major histocompatibility complex I (MHC I) of cancerous cells presenting an appropriate antigen.
  • MHC I major histocompatibility complex I
  • TCRs binding is highly specific, so only a small number of CTLs will be able to recognize a particular antigen. Once an antigen is recognized by CTLs binding to the MHC I complex of the cancerous cell, they activate to induce cellular death. Activated CTLs proliferate to fight the detected cancer.
  • CTLs administered in this therapy may be derived from the subject or may be derived from other biological sources.
  • Methods for producing CTLs directed to a particular antigen are well known in the art, and can be harvested from an individual possessing a CTL directed to a particular antigen or produced outside of the body (ex vivo). For example, when treating cancer, cytotoxic T cells from a subject's tumor are isolated, the cytotoxic T cells with the greatest antitumor activity are identified, the identified cytotoxic T cells are cultured to produce large amounts of the most effective cells, and the cultured cytotoxic T cells are reintroduced into the subject to treat the cancer.
  • CTLs can also be produced in healthy individuals using ex vivo techniques described in U.S. Patent No.
  • CAR-T cells are modified T cells which have been engineered to possess a cellular specificity domain that has not been produced naturally.
  • the natural specificity domain of T cells are T-cell receptors that recognize a particular antigen presented on MHC class I molecules.
  • CAR-T cells possess a T-cell receptor that has not been naturally produced in a subject's body.
  • the cellular specificity domain is a monoclonal antibody that is specific for the targeted cells or tissue.
  • CAR-T cells can be produced using any means known in the art.
  • cytotoxic T cells are harvested from a subject's blood, the cytotoxic T cells are genetically modified by inserting a gene that encodes for a receptor that recognizes an antigen specific to the cancer affecting the subject, the CAR-T cells are cultured and can be stored for later use or reintroduced into the subject's body to treat the cancer.
  • U.S. Patent No. 9, 102,760, U.S. Patent No. 8,399,645, U.S. Patent No. 8,975,071, and U.S. Patent No. 8,916,381 the contents of which are herein incorporated by reference for all purposes.
  • the present invention provides a composition comprising one or more RORy inhibitors in combination with one or more antigen-specific immunotherapeutic agents.
  • the composition further comprises a pharmaceutically acceptable excipient or diluent.
  • the composition is formulated for oral or parenteral administration.
  • the present invention provides a method for treating cancer in a subject comprising administering to the subject an effective amount of one or more RORy inhibitors in combination with one or more antigen-specific immunotherapeutic agents.
  • the effective amount of one or more RORy inhibitors is an amount sufficient to sensitize a cancer that is resistant to treatment with antigen-specific immunotherapeutic agents to such treatment.
  • the RORy inhibitors and antigen-specific immunotherapeutic agents can be delivered to a subject via the same route of administration (e.g., orally or parenterally) or via different routes of administration (e.g., intravenously for RORy inhibitors and orally for antigen-specific immunotherapeutic agents, or vice versa).
  • a cancer can be treated or prevented by administering one or more RORy inhibitors.
  • the one or more RORy inhibitors are administered in combination with an anticancer drug.
  • Cancer generally includes any of various malignant neoplasms characterized by the proliferation of anaplastic cells that tend to invade surrounding tissue and metastasize to new body sites.
  • Non-limiting examples of different types of cancer suitable for treatment using the compositions of the present invention include prostate cancer, lung cancer, ovarian cancer, breast cancer, bladder cancer, thyroid cancer, liver cancer, pleural cancer, pancreatic cancer, cervical cancer, testicular cancer, colon cancer, anal cancer, bile duct cancer, gastrointestinal carcinoid tumors, esophageal cancer, gall bladder cancer, rectal cancer, appendix cancer, small intestine cancer, stomach (gastric) cancer, renal cancer (i.e., renal cell carcinoma), cancer of the central nervous system, skin cancer, choriocarcinomas, head and neck cancers, bone cancer, osteogenic sarcomas, fibrosarcoma, neuroblastoma, glioma, endometrial cancer, melanoma, leukemia (e.g., acute lymphocytic leukemia, chronic lymphocytic leukemia, acute myelogenous leukemia, chronic myelogenous leukemia, or hairy cell leukemia
  • the cancer is an epithelial cancer (e.g., prostate cancer, ovarian cancer, breast cancer, and the like), or a blood cancer (e.g., leukemia, lymphoma, multiple myeloma).
  • the cancer is a prostate cancer.
  • the prostate cancer is an advanced stage prostate cancer selected from one or more of metastatic prostate cancer, drug-resistant prostate cancer (e.g., anti-androgen- resistant prostate cancer such as enzalutamide-resistant prostate cancer, abiraterone-resistant prostate cancer, bicalutamide-resistant prostate cancer, etc.; taxane-resistant prostate cancer; docetaxel-resistant prostate cancer; and the like), hormone refractory prostate cancer, castration-resistant prostate cancer (CRPC), metastatic castration-resistant prostate cancer, AR-V7-induced drug-resistant prostate cancer such as AR-V7-induced anti-androgen- resistant prostate cancer (e.g., AR-V7-induced enzalutamide-resistant prostate cancer), AKR1C3 -induced drug-resistant prostate cancer such as AKR1C3 -induced anti-androgen- resistant prostate cancer (e.g., AKR1C3 -induced enzalutamide-resistant prostate cancer), and combinations thereof.
  • drug-resistant prostate cancer e.g.,
  • the cancer is a lung cancer, breast cancer, liver cancer, ovarian cancer, endometrial cancer, bladder cancer, colon cancer, lymphoma, or a glioma.
  • the lung cancer is a non-small-cell lung cancer (NSCLC), K-Ras mutant lung cancer, BRAF mutant lung cancer, tyrosine kinase inhibitor-resistant lung cancer, small cell lung cancer (SCLC), adenocarcinoma (e.g., adenocarcinoma in situ), squamous cell carcinoma, large cell carcinoma, bronchial carcinoid, or combinations thereof.
  • NSCLC non-small-cell lung cancer
  • K-Ras mutant lung cancer K-Ras mutant lung cancer
  • BRAF mutant lung cancer tyrosine kinase inhibitor-resistant lung cancer
  • SCLC small cell lung cancer
  • adenocarcinoma e.g., adenocarcinoma in situ
  • squamous cell carcinoma large cell carcinoma,
  • the breast cancer is triple-negative breast cancer (TNBC), tamoxifen-resistant breast cancer, radiation-resistant breast cancer, ductal carcinoma in situ, invasive ductal carcinoma, HER2-positive breast cancer, ER-positive breast cancer, inflammatory breast cancer, metastatic breast cancer, medullary carcinoma, tubular carcinoma, mucinous carcinoma (colloid), or combinations thereof.
  • the liver cancer is a hepatocellular carcinoma (HCC), cholangiocarcinoma (bile duct cancer), angiosarcoma, hepatoblastoma, or combinations thereof.
  • the glioma is an ependymoma, astrocytoma (e.g., glioblastoma multiforme), oligodendroglioma, brainstem glioma, optic nerve glioma, or combinations thereof (e.g., mixed glioma).
  • astrocytoma e.g., glioblastoma multiforme
  • oligodendroglioma e.g., brainstem glioma
  • optic nerve glioma e.g., optic nerve glioma, or combinations thereof (e.g., mixed glioma).
  • compositions of the present invention encompass compositions made by admixing one or more RORy inhibitors, such as SR221 1 and/or XY01 1, and a pharmaceutically acceptable carrier and/or excipient or diluent. Such compositions are suitable for pharmaceutical use in an animal or human.
  • compositions of the present invention may be prepared by any of the methods well-known in the art of pharmacy.
  • Pharmaceutically acceptable carriers suitable for use with the present invention include any of the standard pharmaceutical carriers, buffers and excipients, including phosphate-buffered saline solution, water, and emulsions (such as an oil/water or water/oil emulsion), and various types of wetting agents and/or adjuvants. Suitable pharmaceutical carriers and their formulations are described in Remington's Pharmaceutical Sciences (Mack Publishing Co., Easton, 19th ed. 1995). Preferred pharmaceutical carriers depend upon the intended mode of administration of the active agent(s).
  • compositions of the present invention can include one or more RORy inhibitors (e.g., SR221 1 and/or XY01 1), one or more anticancer drugs such as an anti- androgen drug (e.g., enzalutamide, abiraterone, and/or bicalutamide) and/or a chemotherapeutic agent (e.g., tamoxifen and/or a taxane such as docetaxel), or any pharmaceutically acceptable salts thereof, as an active ingredient, and a pharmaceutically acceptable carrier and/or excipient or diluent.
  • RORy inhibitors e.g., SR221 1 and/or XY01 1
  • anticancer drugs such as an anti- androgen drug (e.g., enzalutamide, abiraterone, and/or bicalutamide) and/or a chemotherapeutic agent (e.g., tamoxifen and/or a tax
  • the pharmaceutical composition can include one or more RORy inhibitors, such as SR221 1 and/or XYOl l, and an anti-androgen drug, such as enzalutamide.
  • RORy inhibitors such as SR221 1 and/or XYOl l
  • an anti-androgen drug such as enzalutamide.
  • a pharmaceutical composition may optionally contain other therapeutic ingredients.
  • the compounds of the present invention can be combined as the active ingredient in intimate admixture with a suitable pharmaceutical carrier and/or excipient according to conventional pharmaceutical compounding techniques. Any carrier and/or excipient suitable for the form of preparation desired for administration is contemplated for use with the compounds disclosed herein.
  • the pharmaceutical compositions comprising one or more RORy inhibitors and the pharmaceutical compositions comprising one or more anticancer drugs are prepared as a single medicament. In other embodiments, the pharmaceutical compositions comprising one or more RORy inhibitors and the pharmaceutical compositions comprising one or more anticancer drugs are prepared as separate medicaments.
  • compositions of the present invention include formulations suitable for topical, parenteral, pulmonary, nasal, rectal, or oral administration.
  • the most suitable route of administration in any given case will depend in part on the nature and severity of the cancer condition and also optionally the stage of the cancer.
  • the administration of the RORy inhibitor and the anticancer drug may be administered using the same or a different administration route.
  • both the RORy inhibitor and the anticancer drug may be administered orally or parenterally (e.g., intravenously).
  • the RORy inhibitor may be administered orally, while the anticancer drug may be administered parenterally (e.g., intravenously), or vice versa.
  • Other preferred compositions include compositions suitable for systemic (enteral or parenteral) administration.
  • Systemic administration includes oral, rectal, sublingual, or sublabial administration.
  • compositions for pulmonary administration include, but are not limited to, dry powder compositions consisting of the powder of a compound described herein, or a salt thereof, and the powder of a suitable carrier and/or lubricant.
  • the compositions for pulmonary administration can be inhaled from any suitable dry powder inhaler device known to a person skilled in the art.
  • Compositions for systemic administration include, but are not limited to, dry powder compositions consisting of the composition as set forth herein and the powder of a suitable carrier and/or excipient.
  • the compositions for systemic administration can be represented by, but not limited to, tablets, capsules, pills, syrups, solutions, and suspensions.
  • the present invention provides compositions further including a pharmaceutical surfactant.
  • the present invention provides compositions further including a cryoprotectant.
  • the cryoprotectant is selected from the group consisting of glucose, sucrose, trehalose, lactose, sodium glutamate, PVP, HPPCD, CD, glycerol, maltose, mannitol, and saccharose.
  • the present invention provides a pharmaceutical composition including one or more RORy inhibitors, such as SR221 1 and/or XY01 1, and a pharmaceutically acceptable excipient.
  • the present invention provides a pharmaceutical composition including one or more RORy inhibitors, such as SR221 1 and/or XY01 1, and one or more anticancer drugs such as an anti-androgen drug (e.g., enzalutamide, abiraterone, and/or bicalutamide) and/or a chemotherapeutic agent (e.g., tamoxifen and/or a taxane such as docetaxel), in combination with a pharmaceutically acceptable excipient.
  • an anti-androgen drug e.g., enzalutamide, abiraterone, and/or bicalutamide
  • a chemotherapeutic agent e.g., tamoxifen and/or a taxane such as docetaxel
  • the present invention provides a pharmaceutical composition including one or more RORy inhibitors, such as SR221 1 and/or XY01 1, and an anti-androgen drug, such as enzalutamide, in combination with a pharmaceutically acceptable excipient.
  • the pharmaceutically acceptable excipient includes a salt or a diluent.
  • the present invention provides compositions including an effective amount of one or more RORy inhibitors, such as SR221 1 and/or XY01 1.
  • the composition is formulated for oral administration or parenteral (e.g., intravenous) administration and includes one or more RORy inhibitors, such as SR2211 and/or XY011, and at least one member selected from the group consisting of an aqueous solution and a buffer solution.
  • the composition can include an effective amount of one or more RORy inhibitors, such as SR2211 and/or XYOl 1, and one or more anticancer drugs such as an anti-androgen drug (e.g., enzalutamide, abiraterone, and/or bicalutamide) and/or a chemotherapeutic agent (e.g., tamoxifen and/or a taxane such as docetaxel).
  • an anti-androgen drug e.g., enzalutamide, abiraterone, and/or bicalutamide
  • a chemotherapeutic agent e.g., tamoxifen and/or a taxane such as docetaxel
  • compositions or medicaments for use in the present invention can be formulated by standard techniques using one or more physiologically acceptable carriers or excipients. Suitable pharmaceutical carriers are described herein and in Remington: The Science and Practice of Pharmacy, 21st Ed., University of the Sciences in Philadelphia, Lippencott Williams & Wilkins (2005).
  • a pharmaceutical composition or a medicament can take the form of, e.g., a tablet or a capsule prepared by conventional means with a pharmaceutically acceptable excipient.
  • Liquid preparations for oral administration can take the form of, for example, solutions, syrups, or suspensions, or they can be presented as a dry product for constitution with water or other suitable vehicle before use.
  • Such liquid preparations can be prepared by conventional means with pharmaceutically acceptable additives, for example, suspending agents, for example, sorbitol syrup, cellulose derivatives, or hydrogenated edible fats; emulsifying agents, for example, lecithin or acacia; non-aqueous vehicles, for example, almond oil, oily esters, ethyl alcohol, or fractionated vegetable oils; and preservatives, for example, methyl or propyl-p-hydroxybenzoates or sorbic acid.
  • suspending agents for example, sorbitol syrup, cellulose derivatives, or hydrogenated edible fats
  • emulsifying agents for example, lecithin or acacia
  • non-aqueous vehicles for example, almond oil, oily esters, ethyl alcohol, or fractionated vegetable oils
  • compositions of the present invention can be made as implants, oily injections, or as particulate systems.
  • Particulate systems include microspheres, microparticles, microcapsules, nanocapsules, nanospheres, and nanoparticles.
  • Polymers can be used for ion-controlled release of compositions of the present invention.
  • Various degradable and nondegradable polymeric matrices for use in controlled drug delivery are known in the art (Langer R., Accounts Chem. Res., 26:537-542 (1993)).
  • the block copolymer, polaxamer 407 exists as a viscous yet mobile liquid at low temperatures but forms a semisolid gel at body temperature. It has shown to be an effective vehicle for formulation and sustained delivery of recombinant interleukin 2 and urease (Johnston et al, Pharm. Res., 9:425-434 (1992); and Pec et al, J. Parent. Sci.
  • hydroxyapatite has been used as a microcarrier for controlled release of proteins (Ijntema et al, Int. J. Pharm., 112:215-224 (1994)).
  • liposomes are used for controlled release as well as drug targeting of the lipid-capsulated drug (Betageri et al, LIPOSOME DRUG DELIVERY SYSTEMS, Technomic Publishing Co., Inc., Lancaster, PA (1993)).
  • Numerous additional systems for controlled delivery of therapeutic proteins are known. See, e.g., U.S. Pat. No.
  • compositions or medicaments comprising one or more RORy inhibitors can be administered to a subject at a therapeutically effective dose to treat the subject's cancer, as described herein.
  • pharmaceutical compositions or medicaments comprising one or more RORy inhibitors can be co-administered to a subject in combination with an effective amount of an anticancer drug at a therapeutically effective dose to treat the subject's cancer, as described herein.
  • the pharmaceutical composition or medicament comprising one or more RORy inhibitors is administered to a subject in an amount sufficient in to elicit an effective therapeutic response in the subject.
  • the pharmaceutical composition or medicament comprising one or more RORy inhibitors can be co-administered to a subject at a therapeutically effective dose in combination with an effective amount of an anticancer drug to elicit an effective therapeutic response in the subject.
  • the methods comprise first administering one or more RORy inhibitors, such as SR2211 and/or XYOl l, to a patient having cancer, and then administering an anticancer drug, such as an anti-androgen drug and/or a chemotherapeutic agent, to the patient.
  • the methods comprise first administering an anticancer drug, such as an anti- androgen drug and/or a chemotherapeutic agent, to a patient having cancer, and then administering one or more RORy inhibitors, such as SR2211 and/or XY011, to the patient.
  • the methods comprise co-administering one or more RORy inhibitors, such as SR2211 and/or XYOl l, with an anticancer drug, such as an anti-androgen drug and/or a chemotherapeutic agent, to a patient having cancer.
  • RORy inhibitors such as SR2211 and/or XYOl l
  • an anticancer drug such as an anti-androgen drug and/or a chemotherapeutic agent
  • the methods of administration comprise administering one or more RORy inhibitors, such as SR2211 and/or XYOl l, alone or in combination with enzalutamide to a patient in need thereof.
  • the methods of administration comprise administering one or more RORy inhibitors, such as SR2211 and/or XYOl l, alone or in combination with abiraterone to a patient in need thereof.
  • the methods comprise administering one or more RORy inhibitors, such as SR2211 and/or XYOl l, alone or in combination with bicalutamide to a patient in need thereof.
  • the methods comprise administering one or more RORy inhibitors, such as SR2211 and/or XY011, alone or in combination with a taxane such as docetaxel to a patient in need thereof. In further embodiments, the methods comprise administering one or more RORy inhibitors, such as SR2211 and/or XY011, alone or in combination with tamoxifen to a patient in need thereof.
  • the present invention provides a method of delivering an effective amount of one or more RORy inhibitors, such as SR2211 and/or XYOl 1, to a patient having cancer such as prostate cancer (e.g., CRPC).
  • RORy inhibitors such as SR2211 and/or XYOl 1
  • the RORy inhibitors described herein are useful in the manufacture of a pharmaceutical composition or a medicament.
  • a pharmaceutical composition or medicament can be administered to a subject in need thereof, e.g. a patient having a cancer such as prostate cancer (e.g., CRPC), lung cancer, breast cancer, liver cancer, ovarian cancer, endometrial cancer, bladder cancer, colon cancer, lymphoma, or a glioma.
  • prostate cancer e.g., CRPC
  • lung cancer breast cancer
  • liver cancer ovarian cancer
  • endometrial cancer e.g., bladder cancer
  • colon cancer e.g., lymphoma
  • lymphoma e.g., lymphoma
  • glioma glioma
  • compositions or medicaments for use in the present invention can be formulated by standard techniques using one or more physiologically acceptable carriers or excipients. Suitable pharmaceutical carriers are described herein and in "Remington's Pharmaceutical Sciences” by E.W. Martin. Compounds and agents of the present invention and their physiologically acceptable salts and solvates can be formulated for administration by any suitable route, including via inhalation, topically, nasally, orally, intravenously, parenterally, or rectally.
  • Typical formulations for topical administration include creams, ointments, sprays, lotions, and patches.
  • the pharmaceutical composition can, however, be formulated for any type of administration, e.g., intradermal, subdermal, intravenous, intramuscular, intranasal, intracerebral, intratracheal, intraarterial, intraperitoneal, intravesical, intrapleural, intracoronary or intratumoral injection, with a syringe or other devices.
  • Formulation for administration by inhalation e.g., aerosol
  • oral or rectal administration is also contemplated.
  • Suitable formulations for transdermal application include an effective amount of one or more compounds described herein, optionally with a carrier.
  • Preferred carriers include absorbable pharmacologically acceptable solvents to assist passage through the skin of the host.
  • transdermal devices are in the form of a bandage comprising a backing member, a reservoir containing the compound optionally with carriers, optionally a rate controlling barrier to deliver the compound to the skin of the host at a controlled and predetermined rate over a prolonged period of time, and means to secure the device to the skin.
  • Matrix transdermal formulations may also be used.
  • a pharmaceutical composition or a medicament can take the form of, for example, a tablet or a capsule prepared by conventional means with a pharmaceutically acceptable excipient.
  • the present invention provides tablets and gelatin capsules comprising one or more RORy inhibitors, such as SR2211 and/or XY011, alone or in combination with other compounds such as anticancer drugs, or a dried solid powder of these drugs, together with (a) diluents or fillers, e.g., lactose, dextrose, sucrose, mannitol, sorbitol, cellulose (e.g., ethyl cellulose, microcrystalline cellulose), glycine, pectin, polyacrylates and/or calcium hydrogen phosphate, calcium sulfate, (b) lubricants, e.g., silica, talcum, stearic acid, magnesium or calcium salt, metallic stearates, colloidal silicon dioxide, hydrogenated vegetable oil, corn starch,
  • Tablets may be either film coated or enteric coated according to methods known in the art.
  • Liquid preparations for oral administration can take the form of, for example, solutions, syrups, or suspensions, or they can be presented as a dry product for constitution with water or other suitable vehicle before use.
