WO2016109543A1 - Methods to improve cell therapy - Google Patents
Methods to improve cell therapy Download PDFInfo
- Publication number
- WO2016109543A1 WO2016109543A1 PCT/US2015/067873 US2015067873W WO2016109543A1 WO 2016109543 A1 WO2016109543 A1 WO 2016109543A1 US 2015067873 W US2015067873 W US 2015067873W WO 2016109543 A1 WO2016109543 A1 WO 2016109543A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- population
- cells
- selectin
- cell
- tissue
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
- A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
- A61K35/14—Blood; Artificial blood
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
- A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
- A61K35/14—Blood; Artificial blood
- A61K35/17—Lymphocytes; B-cells; T-cells; Natural killer cells; Interferon-activated or cytokine-activated lymphocytes
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
- A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
- A61K35/28—Bone marrow; Haematopoietic stem cells; Mesenchymal stem cells of any origin, e.g. adipose-derived stem cells
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
- A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
- A61K35/30—Nerves; Brain; Eyes; Corneal cells; Cerebrospinal fluid; Neuronal stem cells; Neuronal precursor cells; Glial cells; Oligodendrocytes; Schwann cells; Astroglia; Astrocytes; Choroid plexus; Spinal cord tissue
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
- A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
- A61K35/32—Bones; Osteocytes; Osteoblasts; Tendons; Tenocytes; Teeth; Odontoblasts; Cartilage; Chondrocytes; Synovial membrane
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
- A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
- A61K35/33—Fibroblasts
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
- A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
- A61K35/34—Muscles; Smooth muscle cells; Heart; Cardiac stem cells; Myoblasts; Myocytes; Cardiomyocytes
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
- A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
- A61K35/35—Fat tissue; Adipocytes; Stromal cells; Connective tissues
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
- A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
- A61K35/37—Digestive system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
- A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
- A61K35/37—Digestive system
- A61K35/407—Liver; Hepatocytes
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
- A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
- A61K35/42—Respiratory system, e.g. lungs, bronchi or lung cells
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K9/00—Medicinal preparations characterised by special physical form
- A61K9/0012—Galenical forms characterised by the site of application
- A61K9/0019—Injectable compositions; Intramuscular, intravenous, arterial, subcutaneous administration; Compositions to be administered through the skin in an invasive manner
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
- A61P1/04—Drugs for disorders of the alimentary tract or the digestive system for ulcers, gastritis or reflux esophagitis, e.g. antacids, inhibitors of acid secretion, mucosal protectants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
- A61P1/16—Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
- A61P1/18—Drugs for disorders of the alimentary tract or the digestive system for pancreatic disorders, e.g. pancreatic enzymes
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P13/00—Drugs for disorders of the urinary system
- A61P13/12—Drugs for disorders of the urinary system of the kidneys
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P17/00—Drugs for dermatological disorders
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P17/00—Drugs for dermatological disorders
- A61P17/02—Drugs for dermatological disorders for treating wounds, ulcers, burns, scars, keloids, or the like
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P17/00—Drugs for dermatological disorders
- A61P17/06—Antipsoriatics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P19/00—Drugs for skeletal disorders
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P19/00—Drugs for skeletal disorders
- A61P19/02—Drugs for skeletal disorders for joint disorders, e.g. arthritis, arthrosis
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P19/00—Drugs for skeletal disorders
- A61P19/08—Drugs for skeletal disorders for bone diseases, e.g. rachitism, Paget's disease
- A61P19/10—Drugs for skeletal disorders for bone diseases, e.g. rachitism, Paget's disease for osteoporosis
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P21/00—Drugs for disorders of the muscular or neuromuscular system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P21/00—Drugs for disorders of the muscular or neuromuscular system
- A61P21/04—Drugs for disorders of the muscular or neuromuscular system for myasthenia gravis
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
- A61P25/14—Drugs for disorders of the nervous system for treating abnormal movements, e.g. chorea, dyskinesia
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
- A61P25/28—Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
- A61P25/30—Drugs for disorders of the nervous system for treating abuse or dependence
- A61P25/32—Alcohol-abuse
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P3/00—Drugs for disorders of the metabolism
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P3/00—Drugs for disorders of the metabolism
- A61P3/08—Drugs for disorders of the metabolism for glucose homeostasis
- A61P3/10—Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/04—Antibacterial agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
- A61P35/02—Antineoplastic agents specific for leukemia
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/02—Immunomodulators
- A61P37/06—Immunosuppressants, e.g. drugs for graft rejection
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P39/00—General protective or antinoxious agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P7/00—Drugs for disorders of the blood or the extracellular fluid
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P7/00—Drugs for disorders of the blood or the extracellular fluid
- A61P7/02—Antithrombotic agents; Anticoagulants; Platelet aggregation inhibitors
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P7/00—Drugs for disorders of the blood or the extracellular fluid
- A61P7/04—Antihaemorrhagics; Procoagulants; Haemostatic agents; Antifibrinolytic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
- A61P9/10—Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/0006—Modification of the membrane of cells, e.g. cell decoration
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
- A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
- A61K2035/124—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells the cells being hematopoietic, bone marrow derived or blood cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/70—Enzymes
- C12N2501/72—Transferases [EC 2.]
- C12N2501/724—Glycosyltransferases (EC 2.4.)
Definitions
- cell-based therapeutics also known as “adoptive cellular therapeutics”
- delivery of cells for clinical indications can be achieved by direct (local) injection into involved tissue(s), by intravascular administration ⁇ e.g., system ically or by catheter-based delivery to a particular vascular bed), or by application/placement of cells directly onto the affected area (e.g., for skin ulcers, burns, etc.).
- intravascular administration e.g., system ically or by catheter-based delivery to a particular vascular bed
- application/placement of cells directly onto the affected area e.g., for skin ulcers, burns, etc.
- microenvironmental site are the "perivascular areas" present in and around microvessels within the injured tissue, as it is well known that integrity of the
- angiogenesis vascular endothelial growth factor-1
- endothelial cells within the microvessels of affected tissue(s) display a characteristic set of adhesion molecules that serve a key role in recruitment of circulating (blood-borne) cells to the target site.
- endothelial molecules are upregulated by inflammatory cytokines such as tumor necrosis factor (TNF) and interleukin 1 (IL-1 ), and, in humans include the molecule E-selectin, and, in mouse, the molecules E-selectin and P-selectin, which are lectins belonging to a family of adhesion molecules known as "selectins" (to be described in more detail below).
- leukocytes that have been recruited to any inflammatory site (including cancer) or to a site of tissue injury/damage display L-selectin, the "leukocyte” selectin, and, therefore, expression of ligands for L-selectin on administered cells would promote lodgement of such cells to regions of leukocyte infiltrates within the affected tissue(s).
- homing receptors The molecules that mediate these contacts are called "homing receptors," and, as defined historically, these structures pilot tropism of cells in blood to the respective target tissue.
- tissue-specific homing receptors L-selectin for peripheral lymph nodes, ⁇ 4 ⁇ 7 (LPAM-1 ) for intestines and gut-associated lymphoid tissue, and a specialized glycoform of the molecule P-selectin Glycoprotein Ligand-1 (PSGL-1 ) known, specifically, as the
- CLA Cutaneous Lymphocyte Antigen
- HSCs hematopoietic stem cells
- a homing receptor functions as a molecular brake, effecting initial tethering then sustained rolling contacts of cells in blood flow onto the vascular endothelium at velocities below that of the prevailing bloodstream (Step 1 ) (R. Sackstein, Curr Opin Hematol 12, 444 (2005)). Thereafter, a cascade of events ensue, typically potentiated by chemokines, resulting in activation of integrin adhesiveness (Step 2), firm adherence (Step 3) and endothelial transmigration (Step 4) (T. A. Springer, Cell 76, 301 (1994)).
- tissue-specific migration is regulated by a discrete combination of homing receptor and chemokine receptor expression on a given circulating cell, allowing for recognition of a pertinent "traffic signal” displayed by the relevant vascular adhesive ligands and chemokines expressed within target endothelium in an organ-specific manner.
- CXCL12 plays an essential role in Step 2-mediated recruitment of cells to this site (T. Lapidot, A. Dar, O. Kollet, Blood 106, 1901 (2005); A. Peled et al., Science 283, 845 (1999); D. A. Sipkins et al., Nature 435, 969 (2005)).
- expression of SDF-1 is not limited to the marrow, and this chemokine is typically expressed at all sites of tissue injury/inflammation (R. Sackstein, Immunol. Rev. 230: 140-163 (2009)).
- selectins are lectins that bind to specialized carbohydrate determinants, consisting of sialofucosylations containing an a(2,3)-linked sialic acid substitution(s) and an a(1 ,3)-linked fucose modification(s) prototypically displayed as the tetrasaccharide sialyl Lewis X (sLe x ; Neu5Aca2-3Gaipi -4[Fuca1 - 3]GlcNAcpi -)) (R.
- sLex glycan is recognized by a variety of monoclonal antibodies (mAbs), including the mAb known as "HECA452.”
- E- and P- selectin are expressed on vascular endothelium (P-selectin also on platelets), and L- selectin is expressed on circulating leukocytes (R. Sackstein, Curr Opin Hematol 12, 444 (2005)).
- E- and P-selectin are typically inducible endothelial membrane molecules that are prominently expressed only at sites of tissue injury and inflammation, where their expression is generated in response to inflammatory cytokines.
- the microvasculature of bone marrow and skin constitutively expresses these selectins, and they play a key role in steady-state recruitment of blood-borne cells to these sites (R Sackstein J Invest. Dermatology, 122: 1061 -1069 (2004)).
- E- selectin is the principal vascular selectin mediating cell recruitment, as the promoter element responsive to the inflammatory cytokines TNF and IL-1 has been deleted from the P-selectin gene.
- vascular E-selectin expression is more pronounced than that of P-selectin (R. Sackstein, Immunol. Rev. 230: 140-163 (2009)).
- HCELL Hematopoietic Cell E-/L-selectin Ligand
- CLA/PSGL-1 is widely expressed among hematopoietic progenitors and more mature myeloid and lymphoid cells within the marrow (Z. Laszik et al., Blood 88, 3010 (1996), R. Sackstein, Immunol. Rev. 230: 140-163 (2009)).
- HCELL is operationally defined as CD44 that binds to E-selectin and L-selectin under shear conditions, and is identified by Western blot analysis of cell lysates as a CD44 glycoform reactive with E-selectin-lg chimera (E-lg) and with mAb HECA452, which recognizes sialyl Lewis X (and, in addition to sLex, HECA452 recognizes the tetrasaccharide isomer of sLex known as a "sialylated Lewis a" (sLea) in which fucose is attached in a(1 ,4)-linkage to N- acetylglucosamine within a type 1 lactosamine backbone).
- CLA CLA
- human leukocytes and HSPCs can also express a CD43 glycoform known as "CD43-E” which can serve as an E-selectin ligand (Fuhlbrigge et al Blood 107:1421 - 1426 (2006), Merzaban et al Blood 1 18: 1774-1783 (201 1 )), and, in mouse leukocytes, another E-selectin ligand known as E-selectin Ligand-1 (ESL-1 ) has been described (Merzaban et al Blood 1 18: 1774-1783 (201 1 )) .
- ESL-1 E-selectin Ligand-1
- HCELL displays the pertinent sialofucosylated selectin binding determinants on N-glycans (C. J. Dimitroff, J. Y. Lee, S. Rafii, R. C. Fuhlbrigge, R.
- E-selectin is constitutively expressed on microvascular endothelium of the marrow and skin, this molecule is prominently expressed on endothelial beds at all sites of inflammation - - both acute and chronic types - - regardless of whether it is induced by direct tissue injury (e.g. , burns, trauma, decubitus ulcers, etc.), ischemic/vascular events (e.g., myocardial infarct, stroke, shock, hemorrhage, coagulopathy, etc.), infections (e.g. , cellulitis, pneumonia, meningitis, SIRS, etc.), neoplasia (e.g.
- immunologic/autoimmune conditions e.g. , graft vs. host disease, multiple sclerosis, diabetes, inflammatory bowel disease, lupus erythematosus, rheumatoid arthritis, psoriasis, etc.
- degenerative diseases e.g. , osteoporosis, osteoarthritis, Alzheimer's disease, etc.
- congenital/genetic diseases e.g. , muscular dystrophies, lysosomal storage diseases, Huntington's disease, etc.
- adverse drug effects e.g. , drug-induced hepatitis, drug-induced cardiac injury, etc.
- toxic injuries e.g. , radiation exposure(s), chemical exposure(s), alcoholic hepatitis, alcoholic pancreatitis, alcoholic
- cardiomyopathy e.g., cocaine cardiomyopathy, etc.
- metabolic derangements e.g. , uremic pericarditis, metabolic acidosis, etc.
- iatrogenic conditions e.g. , radiation-induced tissue injury, surgery-related complications, etc.
- idiopathic processes e.g. , amyotrophic lateral sclerosis, Parsonnage-Turner Syndrome, etc.
- E-selectin binds to sialylated, fucosylated carbohydrates (e.g. , members of the sialylated Lewis X and Lewis A families) present natively on the surface of certain leukocytes and hematopoietic stem/progenitor cells, i.e., myeloid cells (e.g.
- lymphocytes e.g. , neutrophils, monocytes, eosinophils, macrophages, etc.
- dendritic cells both lymphoid- and myeloid-derived
- lymphocytes e.g. , naive and memory T cells, naive and memory B cells, effector T cells, regulatory T cells, natural killer cells (NK cells), etc.
- NK cells natural killer cells
- hematopoietic progenitor cells and hematopoietic stem cells. These cell types are thus found at acute and chronic inflammatory sites, recruited by vascular E-selectin to such inflammatory sites.
- Leukocytes and HSPCs characteristically display L-selectin.
- L- selectin itself, binds to sialylated, fucosylated carbohydrates such as sLex.
- inflammatory sites have cells that express E-selectin (on endothelial cells) and L- selectin (on infiltrating leukocytes and HSPCs).
- the present disclosure is directed to methods of treating a disease, disorder or medical condition manifesting as inflamed and/or damaged tissue and/or cancer in a subject, the methods comprising administering to the subject a cell population that expresses an E-selectin ligand and/or an L-selectin ligand at a level that exceeds that of a native population of the cells.
- the administration occurs coincident with expression of E-selectin on endothelial cells within the target tissue (e.g., inflamed and/or damaged tissue, cancerous tissue) and/or coincident with accumulation of leukocytes (e.g., leukocytic infiltrates) within the target tissue.
- the administration may be by direct injection within the target tissue and/or via the vasculature and/or via other means as described in further detail below.
- the present disclosure is further directed to a method for the treatment of inflammation with a viable population of cells that express an E-selectin and/or L- selectin ligand.
- the viable cell population expresses an E-selectin ligand and/or an L- selectin ligand at a level that exceeds the level of expression of a native population of the cells.
- the administration occurs coincident with expression of E-selectin on endothelial cells within the target tissue (e.g., inflamed and/or damaged tissue, cancerous tissue) and/or coincident with accumulation of leukocytes (e.g., leukocytic infiltrates) within the target tissue.
- the administration may be by direct injection into the target tissue and/or via the vasculature (and/or via other means as described in further detail below) and treatment of the disease, disorder or medical condition need not be accompanied by long-term engraftment of the administered cells (i.e., treatment could be achieved either with transient colonization or with long-term persistence/longevity of administered cells at the treatment site or with proliferation of administered cells at the treatment site or with differentiation and/or maturation of administered cells at the treatment site).
- the present disclosure is further directed to a viable population of cells that express an E-selectin and/or L-selectin ligand for use in the manufacture of a medicament for treating inflammation in a subject.
- the viable cell population expresses an E-selectin ligand and/or an L-selectin ligand at a level that exceeds the level of expression of a native population of the cells.
- the administration occurs coincident with expression of E-selectin on endothelial cells within the target tissue (e.g., inflamed and/or damaged tissue, cancerous tissue) and/or coincident with accumulation of leukocytes ⁇ e.g., leukocytic infiltrates) within the target tissue.
- the administration may be by direct injection into the target tissue and/or via the vasculature and/or via other means as described in further detail below.
- the present disclosure is further directed to a viable population of cells that express an E-selectin ligand and/or an L-selectin ligand for use in the manufacture of a medicament for the treatment of a tumor/malignant disease, the treatment comprising administering to the subject the population of cells that express an E-selectin ligand and/or an L-selectin ligand for use in the manufacture of a medicament for the treatment of a tumor/malignant disease, the treatment comprising administering to the subject the population of cells that express an E-selectin ligand and/or an L-selectin ligand for use in the manufacture of a medicament for the treatment of a tumor/malignant disease, the treatment comprising administering to the subject the population of cells that express an E-selectin ligand and/or an L-selectin ligand for use in
- E-selectin ligand and/or an L-selectin ligand wherein the population expresses the E-selectin ligand and/or L-selectin ligand at a level that exceeds the level of expression of a native population of the cells, wherein said treatment comprises administering the population coincident with E-selectin expression on endothelial cells within the tumor/malignant tissue and/or coincident with accumulation of leukocytes within the tumor/malignant tissue.
- the present disclosure is further directed to a viable population of cells that express an E-selectin ligand and/or an L-selectin ligand for use in the manufacture of a medicament for the treatment of a diseased state manifesting inflammation, the treatment comprising administering to the subject the population of cells that express an E-selectin ligand and/or an L-selectin ligand, wherein the population expresses the E-selectin ligand and/or L-selectin ligand at a level that exceeds the level of expression of a native population of the cells, wherein said treatment comprises administering the population coincident with the onset of E-selectin expression on endothelial cells within the tumor/malignant tissue and/or coincident with accumulation of leukocytes within the tumor/malignant tissue.
- Other methods involving the administration (e.g., via the vasculature and/or via direct injection into tissue and/or via other means) described herein include, for example, method of enhancing cell delivery and colonization in an inflamed and/or damaged tissue or site of cancer in a subject (collectively, a "target" tissue), methods of enhancing cell delivery into a target tissue of a subject and/or enhancing tissue colonization in the target tissue of the subject, methods of improving cellular delivery to a target tissue in a subject, methods of enhancing cell delivery and colonization into a target tissue of a subject, method of enhancing homing and engraftment of a cell population within a target tissue in a subject, methods of treating an inflammatory condition in a subject, methods of enhancing tissue repair/regeneration in a subject, and methods of treating tumor/malignant disease in a subject.
- a target tissue in an inflamed and/or damaged tissue or site of cancer in a subject
- any of a variety of inflammatory conditions e.g. , acute and/or chronic
- damaged tissue may be treated in accordance with the methods described herein, including, but not limited to those initiated by direct tissue injury (e.g. , burns, trauma, decubitus ulcers, etc.), ischemic/vascular events (e.g. , myocardial infarct, stroke, shock, hemorrhage, coagulopathy, etc.), infections (e.g. , cellulitis, pneumonia, meningitis, SIRS, etc.), neoplasia (e.g. , breast cancer, lung cancer, lymphoma, etc.), immunologic/autoimmune conditions (e.g.
- direct tissue injury e.g. , burns, trauma, decubitus ulcers, etc.
- ischemic/vascular events e.g. , myocardial infarct, stroke, shock, hemorrhage, coagulopathy, etc.
- infections e.g. , cellulitis,
- graft vs. host disease multiple sclerosis, diabetes, inflammatory bowel disease, lupus erythematosus, rheumatoid arthritis, psoriasis, etc.
- degenerative diseases e.g. , osteoporosis, osteoarthritis, Alzheimer's disease, etc.
- congenital/genetic diseases e.g. ,
- cardiomyopathy e.g., cocaine cardiomyopathy, etc.
- metabolic derangements e.g. , uremic pericarditis, metabolic acidosis, etc.
- iatrogenic conditions e.g. , radiation-induced tissue injury, surgery-related complications, etc.
- idiopathic processes e.g. , amyotrophic lateral sclerosis, Parsonnage-Turner Syndrome, etc.
- the E-selectin ligand and/or L- selectin ligand expressed by the cell population is selected from one or more of
- the E-selectin ligand is Hematopoietic Cell E-/L-selectin Ligand (HCELL), Neural Cell Adhesion Molecule E- selectin Ligand (NCAM-E), CD43E, and CLA.
- the E-selectin ligand is Hematopoietic Cell E-/L-selectin Ligand (HCELL) and/or Neural Cell Adhesion Molecule E-selectin Ligand (NCAM-E).
- the E-selectin ligand is HCELL.
- the E-selectin ligand is NCAM-E.
- the L-selectin ligand is HCELL.
- E-selectin is expressed within endothelial beds of the affected tissue and leukocytes characteristically express L-selectin
- expression of HCELL a potent E-selectin and L-selectin ligand, would serve to promote tissue lodgement expressly within the microenvironments of most intense immunoreactivity/tissue damage.
- a variety of methods may be utilized to prepare the population of cells for administration to the subject.
- the population is prepared by contacting the cell or a population of cells with glycosy transferase together with appropriate donor nucleotide sugar.
- glycan engineering may be used to sialofucosylate CD44 to enforce the expression of Hematopoietic Cell E-selectin Ligand (HCELL), by glycosyltransferase- enforced expression of fucose residues (fucosylation), sialic acid residues (sialylation), or both (sialofucosylation).
- HCELL Hematopoietic Cell E-selectin Ligand
- glycosy transferases such as a
- fucosyltransferase may be used to transfer intact glycan structures such as sialyl-Lewis x or sialyl-Lewis a to cell surfaces.
- non-enzymatic methods may be used to covalently or non-covalently bind E-selectin and/or L-selectin ligands to cell surfaces.
- aptamers for example, sLex (sialyl-Lewis x ), glycomimetics and/or peptidomimetics of sLex glycans, sLea (sialyl-Lewis a ), glycomimetics and/or peptidomimetics of sLea glycans, and other moieties that bind E-selectin and/or L-selectin may be non-covalently bound to cell surfaces using biotin-streptavidin pairs or covalently bound to the cell surfaces; whether covalent or non-covalent, the binding may be direct or via a linker.
- phage display particles or antibodies that bind E-selectin and/or L-selectin may be covalently or non-covalently bound to the cell surface, in each case mediating adherence of treated cells to E-selectin and/or L-selectin.
- the manner of preparation provides a modified cell population having a viability of at least 70% at 24 hours from the time of modification.
- the modified cell population has a viability of at least 80% at 24 hours from the time of the modification.
- the modified cell population has a viability of at least 85% at 24 hours from the time of the modification.
- the modified cell population has a viability of at least 90% at 24 hours from the time of the modification. Viability may be determined by methods known in the art such as trypan blue exclusion, or by dual color flow cytometry assessment for propidium iodide and Annexin V staining.
- the phenotype of the cells is preserved after treatment. By preserved
- the modified cell populations are viable (i.e. , have a viability of at least 70% at 24 hours from the time of modification as described above) and have enhanced binding to E-selectin and/or L-selectin relative a native population of the cells.
- the administration of cells may be via the vasculature and/or by direct injection into the tissue (and/or by other means as described in detail below).
- the modified cell population is administered at a time coincident with the onset of
- the modified cell population is administered just prior to the onset of inflammation or the infiltration of leukocytes into the tissue.
- measurement of increased sLex expression on treated cells can be performed by fluorescence staining with mAb HECA452 or any other mAb which recognizes sLex determinants, followed by flow cytometry to detect cell fluorescence intensity.
- the predetermined fluorescence threshold of the modified cell population is determined by first analyzing a sample of native (untreated) cells.
- Increases in sLex of treated cells is defined as increase percentage of marker-positive cells (e.g. , HECA452- reactive cells) of greater than 10% compared to native population of cells and/or by a 10% increase in mean channel fluorescence intensity over that of the baseline
- control (baseline) sample of cells is assayed using the functional E- selectin binding assay described elsewhere herein, or by another generally accepted E- selectin fluorescence binding assay known in the art. E-selectin binding fluorescence levels are measured for the control (baseline) population sample.
- Enhanced binding to E-selectin is defined as treated cells having increased adherence to E-selectin in an E- selectin-specific binding assay.
- enhanced binding to E-selectin can be defined by a fluorescence shift in an E-selectin binding assay using fluorochrome- conjugated reagents, e.g. , binding to E-selectin-lg chimera as assessed by flow cytometry, in which the number of cells within the population that possess E-selectin binding increases by at least 10% more than that of the base-line binding (i.e.
- increase of 10% in marker-positive population and/or is at least 10% greater in mean channel fluorescence than a predetermined fluorescence threshold (associated with the native cell population).
- a predetermined fluorescence threshold associated with the native cell population.
- the percentage of cells that possess increased E-selectin reactivity is increased by 25% and/or the modified population exceeds the predetermined fluorescence threshold by 25%.
- the modified population exceeds the baseline reactivity and/or predetermined fluorescence threshold by 50%.
- the percentage of cells that possess increased E- selectin reactivity is increased by 75% over that of the baseline population of E-selectin- binding cells and/or the modified population exceeds the predetermined fluorescence threshold by 75%.
- Enhanced binding to L-selectin may be determined by an increase in binding to L-selectin using a functional L-selectin binding assay with high specificity such as a parallel plate flow chamber under dynamic shear stress conditions or a Stamper-Woodruff Assay, wherein the cell treatment increases the percentage of cells supporting L-selectin-mediated adherence.
- the treated cell population displays at least a 10% increase in tethering/rolling adhesive interactions to L-selectin (affixed and displayed on the chamber plastic or glass support surface) compared to that of baseline (untreated cells).
- increased L-selectin lymphocyte adherence is defined by at least a 10% increase in treated cell binding to L-selectin + lymphocytes under a rotatory shear of 80 rpm; baseline cell binding is assessed on the untreated (control population), and directly compared to that in the treated cell population.
- FTVI treatment Exofucosylation
- MSCs mouse mesenchymal stem cells
- MSCs derived from C57BL/6 marrow lack expression of CD45 and express
- FTVI Fucosyltransferase VI
- FIG. 4(C)-4(G) cryostat sections of pancreas from MSC-treated NOD mice stained with DAPI (blue).
- Figure 4(E) Co-staining of NOD islet with DAPI (blue), T-cell marker CD3 (green) and insulin (red) (E) reveals characteristic T-cell infiltration at the margins of the islet.
- Figures 4(F) and 4(G) Immunofluorescence images of a cryostat section stained for infiltrating MSC (visualized with FITC-conjugated anti-sLex mAb HECA452; green), islet (F) (visualized by APC-conjugated anti-insulin mAb; red) and E-selectin- expressing microvessel (G) (visualized with PE-conjugated anti-E-selectin mAb; red).
- Staining identifies HECA452+ MSCs in zones of insulitis, in proximity to E-selectin- expressing microvessels in the peri-islet area and clustered within areas of lymphocytic infiltrates (i.e., cells which characteristically express L-selectin).