  • Such liquid preparations can be prepared by conventional means with pharmaceutically acceptable additives, for example, suspending agents, for example, sorbitol syrup, cellulose derivatives, or hydrogenated edible fats; emulsifying agents, for example, lecithin or acacia; non-aqueous vehicles, for example, almond oil, oily esters, ethyl alcohol, or fractionated vegetable oils; and preservatives, for example, methyl or propyl-p-hydroxybenzoates or sorbic acid.
  • the preparations can also contain buffer salts, flavoring, coloring, and/or sweetening agents as appropriate. If desired, preparations for oral administration can be suitably formulated to give controlled release of the active compound(s).
  • compositions and formulations set forth herein can be formulated for parenteral administration by injection, for example by bolus injection or continuous infusion.
  • Formulations for injection can be presented in unit dosage form, for example, in ampoules or in multi-dose containers, with an added preservative.
  • Injectable compositions are preferably aqueous isotonic solutions or suspensions, and suppositories are preferably prepared from fatty emulsions or suspensions.
  • the compositions may be sterilized and/or contain adjuvants, such as preserving, stabilizing, wetting or emulsifying agents, solution promoters, salts for regulating the osmotic pressure and/or buffers.
  • the active ingredient(s) can be in powder form for constitution with a suitable vehicle, for example, sterile pyrogen-free water, before use.
  • a suitable vehicle for example, sterile pyrogen-free water
  • they may also contain other therapeutically valuable substances.
  • the compositions are prepared according to conventional mixing, granulating or coating methods, respectively, and contain about 0.1 to 75%, preferably about 1 to 50%, of the active ingredient(s).
  • compositions of the present invention may be conveniently delivered in the form of an aerosol spray presentation from pressurized packs or a nebulizer, with the use of a suitable propellant, for example, dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide, or other suitable gas.
  • a suitable propellant for example, dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide, or other suitable gas.
  • the dosage unit can be determined by providing a valve to deliver a metered amount.
  • Capsules and cartridges of, for example, gelatin for use in an inhaler or insufflator can be formulated containing a powder mix of the compound(s) and a suitable powder base, for example, lactose or starch.
  • compositions set forth herein can also be formulated in rectal compositions, for example, suppositories or retention enemas, for example, containing conventional suppository bases, for example, cocoa butter or other glycerides.
  • the active ingredient(s) can be formulated as a depot preparation.
  • Such long-acting formulations can be administered by implantation (for example, subcutaneously or intramuscularly) or by intramuscular injection.
  • one or more of the compounds described herein can be formulated with suitable polymeric or hydrophobic materials (for example as an emulsion in an acceptable oil) or ion exchange resins, or as sparingly soluble derivatives, for example, as a sparingly soluble salt.
  • a pharmaceutical composition or medicament of the present invention can comprise (i) an effective amount of one or more RORy inhibitors, such as SR2211 and/or XY011, and (ii) optionally an anticancer drug such as an anti-androgen drug (e.g., enzalutamide, abiraterone, bicalutamide), a chemotherapeutic agent such as a taxane (e.g., docetaxel) or tamoxifen, and combinations thereof.
  • the therapeutic agent(s) may be used individually, sequentially, or in combination with one or more other such therapeutic agents (e.g., a first therapeutic agent, a second therapeutic agent, a compound of the present invention, etc.). Administration may be by the same or different route of administration or together in the same pharmaceutical formulation.
  • compositions or medicaments can be administered to a subject at a therapeutically effective dose to prevent, treat, sensitize, or control a cancer such as prostate cancer (e.g., CRPC), lung cancer, breast cancer, liver cancer, ovarian cancer, endometrial cancer, bladder cancer, colon cancer, lymphoma, or a glioma as described herein.
  • a cancer such as prostate cancer (e.g., CRPC), lung cancer, breast cancer, liver cancer, ovarian cancer, endometrial cancer, bladder cancer, colon cancer, lymphoma, or a glioma as described herein.
  • the pharmaceutical composition or medicament is administered to a subject in an amount sufficient to elicit an effective therapeutic response in the subject.
  • An effective therapeutic response includes a response that at least partially arrests or slows the symptoms or complications of the cancer. An amount adequate to accomplish this is defined as a "therapeutically effective dose.”
  • a unit dosage for oral administration to a mammal of about 50 to about 70 kg may contain between about 5 and about 500 mg, about 25-200 mg, about 100 and about 1000 mg, about 200 and about 2000 mg, about 500 and about 5000 mg, or between about 1000 and about 2000 mg of the active ingredient.
  • a unit dosage for oral administration to a mammal of about 50 to about 70 kg may contain about 10 mg, 20 mg, 25 mg, 50 mg, 75 mg, 100 mg, 200 mg, 300 mg, 400 mg, 500 mg, 600 mg, 700 mg, 800 mg, 900 mg, 1,000 mg, 1,250 mg, 1,500 mg, 2,000 mg, 2,500 mg, 3,000 mg, or more of the active ingredient.
  • a dosage of the active compound(s) of the present invention is a dosage that is sufficient to achieve the desired effect.
  • Optimal dosing schedules can be calculated from measurements of active agent accumulation in the body of a subject. In general, dosage may be given once or more of daily, weekly, or monthly. Persons of ordinary skill in the art can easily determine optimum dosages, dosing methodologies and repetition rates.
  • Optimum dosages, toxicity, and therapeutic efficacy of the compositions of the present invention may vary depending on the relative potency of the administered composition and can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, for example, by determining the LD 50 (the dose lethal to 50% of the population) and the ED 50 (the dose therapeutically effective in 50% of the population).
  • the dose ratio between toxic and therapeutic effects is the therapeutic index and can be expressed as the ratio, LD 5 o/ED 5 o.
  • Agents that exhibit large therapeutic indices are preferred. While agents that exhibit toxic side effects can be used, care should be taken to design a delivery system that targets such agents to the site of affected tissue to minimize potential damage to normal cells and, thereby, reduce side effects.
  • Optimal dosing schedules can be calculated from measurements of active ingredient accumulation in the body of a subject. In general, dosage is from about 1 ng to about 1 ,000 mg per kg of body weight and may be given once or more daily, weekly, monthly, or yearly. Persons of ordinary skill in the art can easily determine optimum dosages, dosing methodologies and repetition rates. One of skill in the art will be able to determine optimal dosing for administration of one or more RORy inhibitors, such as SR221 1 and/or XY01 1, to a human being following established protocols known in the art and the disclosure herein.
  • RORy inhibitors such as SR221 1 and/or XY01
  • the data obtained from, for example, animal studies can be used to formulate a dosage range for use in humans.
  • the dosage of compounds of the present invention lies preferably within a range of circulating concentrations that include the ED 5 o with little or no toxicity.
  • the dosage can vary within this range depending upon the dosage form employed and the route of administration.
  • the therapeutically effective dose can be estimated initially from cell culture assays.
  • a dose can be formulated in animal models to achieve a circulating plasma concentration range that includes the IC50 (the concentration of the test compound that achieves a half-maximal inhibition of symptoms) as determined in cell culture. Such information can be used to more accurately determine useful doses in humans.
  • Levels in plasma can be measured, for example, by high performance liquid chromatography (HPLC).
  • HPLC high performance liquid chromatography
  • the dose equivalent of a chimeric protein, preferably a composition is from about 1 ng/kg to about 100 mg/kg for a typical subject.
  • a typical composition of the present invention for oral or intravenous administration can be about 0.1 to about 10 mg of active ingredient per patient per day; about 1 to about 100 mg per patient per day; about 25 to about 200 mg per patient per day; about 50 to about 500 mg per patient per day; about 100 to about 1000 mg per patient per day; or about 1000 to about 2000 mg per patient per day.
  • Exemplary dosages include, but are not limited to, about 10 mg, 20 mg, 25 mg, 50 mg, 75 mg, 100 mg, 200 mg, 300 mg, 400 mg, 500 mg, 600 mg, 700 mg, 800 mg, 900 mg, 1,000 mg, 1,250 mg, 1,500 mg, 2,000 mg, 2,500 mg, 3,000 mg, or more of the active ingredient per patient per day.
  • Methods for preparing administrable compositions will be known or apparent to those skilled in the art and are described in more detail in such publications as Remington: The Science and Practice of Pharmacy, 21 st Ed., University of the Sciences in Philadelphia, Lippencott Williams & Wilkins (2005).
  • Exemplary doses of the compositions described herein include milligram or microgram amounts of the composition per kilogram of subject or sample weight ⁇ e.g., about 1 microgram per kilogram to about 500 milligrams per kilogram, about 100 micrograms per kilogram to about 5 milligrams per kilogram, or about 1 microgram per kilogram to about 50 micrograms per kilogram. It is furthermore understood that appropriate doses of a composition depend upon the potency of the composition with respect to the desired effect to be achieved. When one or more of these compositions is to be administered to a mammal, a physician, veterinarian, or researcher may, for example, prescribe a relatively low dose at first, subsequently increasing the dose until an appropriate response is obtained.
  • the specific dose level for any particular mammal subject will depend upon a variety of factors including the activity of the specific composition employed, the age, body weight, general health, gender, and diet of the subject, the time of administration, the route of administration, the rate of excretion, any drug combination, and the degree of expression or activity to be modulated.
  • a pharmaceutical composition or medicament of the present invention is administered, e.g., in a daily dose in the range from about 1 mg of compound per kg of subject weight (1 mg/kg) to about lg/kg.
  • the dose is a dose in the range of about 5 mg/kg to about 500 mg/kg.
  • the dose is about 10 mg/kg to about 250 mg/kg.
  • the dose is about 25 mg/kg to about 150 mg/kg.
  • a preferred dose is about 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 15, 18, 20, 25, 30, 40, or 50 mg/kg.
  • the daily dose can be administered once per day or divided into subdoses and administered in multiple doses, e.g., twice, three times, or four times per day.
  • compositions described herein may be administered in different amounts and at different times.
  • certain factors may influence the dosage and timing required to effectively treat a subject, including but not limited to the severity of the disease or malignant condition, previous treatments, the general health and/or age of the subject, and other diseases present.
  • treatment of a subject with a therapeutically effective amount of a composition can include a single treatment or, preferably, can include a series of treatments.
  • compositions set forth herein may be administered for at least three consecutive days, often for at least five consecutive days, more often for at least ten, and sometimes for 20, 30, 40 or more consecutive days. While consecutive daily doses are a preferred route to achieve a therapeutically effective dose, a therapeutically beneficial effect can be achieved even if the agents are not administered daily, so long as the administration is repeated frequently enough to maintain a therapeutically effective concentration of the agents in the subject. For example, one can administer the agents every other day, every third day, or, if higher dose ranges are employed and tolerated by the subject, once a week.
  • the one or more RORy inhibitors is orally administered.
  • the one or more RORy inhibitors e.g., SR221 1 and/or XYOl l
  • a subject e.g., an adult human
  • a daily dose of approximately 100; 200; 300; 400; 500; 600; 700; 800; 900; 1,000; 1,250; 1,500; 1,750; 2,000; 2,500; 3,000; 3,500; 4,000; 4,500; 5,000; or more mg per day.
  • the one or more RORy inhibitors (e.g., SR221 1 and/or XYOl l) is orally administered to a subject (e.g., an adult human) at a daily dose of between 1,000 and 2,000 mg per day.
  • the one or more RORy inhibitors (e.g., SR221 1 and/or XY01 1) is orally administered to a subject (e.g., an adult human) at a daily dose of approximately 10, 15, 20, 25, 30, 35, 40, 50, 60, 70, 80, 90, 100, 125, 150, 175, 200, 225, 250, 300, 350, 400, 500, or more mg per day.
  • the one or more RORy inhibitors (e.g., SR221 1 and/or XYOl l) is orally administered to a subject (e.g., an adult human) at a daily dose of between 25 and 200 mg per day.
  • a subject e.g., an adult human
  • the one or more RORy inhibitors (e.g., SR221 1 and/or XYOl l) and an anticancer drug are orally co-administered.
  • the one or more RORy inhibitors can be co-administered at a daily oral dose of between 25 and 1000 mg per day with the anticancer drug at a daily oral dose of between 25 and 2000 mg per day.
  • the methods comprise sequentially administering one or more RORy inhibitors, such as SR221 1 and/or XYOl l, followed by one or more anticancer drugs such as an anti-androgen drug (e.g., enzalutamide, abiraterone, bicalutamide), a chemotherapeutic agent such as a taxane (e.g., docetaxel) or tamoxifen, and combinations thereof.
  • the methods comprise sequentially administering one or more anticancer drugs followed by one or more RORy inhibitors.
  • an efficacious or effective amount of a composition is determined by first administering a low dose or small amount of the composition, and then incrementally increasing the administered dose or dosages, adding a second or third medication as needed, until a desired effect of is observed in the treated subject with minimal or no toxic side-effects.
  • Single or multiple administrations of the compositions are administered depending on the dosage and frequency as required and tolerated by the patient. In any event, the composition should provide a sufficient quantity of the compositions of this invention to effectively treat the patient. Generally, the dose is sufficient to treat or ameliorate symptoms or signs of disease without producing unacceptable toxicity to the patient.
  • kits and systems can be prepared according to the present invention, depending upon the intended user of the kit and system and the particular needs of the user.
  • the present invention provides a kit that includes one or more RORy inhibitors.
  • the present invention provides a kit that includes one or more RORy inhibitors and one or more anticancer drugs such as an anti-androgen drug (e.g., enzalutamide, abiraterone, and/or bicalutamide) and/or a chemotherapeutic agent (e.g., tamoxifen and/or a taxane such as docetaxel).
  • an anti-androgen drug e.g., enzalutamide, abiraterone, and/or bicalutamide
  • a chemotherapeutic agent e.g., tamoxifen and/or a taxane such as docetaxel.
  • kits described herein can include a label describing a method of administering one or more RORy inhibitors and/or one or more anticancer drugs.
  • kits described herein can include a label describing a method of treating cancer in a subject with a cancer such as prostate cancer (e.g., CRPC), lung cancer, breast cancer, liver cancer, ovarian cancer, endometrial cancer, bladder cancer, colon cancer, lymphoma, or a glioma.
  • compositions of the present invention including but not limited to, compositions comprising one or more RORy inhibitors and optionally one or more anticancer drugs may, if desired, be presented in a bottle, jar, vial, ampoule, tube, or other container- closure system approved by the Food and Drug Administration (FDA) or other regulatory body, which may provide one or more dosages containing the compounds.
  • FDA Food and Drug Administration
  • the package or dispenser may also be accompanied by a notice associated with the container in a form prescribed by a governmental agency regulating the manufacture, use, or sale of pharmaceuticals, the notice indicating approval by the agency.
  • the kit may include a formulation or composition as described herein, a container closure system including the formulation or a dosage unit form including the formulation, and a notice or instructions describing a method of use as described herein.
  • the kit includes a container which is compartmentalized for holding the various elements of a formulation (e.g., the dry ingredients and the liquid ingredients) or composition, instructions for making the formulation or composition, and instructions for administering the formulation or composition for enhancing the immune response in a subject with a cancer.
  • the kit may include the pharmaceutical preparation(s) in dehydrated or dry form, with instructions for its rehydration (or reconstitution) and administration.
  • Kits with unit doses of the compounds described herein, e.g. in oral, rectal, transdermal, or injectable doses (e.g., for intramuscular, intravenous, or subcutaneous injection), are provided.
  • an informational package insert describing the use and attendant benefits of the composition for enhancing the immune response in a subject with a cancer such as prostate cancer (e.g., CRPC), lung cancer, breast cancer, liver cancer, ovarian cancer, endometrial cancer, bladder cancer, colon cancer, lymphoma, or a glioma may be included in addition to the containers containing the unit doses.
  • a cancer such as prostate cancer (e.g., CRPC), lung cancer, breast cancer, liver cancer, ovarian cancer, endometrial cancer, bladder cancer, colon cancer, lymphoma, or a glioma
  • a cancer such as prostate cancer (e.g., CRPC), lung cancer, breast cancer, liver cancer, ovarian cancer, endometrial cancer, bladder cancer
  • Some embodiments of the present invention provide packages that include one or more RORy inhibitors and optionally one or more anticancer drugs such as an anti-androgen drug (e.g., enzalutamide, abiraterone, and/or bicalutamide) and/or a chemotherapeutic agent (e.g., tamoxifen and/or a taxane such as docetaxel).
  • an anti-androgen drug e.g., enzalutamide, abiraterone, and/or bicalutamide
  • a chemotherapeutic agent e.g., tamoxifen and/or a taxane such as docetaxel
  • RNA interfering-mediated silencing/suppression of RORy expression was developed using siRNAs and lentiviral vector-shRNAs to specifically block the human RORy gene expression in different PCa cells.
  • siRNAs and lentiviral vector-shRNAs to specifically block the human RORy gene expression in different PCa cells.
  • Suppression of RORy expression and function by the siRNAs or the lenti-vector shRNAs resulted in potent inhibition of AR-positive PCa cell growth and survival in multiple cell lines, but not of AR-negative PCa cells. The suppression also induced marked cell death/apoptosis.
  • the strong inhibition of cell growth was observed in metastatic CRPC models as well as in androgen-dependent PCa cells.
  • RORyt A T cell-specific isoform of RORy, called RORyt, has been studied as a therapeutic target for treatment of autoimmune diseases. So far, there has not been any report on the role of RORy (or RORyt) in cancer cells. Therefore, the findings described above in (1) to (3) constitute the first evidence that the nuclear receptor RORy plays a previously undescribed function in cancer and is a novel therapeutic target for cancer.
  • FIGS. 2A-2F Like the siRNAs, the small molecule inhibitor treatment elicited pronounced cell death, and the potent inhibitory activities were observed in multiple mCRPC cell models and in enzalutamide- resistant PCa cell models. In contrast, treating the same PCa cells with the RORa-specific, small molecule inhibitor SR3335 did not show any significant growth inhibition. RORa is a related member of the ROR sub-family. (5) Treatment of immune-compromised nude mice with the small molecule inhibitors SR2211 and 8k (also known as XY011 and El l) strongly inhibited growth of xenograft tumors derived from one of AR-positive PCa cell line. See, FIGS. 3A-3D.
  • the small molecule inhibitors SR2211 and 8k (also known as XY011 and El l) used in our study, among many other RORy inhibitors such as TMP778 and GSK805, were identified based on their activity to inhibit RORyt function in the immune cells for potential use as therapeutics for treating the immune cell-mediated autoimmune diseases such as rheumatoid arthritis (RA), inflammatory bowel diseases (IBD), and multiple sclerosis (MS). Their activity in cancer cell proliferation and/or survival has not been reported for any type of cancer. Therefore, the findings described above in (4) to (5) constitute the first evidence that small molecule inhibitors targeting RORy can be novel therapeutics for cancers.
  • RA rheumatoid arthritis
  • IBD inflammatory bowel diseases
  • MS multiple sclerosis
  • small molecule therapeutics of PCa target either the AR, the so called anti-androgens which include enzalutamide, or the androgen biosynthesis enzymes which include abiraterone.
  • RORy in the tumor cells prevents the development of resistance to currently advanced therapeutics such as enzalutamide and abiraterone. Both therapeutics are shown to induce tumor production of alternative spliced variant forms of AR that possess even higher potency than the full-length AR protein to drive PCa progression to more deadly forms.
  • the AR variant induction is believed to be a major mechanism for resistance to enzalutamide and abiraterone.
  • RORy inhibition can effectively negate enzalutamide induction of the AR variant proteins in the tumor cells.
  • Targeting RORy in the tumor cells has the potential to be effective in treating cancers that have developed resistance to other therapeutics (e.g., enzalutamide- resistant prostate cancer).
  • the following example illustrates how RORy inhibitors can be used in the treatment of cancer.
  • This example uses castration-resistant prostate cancer (CRPC) as a model system.
  • CRPC castration-resistant prostate cancer
  • Androgen receptor (AR) is overexpressed and hyperactivated in castration-resistant prostate cancer (CRPC).
  • CRPC castration-resistant prostate cancer
  • RORy a master regulator of Thl7 cells and therapeutic target of autoimmune diseases, as a key driver of AR aberrant expression.
  • RORy is overexpressed and amplified in metastatic tumors. Its overexpression confers CRPC cell growth.
  • RORy recruits coactivators SRC-1 and -3 to an AR-RORE to stimulate AR gene transcription. Its specific antagonists strongly suppress the expression of AR and its variant AR-V7.
  • RORy antagonists also markedly diminish genome-wide AR binding, H3K27ac marks and expression of the AR gene network.