- Figure 4(H) Pancreatic infiltration of intravenously administered MSCs into NOD and BALB/c hosts.
- FTVI-modification of MSCs does not affect cell survival or immunosuppressive capacity.
- A Similar levels of hGH was detected in the serum of NOD mice at different time points following injection with pHRST-hGH- transduced FTVI-modified or unmodified MSCs.
- B FTVI-modified and unmodified MSCs equally suppress proliferation of NOD CD4 + T cells stimulated with CD3/CD28, indicating that glycan-modification does not increase MSC capacity to suppress lymphocyte proliferation.
- MSCs were differentiated into osteocytes, adipocytes and chondrocytes (X200 magnification).
- FIGS 9(A)-9(B) Neural stem cells (NSCs) lack E-selectin ligands but express a number of other cell surface adhesion molecules.
- NSCs Neural stem cells
- A Flow cytometric analysis of HECA452, KM93, CSLEX-1 , E-selectin ligand (binding to E- selectin-lg chimera (E-lg)), and P-selectin ligand (P-selectin-lg chimera (P-lg) binding) expression on NSCs.
- E-lg E-selectin ligand
- P-selectin-lg chimera P-selectin-lg chimera
- RatIgM for HECA-452; MFI: 1 .9
- Mouse IgM for KM93 and CSLEX-1 ; MFI: 2.7
- human Igd for E-lg and P-lg; MFI: 3.5.
- a histogram plot representing a typical E-lg binding profile illustrates that over 99% of the cells consistently express E-lg binding following glycosyltransferase-programmed
- FIG. 10(A)-10(C) GPS treatment (i.e., oc(1,3)-exofucosylation via FTVI treatment) of NSCs generates sialofucosylations mainly on
- glycoproteins some of which are glycophosphatidylinositol (GPI)-linked.
- GPI glycophosphatidylinositol
- A Flow cytometric analysis of HECA452, CD15, KM93, CSLEX1 , E-lg and P-lg reactivity on BT- NSCs (black bars) and GPS-NSCs (grey bars).
- the corresponding isotype controls for each antibody surveyed were: Rat IgM (for HECA-452; MFI: 1 .8), Mouse IgM (for CD15, KM93, and CSLEX-1 ; MFI: 1.9), and human IgGi (for E-lg and P-lg; MFI: 3.2). Results displayed are representative of five separate experiments.
- CD44 was immunoprecipitated (with IM7 and KM1 14 mAb to CD44) from equivalent amounts of cell lysates from GPS-treated (GPS) or buffer-treated (BT) NSCs. Western blot analysis was performed on immunoprecipitates of NSCs and supernatants (SN) from the immunoprecipitates, which were electrophoresed and blotted with
- N-CAM was immunoprecipitated (with N-CAM 13) from equivalent amounts of cell lysates from GPS-treated (+) or buffer-treated (-) NSCs lysates that had been either treated with PNGaseF (+) or not (-) Immunoprecipitates were then electrophoresed and blotted with E-lg and N-CAM. Staining with E-lg was performed in the presence of Ca 2+ .
- C NSCs were treated with GPS on Day 0 and cultured for another 3 days in normal growth media. Every 24 hours aliquots of cells were removed and assayed for E-selectin ligand activity by flow cytometry.
- GPS-NSCs show rolling adhesive interactions on HUVECs at a shear stress of up to 32 dyn/cm 2 .
- A-D GPS-NSCs migrate to the CNS parenchyma more efficiently than BT-NSCs.
- C Neuropathology at day 30 PI of the brain from EAE mice injected with NSCs was analyzed by staining with anti- CD1 1 b mAb (green) and the nuclear label To-Pro3 (blue). GPS-NSC injection leads to significantly less injury per brain section as measured by numeration of CD1 1 b macrophage/microglia from 20 different sections of 3 different spinal cords. Bar graphs depict the numeration of CD1 1 b macrophage/microglia in spinal cord sections per high power field (HPF) from EAE mice that received No NSC, BT-NSC, or GPS-NSC and also the numeration of infiltrates per HPF were calculated based on To-Pro3 staining. White boxes correspond to higher magnification images. Yellow arrowheads
- microglia in the No NSC samples are more activated than those found in the BT-NSC and GPS-NSC samples.
- size of the infiltrates in the meninges is larger in the No NSC samples than in the BT-NSC samples.
- E Bar graphs depict the numeration of CD4 T, CNPase, Olig2, SOX-9 cells in brain sections per high power field (HPF) from EAE mice that received No NSC, BT-NSC, or GPS-NSC (as outlined in (D)), indicating that animals that received GPS-NSCs display enhanced neuroprotection of progenitor cells.
- NSCs were stimulated with 10 ng/ml of TNFa, 10 ng/ml IL- ⁇ ⁇ , 10 ng/ml IFNy independently or in combination (all at 10 ng/ml).
- TNFa 10 ng/ml of TNFa
- 10 ng/ml IL- ⁇ ⁇ 10 ng/ml IFNy independently or in combination (all at 10 ng/ml).
- NSCs were harvested and analyzed by flow cytometry for E-selectin binding. Controls included untreated NSCs and Kg1 a cells (positive control for E-selectin binding).
- HCELL is the only E-selectin ligand created by GPS treatment in one (exemplary) human NSC line (CC-2599).
- A Flow cytometric analysis of CD15, CSLEX-1 , HECA452, and E-selectin ligand (E-lg binding), expression on human NSCs either treated with GPS (grey bars) or buffer-treated (BT; black bars). The mean fluorescence intensity is shown for each antibody measured.
- B Flow cytometric analysis of CD44, PSGL-1 , NCAM, and CD43.
- C Western blot analysis of E-lg reactivity of NSC lysates from mouse and human sources.
- CD44 and NCAM were immunoprecipitated from equivalent amounts of cell lysates from GPS-treated (+) or buffer-treated (-) mouse NSCs or human NSCs. Immunoprecipitates were then electrophoresed and blotted with E-lg. Staining of GPS-treated NSCs with E-lg was performed in the presence of Ca 2+ .
- FIG. 17 GPS treatment does not affect of the ability of NSCs to form neurospheres.
- 200 viable GFP + NSCs were plated per well in a 96 well plate immediately following GPS treatment for 7 days. The resulting neurospheres were counted and neurosphere frequency was calculated as the number of neurospheres divided by number of cells plated. There was no statistically significant difference in the density of neurospheres or the number of neurospheres formed between BT-NSCs and GPS-NSCs.
- a representative image of the GFP + neurospheres used for these experiments is shown where the red fluorescence indicates Nestin expression and the green fluorescence indicates GFP. Note that BT- and GPS-GFP* NSCs were both able to form neurospheres equally. This figure is related to Figs. 11(A)-11(C).
- NSCs differentiated into neurons (A), astrocytes (B, D) or
- oligodendrocyte precursors C, D.
- (D) GFAP + astrocytes and NG2 + oligodendrocytes are shown in red and To-Pro3 is used to stain nuclei of neural stem cells treated in vitro with control buffer (BT) or FTVI (GPS). Scale bar, 50 ⁇ . These figures are related to Figs. 11(A)-11(C). [ 0043 ] Figures 19(A)-19(C): GPS treatment does not affect the
- LNCs lymph node cells
- irradiated BT-NSC and GPS-NSC suppressed 3 H-thymidine incorporation (A) into LNCs in response to concanavalin A (ConA) in a dose-dependent manner and also suppress inflammatory cytokine production (B) as measured by ELISA to an equal degree; the ratios correspond to numbers of NSCs to numbers of LNCs (1 :4, 1 :2, 1 : 1 , 2: 1 , and 4: 1 ).
- BT NSCs are primarily localized with FLK-1 + endothelial cells whereas GPS-NSCs are found in the parenchyma as they have crossed the endothelium. These NSCs express sox-2, a marker for neural stem cells (B). These figures are related to Figs. 13(A)-13(F).
- FIG. 21(A)-21(C) GPS treatment generates robust E-selectin ligand activity on mouse HSPCs but this does not translate into amelioration of EAE.
- (A) Flow cytometric analysis of E-lg reactivity on BT- and GPS- mouse
- HSPC hematopoietic stem/progenitor cells
- FIG. 22 No evidence of GFP signal was observed at Day 30 PI from either BT- or GPS- NSCs injected into EAE mice.
- C57BL/6 Mice were sacrificed 30 days after immunization with MOG 35-55 (on day 0) and subsequent injection with 1x10 6 buffer-treated NSCs (BT-NSC), GPS-treated NSCs (GPS-NSC) or sham-treated mice (No NSC) on day 9 and day 13 and immunohistochemistry for GFP + cells was performed.
- BT-NSC buffer-treated NSCs
- GPS-NSC GPS-treated NSCs
- No NSC sham-treated mice
- FIG. 23 Model of neurorestoration afforded by GPS treatment of native-NSCs surface proteins, CD44 and NCAM, creating novel step 1 effectors, HCELL and NCAM-E, that efficiently bind endothelial E-selectin in EAE mice.
- endothelial cells and glia may produce injury signals (e.g. , SDF-1 a and E- selectin) that direct GPS-NSCs toward the injury-induced niches in higher number than in control mice.
- SDF-1 a and E- selectin injury signals
- NSCs offer local modulation of immunity and endogenous regeneration of CNS by increasing the number of SOX-9+/Olig-2+ oligodendroglia. This subsequently leads to more mature oligodendroglial cells (CNPase+), less axonal loss, and more axonal regeneration.
- Niche molecules secreted by primitive neural stem cells may promote some of the effects provided by their increased colonization.
- FIG. 25 Western blot analysis of cell lysates of adipose-derived MSCs. Lysates of MSCs from bone marrow (BM-MSCs) and from lean and obese adipose tissue (A-MSCs) were exofucosylated with FTVII (+) or treated with buffer alone (-), then were subjected to SDS-PAGE and blotted with HECA452 or with anti-human CD44 mAb. Lysates of the hematopoietic cell line KG1 a (control) and the fibroblast cell line PIF were co-electrophoresed and blotted.
- BM-MSCs bone marrow
- A-MSCs lean and obese adipose tissue
- KG1 a cells express HCELL (HECA-452- reactive CD44 at mw of ⁇ 80 kDa).
- FTVII treatment results in enforced expression of HCELL (HECA452-reactive CD44) on PIF cells and on MSCs derived from adipose tissue of lean and obese subjects (upper panel); staining for expression of CD44 in each lysate is shown below the HECA452 blot.
- Expression of HCELL ( ⁇ 80 kDa HECA452-reactive band) is abrogated following sialidase treatment of cells (lower panel), consistent with sialidase sensitivity of HCELL expression (i.e., elimination of sLex).
- HCELL may appear as a doublet at ⁇ 80kDa (see profile of FTVII-treated A-MSC in lower panel), which reflects variable glycosylation of the core CD44 glycoprotein that does not affect E-selectin or L-selectin ligand activity of the HCELL molecule.
- FIG. 26 Results of parallel plate flow chamber studies of MSCs perfused over TNF-stimulated human umbilical vein endothelial cells (HUVEC). As measured under defined hemodynamic shear conditions (dynes/cm 2 , shown on x- axis), a(1 ,3)-exofucosylation (FTVII treatment) of A-MSCs derived from lean subjects (LA-MSCs) and from obese subjects (OA-MSCs) confers potent E-selectin binding on E-selectin displayed on TNF-stimulated HUVEC; the E-selectin ligand activity of FTVII- treated (HCELL+) adipose-derived MSCs is equivalent to that of FTVII-treated
- HCELL+ bone marrow-derived MSCs (BM-MSCs; lower panel).
- Untreated MSCs have no significant binding interactions on HUVEC at any of the shear stress levels.
- HUVEC Monocytes, CD4 T cells, CD8 T cells and B cells were freshly isolated and then perfused over TNF-simtulated HUVECs (i.e., TNF induces HUVEC to express E- selectin) at a flow rate ranging from 0.5-16 dynes/cm 2 and cell rolling was observed and recorded for video analysis.
- Monocytes and CD4 T cells show rolling adhesive interactions on TNF-activated HUVEC at a shear stress up to 16 dynes/cm 2
- CD8 and B cells show minimal adhesive shear-resistant adhesive interactions. Note that monocytes cell rolling was 3-fold greater than CD4 T cells. Values are means ⁇ SEM for a minimum of 3 independent experiments.
- B Representative flow cytometric
- E-lg E-selectin-lg chimera
- mAb HECA452 HECA452
- Filled curves represent isotype control (or, for E-lg staining, E- selectin binding in the absence of input Ca 2+ ) and open curves show specific reactivity (for E-lg, binding in presence of input Ca 2+ ).
- C Untreated (solid black line) or protease (bromelain) treated (dotted line) cells were stained with HECA452 mAb and analyzed by flow cytometry. Protease (bromelain) treatment (dotted line) markedly decreases
- E-lg E-selectin-lg chimera
- SDS-PAGE SDS-PAGE and blotted with HECA-452, anti-CD43, anti-CD44 and anti-PSGL-1 mAbs, respectively.
- E-lg E-selectin-lg chimera
- C Parallel plate flow chamber analysis of tethering and rolling interactions of untreated ("unt") and FTVII-treated (i.e. , a(1 ,3)-exofucosylation; "FT7") of monocytes, CD4 and CD8T cells, and B cells on TNF-a activated HUVEC (which express E-selectin).
- FTVII treatment ("FT7") markedly augments E-selectin-mediated adherence of flowing cells to HUVEC under all shear stress levels tested.
- CD14-S mo-DCs binds E-selectin.
- A Representative flow cytometric histograms of HECA-452 mAb and E-lg reactivity staining of mo-DCs. Grey lines represent isotype control or, for E-lg, staining in the absence of Ca2+, whereas dotted black line represents PA-S mo-DCs and solid black lines are CD14-S mo-DCs.
- B Western blot analysis of E-selectin staining of CD14-S and PA-S mo-DC lysates.
- CD44 IP immunoprecipitates
- TEM transendothelial migration
- A Western blot analysis comparing E-selectin binding (E-lg) of lysates of 2 ⁇ 10 6 of KG1 a cells and of mo-DCs.
- B Western blot analysis of E-lg reactivity of mo-DC that were buffer treated (-) or FTVI-treated (+).
- FTVI treatment induces E-lg binding at ⁇ 80 kDa, indicating enforced expression of HCELL.
- C Transendothelial migration (TEM) assay of buffer treated (BT) and FTVI-treated mo-DCs under shear flow conditions (2 dynes/cm 2 ) on TNF-a-stimulated HUVEC.
- the TEM value is the fold-increase in migration of cells on TNF-a-stimulated HUVEC compared with cells transmigrated on untreated HUVECs (which was minimal).
- TEM was analyzed under different conditions: HUVEC preincubated with function blocking anti-E-selectin mAb clone 68-5H1 1 , mo-DC pre-incubated with function blocking anti-VLA-4 mAb HP2/1 or isotype mAb, and mo-DC treated with sialidase or pertussis toxin (PTX).
- PTX sialidase or pertussis toxin
- (E) Average rolling velocity of buffer treated (BT) and FTVI-treated mo-DCs in the TEM assay. The cell number was counted at 2.0 dyne/cm2 shear stress (i.e., perfused over TNF-a- stimulated HUVEC, at 2.0 dyne/cm2 shear stress). Values are means ⁇ SD (n 3). Statistical significant differences (p ⁇ 0.05) are indicated by brackets and asterisks. The slower rolling of FTVI-treated DCs is indicative of higher efficiency of DC binding interactions to endothelial E-selectin under hemodynamic shear conditions.
- FIG. 31 Expression of FoxP3 on regulatory T cells generated by ex vivo expansion of human CD4+ cells in presence of antibodies to CD3 and CD28, and IL-2 supplementation. Dual color flow cytometry histograms showing expression of CD4 and FoxP3 on cultured CD4+/CD127-low T cells; high FoxP3 staining indicates that all culture-expanded cells are Tregs.
- FIG. 32 Flow cytometry profiles of sLex expression (HECA452 staining) of buffer treated (light grey fill) and exofucosylated (FTVI I -treated; black fill) Tregs. Note that buffer-treated Tregs have no sLex expression (i.e., profile is similar to isotype control staining (dashed line)), whereas FTVII-treated cells display high levels of sLex.
- Figure 33 Western blot analysis of E-lg staining of FTVI I -treated and buffer treated (BT) Tregs compared with the human myeloid leukemia cell line KG1a.
- Buffer treated T regs have no E-selectin ligands.
- a(1 ,3)-Exofucosylation induces expression of several glycoprotein E-selectin ligands on Tregs, including expression of HCELL ( ⁇ 80 kDa band).
- HCELL ⁇ 80 kDa band.
- FIG. 34 Titration of regulatory T cell dosing in xenogenic graft versus host disease (GVHD).
- a(1 ,3)-exofucosylation of Tregs increases potency in immunomodulation of GVHD by 3-fold.
- the present disclosure is directed to methods of treating a disease, disorder, or medical condition manifesting as inflamed and/or damaged tissue or cancer in a subject.
- the methods involve the administration, to a subject in need of tissue repair/regeneration or cancer treatment, of a cell population that expresses an E- selectin ligand and/or an L-selectin ligand at levels that exceeds the level of E-selectin and/or L-selectin binding of a native population of the cells.
- the composition of cells is disposed in a pharmaceutically-acceptable solution, suspension, carrier or vehicle for administration to a subject or for storage (e.g., cryopreserved) prior to administration to a subject.
- Cells can be administered system ically, via either peripheral vascular access (e.g. , intravenous placement, peripheral venous access devices, etc.) or central vascular access (e.g., central venous catheter/devices, arterial access devices/approaches, etc.).
- peripheral vascular access e.g. , intravenous placement, peripheral venous access devices, etc.
- central vascular access e.g., central venous catheter/devices, arterial access devices/approaches, etc.
- Cells can be delivered intravascularly into anatomic feeder vessels of an intended tissue site using catheter-based approaches or other vascular access devices ⁇ e.g.
- Cells can be introduced into the spinal canal and/or intraventricularly (i.e. , intrathecal ⁇ , into the subarachnoid space to distribute within cerebrospinal fluid and/or within the ventricles). Cells can be administered directly into body cavities or anatomic compartments by either catheter-based
- approaches or direct injection e.g. , intraperitoneal, intrapleural, intrapericardial, intravesicularly (e.g. , into bladder, into gall bladder, into bone marrow, into biliary system (including biliary duct and pancreatic duct network), intraurethrally, via renal pelvis/ intraureteral approaches, intravaginally, etc.)).
- Cells can be introduced by direct local tissue injection, using either intravascular approaches (e.g. ,
- endomyocardial injection or percutaneous approaches, or via surgical
- tissue sites and/or guided by imaging techniques e.g. , intra-articular, into spinal discs and other cartilage, into bones, into muscles, into skin, into connective tissues, and into relevant tissues/organs such as central nervous system, peripheral nervous system, heart, liver, kidneys, spleen, etc.
- Cells can also be placed directly onto relevant tissue surfaces/sites (e.g. , placement onto tissue directly, onto ulcers, onto burn surfaces, onto serosal or mucosal surfaces, onto epicardium, etc.).
- Cells can also administered into tissue or structural support devices (e.g. , tissue scaffold devices and/or embedded within scaffolds placed into tissues, etc.), and/or administered in gels, and/or administered together with enhancing agents (e.g. , admixed with supportive cells, cytokines, growth factors, resolvins, antiinflammatory agents, etc.).
- the cell population is administered to the subject during a period of (i.e. , coincident with) induced expression (and, preferably, coincident with the onset of induced expression) of E-selectin on vascular endothelium within one or more tissues of the subject.
- induced expression and, preferably, coincident with the onset of induced expression
- administered cells will aid in revascularization, in host defense (e.g. , against infection or cancer) and/or in tissue repair/regeneration and/or mediate immunomodulatory processes that will dampen inflammation and/or prevent inflammation.
- host defense e.g. , against infection or cancer
- tissue repair/regeneration and/or mediate immunomodulatory processes that will dampen inflammation and/or prevent inflammation.
- the expression of ligands for E-selectin guides delivery of intravascularly administered cells to sites of inflammation by mediating binding of blood-borne cells to vascular E-selectin expressed on endothelial cells at sites of inflammation.
- cells are administered systemically, intravascularly, into the spinal canal and/or intraventricularly (i.e.
- E-selectin and/or L-selectin in the subarachnoid space to distribute within cerebrospinal fluid
- the expression of ligands for E-selectin and/or L-selectin on administered cells promotes lodgement of cells within the affected tissue milieu, in apposition to cells bearing E-selectin (i.e. , endothelial cells) and/or L- selectin (i.e. , leukocytes), respectively, within the target site.
- E-selectin i.e. , endothelial cells
- L- selectin i.e. , leukocytes
- the colonization of a desired cell type at a site of inflammation occurs as a result of the enforced expression of cell surface E-selectin ligands on the administered cells, such that the administered cells have augmented binding to E-selectin, thereby promoting the systemic delivery of the desired cells and/or the lodgement of cells when injected directly into the affected site.
- the enforced expression of E-selectin ligands e.g. , HCELL, CD43-E, CLA/PSLG-1 , ESL-1 , NCAM-E, etc.
- E-selectin ligands is advantageously capable of anchoring directly injected cells within E-selectin-expressing vessels at sites of inflammation, tissue injury, or cancer.
- the present methods augment efficiency in the delivery of relevant cells at or to a site of inflammation, tissue injury, or cancer, including, for example, the capacity to deliver tissue-reparative stem cells, to deliver immunomodulatory cells (e.g. , mesenchymal stem cells, T-regulatory cells, NK-cells, dendritic cells, etc.), and the capacity to deliver immune effector cells to combat the inciting inflammatory process or cancer (e.g.
- L-selectin ligands e.g. , HCELL, PSGL-1 , etc.
- L-selectin ligands is advantageously capable of anchoring directly injected cells within L-selectin-expressing cells infiltrating sites of inflammation, tissue injury, or cancer.
- E-selectin ligands that may be expressed by cells include, for example, CD43-E, ESL-1 , PSGL-1 and the CLA glycoform of PSGL-1 .
- CD44 is a ubiquitously expressed cell membrane protein and is displayed on stem/progenitor cell populations of both "adult" and embryonic types
- the capacity to modify glycosylation of this protein by ex vivo glycan engineering to create the HCELL (CD44 glycoform) phenotype will drive migration of injected (e.g. , intravascularly) (adoptively transferred) cells in vivo to marrow or to any tissue/organ site where E-selectin is expressed.
- the modified cells can be used in therapeutic settings to achieve targeted cell migration in a variety of physiologic and pathologic processes, including, for example, bone diseases, immune diseases, infectious diseases, and cancer therapeutics, to name just a few conditions.
- the disease, disorder, or medical condition having associated inflammation can be treated using the instant methods even in the absence of differentiation of the cell population in the subject. That is, there are trophic effects of administered cells at the site of inflammation without persistent engraftment and/or repopulation of the administered cells, irrespective of the type of tissue involved. These trophic effects include release of cytokines/growth factors that promote revascularization (e.g. , VEGF), that promote tissue repair (e.g. , TGF- ⁇ ), that are immunomodulatory (e.g. , IL-10), that stimulate growth/proliferation of tissue-resident progenitors (e.g.
- cytokines/growth factors that promote revascularization (e.g. , VEGF), that promote tissue repair (e.g. , TGF- ⁇ ), that are immunomodulatory (e.g. , IL-10), that stimulate growth/proliferation of tissue-resident progenitors (e.g.
- administered cells e.g. , Tregs, MSCs, dendritic cells, etc.
- cell populations modified to have enhanced E-selectin and/or L- selectin binding activity relative to native populations of the cell type have increased capacity to home, infiltrate and colonize tissue in the vicinity of E-selectin-expressing vasculature. Additionally, in one embodiment such cells lodge into sites of inflammation via binding to E-selectin on endothelial cells or lodge into sites of infiltrating leukocytes within the inflammatory site (e.g. , see Figures 4(F) and 4(G)).
- beneficial effects ⁇ e.g., ameloriation of the disease
- beneficial effects may be realized by parenteral delivery or by direct injection into the site of inflammation or the site of infiltrating leukocytes even in the absence of differentiation of the cells (or long-term engraftment) after administered cell lodgement within the site (i.e., transient engraftment may be sufficient to deliver intended biologic effect(s)).
- the methods for glycan-engineering described in U.S. Pat. No. 8,084,236 for the enforcement of HCELL expression in viable cell populations, discussed in detail below, can induce higher amounts of expression of E-selectin ligands on such cells to promote their vascular delivery to sites of
- Treatment of the subject refers to reducing or eliminating in an individual a clinical symptom of a disease, disorder, or medical condition having associated inflammation or delaying or preventing in an individual the onset of a clinical symptom of such disease, disorder, or medical condition.
- treating can mean reducing a symptom of a condition characterized by an acute and/or chronic inflammation by, e.g., at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90% at least 95%, or at least 100%.
- the actual symptoms associated with acute and chronic inflammation are well known and can be determined by a person of ordinary skill in the art by taking into account factors, including, without limitation, the location of the acute and/or chronic inflammation
- Subjects that may be treated in accordance with the methods described herein includes any mammal (e.g., a human), such as a mammal that can be susceptible to a disease. Examples include, for instance, a human, a non-human primate, a cow, a horse, a pig, a sheep, a goat, a dog, a cat, or a rodent such as a mouse, a rat, a hamster, or a guinea pig.
- a subject can be a subject diagnosed with a disease, disorder, or medical condition having associated inflammation or otherwise known to have a disease, disorder, or medical condition the result or symptom of which is acute and/or chronic inflammation.
- a subject can be
- a subject can be selected for treatment on the basis of a known disease, disorder, or medical condition in the subject the result or symptom of which is an acute and/or chronic inflammation.
- a subject can be selected for treatment on the basis of a suspected disease, disorder, or medical condition having associated inflammation in the subject.
- the disease, disorder, or medical condition can be diagnosed by detecting a mutation or other abnormality in a biological sample (e.g., urine, sputum, whole blood, serum, stool, etc., or any combination thereof.
- a modified cell population can be administered to a subject based, at least in part, on the fact that a mutation, symptom, or other abnormality is detected in at least one sample (e.g. , biopsy sample or any other biological sample) obtained from the subject.
- a sample e.g. , biopsy sample or any other biological sample
- diabetes, multiple sclerosis, or cancer cannot have been detected or located in the subject, but the presence of a mutation, symptom, or other abnormality associated with diabetes, multiple sclerosis, or cancer in at least one biological sample can be sufficient to administer modified cells to the subject in accordance with the methods described herein.
- the composition can be administered to prevent the development of a disease, disorder, or medical condition such as diabetes, multiple sclerosis, or cancer.