  • the antagonists potently block tumor growth in multiple models and effectively sensitize CRPC tumors to enzalutamide, without overt toxicity. Together, the results establish RORy as a previously unsuspected key player in CRPC by acting upstream of AR and a potential therapeutic target for advanced prostate cancers.
  • AR androgen receptor
  • Recently approved therapeutics such as androgen signaling inhibitor enzalutamide (ENZ) and androgen synthesis inhibitor abiraterone (ABI) benefit some patients. However, de novo and acquired resistance appears inevitable.
  • RAR-related orphan receptors are NRs with tissue endogenous ligands to be widely recognized.
  • RORs The three RORs, RORa, - ⁇ and - ⁇ (with gene name RORA, RORB and RORC respectively) have distinct tissue expression patterns and likely play different physiological functions including metabolic homeostasis and circadian rhythms 11 ' 12 .
  • T cells express an isoform, RORyt (or RORc2 in human), which differs in the N-terminus due to T cell-specific promoter usage.
  • RORyt plays a crucial role in Thl7 cell development and autoimmune diseases.
  • An increasing number of RORy antagonists/inverse agonists are being developed with strong therapeutic potential for autoimmune and metabolic diseases 11 ' 13 .
  • RORy displays constitutive transactivation function through monomer binding to ROREs at its genomic targets 14 ' 15 .
  • RORy is expressed in thymus, muscle, and testis. Its low mRNA levels are also detected in prostate and liver. RORy global knockout mice are relatively healthy and fertile 16 . However, the expression and function of RORy in human tumor cells are largely unexplored.
  • RORy/RORC is overexpressed and amplified in metastatic CRPCs and required for survival and proliferation of CRPC cells
  • NRs Nuclear receptors
  • FIG. 6A To assess the potential role of NSs in cancer progression, we queried several datasets of tumor gene expression profiling for NRs with altered expression and found that members of the ROR subfamily displayed distinct expression patterns. In two different datasets, the expression of RORa and RORP decreased significantly in metastatic tumors when compared to benign prostate tissues or localized tumors. In contrast, the expression of RORy showed a marked increase in metastatic tumors. Significantly, RORy gene RORC is found amplified in 6% of metastic CRPC tumors in a recent study (FIG. 6A; FIG. 12A).
  • RORy protein was readily seen in AR-positive cancer cell lines mostly derived from CRPC tumors (e.g., LNCaP, C4-2B, 22Rvl, VCaP, PC346C and LAPC4), but not in the non- malignant human prostate epithelial cells (RWPE1 and PNT-2) (FIG. 6C).
  • RORy knockdown also resulted in marked apoptosis, demonstrated by the caspase activities and PARPl cleavage, and strong inhibition of key proliferation and survival protein expression (e.g., cyclin-A, -E, -D3, -Cdc2, -Cdc6, and Bcl-xL), as well as the expression of other major drivers of prostate cancer such as Myc and ERG (FIGS. 6E, 6F; FIG. 12C). Consistent with its crucial role in proliferation and survival, ectopic expression of RORy in androgen-sensitive LNCaP cells strongly promoted their growth in an androgen-deprived condition (FIG. 12D). RORy-selective antagonists potently inhibit growth and survival of CRPC cells
  • a RORa-selective antagonist SR3335 25 did not display any significant effect.
  • strong growth inhibition by SR2211 was observed in other AR-positive PCa cell models including 22Rvl, VCaP, LNCaP, LAPC4 and PC346C (FIG. 7C and FIGS. 13A, 13B).
  • No significant growth inhibition by the RORy antagonists was seen in non-malignant human prostate cell RWPE1, normal human fibroblasts IMR90, or AR-negative PCa cells at the concentrations tested (FIG. 7C; FIG. 13B).
  • RORy antagonists potently inhibit AR signaling
  • RNA-seq transcriptomes of cells treated with the two structurally distinct antagonists, SR2211 and XY011 previously reported as compound 8k 21 .
  • Clustering of genes with expression significantly altered by either antagonist (relative to vehicle) showed a high degree of concordance in expression change between the two RORy inhibitors with over 75% of genes either decreased (cluster 1) or increased (cluster 3) by both antagonists (FIG. 8A).
  • genes of an AR activity signature which is of value in predicting clinical tumor response to androgen ablation therapy 26 , constitute partly the two major clusters (cluster 1 and 3).
  • the antagonists also strongly inhibited the expression of genes preferentially up-regulated by AR-V7 27 , and most of the 16-AR target gene set recently identified in human CRPC tumors 28 (FIGS. 14C, 14D).
  • qRT-PCR verified that some of the classic AR targets such as KLK3, KLK2, Nkx3.1, and FKBP5, and ones that are linked to CRPC such as CAMKK2 29 , and ANCCA/ATAD2 30 were strongly inhibited by the antagonists and by RORy knockdown (FIG. 8C; FIG. 14E).
  • RORy overexpression significantly increased AR expression in LNCaP cells (FIG. 15D). Consistent with the results from cell models, in multiple data sets from clinical CRPC tumors, the expression of RORy correlated strongly not only with AR expression but also with a CRPC AR-signature 28 (FIGS. 16A, 16B).
  • transcripts from the deleted or wild type alleles were strongly inhibited by the antagonists.
  • transcript levels from the deleted alleles were not altered by any of the antagonists (FIG. 10E; FIG. 19B), indicating that the site is required for RORy antagonist inhibition of AR transcription.
  • the three sgRNAs when used singularly, caused a "knock-out" effect on AR protein expression.
  • sgRNA#2 the only one that could be designed to cause indel type of alterations adjacent to the RORE sequence, displayed significant inhibition of AR mRNA expression while the other two showed no effect (FIG. 19C).
  • reporter gene assays with the RORE and found that it was highly responsive to RORy-mediated transactivation. Mutations in the core RORE sequence or deletion of RORy C-terminal, AF2 transactivation domain completely abrogated the AR-RORE-dependent activation. The RORy antagonists suppressed the activation in a dose-dependent manner (FIG. 10F).
  • FIGS. 20A-20B a tight correlation between RORy inhibition, AR expression inhibition and anti-proliferation was observed (FIGS. 20A-20B), indicating that suppression of AR expression by the RORy antagonists constitutes the major mechanism of their action in the cancer cells.
  • RORy activates gene transcription through association with co-factors such as the pl60/SRC/NCoA family members 32 .
  • co-factors such as the pl60/SRC/NCoA family members 32 .
  • SRC-1 and SRC-3/ACTR, but not SRC-2 were found to occupy the AR-RORE site.
  • their binding was strongly reduced by the RORy antagonists or knockdown (FIG. 10G; FIG. 21), indicating that the SRCs were recruited to the site via RORy.
  • Treatment with SR2211 strongly reduced the gene activating marks H3K4me3 and H3K27ac at the RORE site and AR promoter (FIG. 10G; FIG. 22C). Consistent with the strong reduction of AR transcripts, Pol-II occupancy at AR promoter and the RORE site was significantly inhibited by RORy inhibition.
  • Antagonists of RORy potently inhibit tumor growth and sensitize CRPC tumors to ENZ
  • tumors that are resistant to ENZ are also very responsive to the antagonists (either alone or in combination with ENZ), indicating that RORy targeting can have a broad clinical utility.
  • the RORy antagonists' effect on AR expression instead of on AR LBD function, may also offer other therapeutic advantages over anti-androgens. Indeed, unlike anti-androgens that display clear suppression of the growth and function of normal androgen- responsive tissues such as testis and prostate, the RORy antagonists do not show any significant impact on the size of the mouse tissues or AR expression in the tissues and in human non-malignant prostate cells. This tumor-specific effect of the antagonists is likely attributable to tumor cell addiction to highly elevated levels of AR and tumor cell-specific control of AR by RORy.
  • LNCaP, C4-2B, 22Rvl, PC-3, and PC346C prostate cancer cells were cultured in RPMI1640, VCaP, HEK293T and human fibroblast IMR90 cells were in DMEM, LAPC-4 was in Iscove's MEM (all from Corning), and RWPE-1 and PZ-HPV-7 were in Keratinocyte Serum Free Medium (K-SFM) (Invitrogen) with the supplements. All the culture media except for RWPE-1 and PZ-HPV-7 were supplemented with 10% FBS (Hy clone) except indicated otherwise.
  • K-SFM Keratinocyte Serum Free Medium
  • C4-2B cells were cultured in RPMI supplemented with 9% cds-FBS plus 1% regular FBS (to mimic the CRPC condition) unless indicated otherwise and 22Rvl cells were cultured in RPMI supplemented with 10% cds-FBS.
  • Cells were grown at 37°C in 5% C02 incubators.
  • LNCaP, VCaP, 22Rvl, PC-3, 293 T, EVIR90, PZ-HPV-7 and RWPE-1 were from ATCC.
  • C4-2B was from UroCor Inc. (Oklahoma City, OK).
  • LAPC4 and PC346C were kindly provided respectively by Dr. Charles Sawyers (MSKCC, New York) or by Dr. Adrie van Bokhoven (University of Colorado).
  • the prostate cancer cell lines were recently authenticated by ATCC using STR profiling. Cell lines were regularly tested being negative for mycoplasma. Chemicals
  • TMA PR803b tissue microarrays
  • AFKJS-9 anti-RORy monoclonal antibody
  • eBioscience anti-RORy monoclonal antibody
  • the percentage of positive nuclear staining was scored as follows: 0% - ⁇ 5%, score 0; 5% - ⁇ 10%, score 1; 10% - 50%, score 2; >50%, score 3. Differences and correlations in immunostaining among groups were analyzed with the ⁇ test.
  • TUNEL Terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling
  • Lentiviral plasmids encoding shRNA targeting RORy/RORC were purchased from Sigma. Non-targeting control shRNA were used as described 49 .
  • human RORy cDNA in pLX304 (DNASU) was amplified and cloned into a modified pLX304 vector with a V5 tag at the receptor N terminal.
  • Lentiviral particles were produced in 293T cells after co-transfection of the above shRNA lentivirus vector, psPAX2 and pMD2.G in 10 cm dishes, as described 49 .
  • siRNAs for gene knockdown were purchased from Dharmacon.
  • siRNA target sequences for RORy and different SRCs are listed in Table 5.
  • Transfections were performed with OptiMEM (Invitrogen) and Dharmafectin#l (Dharmacon) following manufacturer's instruction. Reporter constructs and reporter gene assays
  • ARE reporter gene assays were performed by transfecting 22Rvl cells with 5 x ARE-tk-luc, pcDNA3.1-hAR and pCMV-p-gal for normalization. For transfection with constructs omitted for specific gene expression, corresponding empty vectors were used to ensure equal amount of total DNA used. Briefly, 22Rvl cells seeded in 96- well plates in hormone-deprived medium supplemented with 10% cds-FBS (Hyclone) were transfected with lipofectamine 2000 (Life technology, Carlsbad, CA, USA) and the indicated plasmid DNA.
  • AR-RORE-tk-luc was constructed by inserting four copies of the newly identified AR-RORE TTCTGGGTCA into tk-luciferase reporter vector.
  • AR-RORE mutant form contains sequences mutated from TTCTGGGTCA to TTCTGAACGA.
  • HEK293T HEK293T
  • CMX-RORy or CMX-RORyAH12 expression vector were co-transfected with CMX-RORy or CMX-RORyAH12 expression vector and the RORE-tk-luc reporter plasmid as indicated using Lipofectamine 2000 (Life technology, Carlsbad, CA, USA). After 12 h incubation, cells were treated with vehicle or RORy antagonists as indicated for another 24 hours.
  • Gal4-driven reporter assays 293T cells were transfected with Gal4-RORy LBD and pGL5-luc reporter.
  • luciferase and ⁇ - galactosidase were then analyzed with a Luciferase Assay Substrate (Promega) and Luminescent ⁇ -galactosidase Detection Kit II (Clontech). All transfections were performed in triplicate, and each experiment was repeated at least three times.
  • sgRNAs were designed using the MIT CRISPR design software (http://crispr.mit.edu). Oligos corresponding to the sgRNAs were synthesized and cloned into lentiCRISPR v2 vectors following lentiCRISPRv2 and lentiGuide oligo cloning protocol (Addgene, plasmid#52961). sgRNA sequences are as follows: GFP: GGGCGAGGAGCTGTTCACCG; AR-RORE#l : CTGGCGAGCCTGCATGGCGC; AR- RORE#2: GTGCAGCGGGACCCGGTTCT; AR-RORE#3 :
  • ACTCTCTTCACAGCCGAAGA Lentiviral particles were produced in 293 T cells as described above.
  • C4-2B cells were plated at 2 10 5 cells per well in 6-well plates. Sixteen hours later, one ml of virus-containing supernatant with 10 ng polybrene was added to the cells. After 4 to 6 hours, medium was changed to regular medium and cultured for another 72 hours.
  • Genomic DNA was isolated from cells using the Pure link Genomic DNA kit (Life technology). PCR was performed using indicated primers flanking the sgRNA target sites. PCR products from deleted alleles were purified by running agarose gel and were ligated into plasmids using pGEM-T Easy Vector Systems (Promega). Plasmid DNA was purified from single bacterial colonies by mini-prep kit (Qiagen) and sequenced by GENEWIZ (Davis, California) using Sanger sequencing method.
  • RNA-seq data analysis Analysis of AR niRNA expression in cells treated with CRISPR/Cas9-sgRNA lentivirus [0240]
  • Cells were infected with the CRISPR/Cas9 sgRNA lentiviruses as above and cultured for 2 days. RORy antagonists or vehicle were then added and cells were cultured for another 2 days.
  • Total RNA was extracted by TRIzol and reverse transcribed. Semi- quantitative RT-PCR was performed using the template cDNA generated and indicated primers. PCR products were separated on agarose gels. Quantification of the bands was performed as previously reported 57 . Band intensity was expressed as relative absorbance units and normalized to GAPDH.
  • C4-2B cells were treated with vehicle or the antagonists XY01 1 (5 ⁇ ) and SR221 1 (5 ⁇ ) or ENZ (20 ⁇ ) for 48 hours before RNA extraction.
  • RNA-seq libraries from ⁇ ⁇ total RNA were prepared using Illumina Tru-Seq RNA Sample, according to the manufacturer' s instructions. Libraries were validated with an Agilent Bioanalyzer (Agilent Technologies, Palo Alto, CA). Sequencing was performed on an Illumina HiSeq 2000 sequencer at BGI Tech (Hong Kong). The FASTQ-formatted sequence data were analyzed using a standard BWA-Bowtie-Cufflinks workflow 58"60 .
  • sequence reads were mapped to the reference human genome assembly (Feb. 2009,GRCh37/hgl9) with BWA and Bowtie software.
  • the Cufflinks package 61 was applied for transcript assembly, quantification of normalized gene and isoform expression in RPKM (Reads per kilobase per million mapped reads) or FPKM (fragments per kilobase of exon model per million mapped reads), and testing for differential expression (Cuffdiff).
  • RPKM Reads per kilobase per million mapped reads
  • FPKM fragments per kilobase of exon model per million mapped reads
  • Cuffdiff differential expression
  • the expression change of at least 1.5 fold up or down was clustered with K-mean clustering algorithm in Cluster software 62 . The cluster was displayed with Tree View. RNA- seq data have been deposited to NCBI-GEO with accession code GSE72483.
  • GSEA was performed using the Java desktop software (http://www.broadinstitute.org/gsea) as described previously 63 . Genes were ranked according to the shrunken limma log 2 fold changes and the GSEA tool was used in 'pre-ranked' mode with all default parameters. Previous reported AR activity signature genes 26 were used in the GSEA analysis.
  • ChlP-qPCR analysis was performed as described previously 49 .
  • the antibodies used for ChIP assay are AR (Santa Cruz; sc-815); RNA Pol -II (Santa cruz; sc-899); H3K4me2 (Abeam ab32356); H3K4me3 (Abeam; ab8580); H3K27ac (Abeam; ab4729); H3 (Active Motif; #39163); p300 (Santa Cruz; sc-585); SRC-l(Santa Cruz; sc-8995); SRC-3/ACTR 64 , and IgG (Santa Cruz; sc-2027).
  • PCR primers used in the ChIP assays were listed in the Supplementary table 2. ChlPs were performed with each experimental point in triplicate, and each experiment was repeated three times.
  • C4-2B cells were treated with vehicle or SR2211 (5 ⁇ ) for 24 hours before harvested for ChlP-seq.
  • ChlP-seq experiments were performed as described 65 .
  • Anti-AR ChlP-seq was repeated in two independent experiments.
  • Antibodies used were against AR (Santa Cruz; sc-815); RNA Pol II (Santa cruz; sc-899); H3K4me2 (Abeam ab32356); H3K4me3 (Abeam; ab8580); H3(acetyl K27) (Abeam; ab4729).
  • mice for C4-2B and VCaP
  • BALB/c nu/nu athymic mice for 22Rvl and PC-3
  • 2 x 10 6 cells were suspended in total of 100 ⁇ L ⁇ PBS/Matrigel (1 : 1) and implanted subcutaneously into the dorsal flank on both sides of the mice.
  • Animal group size of six or more was estimated to have a high statistic power, based on power calculation (http://www.biomath.info/power/) and previous studies involving the same xenograft models 34 ' 68 .
  • mice When the tumor volume was approximately 80 mm 3 , the mice were randomized and then treated intraperitoneally (i.p.) with 100 ⁇ of either vehicle or RORy antagonists SR2211, XY011/8k (in a formulation of 15% Cremophor EL, Calbiochem, 82.5% PBS, and 2.5% DMSO) for five times per week. Tumor growth was monitored by calipers with volume calculated using the equation: ( ⁇ /6 (length ⁇ width2)). Body weight during the course of the study was also monitored. At the end of the studies mice were killed and tumors were dissected and weighed. Additionally, prostate, seminal vesicle, testis, kidney, heart, lung, liver, epididymal fat pad and spleen were harvested and weighed.
  • SR2211, XY011/8k in a formulation of 15% Cremophor EL, Calbiochem, 82.5% PBS, and 2.5% DMSO
  • mice were injected with VCaP cells as above to establish the tumors. Then, mice bearing tumors of approximately 180 mm 3 were surgically castrated. They were then observed for tumor regression. Once tumors grew back to the pre-castration size, mice were randomized and treated with vehicle, 5 mg kg "1 SR2211, 10 mg kg "1 ENZ or a combination of 5 mg kg "1 SR2211 and 10 mg kg "1 ENZ. ENZ was given by oral gavage as previously described 68 and SR2211 was administered i.p as above.
  • mice were exluded from the study if bearing no tumor or tumor with size twice larger or smaller than the mean, at the time of randomization.
  • C4-2 cells suspended in Matrigel as above were injected orthotopically into SCID C.B17 mice.
  • serum PSA levels were measured using PSA (human) ELISA kit (Abnova). When serum PSA were detectable, the mice were randomized into different groups for the treatment.
  • C4-2B cells infected with lentivirus encoding control shRNA or shRNA targeting RORy were injected subcutaneously into both sides of the dorsal flank of mice. Tumor growth was monitored weekly by calipers. Tumor volumes were measured in a blinded fashion (to treatment groups). The procedures were approved by the Institutional Animal Care and Use Committee of University of California Davis. Statistical Analysis
  • CDK4 Santa Cruz sc-260 1 500 cleaved- Caspase7 Cell signaling #9491 1 1000 cleaved-PARPl Cell signaling #9542 1 1000
  • PSA enhancer-F2 AGGACAGTCTCAACGTTCCACCAT
  • CAMKK2 promoter F2 AAAATGTGAAAGGCCAGGTG
  • CAMKK2 promoter R2 AAAGCAGGGTTGCCAAACTA
  • AR chip -2.5KB R CAG AGG TGT TCT CTC AGA TTA G
  • AR chip -1KB R GTC CCA TAA GCC CTG TGT AAA G
  • AR chip +2KB R CAG AGC CAG TGG AAA GTT GTA G
  • AR chip +2.3KB F TAC CCT GTC TCT CTA CAA GTC C AR-RORE
  • AR chip +2.3KB R TAG TCC AGC GGG TTC TCC AG AR-RORE
  • AR chip +3KB R ATT TCG GAG AAG TCA CAG GT
  • EXAMPLE 3 Targeting of the Nuclear Receptor RORy with Receptor-Specific, Small Molecule Inhibitors in Tumor Cells of Different Human Cancers [0248]
  • the following example illustrates how a variety of different RORy inhibitors can be used in the treatment of numerous different cancer types including prostate cancer, lung cancer, breast cancer, liver cancer, ovarian cancer, endometrial cancer, bladder cancer, colon cancer, lymphoma, and glioma.
  • FIGS. 31A-31C show that the RORy inhibitors SR221 1, GSK805, and GSK9b strongly inhibited the growth and survival of breast cancer cells having different major molecular features, with triple-negative breast cancer (TNBC) cells being more sensitive than ER-positive breast cancer cells.
  • TNBC triple-negative breast cancer
  • the RORy inhibitors GSK805 and SR221 1 displayed IC50 values ranging from approximately 1 ⁇ to less than 10 ⁇ in TNBC cells including MDA-MB468, MDA-MB231, BT20, SUM149, and HCC1937 (FIG.
  • GSK805 and SR221 1 also displayed relatively strong inhibition of HER2-positive cells, such as SKBR3 and HCC1954 (FIG. 31F).
  • GSK805 and SR221 1 displayed significant inhibition of ER-positive cells, such as MCF-7 and T47D, with IC50 values greater than 10 ⁇ (FIG. 31F).
  • GSK9b showed an inhibition pattern similar to that of GSK805, although slightly less effective than GSK805.
  • the RORy inhibitor GNE3500 also displayed significant inhibition of the growth and survival of different breast cancer cells such as the HER2-positive HCC 1954 cell line, the TNBC MDA-MB468 and MDA-MB231 cell lines, and the radiation-resistant MCF-7-C6 cell line (FIG.
  • FIGS. 31E and 31F show that different RORy small molecule inhibitors were effective in potently inhibiting the growth and survival of human breast cancer cells that are resistant to different therapies including radiation (MCF-7-C6) and targeted therapies such as tamoxifen (MCF-7-TamR).
  • FIG. 31D shows that RORy inhibitors such as SR221 1 and GSK805 were able to sensitize tamoxifen-resistant breast cancer cells to tamoxifen.
  • tamoxifen-resistant MCF-7-TamR cell line tamoxifen (1 ⁇ of 4(OH)- tamoxifen) alone did not show any inhibitory effect; in fact, it showed a slight stimulation.
  • FIGS. 32A-32C show that the RORy inhibitors SR221 1 and GSK805 strongly inhibited the growth and survival of lung cancer cells with different molecular and histological features, including cells with an oncogenic mutant KRAS gene (e.g., A427, Calul, A549, H23, and H358), cells with an oncogenic BRAF mutant gene (e.g., H1666), cells with an EGFR mutant gene (e.g., HCC827 and PC-9), and cells that are either sensitive (e.g.
  • KRAS gene e.g., A427, Calul, A549, H23, and H358
  • an oncogenic BRAF mutant gene e.g., H1666
  • cells with an EGFR mutant gene e.g., HCC827 and PC-9
  • cells that are either sensitive e.g.
  • FIG. 32D shows that RORy inhibitors such as SR2211 strongly inhibited tumor growth of a xenograft lung tumor model.
  • mice bearing xenograft tumors of the A549 human lung cancer cells were treated with either vehicle or 5 mg/kg/day of SR2211 (i.p.). After six weeks of treatment, treatment of the tumor-bearing mice with the RORy inhibitor significantly inhibited tumor growth.
  • FIGS. 33A-33I show that the RORy inhibitors SR2211, GSK805, and GSK9b displayed significant inhibition of the growth and survival of ovarian cancer cells (e.g., OVCAR420), bladder cancer cells (e.g., T24), endometrial cancer cells (e.g., ECCl), liver cancer cells (e.g., HepG2 and Hep3B), glioblastoma cells (e.g., T98G), diffuse large B cell lymphoma (DLBCL) (e.g., SUDHL4 and SUDHL6), colon cancer cells (e.g., HCT116), and docetaxel-resistant cells (e.g., C4-2B).
  • ovarian cancer cells e.g., OVCAR420
  • bladder cancer cells e.g., T24
  • endometrial cancer cells e.g., ECCl
  • liver cancer cells e.g., HepG2 and Hep3B
  • Retinoic acid-related orphan receptor gamma (RORgamma): a novel participant in the diurnal regulation of hepatic gluconeogenesis and insulin sensitivity.
  • RORgamma Retinoic acid-related orphan receptor gamma