- a disease, disorder, or medical condition such as diabetes, multiple sclerosis, or cancer.
- the presence of an existing disease, disorder, or medical condition can be suspected, but not yet identified, and a composition of the disclosure can be administered to prevent further growth or development of the disease, disorder, or medical condition.
- the administered cells can be derived from autologous sources (i.e., derived from the host itself), syngeneic sources (derived from an identical twin), or allogeneic sources (derived from non-genetically identical donor).
- the cell population is administered to the subject coincident with induced expression (and preferably coincident with the onset of induced expression) of E-selectin by endothelial cells of the subject, or just prior to expected increased E-selectin expression within an affected tissue (i.e. , as prophylaxis prior to or coincident with delivery of E-selectin-inducing inflammatory stimulus (e.g. , radiation therapy)) or in anticipation of a reaction to a pathogen or disease process with subsequent upregulation of vascular E-selectin expression (e.g.
- the treatment methods described herein may be implemented, for example, when the subject (e.g. , a human patient) presents to his/her physician or healthcare provider with one or more symptoms of inflammation or anticipated inflammatory flare.
- the subject e.g. , a human patient
- such initial symptoms may include polyuria, nocturia, weight loss/gain, and/or lack of satiety, at which time (and prior to the onset of diabetic ketoacidosis) the subject may be administered the modified cells in accordance with the disclosure.
- such initial symptoms may include transient sensory perturbations (e.g. , numbness, tingling) and/or
- the temporal aspects of the administration of the modified cells may depend for example, on the particular modified cells, or the nature of the disease, disorder, or medical condition (and associated inflammation, tissue injury, or cancer) being treated. Other considerations may include the severity of the disease, disorder, or medical condition; activity of the specific cells or cell fragments and modifications employed; the specific composition employed; the age, body weight, general health, sex and diet of the subject; the time of administration, route of administration, and rate of excretion; the duration of the treatment; drugs used in combination or coincidental with the treatment regime; and like factors.
- administration of the modified cells can occur as a single event or over a time course of treatment.
- the modified cells can be administered hourly (e.g. , every hour, every two hours, every three hours, every four hours, every five hours, every six hours, and so on), daily, weekly, bi-weekly, bi-monthly or monthly.
- the time course of treatment may be at least several hours, days, or weeks. Certain conditions could extend treatment from several days to several weeks, months, or years. For example, treatment could extend over one week, two weeks, or three weeks, or longer (e.g. , one to several months).
- treatment could extend from several weeks to several months, a year or more, or the lifetime of the patient in need of such treatment.
- the compounds and agents can be administered hourly, daily, weekly, bi-weekly, bi-monthly, or monthly, for a period of several weeks, months, years, or over the lifetime of the patient as a prophylactic or as a therapeutic measure.
- the frequency of doses may be increased or decreased based upon the nature and severity of the disease, disorder, or medical condition (and associated inflammation) and/or the stage of the disease, disorder, or medical condition in the subject. For example, depending on these and other factors, less frequent administration may be desirable at the beginning of the treatment and more frequent administration may be desirable at or near end-stage, or vice versa.
- the various targets and symptoms may also be tracked (e.g. , insulin levels in a diabetic subject) and the administration and dose amount may be tailored accordingly.
- the cells can be divided into multiple doses for purposes of administration; consequently, single dose compositions may contain such amounts or submultiples thereof to make up the dose.
- the present disclosure is directed to the treatment of a disease, disorder, or medical condition wherein E-selectin is expressed in endothelial beds of the affected tissue(s) and/or L-selectin-expressing leukocytes have infiltrated/accumulated in the affected tissue(s).
- E-selectin and L-selectin each bind to sialylated, fucosylated carbohydrates, and enforced expression of these
- the disclosure describes methods to enhance homing to target tissue(s) by augmenting the expression of E-selectin ligands on administered cells; additionally, in describing methods to enhance expression of potent E-selectin and L-selectin ligands (such as HCELL) on administered cells to promote adherence to E- selectin on vascular endothelial cells and/or of L-selectin on tissue-infiltrating leukocytes within affected tissue(s), the disclosure provides a means to augment
- the methods described herein have utility in improving the outcome of any cell-based therapeutic approach, be it in immunotherapy applications (e.g. , administration of culture-expanded antigen-specific T cells and/or culture expanded NK cells for cancer or infectious disease applications, administration of culture-expanded chimeric antigen receptor (CAR) T cells, administration of antigen- pulsed dendritic cells, etc.), immunomodulatory/immunosuppressive therapeutic applications (e.g.
- tissue repair/regenerative medicine applications e.g. , use of stem and/or progenitor cells or other tissue- reparative cells for tissue regeneration/restoration; use of culture-expanded stem cells and/or culture-expanded progenitor cells for tissue regeneration/restoration.
- tissue repair/regenerative medicine applications e.g. , use of stem and/or progenitor cells or other tissue- reparative cells for tissue regeneration/restoration; use of culture-expanded stem cells and/or culture-expanded progenitor cells for tissue regeneration/restoration.
- administered cells may themselves contribute to regenerate the target tissue by way of long-term engraftment (with attendant proliferation/differentiation) yielding tissue-specific cells (e.g.
- tissue restorative/reparative effect without long-term engraftment or differentiation into tissue-resident cells (e.g. , via delivery of trophic effects that stimulate resident stem/progenitors to repair the injured tissue(s) and/or by dampening inflammatory processes that promote injury and impede repair).
- enhancing agents e.g. , growth factors, tissue scaffolds, etc.
- any and all diseases, disorders, or medical conditions having associated inflammation may be treated in accordance with the methods described herein, including, but not limited to those initiated by direct tissue injury (e.g. , burns, trauma, bone fracture, bone deformities, decubitus ulcers, etc.), ischemic/vascular events (e.g. , myocardial infarct, stroke, shock, hemorrhage, coagulopathy, etc.), infections (e.g. , cellulitis, pneumonia, meningitis, cystitis, sepsis, SIRS, etc.), neoplasia (e.g.
- direct tissue injury e.g. , burns, trauma, bone fracture, bone deformities, decubitus ulcers, etc.
- ischemic/vascular events e.g. , myocardial infarct, stroke, shock, hemorrhage, coagulopathy, etc.
- infections e.g. , cellulitis, pneumonia, meningitis, cystitis, sep
- immunologic/autoimmune conditions e.g. , acute or chronic GVHD, multiple sclerosis, diabetes, inflammatory bowel disease (e.g. , Crohn's disease, ulcerative colitis), rheumatoid arthritis, psoriasis, etc.), degenerative diseases (e.g. , osteoporosis, osteoarthritis, spinal disc degeneration, Alzheimer's disease, atherosclerosis, etc.), congenital/genetic diseases (e.g.
- Acute Leukemias e.g. , Acute Biphenotypic Leukemia, Acute
- ALL Lymphocytic Leukemia
- AML Acute Myelogenous Leukemia
- Acute ALL Acute Myelogenous Leukemia
- CMML Myelomonocytic Leukemia
- RA Refractory Anemia
- RAEB Refractory Anemia with Excess Blasts
- RAEB Refractory Anemia with Excess Blasts in Transformation
- RARS Refractory Anemia with Ringed Sideroblasts
- Myeloproliferative Disorders e.g. , Acute Myelofibrosis, Agnogenic Myeloid Metaplasia (Myelofibrosis), Essential Thrombocythemia, chronic myelogenous leukemia, and Polycythemia Vera;
- Phagocyte Disorders e.g. , Chediak-Higashi Syndrome, Chronic Granulomatous Disease, Leukocyte adhesion deficiencies, myeloperoxidase deficiency, Neutrophil Actin Deficiency, and Reticular Dysgenesis;
- Lysosomal Storage Diseases e.g. , Adrenoleukodystrophy, Alpha Mannosidosis, Gaucher's Disease, Hunter's Syndrome (MPS-II), Hurler's Syndrome (MPS-IH), Krabbe Disease, Maroteaux-Lamy Syndrome (MPS-VI), Metachromatic Leukodystrophy, Morquio Syndrome (MPS-IV), Mucolipidosis II (l-cell Disease),
- Inherited Erythrocyte Abnormalities e.g. ,_Beta Thalassemia, Blackfan- Diamond Anemia, Pure Red Cell Aplasia, and Sickle Cell Disease;
- Inherited Platelet Abnormalities e.g.,_Amegakaryocytosis/Congenital
- Solid organ malignancies e.g., Brain Tumors, Ewing Sarcoma,
- Neuroblastoma Ovarian Cancer, Renal Cell Carcinoma, Lung Cancers, Breast cancers, Gastric cancers, Esophageal cancers, Skin cancers, Oral cancers, Endocrine cancers, Liver cancers, Biliary system cancers, Pancreatic cancer, Prostate Cancer, and
- Chronic Leukemias e.g., Chronic Lymphocytic Leukemia (CLL), Chronic Myelogenous Leukemia (CML), Juvenile Chronic Myelogenous Leukemia (JCML), and Juvenile Myelomonocytic Leukemia (JMML),
- Stem Cell Disorders e.g., Aplastic Anemia (Severe), Congenital
- Lymphoproliferative Disorders e.g., Hodgkin's Disease, Non-Hodgkin's Lymphomas, and Prolymphocytic Leukemia;
- Histiocytic Disorders e.g., Familial Erythrophagocytic
- Lymphohistiocytosis Hemophagocytosis, Hemophagocytic Lymphohistiocytosis, Histiocytosis-X, and Langerhans' Cell Histiocytosis;
- Congenital (Inherited) Immune System Disorders e.g., Absence of T and B Cells, Absence of T Cells, Normal B Cell SCID, Ataxia-Telangiectasia, Bare Lymphocyte Syndrome, Common Variable Immunodeficiency, DiGeorge Syndrome, Kostmann Syndrome, Leukocyte Adhesion Deficiency, Omenn's Syndrome, Severe Combined Immunodeficiency (SCID), SCID with Adenosine Deaminase Deficiency, Wiskott-Aldrich Syndrome, and X-Linked Lymphoproliferative Disorder; [0091] Other Inherited Disorders, e.g., Cartilage-Hair Hypoplasia, Ceroid
- Lipofuscinosis Congenital Erythropoietic Porphyria, Familial Mediterranean Fever, Glanzmann Thrombasthenia, Lesch-Nyhan Syndrome, Osteopetrosis, and Sandhoff Disease;
- Plasma Cell Disorders e.g. , Multiple Myeloma, Plasma Cell Leukemia, and Waldenstrom's Macroglobulinemia;
- Autoimmune Diseases e.g., Multiple Sclerosis, Rheumatoid Arthritis, Systemic Lupus Erythematosus, Scleroderma, Ankylosing spondylitis, Diabetes
- Articular and skeletal diseases/conditions e.g., disc degeneration, synovial disease, cartilage degeneration, cartilage trauma, cartilage tears, arthritis, bone fractures, bone deformities, bone reconstruction, osteogenesis imperfecta, congenital bone diseases/conditions, genetic bone diseases/conditions, osteoporosis.
- Skin/soft tissue diseases and conditions such as bullous diseases, psoriasis, eczema, epidermolysis bullosa, ulcerative skin conditions, soft tissue deformities (including post-surgical skin and soft tissue deformities), plastic
- associated inflammation symptoms that include, without limitation, fever, pain, edema, hyperemia, erythema, bruising, tenderness, stiffness, swollenness, chills, respiratory distress, hypotension, hypertension, stuffy nose, stuffy head, breathing problems, fluid retention, blood clots, loss of appetite, weight loss, polyuria, nocturia, anuria, dyspnea, dyspnea on exertion, muscle weakness, sensory changes, increased heart rate, decreased heart rate, arrythmias, polydipsia, formation of granulomas, fibrinous, pus, non-viscous serous fluid, or ulcers.
- the actual symptoms associated with an acute and/or chronic inflammation are well known and can be determined by a person of ordinary skill in the art by taking into account factors, including, without limitation, the location of the inflammation, the cause of the
- inflammation the severity of the inflammation, the tissue or organ affected, and the associated disorder.
- granulomatous inflammation is an inflammation resulting from the formation of granulomas arising from a limited but diverse number of diseases, include, without limitation, tuberculosis, leprosy, sarcoidosis, and syphilis.
- Purulent inflammation is an inflammation resulting in large amount of pus, which consists of neutrophils, dead cells, and fluid. Infection by pyogenic bacteria such as staphylococci is characteristic of this kind of inflammation.
- Serous inflammation is an inflammation resulting from copious effusion of non-viscous serous fluid, commonly produced by mesothelial cells of serous membranes, but may be derived from blood plasma. Skin blisters exemplify this pattern of inflammation. Ulcerative inflammation is an inflammation resulting from the necrotic loss of tissue from the epithelial surface, exposing lower layers and forming an ulcer.
- An acute and/or chronic inflammation symptom can be associated with a large, unrelated group of disorders which underlay a variety of diseases and disorders.
- the immune system is often involved with acute and/or chronic inflammatory disorders, demonstrated in both allergic reactions, arthritic conditions, and some myopathies, with many immune system disorders resulting in abnormal inflammation.
- Non-immune diseases with etiological origins in acute and/or chronic inflammatory processes include cancer, atherosclerosis, and ischaemic heart disease.
- disorders exhibiting acute and/or chronic inflammation as a symptom include, without limitation, acne, acid reflux/heartburn, age related macular
- ATD Alzheimer's disease
- amyotrophic lateral sclerosis anemia, appendicitis, arteritis, arthritis, asthma, atherosclerosis, autoimmune disorders, balanitis, blepharitis, bronchiolitis, bronchitis, a bullous pemphigoid, burn, bursitis, cancer, cardiac arrest, carditis, celiac disease, cellulitis, cervicitis, cholangitis, cholecystitis, chorioamnionitis, chronic obstructive pulmonary disease (COPD) (and/or acute exacerbations thereof), cirrhosis, colitis, congestive heart failure, conjunctivitis, drug-induced tissue injury (e.g.
- COPD chronic obstructive pulmonary disease
- cystic fibrosis cystitis
- cystitis common cold, dacryoadenitis, decubitus ulcers, dementia, dermatitis, dermatomyositis, diabetes, diabetic neuropathy, diabetic retinopathy, diabetic
- nephropathy diabetic ulcer, digestive system disease, eczema, emphysema, encephalitis, endocarditis, endocrinopathies, endometritis, enteritis, enterocolitis, epicondylitis, epididymitis, fasciitis, fibromyalgia, fibrosis, fibrositis, gastritis,
- an acute and/or chronic inflammation comprises a tissue inflammation.
- tissue inflammation is an acute and/or chronic inflammation that is confined to a particular tissue or organ.
- a tissue inflammation may comprise a skin inflammation, a muscle inflammation, a tendon inflammation, a ligament inflammation, a bone inflammation, a cartilage/joint
- a lung inflammation a heart inflammation, a liver inflammation, a gall bladder inflammation, a pancreatic inflammation, a kidney inflammation, a bladder inflammation, an gum inflammation, an esophageal inflammation, a stomach
- an acute and/or chronic inflammation comprises a systemic inflammation.
- systemic inflammation is not confined to a particular tissue but rather involves multiple sites within the body, involving the epithelium, endothelium, nervous tissues, serosal surfaces and organ systems.
- sepsis When it is due to infection, the term sepsis can be used, with bacteremia being applied specifically for bacterial sepsis and viremia specifically to viral sepsis. Vasodilation and organ dysfunction are serious problems associated with widespread infection that may lead to septic shock and death.
- an acute and/or chronic inflammation is induced by an arthritis.
- Arthritis includes a group of conditions involving damage to the joints of the body due to the inflammation of the synovium including, for example, osteoarthritis, rheumatoid arthritis, juvenile idiopathic arthritis, spondyloarthropathies like ankylosing spondylitis, reactive arthritis (Reiter's syndrome), psoriatic arthritis, enteropathic arthritis associated with inflammatory bowel disease, Whipple disease and Behcet disease, septic arthritis, gout (also commonly referred to as gouty arthritis, crystal synovitis, metabolic arthritis), pseudogout (calcium pyrophosphate deposition disease), and Still's disease.
- Arthritis can affect a single joint (monoarthritis), two to four joints (oligoarthritis) or five or more joints (polyarthritis) and can be either an autoimmune disease or a non-autoimmune disease.
- an acute and/or chronic inflammation is induced by an autoimmune disorder.
- Autoimmune diseases can be broadly divided into systemic and organ-specific autoimmune disorders, depending on the principal clinico- pathologic features of each disease.
- Systemic autoimmune diseases include, for example, systemic lupus erythematosus (SLE), Sjogren's syndrome, Scleroderma, rheumatoid arthritis and polymyositis.
- Local autoimmune diseases may be
- autoimmune disorders include, without limitation, acute rhemangioma, chronic rhemangioma, chronic rhemangioma, chronic rhemangioma, etc.
- endocrinologic Diabetes Mellitus Type 1 , Hashimoto's thyroiditis, Addison's disease, etc.
- dermatologic pemphigus vulgaris
- hematologic autoimmune haemolytic anemia
- neural multiple sclerosis
- ADAM disseminated encephalomyelitis
- ADAM amyotrophic lateral sclerosis
- APS anti-phospholipid antibody syndrome
- arthritis autoimmune hemolytic anemia, autoimmune hepatitis, autoimmune inner ear disease, autoimmune pancreatitis, bullous pemphigoid, celiac disease, Chagas disease, chronic obstructive pulmonary disease (COPD) (including acute exacerbations thereof), diabetes mellitus type 1 (IDDM), endometriosis, fibromyalgia, Goodpasture's syndrome, Graves' disease, Guillain-Barre syndrome (GBS), Hashimoto's thyroiditis, hidradenitis suppurativa, idiopathic thrombocytopenic purpura, inflammatory bowel disease (IBD), interstitial cystitis, lupus (including discoid lupus erythematosus, drug-induced
- the acute and/or chronic inflammation results from or is otherwise caused by diabetes in the subject. In another particular embodiment, the acute and/or chronic inflammation results from or is otherwise caused by multiple sclerosis in the subject.
- an acute and/or chronic inflammation is induced by a myopathy.
- myopathies are caused when the immune system inappropriately attacks components of the muscle, leading to inflammation in the muscle.
- a myopathy includes, for example, an inflammatory myopathy and an autoimmune myopathy.
- Myopathies include, for example, dermatomyositis, inclusion body myositis, and polymyositis.
- an acute and/or chronic inflammation is induced by a vasculitis.
- Vasculitis is a varied group of disorders featuring inflammation of a vessel wall including lymphatic vessels and blood vessels like veins (phlebitis), arteries (arteritis) and capillaries due to leukocyte migration and resultant damage.
- the inflammation may affect any size blood vessel, anywhere in the body. It may affect either arteries and/or veins.
- the inflammation may be focal, meaning that it affects a single location within a vessel, or it may be widespread, with areas of inflammation scattered throughout a particular organ or tissue, or even affecting more than one organ system in the body.
- Vasculitis include, without limitation, Buerger's disease
- vasculitis thromboangiitis obliterans
- cerebral vasculitis central nervous system vasculitis
- ANCA-associated vasculitis Churg-Strauss arteritis, cryoglobulinemia, essential cryoglobulinemic vasculitis, giant cell (temporal) arteritis, Golfer's vasculitis, Henoch- Schonlein purpura, hypersensitivity vasculitis (allergic vasculitis), Kawasaki disease, microscopic polyarteritis/polyangiitis, polyarteritis nodosa, polymyalgia rheumatica (PMR), rheumatoid vasculitis, Takayasu arteritis, Wegener's granulomatosis, and vasculitis secondary to connective tissue disorders like systemic lupus erythematosus (SLE), rheumatoid arthritis (RA), relapsing polychondritis, Behcet'
- an acute and/or chronic inflammation is induced by a skin disorder.
- Skin disorders include, for example, an acne, including acne vulgaris, a bullous phemigoid, a dermatitis, including atopic dermatitis and acute and/or chronic actinic dermatitis, an eczema-like atopic eczema, contact eczema, xerotic eczema, seborrhoeic dermatitis, dyshidrosis, discoid eczema, venous eczema, dermatitis, dermatitis herpetiformis, neurodermatitis, and autoeczematization, and stasis dermatitis, diabetic skin complications, hidradenitis suppurativa, lichen planus, psoriasis including plaqure psoriasis, nail psoriasis, guttate psoriasis,
- an acute and/or chronic inflammation is induced by a gastrointestinal disorder.
- a gastrointestinal disorder includes, for example, irritable bowel disease (IBD), an inflammatory bowel disease including Crohn's disease and an ulcerative colitis like ulcerative proctitis, left-sided colitis, pancolitis, and fulminant colitis.
- IBD irritable bowel disease
- Crohn's disease an inflammatory bowel disease including Crohn's disease and an ulcerative colitis like ulcerative proctitis, left-sided colitis, pancolitis, and fulminant colitis.
- an acute and/or chronic inflammation is induced by a cardiovascular disease.
- LDL cholesterol becomes embedded in arterial walls, it can invoke an immune response.
- Acute and/or chronic inflammation eventually can damage the arteries, which can cause them to burst.
- cardiovascular disease is any of a number of specific diseases that affect the heart itself and/or the blood vessel system, especially the veins and arteries leading to and from the heart.
- cardiovascular disorders including, for example, a hypertension, endocarditis, myocarditis, heart valve dysfunction, congestive heart failure, myocardial infarction, a diabetic cardiac conditions, blood vessel inflammation like arteritis, phlebitis, vasculitis; arterial occlusive disease like arteriosclerosis and stenosis, inflammatory cardiomegaly, a peripheral arterial disease; an aneurysm; an embolism; a dissection; a pseudoaneurysm; a vascular malformation; a vascular nevus; a thrombosis; a thrombophlebitis; a varicose veins; a stroke.
- Symptoms of a stroke including, for example, a hypertension, endocarditis, myocarditis, heart valve dysfunction, congestive heart failure, myocardial infarction, a diabetic cardiac conditions, blood vessel inflammation like arteritis, phlebitis, vasculitis; arterial occ
- cardiovascular disorder affecting the heart include, without limitation, chest pain or chest discomfort (angina), pain in one or both arms, the left shoulder, neck, jaw, or back, shortness of breath, dizziness, faster heartbeats, nausea, abnormal heartbeats, feeling fatigued.
- Symptoms of a cardiovascular disorder affecting the brain include, without limitation, sudden numbness or weakness of the face, arm, or leg, especially on one side of the body, sudden confusion or trouble speaking or understanding speech, sudden trouble seeing in one or both eyes, sudden dizziness, difficulty walking, or loss of balance or coordination, sudden severe headache with no known cause.
- Symptoms of a cardiovascular disorder affecting the legs, pelvis and/or arm include, without limitation, claudication, which is a pain, ache, or cramp in the muscles, and cold or numb feeling in the feet or toes, especially at night.
- a cancer In another embodiment, inflammation orchestrates the microenvironment around tumors, contributing to proliferation, survival and migration. For example, fibrinous inflammation results from a large increase in vascular permeability which allows fibrin to pass through the blood vessels. If an appropriate procoagulative stimulus is present, such as cancer cells, a fibrinous exudate is deposited. This is commonly seen in serous cavities, where the conversion of fibrinous exudate into a scar can occur between serous membranes, limiting their function.
- a cancer is an inflammatory cancer like a NF-KB-driven inflammatory cancer.
- an acute and/or chronic inflammation is a pharmacologically-induced inflammation.
- Certain drugs or exogenic chemical compounds including deficiencies in key vitamins and minerals, are known to effect inflammation.
- Vitamin A deficiency causes an increase in an inflammatory response
- Vitamin C deficiency causes connective tissue disease
- Vitamin D deficiency leads to osteoporosis.
- Certain pharmacologic agents can induce
- Radiotherapy can induce pulmonary toxicity, burns, myocarditis, mucositis, and other tissue injuries depending on site of exposure and dose.
- an acute and/or chronic inflammation is induced by an infection.
- An infectious organism can escape the confines of the immediate tissue via the circulatory system or lymphatic system, where it may spread to other parts of the body. If an organism is not contained by the actions of acute inflammation it may gain access to the lymphatic system via nearby lymph vessels.
- An infection of the lymph vessels is known as lymphangitis, and infection of a lymph node is known as lymphadenitis.
- lymphadenitis An infection of the lymph vessels
- a pathogen can gain access to the bloodstream through lymphatic drainage into the circulatory system. Infections include, without limitation, bacterial cystitis, bacterial encephalitis, pandemic influenza, viral encephalitis, and viral hepatitis (A, B and C).
- an acute and/or chronic inflammation is induced by a tissue or organ injury.
- Tissue or organ injuries include, without limitation, a burn, a laceration, a wound, a puncture, or a trauma.
- an acute and/or chronic inflammation is induced by a transplant rejection.
- Transplant rejection occurs when a transplanted organ or tissue is not accepted by the body of the transplant recipient because the immune system of the recipient attacks the transplanted organ or tissue.
- An adaptive immune response, transplant rejection is mediated through both T-cell-mediated and humoral immune (antibodies) mechanisms.
- a transplant rejection can be classified as a hyperacute rejection, an acute rejection, or a chronic rejection.
- Acute and/or chronic rejection of a transplanted organ or tissue is where the rejection is due to a poorly understood acute and/or chronic inflammatory and immune response against the transplanted tissue.
- transplant rejection is graft-versus-host disease (GVHD), either acute or chronic GVHD.
- GVHD is a common complication of allogeneic bone marrow transplantation in which functional immune cells in the transplanted marrow recognize the recipient as "foreign" and mount an immunologic attack. It can also take place in a blood transfusion under certain circumstances.
- GVHD is divided into acute and chronic forms. Acute and chronic GVHD appear to involve different immune cell subsets, different cytokine profiles, somewhat different host targets, and respond differently to treatment.
- an acute and/or chronic inflammation is induced by a Th1 -mediated inflammatory disease.
- an immune response should result in a well-balanced pro-inflammatory Th1 response and anti-inflammatory Th2 response that is suited to address the immune challenge.
- Th2 type cytokines such as, e.g., IL-4, IL-5, and IL-13 which are associated with the promotion of IgE and eosinophilic responses in atopy, and also IL-10, which has an anti-inflammatory response.
- Th1 -mediated inflammatory disease involves an excessive proinflammatory response produced by Th1 cells that leads to acute and/or chronic inflammation.
- the Th1 -mediated disease may be virally, bacterially or chemically (e.g., environmentally) induced.
- a virus causing the Th1 -mediated disease may cause a chronic or acute infection, which may cause a respiratory disorder or influenza.
- an acute and/or chronic inflammation comprises an acute and/or chronic neurogenic inflammation.
- Acute and/or chronic neurogenic inflammation refers to an inflammatory response initiated and/or maintained through the release of inflammatory molecules like SP or CGRP which released from peripheral sensory nerve terminals (i.e., an efferent function, in contrast to the normal afferent signaling to the spinal cord in these nerves).
- Acute and/or chronic neurogenic inflammation includes both primary inflammation and secondary neurogenic inflammation.
- Primary neurogenic inflammation refers to tissue inflammation
- Secondary neurogenic inflammation refers to tissue inflammation initiated by non-neuronal sources (e.g., extravasation from vascular bed or tissue interstitium-derived, such as from mast cells or immune cells) of inflammatory mediators, such as peptides or cytokines, stimulating sensory nerve terminals and causing a release of inflammatory mediators from the nerves.
- inflammatory mediators such as peptides or cytokines
- the physiological consequence of the resulting acute and/or chronic neurogenic inflammation depends on the tissue in question, producing, such as, e.g., cutaneous pain (allodynia, hyperalgesia), joint pain and/or arthritis, visceral pain and dysfunction, pulmonary dysfunction (asthma, COPD), and bladder dysfunction (pain, overactive bladder).
- the cell population expressing an E-selectin and/or L-selectin ligand can be administered to subjects in accordance with a number of suitable routes of administration.
- exemplary methods can include vascular injection, for example intravenous (i.v.) injection, or direct implantation of cells into a target site in a subject.
- Other methods of delivery can include intratracheal delivery, intrathecal delivery, intraosseous delivery, pulmonary delivery, buccal delivery, aerosol delivery, inhalational delivery, and oral delivery.
- Still other methods can include intraarterial delivery, intracerebral delivery, intraintestinal delivery, intracardiac delivery, subcutaneous delivery, intramuscular delivery, intraorbital delivery, intracapsular delivery, intraspinal delivery, intraperitoneal delivery, intrasternal delivery, intravesical delivery, intralymphatic delivery, intracavital delivery, vaginal delivery, rectal delivery, transurethral delivery, intradermal delivery, intraocular delivery, aural delivery, intramammary delivery, orthotopic delivery, intratracheal delivery, intralesional delivery, percutaneous delivery, endoscopical delivery, transmucosal delivery, sublingual delivery, and direct application on body surfaces ⁇ e,g., directly onto skin surface).
- Cells can be inserted into a delivery device which facilitates introduction by injection or implantation into the subjects.
- delivery devices can include tubes, e.g., catheters, for injecting cells and fluids into the body of a recipient subject.
- Such delivery devices may also include endoscopic delivery devices and methods.
- the tubes additionally have a needle, e.g., a syringe, through which the cells of the disclosure can be introduced into the subject at a desired location.
- the cells can be delivered subsequent to manipulations/procedures to enhance E-selectin and/or L-selectin binding activity, or, in some embodiments, cryopreserved and then thawed prior to administration to a subject.
- the cells can be prepared for delivery in a variety of different forms.
- the cells can be suspended in a solution or gel or embedded in a support matrix when contained in such a delivery device.
- Cells can be mixed with a pharmaceutically acceptable carrier or diluent in which the cells of the disclosure remain viable.
- Pharmaceutically acceptable carriers and diluents include saline, aqueous buffer solutions, solvents and/or dispersion media. The use of such carriers and diluents is well known in the art.
- the solution is preferably sterile and fluid.
- the solution is stable under the conditions of manufacture and storage and preserved against the contaminating action of
- microorganisms such as bacteria and fungi through the use of, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like.
- Solutions can be prepared by incorporating cells as described herein in a pharmaceutically acceptable carrier or diluent and, as required, other ingredients, followed by filtered sterilization.
- Intravascular delivery via needles or vascular-assisted devices (e.g. , catheter-based) injection techniques for cell administration can also be used to achieve distribution through the entire vasculature, or to the vasculature of a particular organ, such as for example liver, or kidney or any other organ. This includes non-specific targeting of the vasculature.
- any organ can be targeted by selecting a specific injection site, such as e.g., a liver portal vein.
- the injection can be performed system ically into any vein in the body. This method is useful for enhancing stem cell numbers in aging patients.
- the cells can function to populate vacant stem cell niches or create new stem cells to replenish the organ, thus improving organ function.
- cells can take up pericyte locations within the vasculature.
- the cells are introduced into the subject as part of a cell aggregate (e.g., a pancreatic islet), tissue, or organ, e.g., as part of an organ transplant method.
- a cell aggregate e.g., a pancreatic islet
- tissue e.g., a pancreatic islet
- organ e.g., as part of an organ transplant method.
- Delivery of cells can also be used to target sites of active
- angiogenesis For example, delivery of endothelial progenitor cells or mesenchymal stem or progenitor cells can enhance the angiogenic response at a wound site.
- Targeting of angiogenesis can also be useful for using cells as a vehicle to target drugs to tumors.
- E- and/or L-selectin expressing cells are useful in the methods described herein.
- cells can improve engraftment of stem cells such as HSPCs in clinical transplantation, for use of MSC in cell-based therapy (e.g., for bone diseases) or directing migration and infiltration of progenitor/stem cells at injured/damaged tissue(s) for regenerative therapeutics in accordance with the methods described herein.
- the cells used in the methods described herein express an E-selectin ligand and/or an L-selectin ligand.
- the cell binds E-selectin and/or L-selectin.
- the modified cell can bind P-selectin.
- the cells express the sialofucosylated CD44 glycoform known as Hematopoietic Cell E-/L-selectin Ligand (HCELL).
- HCELL Hematopoietic Cell E-/L-selectin Ligand
- NCAM-E Neural Cell Adhesion Molecule E-selectin Ligand
- the cells express both HCELL and NCAM-E.
- the cells express HCELL and/or CD43-E and/or CLA. After modification, the cell is capable of homing in vivo to the bone marrow and or sites of inflammation.
- the cells used in the methods described herein express an L-selectin ligand.
- the cells after modification the cells express the potent L-selectin ligand known as Hematopoietic Cell E-/L-selectin Ligand (HCELL), sialofucosylated CD44 glycoform.
- the cells express increased amounts of the L-selectin ligands HCELL and/or PSGL-1 , or the E- selectin ligands HCELL, CLA, CD43-E, NCAM-E, or ESL-1. Such cells may lodge into sites of inflammation via binding to E-selectin on endothelial cells or via binding to L- selectin expressed on infiltrating leukocytes within the inflammatory site.
- divalent metal co-factors such as manganese had been deemed critical for enzymatic activity for a(1 ,3)- fucosyltransferases, with use of such co-factors at levels that were overtly cytotoxic (e.g., 10 mM Mn ++ ).
- these glycosyltransferases possess enzymatic activity in the absence of, or in presence of, relatively small amounts of, divalent metal co-factors (e.g. , divalent cations such as manganese, magnesium, calcium, zinc, cobalt or nickel).
- these enzymes can be stored in absence of stabilizers such as glycerol which can themselves be toxic to cells.
- glycosyltransferase compositions described in U.S. Pat. No. 7,875,585 are particularly useful in modification of glycans on live cells, which cells and/or particles or fragments thereof can then be used in the treatment methods described herein. In applications utilizing stem cells, it is also important to analyze whether differentiation along characteristic lineages is affected by enzymatic treatment.
- compositions and methods for ex vivo modification of cell surface glycans on a viable cell provide compositions and methods for ex vivo modification of cell surface glycans on a viable cell, the latter of which may in turn be utilized in methods of treatment of acute or chronic inflammation as described herein.
- the compositions include a purified glycosyltransferase polypeptide and a physiologically acceptable solution, for use together with appropriate donor nucleotide sugars in reaction buffers and reaction conditions specifically formulated to retain cell viability.
- the physiologically acceptable solution is free or substantially free of divalent metal co-factors, to such extent that cell viability is not compromised.
- the composition is also free or substantially free of stabilizer compounds such as for example, glycerol.
- Glycosyltransferase include for example, fucosyltransferase, galactosyltransferase, sialytransferase and N- acetylglucosaminyltransferase.
- the fucosyltransferase is an alpha 1 ,3 fucosyltransferase such as an alpha 1 ,3 fucosyltransferase III, alpha 1 ,3 fucosyltransferase IV, an alpha 1 ,3 fucosyltransferase V, an alpha 1 ,3
- fucosyltransferase VI an alpha 1 ,3 fucosyltransferase VII or an alpha 1 ,3
- the fucosyltransferase IX can be ST3Galll, ST3GallV, or ST3GalVI. [ 0128 ] Glycans are modified on the surface of a cell by contacting a
- glycosy transferase compositions described above are contacted with the glycosy transferase composition together with appropriate nucleotide sugar donor (e.g., GDP-fucose, CMP-sialic acid) under conditions in which the glycosy transferase has enzymatic activity.
- Glycan modification according to this method results in cells that have at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or more viability at 24 hours or more after treatment.
- the cells have at least 70% viability at 48 hours after treatment.
- the cells have at least 75% viability at 48 hours after treatment.
- the cells have at least 80% viability at 48 hours after treatment.
- the phenotype of the cells is preferably preserved after treatment.
- preserved phenotype it is meant the cell maintains its native function and/or activity. For example, if the cell is a stem cell it retains its potency, i.e., its relevant totipotency or pluripotency or multipotency or unipotency, as would be characteristic of that particular stem cell type.
- nucleic acids e.g. , an aptamer
- the aptamers can be selected for a specific target, such as those capable of binding to particular proteins.
- aptamers that bind to cell surface receptors/cell adhesion molecules e.g., E-selectin, L-selectin
- cell surface receptors/cell adhesion molecules e.g., E-selectin, L-selectin
- the aptamers may be conjugated to the cell surface using a three step modification process that includes (i) treatment of cells (in a suspension after trypsinization) with sulfonated biotinyl-N-hydroxy-succinimide (NHS-biotin) to introduce biotin groups on the cell surface, (ii) complexing with streptavidin, and (iii) coupling with biotinylated aptamers.
- a three step modification process that includes (i) treatment of cells (in a suspension after trypsinization) with sulfonated biotinyl-N-hydroxy-succinimide (NHS-biotin) to introduce biotin groups on the cell surface, (ii) complexing with streptavidin, and (iii) coupling with biotinylated aptamers.
- selectin binding may also be induced by covalent addition of sLex or sLea moieties or other oligosaccharide complexes that bind selectins.
- biotin-streptavidin conjugation was utilized to chemically incorporate the sialyl-Lewis x moiety onto the cell surface. More specifically, the free amine groups present on the surface of the cells were allowed to react with N-hydroxy-succinimide group of biotinyl-N-hydroxy-succinimide to biotinylate the cell surface.
- This step was subsequently followed by reacting the biotin moiety of the cell surface with a streptavidin molecule.
- the strong interaction between biotin and streptavidin allows the streptavidin molecule to be immobilized on the cell surface.
- the streptavidin is then reacted with biotinylated SLeX (Sialyl-Lex-PAA-Biotin) to introduce SLeX on the cell surface.
- a fucosyltransferase is used incorporate an en bloc assembly of an sLex or sLea glycan onto a cell surface as described, for example, by Srivastava et al., J. Biol. Chem. 1992, 267:22356-22361 . More specifically, Srivastava et al. reported that a partially purified Le-FucT from human milk, which normally used GDP-fucose as the donor for the transfer of a single fucose residue will also transfer a fucose residue substituted on C-6 by a very large sterically demanding structure.
- the fucosyltransferase could be used to transfer a glycan such as such as sialyl-Lewis x to increase the level of expression of E-selectin ligand and/or an L-selectin ligand on the surface of of a population cells that is greater than the level of expression for a native population of such cells.
- a variety of bifunctional chemical linkers can be used to covalently attach sLex or sLea glycans, or glycomimetics of sLex or sLea, or peptidomimetics of sLex or sLea (e.g., as could be generated by phage display technology).
- mAb or mAb fragments thereof that bind to E-selectin and/or L- selectin could be conjugated to the cell surface to enhance binding to E-selectin and/or L-selectin, respectively.
- any other methods of modifying a cell or cells to express an E-selectin ligand and/or an L-selectin ligand may be utilized. This includes, for example, the promotion of covalent and/or non-covalent interactions, hydrogen bonding, and/or van der Wals forces between the cell surface and the ligand, phage display product, and the like.
- any type of cell can modified and used in the treatment methods described herein.
- the cell is of animal origin, while for human use it is preferably that the cell is a human cell; in each case, an autologous cell source could be used, a syngeniec source cell could be used, an allogeneic source cell could be used (including a combination of allogenic donor cells in a given cell product), or a xenogeneic cell source can be utilized.
- the cell can be a primary cell, e.g., a primary hepatocyte, a primary neuronal cell, a primary myoblast, a primary mesenchymal stem cell, primary progenitor cell, or it can be a cell of an established cell line or of a culture expanded cell (e.g., T cells, dendritic cells, etc). It is not necessary that the cell be capable of undergoing cell division; a terminally differentiated cell can be used in the methods described herein.
- a primary cell e.g., a primary hepatocyte, a primary neuronal cell, a primary myoblast, a primary mesenchymal stem cell, primary progenitor cell, or it can be a cell of an established cell line or of a culture expanded cell (e.g., T cells, dendritic cells, etc). It is not necessary that the cell be capable of undergoing cell division; a terminally differentiated cell can be used in the methods described herein.
- the cell can be of any cell type including, but not limited to embryonic stem cells, adult stem cells, induced pluripotent stem cells, blood progenitor cells, tissue progenitor cells, epithelial, endothelial, neuronal, adipose, cardiac, skeletal muscle, fibroblast, immune cells (for example, dendritic cells, monocytes, macrophages, leukocytes (e.g., a lymphocyte such as a B-lymphocyte, a T-lymphocyte, or a subset of T-lymphocytes, such as regulatory lymphocyte (CD4 + /CD25 + /FOXP3 + )), a naive T cell, a central memory T cell, an effector memory T cell, an effector T cell, NK cells, etc.), hepatic, splenic, lung, circulating blood cells, platelets, reproductive cells, gastrointestinal cells, renal cells, bone marrow cells, cardiac cells, endothelial cells,
- stem/progenitor cell for example, a neural stem cell, gastrointestinal stem cell, myocyte stem cell, cardiomyocyte progenitor/stem cell, endothelial progenitor cell, or pulmonary stem cell
- an umbilical cord stem cell or an embryonic stem cell, or a primary cell isolated from any tissue including, but not limited to brain, liver, lung, gut, stomach, fat, muscle, testes, uterus, ovary, skin, spleen, endocrine organ and bone, and the like.
- heterogeneous and homogeneous cell populations are contemplated for use with the methods and compositions described herein.
- transplantable substrates including scaffolds
- tissue proliferative/enhancing agents and/or anti-inflammatory agents e.g., growth factors, cytokines, prostaglandins, trophic agents, Resolvins, NSAIDS, steroids, etc.
- the present disclosure further includes the following enumerated embodiments.
- Embodiment 1 A method of enhancing cell delivery into a target tissue of a subject and/or enhancing tissue colonization in the target tissue of the subject, the method comprising: administering to the subject a population of cells that express an E selectin ligand and/or an L-selectin ligand, the population expressing the E selectin ligand and/or L-selectin ligand at a level that exceeds the level of expression of a native population of the cells, wherein said cell administration occurs coincident with E selectin expression on endothelial cells within the target tissue and/or coincident with accumulation of leukocytes within the target tissue.
- Embodiment 2 A method of treating a disease, disorder or medical condition manifesting as inflamed and/or damaged tissue in a subject, the method comprising: administering to the subject a population of cells that express an E selectin ligand and/or an L-selectin ligand, the population expressing the E selectin ligand and/or L-selectin ligand at a level that exceeds the level of expression of a native population of the cells, wherein said cell administration occurs coincident with E selectin expression on endothelial cells within the target tissue and/or coincident with accumulation of leukocytes within the target tissue, and wherein said population exhibits enhanced localization and/or colonization within the inflamed and/or damaged tissue relative to a native population of the administered cells.
- Embodiment s A method of improving cellular delivery to a target tissue in a subject, the method comprising: administering to the subject, via vascular delivery and/or via direct tissue injection (i.e., directly into affected tissue site(s)) and/or intrethecally and/or intracavitary and/or intravesically and/or within anatomic conduits (biliary system, urinary system, etc.) and/or onto tissue (i.e., placement onto affected tissue), a population of cells that express an E selectin ligand and/or an L-selectin ligand, the population expressing the E selectin ligand and/or L-selectin ligand at a level that exceeds the level of expression of a native population of the cells, wherein said cell administration occurs coincident with E selectin expression on endothelial cells within the target tissue and/or coincident with accumulation of leukocytes within the target tissue, and wherein said administered cell population achieves one or more of enhanced homing,
- Embodiment 4 A method of enhancing cell delivery and colonization in an inflamed and/or damaged tissue of a subject, the method comprising: directly injecting into or placing onto/within said inflamed and/or damaged tissue a population of cells that express an E selectin ligand and/or an L-selectin ligand, the population expressing the E selectin ligand and/or L-selectin ligand at a level that exceeds the level of expression of a native population of the cells, wherein said injection/placement occurs coincident with E selectin expression on endothelial cells within the target tissue and/or coincident with accumulation of leukocytes within the target tissue.
- Embodiment 5 A method of enhancing cell delivery, colonization and/or engraftment into a target tissue of a subject, the method comprising:
- administering via the vasculature of the subject a population of cells that express an E selectin ligand and/or an L-selectin ligand, the population expressing the E selectin ligand and/or L-selectin ligand at a level that exceeds the level of expression of a native population of the cells, wherein said administration occurs coincident with E selectin expression on endothelial cells within the target tissue and/or coincident with
- Embodiment 6 A method of enhancing lodgement, colonization and/or engraftment of a cell population within a target tissue in a subject, the method
- Embodiment 7 A method of treating a disease, disorder or medical condition manifesting as inflamed and/or damaged tissue in a subject, the method comprising: administering to the subject a population of cells that express an E selectin ligand and/or an L-selectin ligand, the population expressing the E selectin ligand and/or L-selectin ligand at a level that exceeds the level of expression of a native population of the cells, and wherein said injection occurs coincident with E selectin expression on endothelial cells within the inflamed and/or damaged tissue and/or coincident with accumulation of leukocytes within the inflamed and/or damaged tissue.
- Embodiment s Embodiment s.
- a method of treating a tumor/malignant disease in a subject comprising: administering to the subject a population of cells that express an E selectin ligand and/or an L-selectin ligand, the population expressing the E selectin ligand and/or L-selectin ligand at a level that exceeds the level of expression of a native population of the cells, wherein said administration occurs coincident with E selectin expression on endothelial cells within tissue(s) harboring tumor/malignant cells and/or coincident with accumulation of leukocytes within the tissue(s) harboring tumor/malignant cells.
- Embodiment 9 A population of cells that express an E selectin ligand and/or an L-selectin ligand for use in the manufacture of a medicament for the treatment of a disease, disorder or medical condition manifesting as inflamed and/or damaged tissue in a subject, the treatment comprising administering to the subject the population of cells that express an E selectin ligand and/or an L-selectin ligand, wherein the population expresses the E selectin ligand and/or L-selectin ligand at a level that exceeds the level of expression of a native population of the cells, wherein said treatment comprises administering the population coincident with E selectin expression on endothelial cells within the inflamed and/or damaged tissue and/or coincident with accumulation of leukocytes within the inflamed and/or damaged tissue.
- Embodiment 10 A population of cells that express an E selectin ligand and/or an L-selectin ligand for use in the manufacture of a medicament for the treatment of a tumor/malignant disease, the treatment comprising administering to the subject the population of cells that express an E selectin ligand and/or an L-selectin ligand, wherein the population expresses the E selectin ligand and/or L-selectin ligand at a level that exceeds the level of expression of a native population of the cells, wherein said treatment comprises administering the population coincident with E selectin expression on endothelial cells within the tumor/malignant tissue and/or coincident with
- Embodiment 1 1 The method or population of any one of Embodiments
- Embodiment 12 The method or population of any one of Embodiments 1 -1 1 , wherein said administration/injection occurs during infiltration of leukocytes to an/the inflamed and/or damaged tissue.
- Embodiment 13 The method or population of any one of Embodiments 1 -12, further comprising engraftment of the administered population of cells in a milieu of an/the inflamed and/or damaged tissue.
- Embodiment 14 The method or population of any one of Embodiments 1 -13, wherein an immunomodulatory effect is achieved by colonization of cells within an/the inflamed and/or damaged tissue.
- Embodiment 15 The method or population of any one of Embodiments 1 -14, wherein a tissue reparative effect is achieved by colonization of administered cells within an/the inflamed and/or damaged tissue.
- Embodiment 16 The method or population of any one of Embodiments
- Embodiment 17 The method or population of any one of Embodiments 1 -16, wherein an anti-malignancy effect is achieved by colonization of administered cells within a/the tumor/malignant tissue site.
- Embodiment 18 The method or population of any one of Embodiments 1 -17, wherein said administration/injection comprises one or a series of injections of the cell population.
- Embodiment 19 The method or population of cells of any one of Embodiments 1 -18, wherein said administration/injection comprises daily, weekly, biweekly, monthly, or yearly injections of the cell population.
- Embodiment 20 The method or population of cells of any one of Embodiments 1 -9, further comprising one or more additional administrations/injection of the cell population upon a decrease in the subject of an immunomodulatory effect of a prior administration/injection.
- Embodiment 21 The method or population of cells of any one of Embodiments 1 -20, wherein the cell population is administered/injected intravenously.
- Embodiment 22 The method or population of cells of any one of Embodiments 1 -21 , wherein the cell population is administered by direct injection to the inflamed and/or injured tissue.
- Embodiment 23 The method or population of cells of any one of Embodiments 1 -21 , wherein the cell population is placed onto the inflamed tissue and/or injured tissue.
- Embodiment 24 The method or population of cells of any one of Embodiments 1 -21 , wherein the cell population is placed onto an/the inflamed tissue and/or injured tissue.
- Embodiment 25 The method or population of cells of any one of Embodiments 1 -21 , wherein the cell population is utilized in combination with other enhancing agents, anti-inflammatory agents, or with tissue scaffolds/transplantable devices/gels.
- Embodiment 26 The method or population of any one of
- Embodiments 1 -25 wherein the population of cells express an E selectin ligand and an L-selectin ligand.
- Embodiment 27 The method or population of any one of Embodiments 1 -26 wherein the E-selectin ligand and/or L-selectin ligand is selected from one or more of Hematopoietic Cell E-/L-selectin Ligand (HCELL), Neural Cell Adhesion Molecule E- selectin Ligand (NCAM-E), CD43E, CLA, and ESL-1 .
- HCELL Hematopoietic Cell E-/L-selectin Ligand
- NCAM-E Neural Cell Adhesion Molecule E- selectin Ligand
- CD43E CD43E
- CLA CLA
- ESL-1 ESL-1
- Embodiment 28 The method or population of any one of Embodiments 1 -27, wherein the E-selectin ligand is Hematopoietic Cell E-/L-selectin Ligand (HCELL) and/or Neural Cell Adhesion Molecule E-selectin Ligand (NCAM-E).
- the E-selectin ligand is Hematopoietic Cell E-/L-selectin Ligand (HCELL) and/or Neural Cell Adhesion Molecule E-selectin Ligand (NCAM-E).
- Embodiment 29 The method or population of any one of Embodiments 1 -28, wherein the E-selectin ligand is HCELL.
- Embodiment 30 The method or population of any one of Embodiments 1 -29, wherein the E-selectin ligand is NCAM-E.
- Embodiment 31 The method or population of any one of Embodiments 1 -30, wherein the L-selectin ligand is HCELL.
- Embodiment 32 The method or population of any one of Embodiments 1 -31 , wherein the cell population comprises one or more of epithelial, endothelial, neuronal, adipose, cardiac, skeletal muscle, fibroblast, and immune cells (for example, dendritic cells, monocytes, macrophages, leukocytes (e.g., a lymphocyte such as a NK cell, a B-lymphocyte, a T-lymphocyte, or a subset of T-lymphocytes, such as regulatory lymphocyte (CD4+/CD25+/FOXP3+)), a cytotoxic lymphocyte, etc.), hepatic, splenic, lung, circulating blood cells, platelets, reproductive cells, gastrointestinal, renal, bone marrow, pancreatic cells, a stem cell (e.g., a mesenchymal stem cell, a hematopoietic stem cell, a tissue stem/progenitor cell
- Embodiment 33 The method or population of any one of
- Embodiments 1 -32 wherein the cell population is a mesenchymal stem cell, a hematopoietic stem cell, a tissue stem/progenitor cell, an umbilical cord stem cell, or an embryonic stem cell.
- Embodiment 34 The method or population of any one of
- Embodiments 1 -33 wherein the cell population is a leukocyte (e.g., a lymphocyte such as an NK cell, B-lymphocyte, a T-lymphocyte, or a subset of T-lymphocytes, such as regulatory lymphocyte (CD4+/CD25+/FOXP3+)), a cytotoxic T cell, etc.).
- a leukocyte e.g., a lymphocyte such as an NK cell, B-lymphocyte, a T-lymphocyte, or a subset of T-lymphocytes, such as regulatory lymphocyte (CD4+/CD25+/FOXP3+)), a cytotoxic T cell, etc.
- Embodiment 35 The method or population of any one of
- Embodiments 1 -34 wherein the disease, disorder or medical condition is one or more of direct tissue injury (e.g., burns, trauma, decubitus ulcers, etc.), ischemic/vascular events (e.g., myocardial infarct, stroke, shock, hemorrhage, coagulopathy, etc.), infections (e.g., cellulitis, pneumonia, meningitis, sepsis, SIRS, etc.), neoplasia (e.g., breast cancer, lung cancer, prostate cancer, lymphoma, leukemia, etc.),
- direct tissue injury e.g., burns, trauma, decubitus ulcers, etc.
- ischemic/vascular events e.g., myocardial infarct, stroke, shock, hemorrhage, coagulopathy, etc.
- infections e.g., cellulitis, pneumonia, meningitis, sepsis, SIRS, etc.
- neoplasia e.g
- immunologic/autoimmune conditions e.g., graft vs. host disease, multiple sclerosis, diabetes, inflammatory bowel disease, lupus erythematosus, rheumatoid arthritis, psoriasis, etc.
- degenerative diseases e.g., osteoporosis, osteoarthritis, Alzheimer's disease, etc.
- congenital/genetic diseases e.g., epidermolysis bullosa, osteogenesis imperfecta, muscular dystrophies, lysosomal storage diseases, Huntington's disease, etc.
- adverse drug effects e.g., drug-induced hepatitis, drug-induced cardiac injury, etc.
- toxic injuries e.g., radiation exposure(s), chemical exposure(s), alcoholic hepatitis, alcoholic pancreatitis, alcoholic cardiomyopathy, cocaine cardiomyopathy, etc.