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • Zoology (AREA)
  • Immunology (AREA)
  • Diabetes (AREA)
  • Endocrinology (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Urology & Nephrology (AREA)
  • Plant Pathology (AREA)
  • Microbiology (AREA)
  • Toxicology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • High Energy & Nuclear Physics (AREA)
  • Cell Biology (AREA)
  • Pulmonology (AREA)
  • Hematology (AREA)
  • Neurology (AREA)
PCT/US2016/021983 2015-03-12 2016-03-11 METHODS FOR TREATING CANCER WITH RORgamma INHIBITORS Ceased WO2016145298A1 (en)

Priority Applications (5)

Application Number Priority Date Filing Date Title
JP2017547968A JP2018513123A (ja) 2015-03-12 2016-03-11 Rorガンマ阻害剤を用いてがんを治療するための方法
CN201680027763.2A CN107614062A (zh) 2015-03-12 2016-03-11 用RORγ抑制剂治疗癌症的方法
EP16762587.0A EP3268087A4 (en) 2015-03-12 2016-03-11 METHODS FOR TREATING CANCER WITH RORgamma INHIBITORS
HK18109103.5A HK1249469A1 (zh) 2015-03-12 2016-03-11 用RORγ抑制剂治疗癌症的方法
US15/701,122 US10959984B2 (en) 2015-03-12 2017-09-11 Methods for treating cancer with RORγ inhibitors