- metabolic derangements e.g., uremic pericarditis, metabolic acidosis, etc.
- Embodiment 36 The method or population of any one of
- Embodiments 1 -35 wherein the disease, disorder or medical condition is diabetes.
- Embodiment 37 The method or population of any one of
- Embodiments 1 -36 wherein the disease, disorder or medical condition is multiple sclerosis.
- Embodiment 38 The method or population of any one of
- Embodiments 1 -37 wherein the subject is a human, non-human primate, mouse, rat, dog, cat, horse, or cow.
- Embodiment 39 The method or population of any one of Embodiments 1 -38, wherein the subject is a human patient.
- Embodiment 40 The method or population of any one of
- Embodiments 1 -39 wherein the cell population is treated to form a modified cell population having an enforced expression of an E-selectin and/or an L-selectin ligand, and the cell population has a viability of at least 70% at 24 hours after the treatment.
- Embodiment 41 The method or population of any one of
- Embodiments 1 -40 wherein the cell population has a viability of at least 80% at 24 hours after the treatment.
- Embodiment 42 The method or population of any one of
- Embodiments 1 -40 wherein the cell population has a viability of at least 70% at 48 hours after the treatment.
- Embodiment 43 The method or population of any one of
- Embodiments 1 -42 wherein, upon administration to the cell population to a subject, the cell population lodges within a tissue comprising infiltrating leukocytes.
- Embodiment 44 The method or population of Embodiment 43 wherein the administration is a direct injection into the tissue or placement onto the tissue.
- Embodiment 45 The method or population of Embodiment 43 wherein the administration is vascular.
- Embodiment 46 The method or population of any of Embodiments 1 - 21 or 25-42 wherein the population is administered system ically, via either peripheral vascular access or central vascular access.
- Embodiment 47 The method or population of any of Embodiments 1 - 21 or 25-42 wherein the population is administered intravascularly into anatomic feeder vessels of an intended tissue site using catheter-based approaches or other vascular access devices that will deliver a vascular bolus of cells to the intended site.
- Embodiment 48 The method or population of any of Embodiments 1 - 21 or 25-42 wherein the population is administered by introduction into the spinal canal and/or intraventricular ⁇ .
- Embodiment 49 The method or population of any of Embodiments 1 - 21 or 25-42 wherein the population is administered directly into body cavities by either catheter-based approaches or direct injection.
- Embodiment 50 The method or population of any of Embodiments 1 - 21 or 25-42 wherein the population is administered by direct local tissue injection, using either intravascular approaches, or percutaneous approaches, or directly into
- anatomically accessible tissue sites and/or guided by imaging techniques.
- Embodiment 51 The method or population of any of Embodiments 1 - 21 or 25-42 wherein the population is administered by placement directly onto relevant tissue surfaces/sites.
- Embodiment 52 The method or population of any of Embodiments 1 - 21 or 25-42 wherein the population is administered into scaffolds or embedded within scaffolds placed into tissues, and/or administered in gels, and/or administered together with enhancing agents.
- Embodiment 53 The method or population of any of Embodiments 1 -
- MSCs were grown at low density (confluence ⁇ 60%) under both normoxic (21 % 0 2 ) and hypoxic ( ⁇ 5% 0 2 ) conditions in MSC medium supplemented with either FBS (DMEM with 20% FBS and 1 % penicillin/streptomycin) or with human platelet lysate (DMEM with 5% human platelet lysate and 1 % penicillin/streptomycin).
- FBS DMEM with 20% FBS and 1 % penicillin/streptomycin
- DMEM human platelet lysate
- MSCs were passaged when confluence approached 60%, and MSCs were harvested at passages 3-6.
- MSCs (20 x 10 6 /ml) were then treated with Fucosyltransferase VII (FTVII; prepared by R&D Systems in suspension without divalent cations) at 20 ug/ml or with
- EXAMPLE 2 ALPHA(1,3)-FUCOSYLTRANSFERASE TREATMENT OF HUMAN BLOOD LEUKOCYTES INDUCES HIGH LEVEL E-SELECTIN LIGAND ACTIVITY ON THE CELLS AND ENFORCES EXPRESSION OF HCELL
- E-selectin ligands on surfaces of desired cells (e.g. stem cells, progenitor cells, leukocytes, etc.) would confer heightened capacity of those cells to traffic
- HCELL intravascularly to sites of tissue inflammation/damage and to sites of tumor/cancer infiltrates on the basis of vascular E-selectin expression on endothelial cells within the affected tissue(s).
- the expression of HCELL (or other enforced E-selectin/ L-selectin ligands) on the relevant administered cell surface would serve to promote colonization of the administered cells within the target tissue, as administered cells would collect within perivascular areas via E-selectin ligand adherence to E-selectin expressed at endothelial cells, and, additionally, administered cells would also anchor via L-selectin ligand adherence to L-selectin displayed on the surfaces of infiltrating leukocytes within the inflamed/damaged or cancer tissue milieu.
- NK cells including, for example, NK cells, CD4 T cells, CD8 T cells, Tregs, monocytes, dendritic cells and granulocytes, as well as relevant leukocytes expanded in culture for
- HCELL chimeric antigen receptor T cells
- EXAMPLE 3 ALPHA(1 ,3)-FUCOSYLTRANSFERASE TREATMENT OF PRIMARY CULTURES OF HUMAN DENDRITIC CELLS INDUCES HIGH LEVEL E-SELECTIN LIGAND ACTIVITY ON THE CELLS AND ENFORCES EXPRESSION OF HCELL.
- monocytes were isolated from human peripheral blood mononuclear cells using anti-CD14 coated magnetic beads (Miltenyi Biotech) (CD14-S) or by plastic adherence (PA-S), and then cultured per standard protocols with cytokines IL-4 and GM-CSF for 6 days to induce
- mo-DCs monocyte-derived dendritic cells
- Monocyte purity was evaluated by flow cytometry for expression of CD14
- differentiation and maturation of mo-DCs was evaluated by staining for expression of BDCA-1 , HLA-DR, CD80, and CD86 (each from BD Biosciences).
- Mo-DCs were then treated with Fucosyltransferase VII (FTVII; prepared by R&D Systems in suspension without divalent cations) at 20 ug/ml or with Fucosyltransferase VI (60 mU/ml (R Sackstein et al, Nature Medicine 14: 181 -187 (2008))) in each case in Hank's balanced salt solution (HBSS) without divalent cations containing 10 mM HEPES, 0.1 % human serum albumin and 1 mM GDP-fucose (Sigma) for 60 min at 37 ' IC, whereas control cells (buffer-treated) were treated in the same buffer without FTVII or without FTVI.
- HBSS Hank's balanced salt solution
- Cell viability was assessed routinely by dual laser flow cytometry using propidium iodide and annexin V staining. Cell viability was consistently greater than 80% at 24 hours following exofucosylation with either FTVI or FTVII. See Figures 29(A)-29(C) and Figures 30(A)-30(E).
- MSCs and Tregs to sites of inflammation would serve to improve the potential of adoptive cell therapeutics to dampen tissue damage in immunologic diseases ⁇ e.g., GVHD, rheumatoid arthritis, etc.) and in exuberant inflammatory responses to infections (e.g., sepsis, fulminant viral hepatitis, etc.).
- immunologic diseases e.g., GVHD, rheumatoid arthritis, etc.
- infections e.g., sepsis, fulminant viral hepatitis, etc.
- Tregs would be expanded from donor
- PBMCs peripheral blood mononuclear cells
- CD4-high/CD127-low T cells were isolated using a negative selection magnetic immunobead system (Miltenyi) and expanded in culture in the presence of anti-CD3/anti-CD28 mAb supplemented with IL-2 to produce
- CD4+/FoxP3+/CD25+ cells Tregs.
- Unfractionated PBMCs from the same donor subject were injected IP (10 7 cells/mouse) into NSG host mice intraperitoneal ⁇ .
- Treg expansion Fourteen days after injection (accordingly, day 14 of Treg expansion) the expanded Treg cells were collected and then treated with Fucosyltransferase VII (FTVII; prepared by R&D Systems in suspension without divalent cations) at 20 ug/ml or with
- FTVII Fucosyltransferase VII
- HBSS Hank's balanced salt solution
- control cells buffer-treated
- FTVII cell viability was assessed routinely by dual laser flow cytometry using propidium iodide and annexin V staining; cell viability was consistently greater than 80% at 24 hours following exofucosylation with either FTVI or FTVII).
- mice were then injected intravascularly with either buffer-treated (BT) Tregs or with exofucosylated Tregs at a dose of 2.5 x 10 5 cells/mouse. Mice were then followed clinically and mouse weights were monitored for 50 days post-initial PBMC
- EXAMPLE 5 ALPHA(1 ,3)-FUCOSYLTRANSFERASE TREATMENT OF MSC AND OF HUMAN BLOOD LEUKOCYTES INDUCES L-SELECTIN LIGAND ACTIVITY ON THE CELLS AS
- stamper Woodruff lymphocyte adherence assay is the
- the assay is performed under rotatory shear conditions, thereby placing a discrete biophysical restriction on the binding interaction: only the most potent L-selectin ligands (presented on the surface of cells attached to glass) will support adherence of L-selectin displayed on the rotating suspension of lymphocytes. Indeed, the only L-selectin ligands that are robust enough to support L-selectin-mediated binding of lymphocytes in this assay are HCELL and the "endothelial" L-selectin ligands displayed on lymph node high endothelial venules (collectively, these L-selectin ligands are called "addressins”) (R. Sackstein, Immunol. Rev. 230: 140-163 (2009)).
- cytocentrifuged cells by light microscopy. L-selectin ligand activity was measured by counting the number of lymphocytes adherent to a confluent area of cytocentrifuged cells, using an ocular grid under 250X magnification. The cytocentrifuged cells that have adherent lymphcytes are scored, and the percentage of such cells within the total lawn of cytocentrifuged cells is quantified (as shown on Key in Table 1 ).
- this L-selectin binding activity is a reflection of enforced HCELL expression, and is commensurate with results of HCELL expression on these cells as exhibited by western blot data staining for sLex/E-lg as displayed in Figures 25, 28(A)-28(C), 30(A)-30(E) and 33.
- EXAMPLE 6 - HCELL EXPRESSION ON MURINE MSC LICENSES PANCREATOTROPISM AND CONFERS DURABLE REVERSAL OF AUTOIMMUNE DIABETES IN NOD MICE
- T1 D type 1 diabetes
- MSCs mesenchymal stem cells
- the efficacy of immunomodulatory cell therapy is closely related to the ability of the infused cells to traffic to the inflamed tissue[14, 15].
- tissue e.g., the heart
- direct (local) injection of cells into the affected site can achieve requisite colonization for physiologic benefit[16].
- the vascular route of cell delivery is mandated, as direct injection of cells into the pancreatic parenchyma would trigger release of proteases and other enzymes that could induce profound, life-threatening pancreatic inflammation.
- the migration of blood-borne cells into tissues is initiated by tethering/rolling adhesive interactions on target tissue endothelium.
- the most potent mediators of these binding interactions are the selectins, a family of three Ca ++ -dependent lectins (E-, P- and L-selectin, also known as CD62E, CD62P, and CD62L, respectively) that bind to sialofucosylated glycan determinants expressed on their respective ligands[17].
- E-, P- and L-selectin also known as CD62E, CD62P, and CD62L, respectively
- CD62E a family of three Ca ++ -dependent lectins
- E-selectin binds to membrane glycoproteins and/or glycolipids on circulating cells that prototypically display the sialofucosylated tetrasaccharide known as "sialylated Lewis X" (sLex).
- sLex sialofucosylated tetrasaccharide
- MSCs do not natively express E-selectin ligands[19]. This deficit in trafficking limits the engraftment of MSCs in inflamed peripheral tissues following intravenous administration[17,20], constraining the utility of MSC-based therapeutics.
- mice were approved by the Institutional Animal Care and Use Committee.
- Bone marrow MSCs were derived as described previously [9, 10].
- isolated marrow cells from C57BL/6 (wild-type) or from CD44-KO mice were flask- seeded in culture medium consisting of Dulbecco's Modified Eagle Medium with 10% fetal bovine serum (Lonza), 10 ng/ml fibroblast growth factor (PeproTech), 100 U/ml penicillin and 100 ug/ml streptomycin (Gibco). MSCs in culture passage 4 to 6 were used for experiments.
- MSCs were characterized by flow cytometry using anti-mouse antibodies (all from eBioscience) directed to cell surface markers Seal , CD44, CD73, CD45, CD29, and CD105, together with relevant isotype controls.
- Recombinant mouse E-selectin (CD62E)-human Fc chimera was purchased from R&D Systems. MSCs were tested for their differentiation capacity into various mesodermal lineages as previously described[21 , 22]. Briefly, chondrogenic differentiation of MSCs was induced with ascorbic acid (50 pg/ml) and TGFpi (1 ng/ml) in culture medium.
- Adipogenic differentiation was induced by the addition of dexamethasone (100 nM) and insulin (6 ng/ml) in F12 medium supplemented with 1 % fetal calf serum, 1 % glutamine, 1 % penicillin-streptomycin. Cells were fixed in 4% parafomaldehyde and stained with 0.3% Oil Red solution in 60% isopropanol to assess lipid-laden vacuoles.
- FTVI modification was assessed by flow cytometry. FTVI enzyme was provided by Dr. Roland Wohlgemuth (Sigma Chemical Corporation). Western blot analysis
- FTVI-modified and unmodified MSC lysates were prepared by incubation with 2% Nonidet P-40 (NP-40) in Buffer A (150 mM NaCI, 50 mM Tris-HCI, pH 7.4, 20 mg/ml_ phenylmethylsulfonyl fluoride, 0.02% sodium azide, and protease inhibitor cocktail tablet (Roche Molecular Biochemicals). All Western blots of whole cell lysates or of immunoprecipitated protein were performed under reducing conditions on 7.5% SDS-PAGE gels as described previously[19]. The amount of lysate in each lane was normalized to cell number for each Western blot performed. Blots were visualized with chemiluminescence using Lumi-Light Western Blotting Substrate (Roche).
- a dynamic flow adhesion assay was performed using a parallel plate flow chamber (250 ⁇ channel depth x 5.0 mm channel width), to assess E-selectin mediated MSC binding over stimulated human umbilical vein endothelial cells (HUVEC) as previously described [19].
- HUVEC human umbilical vein endothelial cells
- MSCs were transduced with the lentivirus containing hGH plasmid construct as described previously[21 ]. Levels of hGH were measured by enzyme-linked immunosorbent assay (Roche Diagnostics) in MSC supernatants and in serum of injected animals.
- MSCs were transduced with a retrovirus plasmid containing GFP (GFP-MSC) as described previously[21 ]. Transduced MSC were assessed for perinuclear expression of GFP by fluorescent microscopy. In a complementary approach to the use of GFP-MSCs to assess homing, MSCs (non-GFP-transduced) were labeled with the fluorescent dye CFSE.
- GFP-MSC retrovirus plasmid containing GFP
- Pancreata were embedded in Tissue Tek OCT, frozen and sectioned in a cryomicrotome. Immunofluorescence images were acquired using a Nikon E-1000 epifluorescence microscope (X400 total magnification). For more details on specific staining, please refer to the Supplementary Methods section.
- T cell proliferation assay using anti-CD3 and anti-CD28 stimulation was used to assess effects of FTV! modification on immunomodulatory capacity of MSCs. Briefly, 1x10 5 NOD splenocytes were stimulated with purified mouse anti- CD3e and anti-CD28 (each at 1 ⁇ 9 per well; eBioscience) for 72 hours in RPM!
- Unmodified and FTVI-modified MSCs (0.5 x 10 6 cells in 200ul) were injected intravenously via tail vein without anesthesia into female NOD mice on the second day of hyperglycemia (>250 mg glucose/dL), and at 7 days and 30 days following onset of hyperglycemia.
- hyperglycemia >250 mg glucose/dL
- Flow cytometry was performed as described previously 19 using biotinylated mAb HECA452 (anti-human cutaneous lymphocyte antigen, which recognizes sLex; Rat IgM (BioLegend)), and anti-mouse CD44 mAb (KM1 14; Rat lgG1 ), purified anti-mouse CD44 mAb (IM7; Rat lgG2b), and phycoerythrin (PE)-labeled streptavidin (all obtained from BD Pharmingen).
- biotinylated mAb HECA452 anti-human cutaneous lymphocyte antigen, which recognizes sLex; Rat IgM (BioLegend)
- anti-mouse CD44 mAb KM1 14; Rat lgG1
- purified anti-mouse CD44 mAb IM7; Rat lgG2b
- PE phycoerythrin
- MSC lysates were incubated with anti-CD44 immunoprecipitating antibodies (KM1 14/IM7) or with appropriate isotype controls and then collected with Protein G-agarose (Invitrogen). Immunoprecipitates were washed extensively using Buffer A containing 2% NP-40, 1 % SDS, and then subjected to SDS-PAGE, transferred to polyvinylidene difluoride membrane, and immunostained with HECA452 or anti-mouse CD44 antibodies
- Confluent HUVECs were stimulated for 6 h with TNF-a (40 ng/ml) to up-regulate E-selectin expression.
- Wild-type (WT) and CD44KO MSC were harvested with 0.005% Trypsin/EDTA, and were either FTVI modified or treated with buffer alone (control) for 90 minutes at 37°C. MSC were then resuspended at 10 6 cells/ml in Hanks' Balanced Salt Solution supplemented with 1 mM calcium chloride, 1 mM magnesium chloride, 5 mM HEPES, and 1 mg/ml BSA.
- MSC were perfused over the HUVEC monolayer at 0.5 dynes/cm 2 , and then subjected to shear stress levels of 1 .0, 2.0, 5.0, 10.0, 20.0, and 30.0 dynes/cm 2 at 3-minute intervals.
- MSC that interacted with HUVEC (cells that rolled in the field of view or rolled into it within a 10 second time frame) were viewed at the center of the chamber, minimum of 6 fields of view at each shear stress level.
- FTVI-modified MSC were treated with sialidase from Vibrio cholerae (0.1 U/ml;Roche) to cleave terminal sialic acid from sLex, and adherence was also assessed in presence of function-blocking anti-human E-selectin mAb (10 ug/ml) (BD Pharmingen).
- Tissues were cryostat-sectioned at 10um thickness and fixed on slides in cold acetone for 5 min. After drying, sections were blocked with 1 % BSA and incubated in primary antibody overnight. Sections were washed 3X in Tris-buffered Saline (TBS) and incubated with secondary antibody for one hour. E-selectin (CD62E) staining was performed using primary rat anti-mouse CD62E (R&D Systems, 1 :100), and secondary PE-conjugated goat anti-rat IgG (Southern Biotech, 1 :500). Isotype- matched rat mAb was used as a staining control.
- E-selectin (CD62E) staining was performed using primary rat anti-mouse CD62E (R&D Systems, 1 :100), and secondary PE-conjugated goat anti-rat IgG (Southern Biotech, 1 :500). Isotype- matched rat mAb was used as a
- CD31 staining was performed using rat anti-mouse CD31 (Biocare, 1 :200) and secondary PE-conjugated goat anti-rat IgG (Southern Biotech, 1 :500). Assessment of CD31 and E-selectin co-localization was performed on sequential sections. Insulin staining was undertaken using purified guinea pig anti-insulin (Dako, 1 :5) and APC conjugated donkey anti-guinea Pig IgG (H+L) (Jackson Immunoresearch, 1 :200).
- HECA452 mAb (Rat anti-CLA IgM mAb (Biolegend, 1 :200)) and FITC conjugated mouse anti-rat IgM (Biolegend, 1 :500) were used to detect FTVI-modified MSC within tissue sections. Sections were overlaid with mounting media alone or, when indicated, with mounting media containing DAPI (Vector Labs), cover- slipped, and then visualized by immunofluorescence microscopy.
- MSCs did not natively express E-selectin ligands, as shown by absence of reactivity with mAb HECA 452 (which recognizes canonical sialofucosylated E-selectin binding determinants (such as sialylated Lewis X (sLe x )) and by absence of binding to E-selectin-lg chimera (E-lg) that serves as a probe for E-selectin ligand activity ( Figure 1(B)).
- mAb HECA 452 which recognizes canonical sialofucosylated E-selectin binding determinants (such as sialylated Lewis X (sLe x ))
- E-lg E-selectin-lg chimera
- glycoengineering i.e., Glycosyltransferase-Programmed Stereosubstitution (GPS)
- GPS Glycosyltransferase-Programmed Stereosubstitution
- FTVI a-(1 ,3)-fucosy transferase VI
- HCELL Hematopoietic Cell E-/L-selectin Ligand
- HCELL Hematopoietic Cell E-/L-selectin Ligand
- HCELL Hematopoietic Cell E-/L-selectin Ligand
- FTVI modification of MSCs markedly induced staining with mAb HECA452, as well as binding with a murine E-selectin-lg chimera (mE-lg) ( Figure 1(B)).
- protease digestions of MSCs prior to FTVI modification markedly reduced mE-lg reactivity, indicating that
- glycoproteins not glycolipids, were predominant carriers of E-selectin binding
- new onset diabetic NOD mice either received no cells (untreated control), or received 5x10 5 FTVI-modified or 5x10 5 unmodified C57BL/6 MSCs intravenously (via tail vein) on day 2 of hyperglycemia (glucose >250 mg/dL), followed by intravenous injections at days 7 and 30 after onset of hyperglycemia.
- untreated NOD mice showed a rapid increase in their blood glucose levels and, with exception of one animal, died within a few weeks of the onset of hyperglycemia.
- mice in the unmodified and FTVI-modified MSC group which had blood glucose levels above 600 mg/dl survived up to 90 days, only one (out of 7 mice) in the untreated group (i.e., receiving no MSCs) survived 90 days.
- E-selectin expression and MSC localization in the pancreas of NOD mice While the majority of the mice in the unmodified and FTVI-modified MSC group which had blood glucose levels above 600 mg/dl survived up to 90 days, only one (out of 7 mice) in the untreated group (i.e., receiving no MSCs) survived 90 days. E-selectin expression and MSC localization in the pancreas of NOD mice
- FIG. 4(E) To assess pancreatic infiltration of system ically administered FTVI- modified MSCs in NOD mice, we stained frozen sections of pancreata with antibody HECA452. As shown in Figures 4(F) and 4(G), HECA452 + MSCs were observed in the peri-islet area within the vicinity of E-selectin-expressing microvasculature 1 day after transplantation, colonizing (E-selectin-expressing) perivascular regions and (L-selectin- expressing) areas of T cell infiltrates.
- FTVI-modified and unmodified MSCs were intravenously injected into NOD mice, and their pancreata, pancreatic and mesenteric lymph nodes and spleen were harvested at day 4 post- injection, sectioned, and assessed for presence of MSCs by fluorescence microscopy.
- FTVI-modified MSCs showed 3-fold higher infiltration of pancreas as compared to unmodified MSCs, whereas no difference in pancreatic infiltrates of infused FTVI- modified and unmodified MSC were seen in diabetes-resistant BALB/c mice ( Figure 4(H)). However, no difference was noted in the extent of homing of FTVI-modified and unmodified MSCs into lymphoid tissues of treated NOD mice.
- T cell suppression assays we performed co-culture T cell suppression assays. T cell proliferation was equally dampened by FTVI-modified and unmodified MSCs
- CD44 KO MSCs conferred anti-diabetic activity
- 5x10 5 cells each of FTVI-modified and unmodified CD44 KO and of C57BL/6 wild-type MSCs were injected into new-onset diabetic NOD mice at days 2, 7 and 30 post- hyperglycemia onset.
- CD44 deficiency of MSCs resulted in a significant impairment in their anti-diabetic effect, as demonstrated by failure in reversing autoimmune diabetes in 5 out 6 mice receiving unmodified CD44 KO MSCs, and in 6 out 7 mice receiving FTVI-modified CD44 KO MSCs ( Figures 6(A) and 6(B), respectively).
- MSCs have become the focus of several human trials to treat various refractory immune-mediated diseases including T1 D[6]. MSCs have been found to suppress insulitis and autoimmune diabetes via multifaceted
- exofucosylated CD44 KO MSCs lack the capacity to induce durable reversal of hyperglycemia, despite evident creation of FTVI- dependent surface sialofucosylated determinants detectable by HEC452 reactivity, indicates that E-selectin binding determinants displayed expressly on the CD44 scaffold (i.e., elaboration of HCELL) are required to achieve potent anti-diabetic effects. This may be related to a key role for HCELL expression to attain requisite tissue homing and extravasation[27] and/or could reflect a requirement for HCELL/CD44 expression to achieve appropriate lodgment in relevant microenvironmental sites[28].
- inflammatory sites[17, 18] offers the opportunity to exploit enforced MSC HCELL expression to improve the efficacy of MSC-based therapy for a wide variety of inflammatory conditions.
- mesenchymal stem cells a potential therapeutic strategy for type 1 diabetes. Diabetes. 2008;57: 1759-1767. [ 0237 ] 7. Tyndall A, Houssiau FA. Mesenchymal stem cells in the treatment of autoimmune diseases. Ann Rheum Dis. 2010;69: 1413-1414.
- Step 1 This process facilitates engagement of specific cell- borne chemokine receptors to pertinent chemokines present in the perivascular areas, thereby triggering inside-out signal transduction events leading to increased
- Step 2 Adhesive interactions between the activated cell integrins and their cognate endothelial cell counter-receptors then leads to arrest of rolling and firm adhesion of the cell to the vessel wall (Step 3), and, ultimately, transendothelial migration (extravasation, Step 4).
- EAE experimental autoimmune encephalomyelitis
- E-selectin is expressed throughout the inflammatory period with a patchy distribution at sites where vessels branch, suggesting the existence of preferential recruitment areas (Piccio, L, Rossi, B., et al. 2002). E-selectin is also characteristically found in vessels from acute plaques in MS patients (Lee, S.J. and Benveniste, E.N. 1999; Washington, R., Burton, J., et al. 1994). These findings suggest that E-selectin plays a dominant role in the recruitment of circulating cells to the brain in inflammatory diseases.
- CD15s may be displayed on either a protein scaffold (i.e., a glycoprotein) or a lipid scaffold (i.e., a glycolipid), and is recognized by mAb such as CSLEX-1 and HECA-452 (Alon, R., Feizi, T., et al. 1995; Dimitroff, C.J., Lee, J.Y., et al.
- Neural stem cell (NSC)-based therapy has generated great hope for halting and/or reversing disease progression in CNS inflammatory and/or degenerative diseases (Ben-Hur, T., Einstein, O., et al. 2003; Einstein, O., Fainstein, N., et al. 2007; Einstein, O., Grigoriadis, N., et al. 2006; Imitola, J., Raddassi, K., et al. 2004; Lee, S T., Chu, K., et al. 2008; Pluchino, S., Quattrini, A., et al. 2003; Pluchino, S., Zanotti, L, et al.
- NSCs express Step 2 and Step 3/4 effectors, such as CXCR4 (Bezzi, P., Domercq, M., et al. 2001 ; Flax, J.D., Aurora, S., et al. 1998; Imitola, J., Raddassi, K., et al. 2004) and VLA-4 (Pluchino, S., Zanotti, L, et al. 2005; Rampon, C, Weiss, N., et al. 2008), respectively, but there are no data on whether NSCs natively express Step 1 effectors.
- CXCR4 Bezzi, P., Domercq, M., et al. 2001 ; Flax, J.D., Aurora, S., et al. 1998; Imitola, J., Raddassi, K., et al. 2004
- VLA-4 Pluchino, S., Zanotti, L, et al. 2005; Rampon, C, Weiss,
- Step 1 effectors on mouse NSCs, and found that these cells are conspicuously devoid of Step 1 effectors, in particular, E-selectin ligands.
- EAE model we analyzed whether enforced E-selectin ligand activity via cell surface glycan engineering would impact migration of administered NSCs and, more
- GPS glycosyltransferase-programmed stereosubstitution
- Step 3/4 of cell migration, flow cytometry was performed on primary cultures of mouse
- NSCs were devoid of reactivity with E-selectin-lg chimera (E-lg) and P-selectin- lg chimera (P-lg), indicating absence of E- and P-selectin ligands (Figure 9(A)) even in the presence of inflammatory mediators ( Figure 15); they also did not stain with mAb CSLEX1 , KM93, or HECA452 (each of which identify sLe x ).
- NSCs also characteristically expressed Neural Cell Adhesion Molecule (NCAM) in addition to the well-described polysialic acid (PSA) (Vitry, S., Avellana-Adalid, V., et al. 2001 ) ( Figure 9(B)).
- PSA Polysialic acid
- NSCs did not express PSGL-1 , CD43, LFA-1 (lacking both CD1 1 a (ai) and CD18 ( ⁇ 2 ) chains), and LPAM-1 ( ⁇ 4 ⁇ 7 ) ( Figure 9(B)). These results indicate that NSCs are deficient in expression of Step 1 effectors of the multistep cascade of cell
- CD44 a molecule involved in migration of NSCs (Deboux, C, Ladraa, S., et al. 2013) and brain cancer stem cells (Fu, J., Yang, Q.Y., et al. 2013), is strongly expressed among NSCs in culture ( Figure 9(B)).
- Figure 9(A) indicates that these cells do not natively express the E- selectin binding glycoform of CD44 known as HCELL (Dimitroff, C.J., Lee, J.Y., et al. 2000; Dimitroff, C.J., Lee, J.Y., et al. 2001 ; Sackstein, R. 2004).
- GPS-NSCs Treatment of GPS-NSCs with phosphatidylinositol phospholipase C (Pl- PLC) resulted in a modest but significant decrease in the HECA452 signal by FACS ( Figure 10(C)), indicating that a minor population of sLe x -decorated glycoproteins are glycophosphatidyl (GPI)-linked.
- Pl- PLC phosphatidylinositol phospholipase C
- NCAM-E The contribution of the GPI-anchored form of NCAM-E to overall sLe x expression after enforced fucosylation of NSC is modest, as shown by a small decrease in HECA452 signal (and E-lg signal - data not shown) following PI-PLC treatment ( Figure 10(C)). Therefore, enforced a(1 ,3)-fucosylation of murine NSCs created HCELL as well as a unique E-selectin ligand reactive form of the neural precursor molecule NCAM, which we named "NCAM-E". Interestingly, human NSCs (CC-2599) only express HCELL and not NCAM-E following GPS treatment ( Figures 16(A)-16(C)).
- NSC viability (Figure 17) was unaffected by enforced exofucosylation and there were no differences in the number or proliferation of neurospheres in clonogenic assays or in differentiation of NSCs ( Figures 18(A)-18(D)). Thus, there were no evident phenotypic differences induced by GPS treatment of NSCs, except for creation of E-selectin ligands.
- NSCs have been shown to inhibit the proliferation T cells in vitro (Einstein, O., Fainstein, N., et al. 2007; Einstein, O., Grigoriadis, N., et al. 2006; Martino, G. and Pluchino, S. 2006), and, in particular, to dampen mitogenic responses of T cells in vitro.
- E-selectin ligand activity we examined the ability of GPS-NSCs and control buffer-treated NSCs (BT-NSCs) to suppress the proliferation of lymph node cells in response to Con A activation. As displayed in Figures 19(A)-19(C), both GPS- and BT- NSCs were able to decrease T cell proliferation as well as suppress the level of inflammatory cytokine production equally, suggesting that there is no
- E-selectin transfected CHO cells were perfused over HECA-452 immunostained blots of GPS-NSC lysates. As illustrated in Figure 12(B), more CHO-E cells interacted and adhered to HCELL compared to either the 120kD or the 140kD forms of NCAM-E. CHO-E cells suspended in flow medium containing 5 mM EDTA had negligible adhesion to any regions of the blot, confirming Ca 2+ -dependent binding consistent with selectin ligand activity.
- GPS-NSCs exhibit increased homing and tissue infiltration in vivo in EAE
- Lumbar-sacral spinal cords and brains were harvested 4 days (day 17 PI) after the second NSC injection. Confocal analysis of the brain demonstrated both higher amounts of GPS-NSCs (Figure 13(A)) and localization outside of Flk-1 + vessels in the brain ( Figures 20(A)-20(B)). Further, parallel analysis of the spinal cord ( Figures 13(B)-13(D)), where the majority of pathology occurs in EAE, demonstrated two-fold greater numbers of extravascular GPS-NSCs infiltrates over BT-NSCs infiltrates by day 17 PI ( Figure 13(D)). These data indicate that GPS-NSCs infiltrate the CNS
- GPS-NSCs increased homing translates into amelioration of neuropathology by enhanced endogenous indirect
- EAE features in C57BL/6 mice treated i.v. GPS treated NSCs.
- Table 3 EAE clinical features in C57BL/6 mice injected with i.v. GPS treated HSPCs.
- MS is a chronic, demyelinating disease of the CNS characterized by multifocal inflammatory lesions yielding gradual destruction of the myelin sheath, leading to axonal injury and loss (Imitola, J., Chitnis, T., et al. 2006).
- Stem cell-based therapeutics offers the promise of repair of damaged/inflamed tissue by replacing affected cells (direct regeneration) and/or by production of supportive/trophic factors in the milieu that evoke tissue restoration by endogenous cells (indirect regeneration).
- Step 2-4 effectors are conspicuously deficient in Step 1 effectors: (1 ) they do not natively express ligands for E-selectin or P-selectin (even when grown in the presence of inflammatory cytokines (Figure 15)); (2) they lack expression of the glycan sLe x , which is the canonical selectin binding determinant; and (3) they do not express the glycoprotein PSGL-1 , a selectin ligand on myelin-specific Th1 cells that has been reported to mediate trafficking to the brain (Piccio, L, Rossi, B., et al.
- NCAM-E sialofucosylated glycoforms of NCAM of ⁇ 120 kDa and ⁇ 140 kDa
- Blot rolling assays revealed that HCELL is the principal E-selectin ligand expressed on GPS-NSCs ( Figure 12(B)).
- PSA polysialic acid
- NCAM displays relevant terminal a-(2,3)-sialyllactosaminyl glycans that can serve as acceptors for exofucosylation to create sLe x determinants.
- PSA expression levels did not change and the induced E-selectin ligand activity is not permanent, as there was complete loss of sLe x expression within 72 hours of enforced fucosylation ( Figures 11(A)-11(C)).
- VLA-4 The corresponding endothelial receptor for VLA-4, VCAM-1 , is also upregulated in the inflammatory response of the brain to injury (Justicia, C, Martin, A., et al. 2006).
- the VLA-4/VCAM-1 axis has similarly been shown to play a critical role in migration of NSC, in that only NSCs that constitutively express VLA-4, in addition to CXCR4, were able to accumulate around inflamed CNS microvessels in affected lesions in EAE (Pluchino, S., Zanotti, L, et al. 2005).
- integrins may play a role as step 1 mediators of migration on human NSCs in a rat stroke model suggesting that selectin interactions are not necessary in this model system (Goncharova, V., Das, S., et al. 2014).
- the varying role(s) of integrins as mediators of Step 1 interactions could reflect differences in the inflammatory model used, the host animal system, the permeability of vessels, the expression of endothelial adhesion molecules at that site of inflammation, the presence of soluble adhesion molecules at the site, and the physical properties of the vessel that dictate the flow rate (i.e.
- NSC accumulation in the CNS parenchyma was two-fold higher among GPS-NSCs than BT-NSCs by day 17 post-injection, indicating that enforced expression of Step 1 effectors promotes extravasation.
- NSCs provide peripheral immunosuppression (Einstein, O., Fainstein, N., et al. 2007; Einstein, O., Grigoriadis, N., et al. 2006) or local immunomodulation that restrains CNS injury, rather than by enhancing neuroregeneration (Martino, G. and Pluchino, S. 2006; Pluchino, S., Zanotti, L, et al. 2009; Wang, L, Shi, J., et al. 2009).
- the observed increased splenic homing by enforced expression of E-selectin ligand activity on NSCs could be contributory to neuroprotection via immunomodulation by virtue of increased tissue ratio of NSCs to immune cells.
- NSCs neurotrophins such as LIF (Laterza, C, Merlini, A., et al. 2013).
- NSCs support the formation of injury-induced growth niches through the expression of molecules such as BMP-4 and Noggin (Imitola, J., Raddassi, K., et al. 2004; Pluchino, S., Zanotti, L, et al. 2005) that trigger indirect neuroregeneration by endogenous cells.
- EAE is a valuable model for the human disease multiple sclerosis. There are no mathematical models, computer simulations or in vitro systems that can substitute for the in vivo disease. Many of the treatments available for MS and other autoimmune diseases were first tested and their mechanisms investigated in EAE. MOG induced EAE in C57/BL6 mice is valuable because of the availability of many knockout and transgenic mice on that background.
- Veterinary care Mice are handled and cared for according to federal, institutional, and AAALAC guidelines.
- Pharmingen function blocking mouse anti-human E-selectin (68-5H1 1 ; lgG1 ), rat anti- human CLA (HECA-452; IgM), mouse anti-human sLe x (CSLEX-1 ; IgM), mouse anti- human CD15 (IgM), rat anti-mouse PSGL-1 (2PH1 and 4RA10; lgG1 ), mouse anti- human PSGL-1 (KPL-1 ; lgG1 ), rat anti-mouse CD44 (KM1 14 and IM7; lgG1 ), mouse anti-human CD44 (515; lgG1 ), rat anti-mouse CD43 (S7; lgG2a), mouse anti-human CD43 (1 G10; lgG1 ), mouse anti-(mouse anti-adult and embryonic pan N-Cam) CD56 (NCAM13; lgG2b), mouse anti-human CD56 (NCAM16.2; lgG2b),
- Streptavidin, biotin anti-rat IgM, and goat anti-mouse Ig-HRP The following secondary antibodies were purchased from Southern Biotech.: rabbit anti-human IgG-biotin, goat anti-mouse IgM-PE, goat anti-rat IgG-PE, goat anti-mouse Ig-biotin, goat anti-rat Ig- HRP, and goat anti-human Ig-HRP.
- Recombinant mouse E-selectin/human Ig chimera (E-lg) and recombinant mouse P-selectin/human Ig chimera (P-lg) were from R&D.
- Mouse anti-human sLe x (KM93; IgM) was purchased from Calbiochem.
- Rat anti-mouse CD43 (1 B1 1 ; lgG2a) was purchased from Biolegend.
- Rat anti-mouse LPAM-1 The following secondary antibodies were purchased from Southern Biotech.: rabbit anti-human IgG-bio
- DATK32 mouse anti-SMI32
- SMI-32 mouse anti-SMI32
- Abeam mouse anti-human CD15 (80H5; IgM) was purchased from Coulter-lmmunotech.
- PNGase F was purchased from New England Biolabs.
- PI-PLC, Bromelain, Soybean Trypsin Inhibitor, DNase, mouse anti-Map2 (HM-2 ; lgG1 ) were purchased from Sigma.
- Mouse-anti GFP (B2, lgG2a) was purchased from Santa Cruz Biotechnology, Inc (Santa Cruz, CA).
- To-pro3 was purchased from Invitrogen.
- PSA mouse anti-human polysialic acid
- FVI Fucosyltransferase VI
- Cells Mouse NSCs were isolated and cultured as described (Imitola,
- a suspension of dissociated NSCs (5x10 5 cells per ml), isolated from the telencephalic VZ of murine embryonic day 12, were cultured in 98% DMEM/F12 (GIBCO), 1 % N2 supplement (GIBCO), 1 % penicillin/streptomycin (GIBCO) 8 mg/ml heparin (Sigma), 10 ng/ml leukemia inhibiting factor (LIF, Chemicon), 20 ng/ml bFGF (Calbiochem) in uncoated 25-cm 2 flasks (Falcon) at 37°C in 5% CO2. NSCs were used after second passage for most experiments. Single cell suspension of neural stem cells was achieved by mechanical dissociation of the neurospheres in Versene (Life
- Immunoprecipitates were washed extensively using Buffer A containing 2% NP-40, 1 % SDS. In some experiments, immunoprecipitates were treated with N-glycosidase F (New England Biolabs) as previously described (Dimitroff, C.J., Lee, J.Y., et al. 2001 ). For Western blot analysis, all immunoprecipitates were diluted in reducing sample buffer, boiled, then subjected to SDS-PAGE, transferred to PVDF membrane, and immunostained with HECA-452 or E- ig.
- N-glycosidase F New England Biolabs
- the number of BT- or GPS-NSCs adherent to the HUVEC monolayer were quantified in the final 15 sec interval at shear stress of 0.5, 1 , 2, 5, 10, 20 and 30 dyne/cm 2 . Each assay was performed at least 3 times and the values averaged. Control assays were performed by adding 5 mM EDTA to the assay buffer to chelate Ca 2+ required for selectin binding or treating HUVEC with function- blocking anti-human E-selectin mAb at 37°C for 15 min. prior to use in adhesion assays.
- Blot Rolling Assay The blot rolling assay has been described previously (Dimitroff, C.J., Lee, J.Y., et al. 2000; Fuhlbrigge, R.C., King, S.L., et al. 2002; Sackstein, R. and Fuhlbrigge, R. 2006) and here was used to detect selectin- binding activity of NSC membrane proteins resolved by SDS-PAGE.
- Western blots of NSC membrane preparations were stained with anti-CLA (HECA-452) and rendered translucent by immersion in DMEM with 10% glycerol.
- CHO-E cells were resuspended (5 x 10 6 /ml_) in DMEM containing 2mM CaCI 2 and 10% glycerol. The blots were placed under a parallel plate flow chamber, and CHO-E cells were perfused at a physiologically relevant shear stress of 1.0 dyne/cm 2 , an adjustment in the volumetric flow rate was made to account for the increase in viscosity due to the presence of 10% glycerol in the flow medium. Molecular weight markers were used as guides to aid placement of the flow chamber over stained bands of interest. The number of interacting cells per square millimeter was tabulated as a function of the molecularweight region and compiled into an adhesion histogram. Nonspecific adhesion was assessed by perfusing CHO-E cell suspensions containing 5mM EDTA in the flow medium.
- NSCs or bone marrow HSPC Lineage neg C-kit pos
- 1x10 6 cells were injected into the tail vein of C57BL/6 mice on day 9 and day13 after immunization (PI) with MOG 35-55 (subcutaneously in the flanks; see details in Supplementary Material).
- PI immunization
- MOG 35-55 subcutaneously in the flanks; see details in Supplementary Material.
- EAE was scored in a blinded fashion; the investigator was not involved in the injections and was not aware of the composition of the groups.
- BT-NSC, GPS-NSCs, BT-HSPCs or GPS-HSPCs were injected as a cell suspension into the tail- vein of EAE mice in a volume of 0.2 ml of HBSS. Sham treated mice (No NSCs) injected with HBSS alone were used as a negative control.
- BT-NSCs and GPS-NSCs were labelled with 5mM CFDA-SE (Invitrogen) for 5 min at room temperature in RPMI containing 10% FBS and injected intravenously into MOG-treated C57BL6 mice on day 9 and day 13 post-immunization (PI). Two million NSCs in a volume of 0.2ml_ of HBSS were injected into each mouse on each day. HBSS buffer alone was used to determine background signals. BT-NSCs and GPS-NSCs were also injected into animals that were not immunized with MOG and used to standardize the signals observed in each tissue assayed.
- 5mM CFDA-SE Invitrogen
- mice Sixteen hours after the second NSC transfer, mice were sacrificed and perfused with 1X PBS without Ca 2+ and Mg 2+ .
- the brain, spinal cord, lymph nodes, spleen, liver and lung were isolated.
- the brain and spinal cord were homogenized.
- Resulting pellets were resuspended in 0.25% Trypsin-EDTA (Invitrogen) and incubated at 37°C for 10 minutes.
- the digestion process was stopped using DMEM containing 0.01 % SBTI, 0.001 % DNase and 0.075% BSA.
- the lymph nodes, spleen and liver were mechanically dissociated and the resulting single-cell suspensions were assessed for frequencies of CFDA-SE positive cells by flow cytometry in the FL1 channel.
- Flow cytometric data was analyzed and expressed as percent of CFDA-SE-positive events detected in 200,000 cells scanned within a narrow gate that is set to include NSC. This gate was determined based on mixing cultured NSCs with suspensions of cells isolated from each tissue tested (brain, spinal cord, lymph node, spleen, liver and lung).
- DNase and 0.075% BSA were snap- frozen in liquid nitrogen and stored in -80°C until sectioning.
- the cryostat sections (20pm) of lumbar-sacral spinal cord or anterior, middle and posterior brain were fixed with 4% paraformaldehyde for 15 minutes and then stained with antibodies of interest, Blood vessels were visualized by anti-Flk-1 (VEGFR2, Sigma) and NSCs were stained with either anti-sox-2 (Millipore) or visualized by PKH26 dye in red.
- the spinal cords were then homogenized and the resulting pellets were resuspended in 0.25% Trypsin- EDTA (Invitrogen) and incubated at 37°C for 10 minutes. The digestion process was stopped using DMEM containing 0.01 % SBTI, 0.001 % DNase and 0.075% BSA. Blood vessels were visualized by Flk-1 (VEGFR2) staining.
- NSCs or HSPC Lineage neg C-kit pos
- 1x10 6 cells were injected into the tail vein of C57BL/6 mice on day 9 and day 13 after immunized (PI) with MOG 35-55.
- MOG 35-55 M-E-V-G-W-Y-R-S-P-F-S-R-O-V-H-L-Y-R-N-G-K corresponding to mouse sequence is synthesized by QCB Inc. Division of BioSource International (Hopkinton, MA), and purified to >99% by HPLC.
- mice are immunized subcutaneously in the flanks with 150-200 of MOG peptide in 0.1 ml PBS and 0.1 ml CFA containing 0.4 mg Mycobacterium Tuberculosis (H37Ra, Difco, Detroit, Michigan) and injected intraperitoneally with 200 ng Pertussis toxin (List Laboratories, Campbell, California) on the day of immunization and 2 days later. EAE was scored in a blinded fashion; the investigator was not involved in the injections and was not aware of the composition of the groups.
- grade 1 limp tail or isolated weakness of gait without limp tail
- grade 2 partial hind leg paralysis
- grade 3 total hind leg or partial hind and front leg paralysis
- grade 4 total hind leg and partial front leg paralysis
- grade 5 moribund or dead animal.
- BT-NSC, GPS-NSCs, BT-HSPCs, GPS- HSPCs were injected as a cell suspension into the tail-vein of EAE mice in a volume of 0.2 ml of HBSS. Sham treated mice (No NSCs) injected with HBSS alone were used as a negative control.
- the entire tissue section (a longitudinal spinal cord section) was evaluated for a given cellular marker at 40X magnification. The number of cells staining positive for the given markers were counted in ten 40X (high power fields) fields per section. The results for one section were totalled, and the results between sections were averaged.
- Staining for confocal microscopy Paraformaldehyde fixed sections (40pm) were washed in PBS, blocked in PBS containing 4% goat serum, 0.3% BSA, and 0.3% triton and subsequently incubated with primary antibodies overnight and secondary antibodies for 2h in blocking solution. We used highly cross-adsorbed secondary antibodies to avoid cross-reactivity (Alexa 488 and Alexa 594). Confocal microscopy was performed using a Zeiss Laser Scanning Microscope 3D analysis software (Zeiss, Thornwood, NY) with a multitrack acquisition protocol to avoid potential overlapping of the two fluorochromes.
- NSC differentiation and self-renewal capacity Neurospheres initially cultured in FGF/EGF containing media were plated on poly-D- lysine (PDL)-coated glass coverslips allowed to proliferate then harvested and treated for an hour with buffer (control) or enzymatic treatment with FTVI (60mll/mL), subsequently the resulting BT-NSCs and GPS-NSCs were plated at clonal density of 20 cells per ⁇ and allowed to proliferate as neurospheres for 96 hours to 5 days.
- PDL poly-D- lysine
- Neurosphere imaging was captured with an Axiovision microscope (NY).
- NY Axiovision microscope
- MAP2 neuronal, astrocyte, and oligodendrocyte differentiation
- dissociated neurospheres were plated on PL-coated glass coverslips in a 24 well plate and cultured without FGF/EGF but in the presence of neurobasal medium containing 1 % Glutamax, 1 % Antibiotic/Antimycotic and 2% B27-Supplement. Fresh media was added every other day until day 5, and the cells were then subjected to immunofluorescence staining with MAP2 (neurons), GFAP (astrocytes), and NG2 (oligodendrocyte precursors).
- NG2 oligodendrocyte precursors
- Lymph nodes were isolated from naive C57BL/6 mice. Lymph node cells (LNC) were cultured as single-cell suspensions in a 96 well plate at 2 x 10 5 cells per well, as previously described (Einstein, O., Fainstein, N., et al. 2007).
- Culture medium consisted of RPMI- 1640 supplemented with 10% fetal bovine serum, L-glutamine, sodium pyruvate, nonessential amino acid, 2-mercaptoethanol, HEPES and antibiotics (BioWhittaker) with 2.5 ⁇ / ⁇ ⁇ concanavalin A (ConA, Sigma) or without. Neurospheres were dissociated and were first either treated with GPS or not (BT) and subsequently irradiated with 3,000 Rad. Following irradiation the dissociated NSCs were then added directly to the LNC culture medium at different ratios with ConA stimulated LNCs.
- the ratios tested of numbers of NSCs to numbers of LNCs were: 1 :4, 1 :2, 1 : 1 , 2: 1 , and 4: 1 .
- the cells were then cultured for 48 hours before adding thymidine. Thymidine incorporation assays were performed 16 hours later.
- TNFa (R&D; 410-TRNC), 10 ng/ml IL-1 ⁇ (R&D; 401 -ML), 10 ng/ml IFNy (R&D; 485-MI) independently or in combination (all three at 10 ng/ml).
- the neurospheres were harvested by centrifugation and stained with E-lg for flow cytometric analysis.
- Measurement of LIF mRNA 1 x10° mouse embryonic NSCs were treated for 24 hours with or without inflammatory cytokines (!FN-Y at 10ng/m! and TNF- ⁇ at 15ng/ml).
- cDNA synthesis was done using high capacity cDNA reverse transcription kit (Applied Biosystems) and a Random Hexamer.
- mRNA level was measured using RT-PCR and the fold change in gene expression was calculated using 2 " ⁇ 0 ⁇ method.
- the forward primer sequence for the LIF gene was CCTACCTGCGTCTTACTCCATCA and the reverse primer was CCCCAAAGGCTCAATGGTT (Sigma).
- BT-NSCs GPS-NSCs were labeled with PKH26 dye (Invitrogen) and injected intravenously into MOG-treated C57BL6 mice on day 9 and day 13 post-immunization (PI).
- PKH26 dye Invitrogen
- PI post-immunization
- the spinal cord was chosen because in the B6 model, the CNS lesions in the forebrain are very variable in size and location compared with the spinal cords, which possess a more predictable location (lumbosacral region) and also more exuberant pathology (Chitnis, T., Najafian, N., et al. 2001 ; Rasmussen, S., Wang, Y., et al. 2007; Wang, Y., Imitola, J., et al. 2008).
- the spinal cords were then homogenized and the resulting pellets were resuspended in 0.25% Trypsin-EDTA and incubated at 37°C for 10 minutes.
- the digestion process was stopped using DMEM containing 0.01 % SBTI, 0.001 % DNase and 0.075% BSA.
- the brain and spinal cord were snap-frozen in liquid nitrogen and stored in -80°C until sectioning.
- the cryostat sections (20pm) of lumbar-sacral spinal cord or anterior, middle and posterior brain were fixed and then stained with antibodies of interest. Blood vessels were visualized by anti-Flk-1 (VEGFR2) and NSCs were stained with either anti-SOX-2 or visualized by PKH26 dye in red.
- VEGFR2 anti-Flk-1
- PKH26 dye visualized by PKH26 dye in red.
- cell quantification was performed by stereological analysis of animals in different groups.
- Glycolipid ligands for selectins support leukocyte tethering and rolling under physiologic flow conditions. Journal of immunology, 154:5356-5366.
- Hyaluronan accumulates in demyelinated lesions and inhibits oligodendrocyte progenitor maturation. Nature medicine, 1 1 :966- 972.
- Butcher EC. 1991 Leukocyte-endothelial cell recognition: three (or more) steps to specificity and diversity. Cell, 67: 1033-1036.
- Betal integrins activate a MAPK signalling pathway in neural stem cells that contributes to their maintenance. Development, 131 :3433-3444.
- CD44 is a major E-selectin ligand on human hematopoietic progenitor cells. J Cell Biol, 153: 1277-1286.
- microscopy reveals microglia-associated myelin and axonal dysfunction in multiple sclerosis-like lesions in mice. Journal of biomedical optics, 16:021 109.
- Schwann cells genetically engineered to express PSA show enhanced migratory potential without impairment of their myelinating ability in vitro. Glia, 53:868-878.