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US201562132465P 2015-03-12 2015-03-12
US62/132,465 2015-03-12
US201662280081P 2016-01-18 2016-01-18
US62/280,081 2016-01-18

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US15/701,122 Continuation US10959984B2 (en) 2015-03-12 2017-09-11 Methods for treating cancer with RORγ inhibitors

Publications (1)

Publication Number Publication Date
WO2016145298A1 true WO2016145298A1 (en) 2016-09-15

Family

ID=56879765

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2016/021983 Ceased WO2016145298A1 (en) 2015-03-12 2016-03-11 METHODS FOR TREATING CANCER WITH RORgamma INHIBITORS

Country Status (6)

Country Link
US (1) US10959984B2 (enExample)
EP (1) EP3268087A4 (enExample)
JP (1) JP2018513123A (enExample)
CN (1) CN107614062A (enExample)
HK (1) HK1249469A1 (enExample)
WO (1) WO2016145298A1 (enExample)

Cited By (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110139652A (zh) * 2016-10-27 2019-08-16 爱思凯利尔生物科学私人有限责任公司 ROR-γ调节剂
WO2020065682A1 (en) * 2018-09-29 2020-04-02 Translational Health Science And Technology Institute Ror antagonists, their use and method of treatment comprising the said modulators
US10959984B2 (en) 2015-03-12 2021-03-30 The Regents Of The University Of California Methods for treating cancer with RORγ inhibitors
US10961216B2 (en) 2017-07-28 2021-03-30 Massachusetts Institute Of Technology Small molecule modulators of the androgen receptor
WO2022067185A1 (en) * 2020-09-27 2022-03-31 Veru Inc. Methods of treating prostate cancer with minimal side effects
WO2022122740A1 (en) * 2020-12-07 2022-06-16 Diaccurate Ror-gamma inhibitors for the treatment of ror-gamma-dependent cancer
EP3927329A4 (en) * 2019-02-20 2022-11-23 The Regents of the University of California TREATMENT OF RETINIC ACID RECEPTOR-RELATED ORPHAN RECEPTOR-Y(RORY)-DEPENDENT CANCER
WO2023281097A1 (en) 2021-07-09 2023-01-12 Immunic Ag Methods for treating cancer