- CD62 and endothelial cell-leukocyte adhesion molecule 1 recognize the same carbohydrate ligand, sialyl-Lewis x. Proc Natl Acad Sci U S A, 88:6224-6228.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Veterinary Medicine (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Cell Biology (AREA)
- Biomedical Technology (AREA)
- Developmental Biology & Embryology (AREA)
- Immunology (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Biotechnology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Epidemiology (AREA)
- Virology (AREA)
- Hematology (AREA)
- Neurology (AREA)
- Neurosurgery (AREA)
- Diabetes (AREA)
- Physiology (AREA)
- Rheumatology (AREA)
- Orthopedic Medicine & Surgery (AREA)
- Physical Education & Sports Medicine (AREA)
- Wood Science & Technology (AREA)
- Genetics & Genomics (AREA)
- Nutrition Science (AREA)
- Cardiology (AREA)
- Vascular Medicine (AREA)
- Dermatology (AREA)
- Ophthalmology & Optometry (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
Priority Applications (13)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202310228900.0A CN116327805A (zh) | 2014-12-30 | 2015-12-29 | 改善细胞治疗的方法 |
| BR112017014361-5A BR112017014361B1 (pt) | 2014-12-30 | 2015-12-29 | Uso de uma população de células-tronco mesenquimais (MSCS) modificadas com fucosiltransferase VI (FTVI) que expressa o ligante de E-L Selectina de célula hematopoiética (HCELL) para tratar diabetes |
| KR1020177021422A KR102569540B1 (ko) | 2014-12-30 | 2015-12-29 | 세포 요법을 개선시키는 방법 |
| EP21193478.1A EP4012024B1 (en) | 2014-12-30 | 2015-12-29 | Methods to improve cell therapy |
| CN201580076144.8A CN107249601A (zh) | 2014-12-30 | 2015-12-29 | 改善细胞治疗的方法 |
| EP15831197.7A EP3240893B1 (en) | 2014-12-30 | 2015-12-29 | Methods to improve cell therapy |
| CA2972899A CA2972899C (en) | 2014-12-30 | 2015-12-29 | Methods to improve cell therapy |
| SG11201705401YA SG11201705401YA (en) | 2014-12-30 | 2015-12-29 | Methods to improve cell therapy |
| JP2017535420A JP6963500B2 (ja) | 2014-12-30 | 2015-12-29 | 細胞療法を改善するための方法 |
| HK18104812.8A HK1245132A1 (zh) | 2014-12-30 | 2015-12-29 | 改善细胞治疗的方法 |
| AU2015374198A AU2015374198B2 (en) | 2014-12-30 | 2015-12-29 | Methods to improve cell therapy |
| KR1020237028021A KR20230127358A (ko) | 2014-12-30 | 2015-12-29 | 세포 요법을 개선시키는 방법 |
| AU2022201482A AU2022201482A1 (en) | 2014-12-30 | 2022-03-03 | Methods to improve cell therapy |
Applications Claiming Priority (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201462098048P | 2014-12-30 | 2014-12-30 | |
| US62/098,048 | 2014-12-30 | ||
| US201562101863P | 2015-01-09 | 2015-01-09 | |
| US62/101,863 | 2015-01-09 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2016109543A1 true WO2016109543A1 (en) | 2016-07-07 |
Family
ID=55299731
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2015/067873 Ceased WO2016109543A1 (en) | 2014-12-30 | 2015-12-29 | Methods to improve cell therapy |
Country Status (12)
| Country | Link |
|---|---|
| US (3) | US10471103B2 (enExample) |
| EP (2) | EP3240893B1 (enExample) |
| JP (3) | JP6963500B2 (enExample) |
| KR (2) | KR20230127358A (enExample) |
| CN (2) | CN107249601A (enExample) |
| AU (2) | AU2015374198B2 (enExample) |
| BR (1) | BR112017014361B1 (enExample) |
| CA (2) | CA3202385A1 (enExample) |
| ES (1) | ES3051035T3 (enExample) |
| HK (1) | HK1245132A1 (enExample) |
| SG (2) | SG11201705401YA (enExample) |
| WO (1) | WO2016109543A1 (enExample) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2017201537A1 (en) * | 2016-05-20 | 2017-11-23 | Robert Sackstein | Glycoengineering of e-selectin ligands |
| WO2026010977A1 (en) * | 2024-07-01 | 2026-01-08 | Robert Sackstein | Compositions and methods for treatment of human diseases with glycocalyx-modified mesenchymal stem cells |
Families Citing this family (11)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP7637323B2 (ja) * | 2016-06-23 | 2025-02-28 | ティソン バイオテック,インコーポレイテッド | 副甲状腺ホルモン1型受容体を発現する細胞およびその使用 |
| EP4417210A1 (en) | 2017-03-15 | 2024-08-21 | Orca Biosystems, Inc. | Compositions and methods for hematopoietic stem cell transplants |
| EP3773629A4 (en) | 2018-03-27 | 2022-01-19 | AZTherapies, Inc. | CAR-TREG-BASED THERAPIES FOR THE TREATMENT OF NEURODEGENERATIVE DISEASES |
| US20210154230A1 (en) * | 2018-05-04 | 2021-05-27 | Spinalcyte, Llc | Intradiscal t-regulatory cell administration for treatment of disc degenerative disease |
| CN108642004A (zh) * | 2018-05-17 | 2018-10-12 | 广东芙金干细胞再生医学有限公司 | 一种外泌体的制备方法及含有外泌体的干细胞增殖试剂 |
| WO2019245904A1 (en) * | 2018-06-18 | 2019-12-26 | The Brigham And Women's Hospital | Compositions and methods for production of exofucosylated cells for clinical applications |
| TW202043463A (zh) * | 2018-12-14 | 2020-12-01 | 比利時商普羅米修亞生物科技股份有限公司 | 包含表現hla-e之肝先驅細胞之細胞組成物 |
| WO2020224450A1 (en) * | 2019-05-03 | 2020-11-12 | The University Of Hong Kong | Method for peritoneal metastatic cell detection and isolation thereof |
| EP4153616A4 (en) * | 2020-05-18 | 2024-08-21 | Robert Sackstein | COMPOSITIONS AND METHODS FOR THE TREATMENT OF INFLAMMATORY DISEASES |
| TWI883563B (zh) * | 2022-09-30 | 2025-05-11 | 中國醫藥大學 | 細胞植體與類膠原蛋白之多功能胜肽組合物及其應用 |
| EP4649140A1 (en) * | 2023-01-13 | 2025-11-19 | The Brigham and Women's Hospital | Compositions and methods for identifying and isolating human hematopoietic stem and progenitor cells |
Citations (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2006068720A2 (en) * | 2004-11-12 | 2006-06-29 | The Brigham And Women's Hospital, Inc. | Hematopoietic cell selectin ligand polypeptides and methods of use thereof |
| WO2007005180A2 (en) * | 2005-06-29 | 2007-01-11 | Advanced Cardiovascular Systems, Inc. | Method for enhancing engraftment of therapeutic cells at a target site |
| WO2007143204A2 (en) * | 2006-06-02 | 2007-12-13 | Sacktein Robert | Compositions and methods for modifying cell surface glycans |
| WO2008011094A2 (en) * | 2006-07-18 | 2008-01-24 | Robert Sackstein | Cytokine induction of selectin ligands on cells |
| US7875585B2 (en) | 2000-10-18 | 2011-01-25 | Robert Sackstein | Hematopoietic cell E-selectin / L-selectin ligand glycosylated CD44 polypeptide |
| US20110206740A1 (en) | 2008-04-29 | 2011-08-25 | Karp Jeffrey M | Cell Membrane Engineering |
| US20130040837A1 (en) | 2009-12-01 | 2013-02-14 | Brigham And Women's Hospital, Inc. | Aptamer cell compositions |
| US20140161782A1 (en) * | 2008-06-09 | 2014-06-12 | Targazyme, Inc. | Augmentation of cell therapy efficacy including treatment with alpha 1-3 fucoslytransferase |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AU782952C (en) * | 1999-08-25 | 2006-09-07 | Altarex Medical Corp. | Therapeutic immune condition compositions and methods |
| BRPI0513897A (pt) * | 2004-07-29 | 2008-05-20 | Stem Cell Innovations Inc | diferenciação de células-tronco |
| AU2007243221A1 (en) * | 2006-04-28 | 2007-11-08 | Tulane University Health Sciences Center | Methods for treating diabetes |
| CA2954534C (en) * | 2014-07-07 | 2023-04-04 | Targazyme, Inc. | Manufacture and cryopreservation of fucosylated cells for therapeutic use |
-
2015
- 2015-12-29 SG SG11201705401YA patent/SG11201705401YA/en unknown
- 2015-12-29 EP EP15831197.7A patent/EP3240893B1/en active Active
- 2015-12-29 BR BR112017014361-5A patent/BR112017014361B1/pt active IP Right Grant
- 2015-12-29 KR KR1020237028021A patent/KR20230127358A/ko not_active Ceased
- 2015-12-29 KR KR1020177021422A patent/KR102569540B1/ko active Active
- 2015-12-29 JP JP2017535420A patent/JP6963500B2/ja active Active
- 2015-12-29 CN CN201580076144.8A patent/CN107249601A/zh active Pending
- 2015-12-29 US US14/982,863 patent/US10471103B2/en active Active
- 2015-12-29 AU AU2015374198A patent/AU2015374198B2/en active Active
- 2015-12-29 ES ES21193478T patent/ES3051035T3/es active Active
- 2015-12-29 WO PCT/US2015/067873 patent/WO2016109543A1/en not_active Ceased
- 2015-12-29 SG SG10202013095YA patent/SG10202013095YA/en unknown
- 2015-12-29 HK HK18104812.8A patent/HK1245132A1/zh unknown
- 2015-12-29 EP EP21193478.1A patent/EP4012024B1/en active Active
- 2015-12-29 CA CA3202385A patent/CA3202385A1/en active Pending
- 2015-12-29 CA CA2972899A patent/CA2972899C/en active Active
- 2015-12-29 CN CN202310228900.0A patent/CN116327805A/zh active Pending
-
2019
- 2019-11-08 US US16/678,929 patent/US20200281985A1/en not_active Abandoned
-
2021
- 2021-10-15 JP JP2021169444A patent/JP7339990B2/ja active Active
-
2022
- 2022-03-03 AU AU2022201482A patent/AU2022201482A1/en not_active Abandoned
- 2022-11-10 US US18/054,364 patent/US12090173B2/en active Active
-
2023
- 2023-08-25 JP JP2023137151A patent/JP2023156522A/ja active Pending
Patent Citations (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7875585B2 (en) | 2000-10-18 | 2011-01-25 | Robert Sackstein | Hematopoietic cell E-selectin / L-selectin ligand glycosylated CD44 polypeptide |
| WO2006068720A2 (en) * | 2004-11-12 | 2006-06-29 | The Brigham And Women's Hospital, Inc. | Hematopoietic cell selectin ligand polypeptides and methods of use thereof |
| WO2007005180A2 (en) * | 2005-06-29 | 2007-01-11 | Advanced Cardiovascular Systems, Inc. | Method for enhancing engraftment of therapeutic cells at a target site |
| WO2007143204A2 (en) * | 2006-06-02 | 2007-12-13 | Sacktein Robert | Compositions and methods for modifying cell surface glycans |
| US8084236B2 (en) | 2006-06-02 | 2011-12-27 | Robert Sackstein | Compositions and methods for modifying cell surface glycans |
| WO2008011094A2 (en) * | 2006-07-18 | 2008-01-24 | Robert Sackstein | Cytokine induction of selectin ligands on cells |
| US20110206740A1 (en) | 2008-04-29 | 2011-08-25 | Karp Jeffrey M | Cell Membrane Engineering |
| US20140161782A1 (en) * | 2008-06-09 | 2014-06-12 | Targazyme, Inc. | Augmentation of cell therapy efficacy including treatment with alpha 1-3 fucoslytransferase |
| US20130040837A1 (en) | 2009-12-01 | 2013-02-14 | Brigham And Women's Hospital, Inc. | Aptamer cell compositions |
Non-Patent Citations (128)
| Title |
|---|
| A. PELED ET AL., SCIENCE, vol. 283, 1999, pages 845 |
| ABDI R; FIORINA P; ADRA CN ET AL.: "Immunomodulation by mesenchymal stem cells: a potential therapeutic strategy for type 1 diabetes", DIABETES, vol. 57, 2008, pages 1759 - 1767, XP008098188, DOI: doi:10.2337/db08-0180 |
| ALAM HB; SUN L; RUFF P; AUSTIN B; BURRIS D; RHEE P: "E- and P-selectin expression depends on the resuscitation fluid used in hemorrhaged rats", THE JOURNAL OF SURGICAL RESEARCH, vol. 94, 2000, pages 145 - 152 |
| ALON R; FEIZI T; YUEN CT; FUHLBRIGGE RC; SPRINGER TA: "Glycolipid ligands for selectins support leukocyte tethering and rolling under physiologic flow conditions", JOURNAL OF IMMUNOLOGY, vol. 154, 1995, pages 5356 - 5366 |
| AMADO LC; SALIARIS AP; SCHULERI KH ET AL.: "Cardiac repair with intramyocardial injection of allogeneic mesenchymal stem cells after myocardial infarction", PROC NATL ACAD SCI USA., vol. 102, 2005, pages 11474 - 11479, XP002558743, DOI: doi:10.1073/pnas.0504388102 |
| BACK SA; TUOHY TM; CHEN H; WALLINGFORD N; CRAIG A; STRUVE J; LUO NL; BANINE F; LIU Y; CHANG A ET AL.: "Hyaluronan accumulates in demyelinated lesions and inhibits oligodendrocyte progenitor maturation", NATURE, vol. 11, 2005, pages 966 - 972 |
| BASSI EJ; MORAES-VIEIRA PM; MOREIRA-SA CS ET AL.: "Immune regulatory properties of allogeneic adipose-derived mesenchymal stem cells in the treatment of experimental autoimmune diabetes", DIABETES, vol. 61, 2012, pages 2534 - 2545 |
| BEN-HUR T; EINSTEIN 0; MIZRACHI-KOL R; BEN-MENACHEM 0; REINHARTZ E; KARUSSIS D; ABRAMSKY 0: "Transplanted multipotential neural precursor cells migrate into the inflamed white matter in response to experimental autoimmune encephalomyelitis", GLIA, vol. 41, 2003, pages 73 - 80 |
| BERLIN C; BARGATZE RF; CAMPBELL JJ; VON ANDRIAN UH; SZABO MC; HASSLEN SR; NELSON RD; BERG EL; ERLANDSEN SL; BUTCHER EC: "alpha 4 integrins mediate lymphocyte attachment and rolling under physiologic flow.", CELL, vol. 80, 1995, pages 413 - 422, XP001147328, DOI: doi:10.1016/0092-8674(95)90491-3 |
| BERMAN DM; WILLMAN MA; HAN D ET AL.: "Mesenchymal stem cells enhance allogeneic islet engraftment in nonhuman primates", DIABETES, vol. 59, 2010, pages 2558 - 2568 |
| BEVILACQUA MP; STENGELIN S; GIMBRONE MA JR; SEED B.: "Endothelial leukocyte adhesion molecule 1: an inducible receptor for neutrophils related to complement regulatory proteins and lectins.", SCIENCE, vol. 243, 1989, pages 1160 - 5 |
| BEZZI P; DOMERCQ M; BRAMBILLA L; GALLI R; SCHOLS D; DE CLERCQ E; VESCOVI A; BAGETTA G; KOLLIAS G; MELDOLESI J ET AL.: "CXCR4-activated astrocyte glutamate release via TNFalpha: amplification by microglia triggers neurotoxicity", NAT NEUROSCI, vol. 4, 2001, pages 702 - 710 |
| BONIFACIO E.: "Immunotherapy in type 1 diabetes: a shorter but more winding road?", DIABETES, vol. 61, 2012, pages 2214 - 2215 |
| BORG DJ; WEIGELT M; WILHELM C ET AL.: "Mesenchymal stromal cells improve transplanted islet survival and islet function in a syngeneic mouse model", DIABETOLOGIA, vol. 57, 2014, pages 522 - 531 |
| BRESSON D; VON HERRATH M: "Immunotherapy for the prevention and treatment of type 1 diabetes: optimizing the path from bench to bedside", DIABETES CARE, vol. 32, 2009, pages 1753 - 1768, XP008167682, DOI: doi:10.2337/dc09-0373 |
| BUTCHER EC: "Leukocyte-endothelial cell recognition: three (or more) steps to specificity and diversity", CELL, vol. 67, 1991, pages 1033 - 1036, XP023908196, DOI: doi:10.1016/0092-8674(91)90279-8 |
| C. I. SILVESCU ET AL: "G-CSF Induces Membrane Expression of a Myeloperoxidase Glycovariant that Operates as an E-selectin Ligand on Human Myeloid Cells", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES, vol. 111, no. 29, 22 July 2014 (2014-07-22), US, pages 10696 - 10701, XP055255945, ISSN: 0027-8424, DOI: 10.1073/pnas.1320833111 * |
| C. J. DIMITROFF; J. Y. LEE; K. S. SCHOR; B. M. SANDMAIER; R. SACKSTEIN, J BIOL CHEM, vol. 276, 2001, pages 47623 |
| C. J. DIMITROFF; J. Y. LEE; R. C. FUHLBRIGGE; R. SACKSTEIN, PROC NATL ACAD SCI US A, vol. 97, 2000, pages 13841 |
| C. J. DIMITROFF; J. Y. LEE; S. RAFII; R. C. FUHLBRIGGE; R. SACKSTEIN, J CELL BIOL, vol. 153, 2001, pages 1277 |
| CAMPOS LS; DECKER L; TAYLOR V; SKARNES W: "Notch, epidermal growth factor receptor, and beta1-integrin pathways are coordinated in neural stem cells", J BIOL CHEM, vol. 281, 2006, pages 5300 - 5309 |
| CAMPOS LS; LEONE DP; RELVAS JB; BRAKEBUSCH C; FASSLER R; SUTER U, FFRENCH; CONSTANT C.: "Beta1 integrins activate a MAPK signalling pathway in neural stem cells that contributes to their maintenance", DEVELOPMENT, vol. 131, 2004, pages 3433 - 3444, XP003018064, DOI: doi:10.1242/dev.01199 |
| CAPLAN AI: "Why are MSCs therapeutic? New data: new insight", THE JOURNAL OF PATHOLOGY, vol. 217, 2009, pages 318 - 324 |
| CHITNIS T; NAJAFIAN N; ABDALLAH KA; DONG V; YAGITA H; SAYEGH MH; KHOURY SJ.: "CD28-independent induction of experimental autoimmune encephalomyelitis", J CLIN INVEST,, vol. 107, 2001, pages 575 - 583 |
| D. A. SIPKINS ET AL., NATURE, vol. 435, 2005, pages 969 |
| DAZZI F; LOPES L; WENG L: "Mesenchymal stromal cells: a key player in 'innate tolerance'?", IMMUNOLOGY, vol. 137, 2012, pages 206 - 213 |
| DAZZI F; VAN LAAR JM; COPE A ET AL.: "Cell therapy for autoimmune diseases", ARTHRITIS RES THER., vol. 9, 2007, pages 206 |
| DEBOUX C; LADRAA S; CAZAUBON S; GHRIBI-MALLAH S; WEISS N; CHAVEROT N; COURAUD PO; BARON-VAN EVERCOOREN A.: "Overexpression of CD44 in neural precursor cells improves trans-endothelial migration and facilitates their invasion of perivascular tissues in vivo", PLOS ONE, vol. 8, no. E57430, 2013 |
| DIMITROFF CJ; LEE JY; FUHLBRIGGE RC; SACKSTEIN R: "A distinct glycoform of CD44 is an L-selectin ligand on human hematopoietic cells", PROC NATL ACAD SCI USA, vol. 97, 2000, pages 13841 - 13846, XP002939191, DOI: doi:10.1073/pnas.250484797 |
| DIMITROFF CJ; LEE JY; RAFII S; FUHLBRIGGE RC; SACKSTEIN R: "CD44 is a major E-selectin ligand on human hematopoietic progenitor cells", J CELL BIOL, vol. 153, 2001, pages 1277 - 1286, XP002288890, DOI: doi:10.1083/jcb.153.6.1277 |
| DING Y; XU D; FENG G ET AL.: "Mesenchymal stem cells prevent the rejection of fully allogenic islet grafts by the immunosuppressive activity of matrix metalloproteinase-2 and -9", DIABETES, vol. 58, 2009, pages 1797 - 1806 |
| DING ZM; BABENSEE JE; SIMON SI; LU H; PERRARD JL; BULLARD DC; DAI XY; BROMLEY SK; DUSTIN ML; ENTMAN ML ET AL.: "Relative contribution of LFA-1 and Mac-1 to neutrophil adhesion and migration", JOURNAL OF IMMUNOLOGY, vol. 163, 1999, pages 5029 - 5038 |
| DRAKE TA; CHENG J; CHANG A; TAYLOR FB, JR: "Expression of tissue factor, thrombomodulin, and E-selectin in baboons with lethal Escherichia coli sepsis", THE AMERICAN JOURNAL OF PATHOLOGY, vol. 142, 1993, pages 1458 - 1470 |
| EINSTEIN O; FAINSTEIN N; VAKNIN I; MIZRACHI-KOL R; REIHARTZ E; GRIGORIADIS N; LAVON I; BANIYASH M; LASSMANN H; BEN-HUR T: "Neural precursors attenuate autoimmune encephalomyelitis by peripheral immunosuppression", ANNALS OF NEUROLOGY, vol. 61, 2007, pages 209 - 218 |
| EINSTEIN O; GRIGORIADIS N; MIZRACHI-KOL R; REINHARTZ E; POLYZOIDOU E; LAVON I; MILONAS I; KARUSSIS D; ABRAMSKY O; BEN-HUR T: "Transplanted neural precursor cells reduce brain inflammation to attenuate chronic experimental autoimmune encephalomyelitis", EXPERIMENTAL NEUROLOGY, vol. 198, 2006, pages 275 - 284, XP024945752, DOI: doi:10.1016/j.expneurol.2005.11.007 |
| EL HADDAD N; HEATHCOTE D; MOORE R ET AL.: "Mesenchymal stem cells express serine protease inhibitor to evade the host immune response", BLOOD, vol. 117, 2011, pages 1176 - 1183 |
| EMAMGHOLIPOUR S; ESHAGHI SM; HOSSEIN-NEZHAD A; MIRZAEI K; MAGHBOOLI Z; SAHRAIAN MA: "Adipocytokine profile, cytokine levels and foxp3 expression in multiple sclerosis: a possible link to susceptibility and clinical course of disease", PLOS ONE, vol. 8, 2013, pages E76555 |
| FIORINA P; JUREWICZ M; AUGELLO A ET AL.: "Immunomodulatory function of bone marrow-derived mesenchymal stem cells in experimental autoimmune type 1 diabetes", J IMMUNOL., vol. 183, 2009, pages 993 - 1004 |
| FLAX JD; AURORA S; YANG C; SIMONIN C; WILLS AM; BILLINGHURST LL; JENDOUBI M; SIDMAN RL; WOLFE JH; KIM SU ET AL.: "Engraftable human neural stem cells respond to developmental cues, replace neurons, and express foreign genes", NAT BIOTECHNOL, vol. 16, 1998, pages 1033 - 1039 |
| FU J; YANG QY; SAI K; CHEN FR; PANG JC; NG HK; KWAN AL; CHEN ZP: "TGM2 inhibition attenuates ID1 expression in CD44-high glioma-initiating cells", NEURO-ONCOLOGY, vol. 15, 2013, pages 1353 - 1365 |
| FUHLBRIGGE ET AL., BLOOD, vol. 107, 2006, pages 1421 - 1426 |
| FUHLBRIGGE RC; KIEFFER JD; ARMERDING D; KUPPER TS.: "Cutaneous lymphocyte antigen is a specialized form of PSGL-1 expressed on skin-homing T cells", NATURE, vol. 389, 1997, pages 978 - 981, XP002975219, DOI: doi:10.1038/40166 |
| FUHLBRIGGE RC; KING SL; DIMITROFF CJ; KUPPERTS; SACKSTEIN R: "Direct real-time observation of E- and P-selectin-mediated rolling on cutaneous lymphocyte-associated antigen immobilized on Western blots", JOURNAL OF IMMUNOLOGY, vol. 168, 2002, pages 5645 - 5651 |
| GADHOUM SZ; SACKSTEIN R: "CD15 expression in human myeloid cell differentiation is regulated by sialidase activity", NAT CHEM BIOL, vol. 4, 2008, pages 751 - 757 |
| GASCON E; VUTSKITS L; KISS JZ.: "Polysialic acid-neural cell adhesion molecule in brain plasticity: from synapses to integration of new neurons", BRAIN RES REV, vol. 56, 2007, pages 101 - 118, XP022345478, DOI: doi:10.1016/j.brainresrev.2007.05.014 |
| GLASER T; BROSE C; FRANCESCHINI I; HAMANN K; SMORODCHENKO A; ZIPP F, DUBOIS; DALCQ M; BRUSTLE O: "Neural cell adhesion molecule polysialylation enhances the sensitivity of embryonic stem cell-derived neural precursors to migration guidance cues", STEM CELLS, vol. 25, 2007, pages 3016 - 3025 |
| GONCHAROVA V; DAS S; NILES W; SCHRAUFSTATTER I; WONG AK; POVALY T; WAKEMAN D; MILLER L; SNYDER EY; KHALDOYANIDI SK: "Homing of neural stem cells from the venous compartment into a brain infarct does not involve conventional interactions with vascular endothelium", STEM CELLS TRANSLATIONAL MEDICINE, vol. 3, 2014, pages 229 - 240 |
| HESS DC; BORLONGAN CV.: "Stem cells and neurological diseases", CELL PROLIFERATION, vol. 41, no. 1, 2008, pages 94 - 114 |
| HORIE K; SAKAGAMI M; KURAMOCHI K; ITO T; HAMANA H: "Effect of the sialyl Lewis X (SLe(x)) moiety on splenic accumulation of SLe(x)-carboxymethylpullulan conjugate", MICROBIOLOGY AND IMMUNOLOGY, vol. 44, 2000, pages 401 - 404 |
| HORIE K; SAKAGAMI M; MASUDA K; NOTOYA M; HAMANA H; YOSHIKAWA T; HIRANO K: "Sialyl Lewis X-carboxymethylpullulan conjugate: a novel homing device to spleen and lymph nodes", BIOLOGICAL & PHARMACEUTICAL BULLETIN, vol. 27, 2004, pages 1275 - 1280 |
| IMITOLA J; CHITNIS T; KHOURY SJ: "Insights into the molecular pathogenesis of progression in multiple sclerosis: potential implications for future therapies", ARCH NEUROL, vol. 63, 2006, pages 25 - 33 |
| IMITOLA J; COMABELLA M; CHANDRAKER AK; DANGOND F; SAYEGH MH; SNYDER EY; KHOURY SJ: "Neural stem/progenitor cells express costimulatory molecules that are differentially regulated by inflammatory and apoptotic stimuli", THE AMERICAN JOURNAL OF PATHOLOGY, vol. 164, 2004, pages 1615 - 1625 |
| IMITOLA J; COTE D; RASMUSSEN S; XIE XS; LIU Y; CHITNIS T; SIDMAN RL; LIN CP; KHOURY SJ: "Multimodal coherent anti-Stokes Raman scattering microscopy reveals microglia-associated myelin and axonal dysfunction in multiple sclerosis-like lesions in mice", JOURNAL OF BIOMEDICAL OPTICS, vol. 16, 2011, pages 021109 |
| IMITOLA J; RADDASSI K; PARK KI; MUELLER FJ; NIETO M; TENG YD; FRENKEL D; LI J; SIDMAN RL; WALSH CA ET AL.: "Directed migration of neural stem cells to sites of CNS injury by the stromal cell-derived factor 1 alpha/CXC chemokine receptor 4 pathway", PROC NATL ACAD SCI U S A, vol. 101, 2004, pages 18117 - 18122 |
| JASMEEN S MERZABAN ET AL: "Cell surface glycan engineering of neural stem cells augments neurotropism and improves recovery in a murine model of multiple sclerosis", GLYCOBIOLOGY, vol. 25, no. 12, 7 July 2015 (2015-07-07), US, pages 1392 - 1409, XP055255942, ISSN: 0959-6658, DOI: 10.1093/glycob/cwv046 * |
| JI JF; HE BP; DHEEN ST; TAY SS: "Expression of chemokine receptors CXCR4, CCR2, CCR5 and CX3CR1 in neural progenitor cells isolated from the subventricular zone of the adult rat brain", NEUROSCIENCE LETTERS, vol. 355, 2004, pages 236 - 240 |
| JUREWICZ M; YANG S; AUGELLO A ET AL.: "Congenic mesenchymal stem cell therapy reverses hyperglycemia in experimental type 1 diabetes", DIABETES, vol. 59, 2010, pages 3139 - 3147 |
| JUSTICIA C; MARTIN A; ROJAS S; GIRONELLA M; CERVERA A; PANES J; CHAMORRO A; PLANAS AM: "Anti-VCAM-1 antibodies did not protect against ischemic damage either in rats or in mice", J CEREB BLOOD FLOW METAB, vol. 26, 2006, pages 421 - 432 |
| KANG SK; SHIN IS; KO MS ET AL.: "Journey of mesenchymal stem cells for homing: strategies to enhance efficacy and safety of stem cell therapy", STEM CELLS INT., 2012 |
| KORPOS E; KADRI N; KAPPELHOFF R ET AL.: "The peri-islet basement membrane, a barrier to infiltrating leukocytes in type 1 diabetes in mouse and human", DIABETES, vol. 62, 2013, pages 531 - 542 |
| KOTA DJ; WIGGINS LL; YOON N ET AL.: "TSG-6 produced by hMSCs delays the onset of autoimmune diabetes by suppressing Th1 development and enhancing tolerogenicity", DIABETES, vol. 62, 2013, pages 2048 - 2058 |
| LATERZA C; MERLINI A; DE FEO D; RUFFINI F; MENON R; ONORATI M; FREDRICKX E; MUZIO L; LOMBARDO A; COMI G ET AL.: "iPSC-derived neural precursors exert a neuroprotective role in immune-mediated demyelination via the secretion of LIF", NATURE COMMUNICATIONS, vol. 4, 2013, pages 2597 |
| LAVDAS AA; FRANCESCHINI I; DUBOIS-DALCQ M; MATSAS R: "Schwann cells genetically engineered to express PSA show enhanced migratory potential without impairment of their myelinating ability in vitro", GLIA, vol. 53, 2006, pages 868 - 878 |
| LEE RH; KIM B; CHOI I ET AL.: "Characterization and expression analysis of mesenchymal stem cells from human bone marrow and adipose tissue", CELL PHYSIOL BIOCHEM., vol. 14, 2004, pages 311 - 324, XP002360960, DOI: doi:10.1159/000080341 |
| LEE RH; SEO MJ; REGER RL ET AL.: "Multipotent stromal cells from human marrow home to and promote repair of pancreatic islets and renal glomeruli in diabetic NOD/scid mice", PROC NATL ACAD SCI USA., vol. 103, 2006, pages 17438 - 17443, XP002459835, DOI: doi:10.1073/pnas.0608249103 |
| LEE SJ; BENVENISTE EN: "Adhesion molecule expression and regulation on cells of the central nervous system", JOURNAL OF NEUROIMMUNOLOGY,, vol. 98, 1999, pages 77 - 88 |
| LEE ST; CHU K; JUNG KH; KIM SJ; KIM DH; KANG KM; HONG NH; KIM JH; BAN JJ; PARK HK ET AL.: "Anti-inflammatory mechanism of intravascular neural stem cell transplantation in haemorrhagic stroke", BRAIN : A JOURNAL OF NEUROLOGY, vol. 131, 2008, pages 616 - 629 |
| LEONE DP; RELVAS JB; CAMPOS LS; HEMMI S; BRAKEBUSCH C; FASSLER R; FFRENCH-CONSTANT C; SUTER U: "Regulation of neural progenitor proliferation and survival by beta1 integrins", J CELL SCI, vol. 118, 2005, pages 2589 - 2599, XP003018063, DOI: doi:10.1242/jcs.02396 |
| LEPPANEN A; WHITE SP; HELIN J; MCEVER RP; CUMMINGS RD: "Binding of glycosulfopeptides to P-selectin requires stereospecific contributions of individual tyrosine sulfate and sugar residues", J BIOL CHEM, vol. 275, 2000, pages 39569 - 39578 |
| LIU H; ZHANG J; LIU CY; WANG IJ; SIEBER M; CHANG J; JESTER JV; KAO WW.: "Cell therapy of congenital corneal diseases with umbilical mesenchymal stem cells: lumican null mice", PLOS ONE, vol. 5, 2010, pages E10707 |
| LUDVIGSSON J; KRISKY D; CASAS R ET AL.: "GAD65 antigen therapy in recently diagnosed type 1 diabetes mellitus", N ENGL J MED, vol. 366, 2012, pages 433 - 442, XP055434070, DOI: doi:10.1056/NEJMoa1107096 |
| M. J. POLLEY ET AL., PROC NATL ACAD SCI USA, vol. 88, 1991, pages 6224 |
| MADEC AM; MALLONE R; AFONSO G ET AL.: "Mesenchymal stem cells protect NOD mice from diabetes by inducing regulatory T cells", DIABETOLOGIA, vol. 52, 2009, pages 1391 - 1399, XP019698646 |
| MANESS PF; SCHACHNER M: "Neural recognition molecules of the immunoglobulin superfamily: signaling transducers of axon guidance and neuronal migration", NAT NEUROSCI, vol. 10, 2007, pages 19 - 26 |
| MARTINO G; PLUCHINO S.: "The therapeutic potential of neural stem cells", NAT REV NEUROSCI, vol. 7, 2006, pages 395 - 406, XP002587341 |
| MERZABAN ET AL., BLOOD, vol. 118, 2011, pages 1774 - 1783 |
| MERZABAN JS; BURDICK MM; GADHOUM SZ; DAGIA NM; CHU JT; FUHLBRIGGE RC; SACKSTEIN R: "Analysis of glycoprotein E-selectin ligands on human and mouse marrow cells enriched for hematopoietic stem/progenitor cells", BLOOD, vol. 118, 2011, pages 1774 - 1783 |
| MONTANE J; BISCHOFF L; SOUKHATCHEVA G ET AL.: "Prevention of murine autoimmune diabetes by CCL22-mediated Treg recruitment to the pancreatic islets", J CLIN INVEST., vol. 121, 2011, pages 3024 - 3028 |
| PHINNEY DG; PROCKOP DJ.: "Concise review: mesenchymal stem/multipotent stromal cells: the state of transdifferentiation and modes of tissue repair--current views", STEM CELLS (DAYTON, OHIO), vol. 25, 2007, pages 2896 - 2902, XP002612819, DOI: doi:10.1634/stemcells.2007-0637 |
| PICCIO L; ROSSI B; COLANTONIO L; GRENNINGLOH; GHO A; OTTOBONI L; HOMEISTER JW; SCARPINI E; MARTINELLO M; LAUDANNA C ET AL.: "Efficient recruitment of lymphocytes in inflamed brain venules requires expression of cutaneous lymphocyte antigen and fucosyltransferase-VI", J IMMUNOL, vol. 174, 2005, pages 5805 - 5813, XP055290817, DOI: doi:10.4049/jimmunol.174.9.5805 |
| PICCIO L; ROSSI B; SCARPINI E; LAUDANNA C; GIAGULLI C; ISSEKUTZ AC; VESTWEBER D; BUTCHER EC; CONSTANTIN G: "Molecular mechanisms involved in lymphocyte recruitment in inflamed brain microvessels: critical roles for P-selectin glycoprotein ligand-1 and heterotrimeric G(i)-linked receptors", JOURNAL OF IMMUNOLOGY, vol. 168, 2002, pages 1940 - 1949, XP055290778, DOI: doi:10.4049/jimmunol.168.4.1940 |
| PLUCHINO S; QUATTRINI A; BRAMBILLA E; GRITTI A; SALANI G; DINA G; GALLI R; DEL CARRO U; AMADIO S; BERGAMI A ET AL.: "Injection of adult neurospheres induces recovery in a chronic model of multiple sclerosis", NATURE, vol. 422, 2003, pages 688 - 694, XP002399606, DOI: doi:10.1038/nature01552 |
| PLUCHINO S; ZANOTTI L; BRINI E; FERRARI S; MARTINO G: "Regeneration and repair in multiple sclerosis: the role of cell transplantation", NEUROSCIENCE LETTERS, vol. 456, 2009, pages 101 - 106, XP026057090, DOI: doi:10.1016/j.neulet.2008.03.097 |
| PLUCHINO S; ZANOTTI L; ROSSI B; BRAMBILLA E; OTTOBONI L; SALANI G; MARTINELLO M; CATTALINI A; BERGAMI A; FURLAN R ET AL.: "Neurosphere-derived multipotent precursors promote neuroprotection by an immunomodulatory mechanism", NATURE, vol. 436, 2005, pages 266 - 271, XP002426967, DOI: doi:10.1038/nature03889 |
| POLITI LS; BACIGALUPPI M; BRAMBILLA E; CADIOLI M; FALINI A; COMI G; SCOTTI G; MARTINO G; PLUCHINO S: "Magnetic-resonance-based tracking and quantification of intravenously injected neural stem cell accumulation in the brains of mice with experimental multiple sclerosis", STEM CELLS, vol. 25, 2007, pages 2583 - 2592 |
| POLLEY MJ; PHILLIPS ML; WAYNER E; NUDELMAN E; SINGHAL AK; HAKOMORI S; PAULSON JC: "CD62 and endothelial cell-leukocyte adhesion molecule 1 (ELAM-1) recognize the same carbohydrate ligand, sialyl-Lewis x", PROC NATL ACAD SCI U S A, vol. 88, 1991, pages 6224 - 6228 |
| PROCKOP DJ; BRENNER M; FIBBE WE ET AL.: "Defining the risks of mesenchymal stromal cell therapy", CYTOTHERAPY, vol. 12, 2010, pages 576 - 578 |
| R SACKSTEIN ET AL., NATURE MEDICINE, vol. 14, 2008, pages 181 - 187 |
| R SACKSTEIN, J INVEST. DERMATOLOGY, vol. 122, 2004, pages 1061 - 1069 |
| R. SACKSTEIN, CURR OPIN HEMATOL, vol. 12, 2005, pages 444 |
| R. SACKSTEIN, IMMUNOL. REV., vol. 230, 2009, pages 140 - 163 |
| R. SACKSTEIN; C. J. DIMITROFF, BLOOD, vol. 96, 2000, pages 2765 |
| RAMPON C; WEISS N; DEBOUX C; CHAVEROT N; MILLER F; BUCHET D; TRICOIRE-LEIGNEL H; CAZAUBON S; BARON-VAN EVERCOOREN A; COURAUD PO: "Molecular mechanism of systemic delivery of neural precursor cells to the brain: assembly of brain endothelial apical cups and control of transmigration by CD44", STEM CELLS, vol. 26, 2008, pages 1673 - 1682 |
| RASMUSSEN S; WANG Y; KIVISAKK P; BRONSON RT; MEYER M; IMITOLA J; KHOURY SJ: "Persistent activation of microglia is associated with neuronal dysfunction of callosal projecting pathways and multiple sclerosis-like lesions in relapsing--remitting experimental autoimmune encephalomyelitis", BRAIN, vol. 130, 2007, pages 2816 - 2829 |
| REDL H; DINGES HP; BUURMAN WA; VAN DER LINDEN CJ; POBER JS; COTRAN RS; SCHLAG G: "Expression of endothelial leukocyte adhesion molecule-1 in septic but not traumatic/hypovolemic shock in the baboon", THE AMERICAN JOURNAL OF PATHOLOGY, vol. 139, 1991, pages 461 - 466 |
| REZA ABDI ET AL: "HCELL Expression on Murine MSC Licenses Pancreatotropism and Confers Durable Reversal of Autoimmune Diabetes in NOD Mice", STEM CELLS., vol. 33, no. 5, 23 May 2015 (2015-05-23), US, pages 1523 - 1531, XP055255944, ISSN: 1066-5099, DOI: 10.1002/stem.1948 * |
| ROBERT SACKSTEIN: "Engineering cellular trafficking via glycosyltransferase-programmed stereosubstitution", ANNALS OF THE NEW YORK ACADEMY OF SCIENCES, vol. 1253, no. 1, 21 April 2012 (2012-04-21), US, pages 193 - 200, XP055255948, ISSN: 0077-8923, DOI: 10.1111/j.1749-6632.2011.06421.x * |
| ROBERT SACKSTEIN: "Glycoengineering of HCELL, the Human Bone Marrow Homing Receptor: Sweetly Programming Cell Migration", ANNALS OF BIOMEDICAL ENGINEERING, KLUWER ACADEMIC PUBLISHERS-PLENUM PUBLISHERS, NE, vol. 40, no. 4, 9 November 2011 (2011-11-09), pages 766 - 776, XP035033709, ISSN: 1573-9686, DOI: 10.1007/S10439-011-0461-8 * |
| ROSEN SD: "Ligands for L-selectin: homing, inflammation, and beyond", ANNU REV IMMUNOL, vol. 22, 2004, pages 129 - 156 |
| RUTISHAUSER U: "Polysialic acid in the plasticity of the developing and adult vertebrate nervous system", NAT REV NEUROSCI, vol. 9, 2008, pages 26 - 35 |
| SACKSTEIN R.: "The lymphocyte homing receptors: gatekeepers of the multistep paradigm", CURR OPIN HEMATOL, vol. 12, 2005, pages 444 - 450 |
| SACKSTEIN R: "Glycosyltransferase-programmed stereosubstitution (GPS) to create HCELL: engineering a roadmap for cell migration", IMMUNOL REV, vol. 230, 2009, pages 51 - 74, XP055403602, DOI: doi:10.1111/j.1600-065X.2009.00792.x |
| SACKSTEIN R: "The bone marrow is akin to skin: HCELL and the biology of hematopoietic stem cell homing", J INVEST DERMATOL, vol. 122, 2004, pages 1061 - 1069, XP002288891, DOI: doi:10.1111/j.0022-202X.2004.09301.x |
| SACKSTEIN R; FUHLBRIGGE R: "The blot rolling assay: a method for identifying adhesion molecules mediating binding under shear conditions", METHODS IN MOLECULAR BIOLOGY, vol. 341, 2006, pages 217 - 226 |
| SACKSTEIN R; MERZABAN JS; CAIN DW ET AL.: "Ex vivo glycan engineering of CD44 programs human multipotent mesenchymal stromal cell trafficking to bone", NAT MED, vol. 14, 2008, pages 181 - 187, XP002526137, DOI: doi:10.1038/NM1703 |
| SACKSTEIN R; MERZABAN JS; CAIN DW; DAGIA NM; SPENCER JA; LIN CP; WOHLGEMUTH R: "Ex vivo glycan engineering of CD44 programs human multipotent mesenchymal stromal cell trafficking to bone", NATURE MEDICINE, vol. 14, 2008, pages 181 - 187, XP002526137, DOI: doi:10.1038/NM1703 |
| SACKSTEIN ROBERT ET AL: "Ex vivo glycan engineering of CD44 programs human multipotent mesenchymal stromal cell trafficking to bone", NATURE MEDICINE, NATURE PUBLISHING GROUP, NEW YORK, NY, US, vol. 14, no. 2, 1 February 2008 (2008-02-01), pages 181 - 187, XP002526137, ISSN: 1078-8956, [retrieved on 20080113], DOI: 10.1038/NM1703 * |
| SCHWEITZER KM; DRAGER AM; VAN DER VALK P; THIJSEN SF; ZEVENBERGEN A; THEIJSMEIJER AP; VAN DER SCHOOT CE; LANGENHUIJSEN MM: "Constitutive expression of E-selectin and vascular cell adhesion molecule-1 on endothelial cells of hematopoietic tissues", THE AMERICAN JOURNAL OF PATHOLOGY, vol. 148, 1996, pages 165 - 175 |
| SPRINGER TA: "Traffic signals for lymphocyte recirculation and leukocyte emigration: the multistep paradigm.", CELL, vol. 76, 1994, pages 301 - 314, XP024245174, DOI: doi:10.1016/0092-8674(94)90337-9 |
| SRIVASTAVA ET AL., J. BIOL. CHEM., vol. 267, 1992, pages 22356 - 22361 |
| STRANFORD S; RUDDLE NH: "Follicular dendritic cells, conduits, lymphatic vessels, and high endothelial venules in tertiary lymphoid organs: Parallels with lymph node stroma", FRONT IMMUNOL., vol. 3, 2012, pages 350 |
| T. A. SPRINGER, CELL, vol. 76, 1994, pages 301 |
| T. LAPIDOT; A. DAR; O. KOLLET, BLOOD, vol. 106, 2005, pages 1901 |
| THANKAMONY SP; SACKSTEIN R: "Enforced hematopoietic cell E- and L-selectin ligand (HCELL) expression primes transendothelial migration of human mesenchymal stem cells", PROC NATL ACAD SCI USA., vol. 108, 2011, pages 2258 - 2263, XP055255951, DOI: doi:10.1073/pnas.1018064108 |
| TYNDALL A; HOUSSIAU FA: "Mesenchymal stem cells in the treatment of autoimmune diseases", ANN RHEUM DIS., vol. 69, 2010, pages 1413 - 1414 |
| UCCELLI A; MORETTA L; PISTOIA V: "Mesenchymal stem cells in health and disease", NAT REV IMMUNOL., vol. 8, 2008, pages 726 - 36, XP007913720, DOI: doi:10.1038/nri2395 |
| VITRY S; AVELLANA-ADALID V; LACHAPELLE F; EVERCOOREN AB: "Migration and multipotentiality of PSA-NCAM+ neural precursors transplanted in the developing brain", MOLECULAR AND CELLULAR NEUROSCIENCES, vol. 17, 2001, pages 983 - 1000 |
| WANG L; SHI J; VAN GINKEL FW; LAN L; NIEMEYER G; MARTIN DR; SNYDER EY; COX NR: "Neural stem/progenitor cells modulate immune responses by suppressing T lymphocytes with nitric oxide and prostaglandin E2", EXPERIMENTAL NEUROLOGY, vol. 216, 2009, pages 177 - 183, XP025942316, DOI: doi:10.1016/j.expneurol.2008.11.017 |
| WANG Y; IMITOLA J; RASMUSSEN S; O'CONNOR KC; KHOURY SJ: "Paradoxical dysregulation of the neural stem cell pathway sonic hedgehog-Glil in autoimmune encephalomyelitis and multiple sclerosis", ANNALS OF NEUROLOGY, vol. 64, 2008, pages 417 - 427, XP055217997, DOI: doi:10.1002/ana.21457 |
| WASHINGTON R; BURTON J; TODD RF; NEWMAN W; DRAGOVIC L; DORE-DUFFY P: "Annals of neurology", vol. 35, 1994, article "Expression of immunologically relevant endothelial cell activation antigens on isolated central nervous system microvessels from patients with multiple sclerosis", pages: 89 - 97 |
| WEISHAUPT A; JANDER S; BRUCK W; KUHLMANN T; STIENEKEMEIER M; HARTUNG T; TOYKA KV; STOLL G; GOLD R: "Molecular mechanisms of high-dose antigen therapy in experimental autoimmune encephalomyelitis: rapid induction of Th1-type cytokines and inducible nitric oxide synthase", JOURNAL OF IMMUNOLOGY, vol. 165, 2000, pages 7157 - 7163 |
| YEUNG TY; SEEBERGER KL; KIN T ET AL.: "Human mesenchymal stem cells protect human islets from pro-inflammatory cytokines", PLOS ONE., vol. 7, 2012, pages E38189 |
| Z. LASZIK ET AL., BLOOD, vol. 88, 1996, pages 3010 |
| ZARBOCK A; KEMPF T; WOLLERT KC; VESTWEBER D: "Leukocyte integrin activation and deactivation: novel mechanisms of balancing inflammation", JOURNAL OF MOLECULAR MEDICINE, vol. 90, 2012, pages 353 - 359, XP035032112, DOI: doi:10.1007/s00109-011-0835-2 |
| ZARBOCK A; LOWELL CA; LEY K.: "Spleen tyrosine kinase Syk is necessary for E-selectin-induced alpha(L)beta(2) integrin-mediated rolling on intercellular adhesion molecule-1", IMMUNITY, vol. 26, 2007, pages 773 - 783 |
| ZHANG H; VUTSKITS L; CALAORA V; DURBEC P; KISS JZ: "A role for the polysialic acid-neural cell adhesion molecule in PDGF-induced chemotaxis of oligodendrocyte precursor cells", J CELL SCI, vol. 117, 2004, pages 93 - 103, XP055082345, DOI: doi:10.1242/jcs.00827 |
| ZHU H; MITSUHASHI N; KLEIN A ET AL.: "The role of the hyaluronan receptor CD44 in mesenchymal stem cell migration in the extracellular matrix.", STEM CELLS, vol. 24, 2006, pages 928 - 935 |
| ZIV Y; AVIDAN H; PLUCHINO S; MARTINO G; SCHWARTZ M: "Synergy between immune cells and adult neural stem/progenitor cells promotes functional recovery from spinal cord injury", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE UNITED STATES OF AMERICA, vol. 103, 2006, pages 13174 - 13179 |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2017201537A1 (en) * | 2016-05-20 | 2017-11-23 | Robert Sackstein | Glycoengineering of e-selectin ligands |
| WO2026010977A1 (en) * | 2024-07-01 | 2026-01-08 | Robert Sackstein | Compositions and methods for treatment of human diseases with glycocalyx-modified mesenchymal stem cells |
Also Published As
| Publication number | Publication date |
|---|---|
| JP2023156522A (ja) | 2023-10-24 |
| US10471103B2 (en) | 2019-11-12 |
| KR20230127358A (ko) | 2023-08-31 |
| EP3240893A1 (en) | 2017-11-08 |
| JP2022003094A (ja) | 2022-01-11 |
| US20230138484A1 (en) | 2023-05-04 |
| AU2022201482A1 (en) | 2022-03-24 |
| AU2015374198A1 (en) | 2017-07-27 |
| US20200281985A1 (en) | 2020-09-10 |
| SG11201705401YA (en) | 2017-08-30 |
| SG10202013095YA (en) | 2021-02-25 |
| CN107249601A (zh) | 2017-10-13 |
| JP6963500B2 (ja) | 2021-11-10 |
| BR112017014361B1 (pt) | 2023-10-31 |
| BR112017014361A2 (pt) | 2018-01-02 |
| EP4012024B1 (en) | 2025-07-30 |
| HK1245132A1 (zh) | 2018-08-24 |
| CA2972899C (en) | 2023-08-08 |
| CA2972899A1 (en) | 2016-07-07 |
| JP7339990B2 (ja) | 2023-09-06 |
| AU2015374198B2 (en) | 2021-12-23 |
| ES3051035T3 (en) | 2025-12-23 |
| CN116327805A (zh) | 2023-06-27 |
| EP4012024A1 (en) | 2022-06-15 |
| CA3202385A1 (en) | 2016-07-07 |
| EP4012024C0 (en) | 2025-07-30 |
| JP2018502117A (ja) | 2018-01-25 |
| EP3240893B1 (en) | 2021-09-01 |
| US12090173B2 (en) | 2024-09-17 |
| KR102569540B1 (ko) | 2023-08-22 |
| US20160184367A1 (en) | 2016-06-30 |
| KR20170133318A (ko) | 2017-12-05 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US12090173B2 (en) | Methods to improve cell therapy | |
| Merzaban et al. | Cell surface glycan engineering of neural stem cells augments neurotropism and improves recovery in a murine model of multiple sclerosis | |
| EP2300599B1 (en) | Augmentation of cell therapy efficacy including treatment with alpha 1-3 fucoslytransferase | |
| US20250115867A1 (en) | Augmentation of cell therapy efficacy including treatment with alpha, 1,3 fucosyltransferase | |
| AU2023202338B2 (en) | Glycoengineering of E-selectin ligands | |
| HK40076096A (en) | Methods to improve cell therapy | |
| HK40091146A (zh) | 改善细胞治疗的方法 | |
| WO2026010977A1 (en) | Compositions and methods for treatment of human diseases with glycocalyx-modified mesenchymal stem cells | |
| Merzaban et al. | Advance Access Publication Date: 7 July 2015 | |
| HK1156068B (en) | Augmentation of cell therapy efficacy including treatment with alpha 1-3 fucoslytransferase | |
| HK1156068A (en) | Augmentation of cell therapy efficacy including treatment with alpha 1-3 fucoslytransferase |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 15831197 Country of ref document: EP Kind code of ref document: A1 |
|
| ENP | Entry into the national phase |
Ref document number: 2017535420 Country of ref document: JP Kind code of ref document: A Ref document number: 2972899 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 122021011711 Country of ref document: BR |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 11201705401Y Country of ref document: SG |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01A Ref document number: 112017014361 Country of ref document: BR |
|
| REEP | Request for entry into the european phase |
Ref document number: 2015831197 Country of ref document: EP |
|
| ENP | Entry into the national phase |
Ref document number: 2015374198 Country of ref document: AU Date of ref document: 20151229 Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 20177021422 Country of ref document: KR Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 112017014361 Country of ref document: BR Kind code of ref document: A2 Effective date: 20170630 |