Families Citing this family (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3849556A1 (en) * 2018-09-13 2021-07-21 Fundación del Sector Público Estatal Centro Nacional de Investigaciones Oncológicas Carlos III (F.S.P. CNIO) Modulation of trf1 for brain cancer treatment
WO2020061024A1 (en) * 2018-09-18 2020-03-26 Yale University Dermatologic topical applications of ror gamma and ror gamma-t inhibitors for the prevention of skin cancer development
RU2679625C1 (ru) * 2018-11-08 2019-02-12 Ильясов Шамиль Сионович ПРИМЕНЕНИЕ 3-О-СУЛЬФАМОИЛОКСИ-6-ОКСА-7β-МЕТИЛ-D-ГОМО-8α-ЭСТРА-1,3,5(10)-ТРИЕН-17а-ОНА ДЛЯ ЛЕЧЕНИЯ РАКА МОЛОЧНОЙ ЖЕЛЕЗЫ, ВКЛЮЧАЯ ТРИЖДЫ-НЕГАТИВНУЮ ФОРМУ, И СПОСОБ ЕГО ПОЛУЧЕНИЯ
CN109879784B (zh) * 2019-03-18 2021-06-29 中国科学院广州生物医药与健康研究院 一种联苯胺类化合物及其应用
AU2020253486A1 (en) * 2019-04-03 2021-11-04 University Of Florida Research Foundation, Incorporated Method of inhibiting trem-1
US12467043B2 (en) 2019-07-12 2025-11-11 Duke University 3′ UTR CRISPR-DCAS 13 engineering system and methods of using same
CN113912563B (zh) * 2020-07-10 2025-05-27 中国科学院广州生物医药与健康研究院 一种苯并五元氮杂环化合物及其应用
WO2023155846A1 (zh) * 2022-02-18 2023-08-24 上海醇健医药技术有限公司 17-吡啶基-10α-甲基-甾体衍生物及中间体化合物、其制备方法、其用途、以及其药物组合物

Citations (40)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4235871A (en) 1978-02-24 1980-11-25 Papahadjopoulos Demetrios P Method of encapsulating biologically active materials in lipid vesicles
US4501728A (en) 1983-01-06 1985-02-26 Technology Unlimited, Inc. Masking of liposomes from RES recognition
US4837028A (en) 1986-12-24 1989-06-06 Liposome Technology, Inc. Liposomes with enhanced circulation time
US4902505A (en) 1986-07-30 1990-02-20 Alkermes Chimeric peptides for neuropeptide delivery through the blood-brain barrier
US4957735A (en) 1984-06-12 1990-09-18 The University Of Tennessee Research Corporation Target-sensitive immunoliposomes- preparation and characterization
US5004697A (en) 1987-08-17 1991-04-02 Univ. Of Ca Cationized antibodies for delivery through the blood-brain barrier
US5019369A (en) 1984-10-22 1991-05-28 Vestar, Inc. Method of targeting tumors in humans
US5055303A (en) 1989-01-31 1991-10-08 Kv Pharmaceutical Company Solid controlled release bioadherent emulsions
US5188837A (en) 1989-11-13 1993-02-23 Nova Pharmaceutical Corporation Lipsopheres for controlled delivery of substances
US5254342A (en) 1991-09-30 1993-10-19 University Of Southern California Compositions and methods for enhanced transepithelial and transendothelial transport or active agents
US5268164A (en) 1990-04-23 1993-12-07 Alkermes, Inc. Increasing blood-brain barrier permeability with permeabilizer peptides
US5271961A (en) 1989-11-06 1993-12-21 Alkermes Controlled Therapeutics, Inc. Method for producing protein microspheres
US5413797A (en) 1992-03-12 1995-05-09 Alkermes Controlled Therapeutics, Inc. Controlled release ACTH containing microspheres
US5514670A (en) 1993-08-13 1996-05-07 Pharmos Corporation Submicron emulsions for delivery of peptides
US5534496A (en) 1992-07-07 1996-07-09 University Of Southern California Methods and compositions to enhance epithelial drug transport
US5962318A (en) 1996-11-15 1999-10-05 St. Jude Children's Research Hospital Cytotoxic T lymphocyte-mediated immunotherapy
US20070154487A1 (en) 2004-07-01 2007-07-05 Dan Littman Compositions and methods for modulation of RORgammat functions
US20090324539A1 (en) 2006-03-01 2009-12-31 Zeling Cai CANCER TREATMENT COMBINING LYMPHODEPLETING AGENT WITH CTLs AND CYTOKINES
WO2012100734A1 (en) 2011-01-24 2012-08-02 Glaxo Group Limited Compounds useful as retinoid-related orphan receptor gamma modulators
WO2012106995A1 (en) 2011-02-11 2012-08-16 Merck Sharp & Dohme Corp. Rorgammat inhibitors
WO2013019682A1 (en) 2011-07-29 2013-02-07 Tempero Pharmaceuticals, Inc. Compounds and methods
US8399645B2 (en) 2003-11-05 2013-03-19 St. Jude Children's Research Hospital, Inc. Chimeric receptors with 4-1BB stimulatory signaling domain
WO2013160418A1 (en) 2012-04-27 2013-10-31 Glaxo Group Limited Novel compounds
WO2013171729A2 (en) 2013-01-08 2013-11-21 Glenmark Pharmaceuticals S.A. Aryl and heteroaryl amide compounds as rorgamat modulator
WO2014028589A2 (en) 2012-08-15 2014-02-20 Merck Sharp & Dohme Corp. 4-HETEROARYL SUBSTITUTED BENZOIC ACID COMPOUNDS AS RORgammaT INHIBITORS AND USES THEREOF
WO2014028591A2 (en) 2012-08-15 2014-02-20 Merck Sharp & Dohme Corp. N-ALKYLATED INDOLE AND INDAZOLE COMPOUNDS AS RORgammaT INHIBITORS AND USES THEREOF
WO2014028597A2 (en) 2012-08-15 2014-02-20 Merck Sharp & Dohme Corp. 3-CYCLOHEXENYL AND CYCLOHEXYL SUBSTITUTED INDOLE AND INDAZOLE COMPOUNDS AS RORgammaT INHIBITORS AND USES THEREOF
WO2014028600A2 (en) 2012-08-15 2014-02-20 Merck Sharp & Dohme Corp. 3-AMINOCYCLOALKYL COMPOUNDS AS RORgammaT INHIBITORS AND USES THEREOF
WO2014089241A2 (en) * 2012-12-04 2014-06-12 Caris Mpi, Inc. Molecular profiling for cancer
US20140187554A1 (en) * 2011-05-16 2014-07-03 The Scripps Research Institute Modulators of the nuclear hormone receptor ror
WO2014179564A1 (en) 2013-05-01 2014-11-06 Vitae Pharmaceuticals, Inc. Thiazalopyrrolidine inhibitors of ror-gamma
US8916381B1 (en) 2010-12-09 2014-12-23 The Trustees Of The University Of Pennyslvania Methods for treatment of cancer
WO2015008234A1 (en) 2013-07-17 2015-01-22 Glenmark Pharmaceuticals S.A. Bicyclic heterocyclic compounds as ror gamma modulators
WO2015036411A1 (en) 2013-09-11 2015-03-19 F. Hoffmann-La Roche Ag KETO-IMIDAZOPYRIDINE DERIVATIVES AS RORc MODULATORS
WO2015061515A1 (en) 2013-10-25 2015-04-30 Glaxosmithkline Llc Novel compounds
WO2015082533A1 (en) 2013-12-05 2015-06-11 Lead Pharma Cel Models Ip B.V. Ror gamma (rory) modulators
WO2015083130A1 (en) 2013-12-06 2015-06-11 Aurigene Discovery Technologies Limited Fused pyridine and pyrimidine derivatives as ror gamma modulators
WO2015096771A1 (zh) 2013-12-25 2015-07-02 中国科学院广州生物医药与健康研究院 2-氧代-1,2-二氢苯并[cd]吲哚-6-磺酰胺类化合物及其组合物和应用
WO2015101928A1 (en) 2013-12-31 2015-07-09 Aurigene Discovery Technologies Limited Fused thiophene and thiazole derivatives as ror gamma modulators
WO2015116904A1 (en) 2014-02-03 2015-08-06 Vitae Pharmaceuticals, Inc. Dihydropyrrolopyridine inhibitors of ror-gamma

Family Cites Families (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2011115892A1 (en) * 2010-03-15 2011-09-22 Griffin Patrick R Modulators of the retinoic acid receptor-related orphan receptors
WO2012129394A2 (en) * 2011-03-22 2012-09-27 Brigham And Women's Hospital, Inc. Methods and compositions for the treatment of cancer
WO2013018695A1 (ja) * 2011-07-29 2013-02-07 武田薬品工業株式会社 複素環化合物
WO2014008214A1 (en) 2012-07-02 2014-01-09 Biogen Idec Ma Inc. Biaryl-containing compounds as inverse agonists of ror-gamma receptors
PL2849736T3 (pl) 2012-07-05 2019-06-28 Nutramax Laboratories, Inc. Kompozycje zawierające prekursor sulforafanu glukorafaninę, glukozydazę, kwas askorbinowy i ekstrakt lub proszek z ostropestu plamistego
CN105272904B (zh) 2014-07-18 2019-04-09 中国科学院广州生物医药与健康研究院 N-苯基酰胺类化合物及其应用
CN107614062A (zh) 2015-03-12 2018-01-19 加利福尼亚大学董事会 用RORγ抑制剂治疗癌症的方法
WO2017127442A1 (en) 2016-01-18 2017-07-27 The Regents Of The University Of California Methods for treating cancer with rorgamma inhibitors

Patent Citations (44)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4235871A (en) 1978-02-24 1980-11-25 Papahadjopoulos Demetrios P Method of encapsulating biologically active materials in lipid vesicles
US4501728A (en) 1983-01-06 1985-02-26 Technology Unlimited, Inc. Masking of liposomes from RES recognition
US4957735A (en) 1984-06-12 1990-09-18 The University Of Tennessee Research Corporation Target-sensitive immunoliposomes- preparation and characterization
US5019369A (en) 1984-10-22 1991-05-28 Vestar, Inc. Method of targeting tumors in humans
US4902505A (en) 1986-07-30 1990-02-20 Alkermes Chimeric peptides for neuropeptide delivery through the blood-brain barrier
US4837028A (en) 1986-12-24 1989-06-06 Liposome Technology, Inc. Liposomes with enhanced circulation time
US5004697A (en) 1987-08-17 1991-04-02 Univ. Of Ca Cationized antibodies for delivery through the blood-brain barrier
US5055303A (en) 1989-01-31 1991-10-08 Kv Pharmaceutical Company Solid controlled release bioadherent emulsions
US5271961A (en) 1989-11-06 1993-12-21 Alkermes Controlled Therapeutics, Inc. Method for producing protein microspheres
US5188837A (en) 1989-11-13 1993-02-23 Nova Pharmaceutical Corporation Lipsopheres for controlled delivery of substances
US5268164A (en) 1990-04-23 1993-12-07 Alkermes, Inc. Increasing blood-brain barrier permeability with permeabilizer peptides
US5506206A (en) 1990-04-23 1996-04-09 Alkermes, Inc. Increasing blood-brain barrier permeability with permeabilizer peptides
US5254342A (en) 1991-09-30 1993-10-19 University Of Southern California Compositions and methods for enhanced transepithelial and transendothelial transport or active agents
US5413797A (en) 1992-03-12 1995-05-09 Alkermes Controlled Therapeutics, Inc. Controlled release ACTH containing microspheres
US5534496A (en) 1992-07-07 1996-07-09 University Of Southern California Methods and compositions to enhance epithelial drug transport
US5514670A (en) 1993-08-13 1996-05-07 Pharmos Corporation Submicron emulsions for delivery of peptides
US5962318A (en) 1996-11-15 1999-10-05 St. Jude Children's Research Hospital Cytotoxic T lymphocyte-mediated immunotherapy
US8399645B2 (en) 2003-11-05 2013-03-19 St. Jude Children's Research Hospital, Inc. Chimeric receptors with 4-1BB stimulatory signaling domain
US20070154487A1 (en) 2004-07-01 2007-07-05 Dan Littman Compositions and methods for modulation of RORgammat functions
US20090324539A1 (en) 2006-03-01 2009-12-31 Zeling Cai CANCER TREATMENT COMBINING LYMPHODEPLETING AGENT WITH CTLs AND CYTOKINES
US8975071B1 (en) 2010-12-09 2015-03-10 The Trustees Of The University Of Pennsylvania Compositions for treatment of cancer
US8916381B1 (en) 2010-12-09 2014-12-23 The Trustees Of The University Of Pennyslvania Methods for treatment of cancer
US9102760B2 (en) 2010-12-09 2015-08-11 The Trustees Of The University Of Pennsylvania Compositions for treatment of cancer
WO2012100734A1 (en) 2011-01-24 2012-08-02 Glaxo Group Limited Compounds useful as retinoid-related orphan receptor gamma modulators
WO2012106995A1 (en) 2011-02-11 2012-08-16 Merck Sharp & Dohme Corp. Rorgammat inhibitors
US20140187554A1 (en) * 2011-05-16 2014-07-03 The Scripps Research Institute Modulators of the nuclear hormone receptor ror
US20140315881A1 (en) 2011-07-29 2014-10-23 Tempero Pharmaceuticals, Inc. Compounds and methods
WO2013019682A1 (en) 2011-07-29 2013-02-07 Tempero Pharmaceuticals, Inc. Compounds and methods
WO2013160418A1 (en) 2012-04-27 2013-10-31 Glaxo Group Limited Novel compounds
WO2014028591A2 (en) 2012-08-15 2014-02-20 Merck Sharp & Dohme Corp. N-ALKYLATED INDOLE AND INDAZOLE COMPOUNDS AS RORgammaT INHIBITORS AND USES THEREOF
WO2014028597A2 (en) 2012-08-15 2014-02-20 Merck Sharp & Dohme Corp. 3-CYCLOHEXENYL AND CYCLOHEXYL SUBSTITUTED INDOLE AND INDAZOLE COMPOUNDS AS RORgammaT INHIBITORS AND USES THEREOF
WO2014028600A2 (en) 2012-08-15 2014-02-20 Merck Sharp & Dohme Corp. 3-AMINOCYCLOALKYL COMPOUNDS AS RORgammaT INHIBITORS AND USES THEREOF
WO2014028589A2 (en) 2012-08-15 2014-02-20 Merck Sharp & Dohme Corp. 4-HETEROARYL SUBSTITUTED BENZOIC ACID COMPOUNDS AS RORgammaT INHIBITORS AND USES THEREOF
WO2014089241A2 (en) * 2012-12-04 2014-06-12 Caris Mpi, Inc. Molecular profiling for cancer
WO2013171729A2 (en) 2013-01-08 2013-11-21 Glenmark Pharmaceuticals S.A. Aryl and heteroaryl amide compounds as rorgamat modulator
WO2014179564A1 (en) 2013-05-01 2014-11-06 Vitae Pharmaceuticals, Inc. Thiazalopyrrolidine inhibitors of ror-gamma
WO2015008234A1 (en) 2013-07-17 2015-01-22 Glenmark Pharmaceuticals S.A. Bicyclic heterocyclic compounds as ror gamma modulators
WO2015036411A1 (en) 2013-09-11 2015-03-19 F. Hoffmann-La Roche Ag KETO-IMIDAZOPYRIDINE DERIVATIVES AS RORc MODULATORS
WO2015061515A1 (en) 2013-10-25 2015-04-30 Glaxosmithkline Llc Novel compounds
WO2015082533A1 (en) 2013-12-05 2015-06-11 Lead Pharma Cel Models Ip B.V. Ror gamma (rory) modulators
WO2015083130A1 (en) 2013-12-06 2015-06-11 Aurigene Discovery Technologies Limited Fused pyridine and pyrimidine derivatives as ror gamma modulators
WO2015096771A1 (zh) 2013-12-25 2015-07-02 中国科学院广州生物医药与健康研究院 2-氧代-1,2-二氢苯并[cd]吲哚-6-磺酰胺类化合物及其组合物和应用
WO2015101928A1 (en) 2013-12-31 2015-07-09 Aurigene Discovery Technologies Limited Fused thiophene and thiazole derivatives as ror gamma modulators
WO2015116904A1 (en) 2014-02-03 2015-08-06 Vitae Pharmaceuticals, Inc. Dihydropyrrolopyridine inhibitors of ror-gamma

Non-Patent Citations (88)

* Cited by examiner, † Cited by third party
Title
AGOULNIK, I.U. ET AL.: "Androgens modulate expression of transcription intermediary factor 2, an androgen receptor coactivator whose expression level correlates with early biochemical recurrence in prostate cancer", CANCER RESEARCH, vol. 66, 2006, pages 10594 - 10602
ANTONARAKIS, E.S. ET AL.: "AR-V7 and resistance to enzalutamide and abiraterone in prostate cancer", THE NEW ENGLANDJOURNAL OF MEDICINE, vol. 371, 2014, pages 1028 - 1038, XP055566838, DOI: 10.1056/NEJMoa1315815
ASANGANI, I. A. ET AL.: "Therapeutic targeting of BET bromodomain proteins in castration-resistant prostate cancer", NATURE, vol. 510, 2014, pages 278 - 282, XP055235062, DOI: 10.1038/nature13229
BANGA, A.J.: "THERAPEUTIC PEPTIDES AND PROTEINS: FORMULATION, PROCESSING, AND DELIVERY SYSTEMS", 1995, TECHNOMIC PUBLISHING COMPANY, INC.
BETAGERI ET AL.: "LIPOSOME DRUG DELIVERY SYSTEMS", 1993, TECHNOMIC PUBLISHING CO., INC.
BILD, A.H. ET AL.: "Oncogenic pathway signatures in human cancers as a guide to targeted therapies", NATURE, vol. 439, 2006, pages 353 - 357, XP002460134, DOI: 10.1038/nature04296
CHANDRAN, U.R. ET AL.: "Gene expression profiles of prostate cancer reveal involvement of multiple molecular pathways in the metastatic process", BMC CANCER, vol. 7, 2007, pages 64, XP021023145, DOI: 10.1186/1471-2407-7-64
CHANG, M.R.LYDA, B.KAMENECKA, T.M.GRIFFIN, P.R.: "Pharmacologic repression of retinoic acid receptor-related orphan nuclear receptor gamma is therapeutic in the collagen-induced arthritis experimental model", ARTHRITIS RHEUMATOL, vol. 66, 2014, pages 579 - 588, XP055673402, DOI: 10.1002/art.38272
CIOFANI, M. ET AL.: "A validated regulatory network for Thl7 cell specification", CELL, vol. 151, 2012, pages 289 - 303, XP055044458, DOI: 10.1016/j.cell.2012.09.016
DEBLOIS, G.GIGUERE, V.: "Oestrogen-related receptors in breast cancer: control of cellular metabolism and beyond", NATURE REVIEWS. CANCER, vol. 13, 2013, pages 27 - 36
EISEN, M.B.SPELLMAN, P.T.BROWN, P.O.BOTSTEIN, D.: "Cluster analysis and display of genome-wide expression patterns", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES, vol. 95, 1998, pages 14863 - 14868, XP002939285, DOI: 10.1073/pnas.95.25.14863
FAUBER ET AL., J. MED. CHEM., vol. 58, no. 13, 2015, pages 5308 - 22
FERRALDESCHI, R.WELTI, J.LUO, J.ATTARD, G.DE BONO, J.S.: "Targeting the androgen receptor pathway in castration-resistant prostate cancer: progresses and prospects", ONCOGENE, vol. 34, 2015, pages 1745 - 1757, XP036972812, DOI: 10.1038/onc.2014.115
FLAVENY, C.A. ET AL.: "Broad Anti-tumor Activity of a Small Molecule that Selectively Targets the Warburg Effect and Lipogenesis", CANCER CELL, vol. 28, 2015, pages 42 - 56, XP055750040, DOI: 10.1016/j.ccell.2015.05.007
FRIGO, D.E. ET AL.: "CaM kinase kinase beta-mediated activation of the growth regulatory kinase AMPK is required for androgen-dependent migration of prostate cancer cells", CANCER RESEARCH, vol. 71, 2011, pages 528 - 537, XP055091411, DOI: 10.1158/0008-5472.CAN-10-2581
GEGE, EXPERT OPINION ON THERAPEUTIC PATENTS, DOI: 10.1517/13543776.2016.1153066, 2016
GEGE, EXPERT OPINION ON THERAPEUTIC PATENTS, vol. 25, no. 10, 2015, pages 1215 - 1221
GIGUERE, V. ET AL.: "Isoform-specific amino-terminal domains dictate DNA-binding properties of ROR alpha, a novel family of orphan hormone nuclear receptors", GENES & DEVELOPMENT, vol. 8, 1994, pages 538 - 553, XP055058864, DOI: 10.1101/gad.8.5.538
GRASSO, C. S. ET AL.: "The mutational landscape of lethal castration-resistant prostate cancer", NATURE, vol. 487, 2012, pages 239 - 243, XP055420012, DOI: 10.1038/nature11125
GUO ET AL., CANCER RES., vol. 69, no. 6, 2009, pages 2305 - 13
HU ET AL., CANCER RESEARCH, vol. 69, no. 1, 2009, pages 16 - 22
HU, R. ET AL.: "Distinct transcriptional programs mediated by the ligand-dependent full-length androgen receptor and its splice variants in castration-resistant prostate cancer", CANCER RESEARCH, vol. 72, 2012, pages 3457 - 3462, XP055316015, DOI: 10.1158/0008-5472.CAN-11-3892
IJNTEMA ET AL., INT. J. PHARM., vol. 112, 1994, pages 215 - 224
JOHNSTON ET AL., PHARM. RES., vol. 9, 1992, pages 425 - 434
KALASHNIKOVA, E.V. ET AL.: "ANCCA/ATAD2 overexpression identifies breast cancer patients with poor prognosis, acting to drive proliferation and survival of triple-negative cells through control of B-Myb and EZH2", CANCER RESEARCH, vol. 70, 2010, pages 9402 - 9412, XP055207806, DOI: 10.1158/0008-5472.CAN-10-1199
KARANTANOS, T. ET AL.: "Understanding the mechanisms of androgen deprivation resistance in prostate cancer at the molecular level", EUROPEAN UROLOGY, vol. 67, 2015, pages 470 - 479
KOHLERMILSTEIN, NATURE, vol. 256, 1975, pages 495
KOJETIN, D.J.BURRIS, T.P.: "REV-ERB and ROR nuclear receptors as drug targets", NATURE REVIEWS. DRUG DISCOVERY, vol. 13, 2014, pages 197 - 216, XP055765003, DOI: 10.1038/nrd4100
KUMAR ET AL., MOLECULAR PHARMACOLOGY, vol. 77, no. 2, 2010, pages 228 - 236
KUMAR, N. ET AL.: "Identification of SR2211: a potent synthetic RORgamma-selective modulator", ACS CHEMICAL BIOLOGY, vol. 7, 2012, pages 672 - 677, XP055673407, DOI: 10.1021/cb200496y
KUMAR, N. ET AL.: "Identification of SR3335 (ML-176): a synthetic RORalpha selective inverse agonist", ACS CHEMICAL BIOLOGY, vol. 6, 2011, pages 218 - 222
LAI, K.P. ET AL.: "New therapeutic approach to suppress castration-resistant prostate cancer using ASC-J9 via targeting androgen receptor in selective prostate cells", THE AMERICAN JOURNAL OF PATHOLOGY, vol. 182, 2013, pages 460 - 473
LANGE, T. ET AL.: "Aberrant Presentation of HPA-Reactive Carbohydrates Implies Selectin-Independent Metastasis Formation in Human Prostate Cancer", CLINICAL CANCER RESEARCH, vol. 20, 2014, pages 1791 - 1802, XP055453916, DOI: 10.1158/1078-0432.CCR-13-2308
LANGER R., ACCOUNTS CHEM. RES., vol. 26, 1993, pages 537 - 542
LANGMEAD, B.SALZBERG, S.L.: "Fast gapped-read alignment with Bowtie 2", NATURE METHODS, vol. 9, 2012, pages 357 - 359, XP002715401, DOI: 10.1038/nmeth.1923
LANGMEAD, B.TRAPNELL, C.POP, M.SALZBERG, S.L.: "Ultrafast and memory-efficient alignment of short DNA sequences to the human genome", GENOME BIOLOGY, vol. 10, 2009, pages R25 - R25, XP021053573, DOI: 10.1186/gb-2009-10-3-r25
LI, H.DURBIN, R.: "Fast and accurate short read alignment with Burrows-Wheeler transform", BIOINFORMATICS, vol. 25, 2009, pages 1754 - 1760, XP055553969, DOI: 10.1093/bioinformatics/btp324
LI, Y. ET AL.: "LEF1 in androgen-independent prostate cancer: regulation of androgen receptor expression, prostate cancer growth, and invasion", CANCER RESEARCH, vol. 69, 2009, pages 3332 - 3338
LIU, C. ET AL.: "Niclosamide inhibits androgen receptor variants expression and overcomes enzalutamide resistance in castration-resistant prostate cancer", CLINICAL CANCER RESEARCH : AN OFFICIAL JOURNAL OF THE AMERICAN ASSOCIATION FOR CANCER RESEARCH, vol. 20, 2014, pages 3198 - 3210
LOUIE, M.C. ET AL.: "Androgen-induced recruitment of RNA polymerase II to a nuclear receptor-pl60 coactivator complex", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE UNITED STATES OF AMERICA, vol. 100, 2003, pages 2226 - 2230, XP055179591, DOI: 10.1073/pnas.0437824100
LOUIE, M.C.ZOU, J.X.RABINOVICH, A.CHEN, H.W.: "ACTR/AIB1 functions as an E2F1 coactivator to promote breast cancer cell proliferation and antiestrogen resistance", MOLECULAR AND CELLULAR BIOLOGY, vol. 24, 2004, pages 5157 - 5171, XP055259529, DOI: 10.1128/MCB.24.12.5157-5171.2004
LU, J.VAN DER STEEN, T.TINDALL, D.J.: "Are androgen receptor variants a substitute for the full-length receptor?", NATURE REVIEWS. UROLOGY, vol. 12, 2015, pages 137 - 144
MALIK, R. ET AL.: "Targeting the MLL complex in castration-resistant prostate cancer", NAT MED, vol. 21, 2015, pages 344 - 352
MEHTA NR, CLIN. CANCER RES., vol. 18, 2012, pages 2861 - 2871
MEISSBURGER, B. ET AL.: "Adipogenesis and insulin sensitivity in obesity are regulated by retinoid-related orphan receptor gamma", EMBO MOLECULAR MEDICINE, vol. 3, 2011, pages 637 - 651
MENDIRATTA, P. ET AL.: "Genomic strategy for targeting therapy in castration-resistant prostate cancer", J CLIN ONCOL, vol. 27, 2009, pages 2022 - 2029
MOSTAGHEL, E.A.PLYMATE, S.R.MONTGOMERY, B.: "Molecular pathways: targeting resistance in the androgen receptor for therapeutic benefit", CLINICAL CANCER RESEARCH : AN OFFICIAL JOURNAL OF THE AMERICAN ASSOCIATION FOR CANCER RESEARCH, vol. 20, 2014, pages 791 - 798, XP055220529, DOI: 10.1158/1078-0432.CCR-12-3601
MYUNG, J.K. ET AL.: "An androgen receptor N-terminal domain antagonist for treating prostate cancer", THE JOURNAL OF CLINICAL INVESTIGATION, vol. 123, 2013, pages 2948 - 2960, XP055137757, DOI: 10.1172/JCI66398
NGUYEN, H.G. ET AL.: "Targeting autophagy overcomes Enzalutamide resistance in castration-resistant prostate cancer cells and improves therapeutic response in a xenograft model", ONCOGENE, vol. 33, 2014, pages 4521 - 4530
O'MALLEY ET AL., CANCER CELL, vol. 28, 2015, pages 240 - 252
PEC ET AL., J. PARENT. SCI. TECH., vol. 44, no. 2, 1990, pages 58 - 65
QIN, J. ET AL.: "Androgen deprivation-induced NCoA2 promotes metastatic and castration-resistant prostate cancer", THE JOURNAL OF CLINICAL INVESTIGATION, vol. 124, 2014, pages 5013 - 5026
RENE, O. ET AL.: "Minor Structural Change to Tertiary Sulfonamide RORc Ligands Led to Opposite Mechanisms of Action", ACS MEDICINAL CHEMISTRY LETTERS, vol. 6, 2015, pages 276 - 281
ROBINSON, D. ET AL.: "Integrative clinical genomics of advanced prostate cancer", CELL, vol. 161, 2015, pages 1215 - 1228, XP029129142, DOI: 10.1016/j.cell.2015.05.001
ROSS-ADAMS, H. ET AL.: "Integration of copy number and transcriptomics provides risk stratification in prostate cancer: A discovery and validation cohort study", EBIOMEDICINE, vol. 2, 2015, pages 1133 - 1144, XP055433817, DOI: 10.1016/j.ebiom.2015.07.017
SCHMIDT, D. ET AL.: "ChIP-seq: using high-throughput sequencing to discover protein-DNA interactions", METHODS, vol. 48, 2009, pages 240 - 248, XP026284845, DOI: 10.1016/j.ymeth.2009.03.001
See also references of EP3268087A4 *
SHARMA, A. ET AL.: "The retinoblastoma tumor suppressor controls androgen signaling and human prostate cancer progression", THE JOURNAL OF CLINICAL INVESTIGATION, vol. 120, 2010, pages 4478 - 4492
SHARMA, N.L. ET AL.: "The androgen receptor induces a distinct transcriptional program in castration-resistant prostate cancer in man", CANCER CELL, vol. 23, 2013, pages 35 - 47
SOLT, L.A. ET AL.: "Identification of a selective RORgamma ligand that suppresses T(H)17 cells and stimulates T regulatory cells", ACS CHEMICAL BIOLOGY, vol. 7, 2012, pages 1515 - 1519
SUBRAMANIAN, A. ET AL.: "Gene set enrichment analysis: a knowledge-based approach for interpreting genome-wide expression profiles", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE UNITED STATES OF AMERICA, vol. 102, 2005, pages 15545 - 15550, XP002464143, DOI: 10.1073/pnas.0506580102
SUN, Z. ET AL.: "Requirement for RORgamma in thymocyte survival and lymphoid organ development", SCIENCE, vol. 288, 2000, pages 2369 - 2373, XP008091908, DOI: 10.1126/science.288.5475.2369
TAKEDA, Y. ET AL.: "Retinoic acid-related orphan receptor gamma (RORgamma): a novel participant in the diurnal regulation of hepatic gluconeogenesis and insulin sensitivity", PLOS GENET, vol. 10, 2014, pages e1004331
TAMURA, K. ET AL.: "Molecular Features of Hormone-Refractory Prostate Cancer Cells by Genome-Wide Gene Expression Profiles", CANCER RESEARCH, vol. 67, 2007, pages 5117 - 5125, XP002613537, DOI: 10.1158/0008-5472.can-06-4040
TAYLOR, B.S. ET AL.: "Integrative genomic profiling of human prostate cancer", CANCER CELL, vol. 18, 2010, pages 11 - 22, XP055280056, DOI: 10.1016/j.ccr.2010.05.026
TIEN, J.C. ET AL.: "The steroid receptor coactivator-3 is required for the development of castration-resistant prostate cancer", CANCER RESEARCH, vol. 73, 2013, pages 3997 - 4008
TRAPNELL, C. ET AL.: "Differential gene and transcript expression analysis of RNA-seq experiments with TopHat and Cufflinks", NAT. PROTOCOLS, vol. 7, 2012, pages 562 - 578, XP055175849, DOI: 10.1038/nprot.2012.016
TRAPNELL, C. ET AL.: "Transcript assembly and quantification by RNA-Seq reveals unannotated transcripts and isoform switching during cell differentiation", NAT BIOTECH, vol. 28, 2010, pages 511 - 515, XP055091870, DOI: 10.1038/nbt.1621
WANG ET AL., ACS MED. CHEM. LETT., vol. 6, 2015, pages 787 - 92
WANG, Y. ET AL.: "Bufalin is a potent small-molecule inhibitor of the steroid receptor coactivators SRC-3 and SRC-1", CANCER RESEARCH, vol. 74, 2014, pages 1506 - 1517, XP055258893, DOI: 10.1158/0008-5472.CAN-13-2939
WANG, Y. ET AL.: "Discovery of novel N-(5-(arylcarbonyl)thiazol-2-yl)amides and N-(5-(arylcarbonyl)thiophen-2-yl)amides as potent RORgammat inhibitors", BIOORGANIC & MEDICINAL CHEMISTRY, vol. 22, 2014, pages 692 - 702
WEI, Q. ET AL.: "Reduced Expression of Mismatch Repair Genes Measured by Multiplex Reverse Transcription-Polymerase Chain Reaction in Human Gliomas", CANCER RESEARCH, vol. 57, 1997, pages 1673 - 1677
XIAO, S. ET AL.: "Small-molecule RORgammat antagonists inhibit T helper 17 cell transcriptional network by divergent mechanisms", IMMUNITY, vol. 40, 2014, pages 477 - 489
YAMAMOTO, Y. ET AL.: "Generation 2.5 antisense oligonucleotides targeting the androgen receptor and its splice variants suppress enzalutamide-resistant prostate cancer cell growth", CLINICAL CANCER RESEARCH : AN OFFICIAL JOURNAL OF THE AMERICAN ASSOCIATION FOR CANCER RESEARCH, vol. 21, 2015, pages 1675 - 1687, XP055500439, DOI: 10.1158/1078-0432.CCR-14-1108
YANG ET AL.: "T helper 17 lineage differentiation is programmed by orphan nuclear receptors ROR alpha and ROR gamma", IMMUNITY, vol. 28, no. 1, 27 December 2007 (2007-12-27), pages 29 - 39, XP055042175 *
YANG, L. ET AL.: "Induction of androgen receptor expression by phosphatidylinositol 3-kinase/Akt downstream substrate, FOX03a, and their roles in apoptosis of LNCaP prostate cancer cells", THE JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 280, 2005, pages 33558 - 33565
YANG, P. ET AL.: "Histone Methyltransferase NSD2/MMSET Mediates Constitutive NF-kappaB Signaling for Cancer Cell Proliferation, Survival, and Tumor Growth via a Feed-Forward Loop", MOLECULAR AND CELLULAR BIOLOGY, vol. 32, 2012, pages 3121 - 3131
YU, Z. ET AL.: "Galeterone prevents androgen receptor binding to chromatin and enhances degradation of mutant androgen receptor", CLINICAL CANCER RESEARCH : AN OFFICIAL JOURNAL OF THE AMERICAN ASSOCIATION FOR CANCER RESEARCH, vol. 20, 2014, pages 4075 - 4085
ZHANG ET AL., EUR. J. MED. CHEM., vol. 6, no. 78, 2014, pages 431 - 41
ZHANG ET AL.: "Interieukin-1 promotes development of castration-resistant prostate cancer potentially through creating an immunotolerant and pro-angiogenic tumor microenvironment", PROSTATE, vol. 74, no. 8, 1 April 2014 (2014-04-01), pages 869 - 879, XP055310525 *
ZHANG, L. ET AL.: "NF-kappaB regulates androgen receptor expression and prostate cancer growth", THE AMERICAN JOURNAL OF PATHOLOGY, vol. 175, 2009, pages 489 - 499
ZHANG, Q. ET AL.: "Interleukin-17 promotes formation and growth of prostate adenocarcinoma in mouse models", CANCER RESEARCH, vol. 72, 2012, pages 2589 - 2599
ZHANG, Y. ET AL.: "Discovery of 2-oxo-1,2-dihydrobenzo[cd]indole-6-sulfonamide derivatives as new RORgamma inhibitors using virtual screening, synthesis and biological evaluation", EUROPEAN JOURNAL OF MEDICINAL CHEMISTRY, vol. 78, 2014, pages 431 - 441
ZHANG, Y. ET AL.: "Model-based analysis of ChIP-Seq (MACS", GENOME BIOLOGY, vol. 9, 2008, pages R137, XP021046980, DOI: 10.1186/gb-2008-9-9-r137
ZHANG, Y.LUO, X.-Y.WU, D.-H.XU, Y.: "ROR nuclear receptors: structures, related diseases, and drug discovery", ACTA PHARMACOL SIN, vol. 36, 2015, pages 71 - 87, XP055621844, DOI: 10.1038/aps.2014.120
ZHAO, X. ET AL.: "Nuclear receptors rock around the clock", EMBO REPORTS, vol. 15, 2014, pages 518 - 528
ZHONG, J. ET AL.: "p300 acetyltransferase regulates androgen receptor degradation and PTEN-deficient prostate tumorigenesis", CANCER RESEARCH, vol. 74, 2014, pages 1870 - 1880
ZOU, J.X. ET AL.: "Androgen-induced coactivator ANCCA mediates specific androgen receptor signaling in prostate cancer", CANCER RESEARCH, vol. 69, 2009, pages 3339 - 3346, XP055018913, DOI: 10.1158/0008-5472.CAN-08-3440

Cited By (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10959984B2 (en) 2015-03-12 2021-03-30 The Regents Of The University Of California Methods for treating cancer with RORγ inhibitors
CN110139652A (zh) * 2016-10-27 2019-08-16 爱思凯利尔生物科学私人有限责任公司 ROR-γ调节剂
CN110139652B (zh) * 2016-10-27 2022-10-11 爱思凯利尔生物科学私人有限责任公司 ROR-γ调节剂
US10961216B2 (en) 2017-07-28 2021-03-30 Massachusetts Institute Of Technology Small molecule modulators of the androgen receptor
WO2020065682A1 (en) * 2018-09-29 2020-04-02 Translational Health Science And Technology Institute Ror antagonists, their use and method of treatment comprising the said modulators
EP3927329A4 (en) * 2019-02-20 2022-11-23 The Regents of the University of California TREATMENT OF RETINIC ACID RECEPTOR-RELATED ORPHAN RECEPTOR-Y(RORY)-DEPENDENT CANCER
WO2022067185A1 (en) * 2020-09-27 2022-03-31 Veru Inc. Methods of treating prostate cancer with minimal side effects
WO2022122740A1 (en) * 2020-12-07 2022-06-16 Diaccurate Ror-gamma inhibitors for the treatment of ror-gamma-dependent cancer
US20240051969A1 (en) * 2020-12-07 2024-02-15 Diaccurate Ror-gamma inhibitors for the treatment of ror-gamma-dependent cancer
WO2023281097A1 (en) 2021-07-09 2023-01-12 Immunic Ag Methods for treating cancer

Also Published As

Publication number Publication date
US10959984B2 (en) 2021-03-30
HK1249469A1 (zh) 2018-11-02
JP2018513123A (ja) 2018-05-24
CN107614062A (zh) 2018-01-19
EP3268087A1 (en) 2018-01-17
US20180085348A1 (en) 2018-03-29
EP3268087A4 (en) 2018-08-29

Similar Documents

Publication Publication Date Title
US10959984B2 (en) Methods for treating cancer with RORγ inhibitors
US20210161837A1 (en) Methods for treating cancer with rorgamma inhibitors
US11215617B2 (en) Treatment of metastatic prostate cancer
Samanta et al. RETRACTED: PHGDH expression is required for mitochondrial redox homeostasis, breast cancer stem cell maintenance, and lung metastasis
Luo et al. Stem cell quiescence and its clinical relevance
JP2023139230A (ja) 癌を治療するための併用療法
Jia et al. Neddylation inactivation facilitates FOXO3a nuclear export to suppress estrogen receptor transcription and improve fulvestrant sensitivity
US20190307750A1 (en) Targeting chromatin regulators inhibits leukemogenic gene expression in npm1 mutant leukemia
KR102615210B1 (ko) 난소암의 치료에 사용되는 티노스타무스틴
Han et al. Triptolide inhibits the AR signaling pathway to suppress the proliferation of enzalutamide resistant prostate cancer cells
Timilsina et al. The antidepressant imipramine inhibits breast cancer growth by targeting estrogen receptor signaling and DNA repair events
WO2020047487A1 (en) Methods for treating cancer with rorgamma inhibitors and statins
Wang et al. Dual PLK1 and STAT3 inhibition promotes glioblastoma cells apoptosis through MYC
Wang et al. Rottlerin inhibits cell growth and invasion via down-regulation of Cdc20 in glioma cells
EP3213752A1 (en) Composition for treating cancer stem cells
Abdelaal et al. Reversing oncogenic transformation with iron chelation
Hou et al. Conquering oncogenic KRAS and its bypass mechanisms
JP7683931B2 (ja) 抗腫瘍剤及び配合剤
WO2019171268A1 (en) New active principles for the treatment of tumours
WO2020049139A1 (en) Urea derivatives for use in the treatment of subjects with elevated expression and/or activity of srpk1
JP7361779B2 (ja) がんに治療的処置をするためのc-19ステロイドの組み合わせ
CN113230249A (zh) 土荆皮乙酸在作为或制备Hedgehog信号通路抑制剂中的应用
Yang et al. Discovery of new tetrahydroisoquinolines as potent and selective LSD1 inhibitors for the treatment of MLL-rearranged leukemia
EP3487490A1 (en) Compounds for targeting cancer stem cells
US20250099426A1 (en) Indolium Compounds for Treating Cancer

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 16762587

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2017547968

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

REEP Request for entry into the european phase

Ref document number: 2016762587

Country of ref document: EP