WO2016059239A1 - Methods and compositions for treating a subject with a smad7 antisense oligonucleotide - Google Patents
Methods and compositions for treating a subject with a smad7 antisense oligonucleotide Download PDFInfo
- Publication number
- WO2016059239A1 WO2016059239A1 PCT/EP2015/074066 EP2015074066W WO2016059239A1 WO 2016059239 A1 WO2016059239 A1 WO 2016059239A1 EP 2015074066 W EP2015074066 W EP 2015074066W WO 2016059239 A1 WO2016059239 A1 WO 2016059239A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- smad7
- day
- antisense oligonucleotide
- patient
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
- A61K31/7115—Nucleic acids or oligonucleotides having modified bases, i.e. other than adenine, guanine, cytosine, uracil or thymine
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
- A61P1/04—Drugs for disorders of the alimentary tract or the digestive system for ulcers, gastritis or reflux esophagitis, e.g. antacids, inhibitors of acid secretion, mucosal protectants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/11—Antisense
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/11—Antisense
- C12N2310/111—Antisense spanning the whole gene, or a large part of it
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/31—Chemical structure of the backbone
- C12N2310/315—Phosphorothioates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/32—Chemical structure of the sugar
- C12N2310/322—2'-R Modification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/33—Chemical structure of the base
- C12N2310/334—Modified C
- C12N2310/3341—5-Methylcytosine
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2320/00—Applications; Uses
- C12N2320/30—Special therapeutic applications
- C12N2320/34—Allele or polymorphism specific uses
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2320/00—Applications; Uses
- C12N2320/30—Special therapeutic applications
- C12N2320/35—Special therapeutic applications based on a specific dosage / administration regimen
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Definitions
- IBD Inflammatory bowel disease
- CD Crohn's disease
- UC ulcerative colitis
- CD can affect the entire gastrointestinal tract, it primarily affects the ileum (the distal or lower portion of the small intestine) and the large intestine.
- UC primarily affects the colon and the rectum.
- Current treatment for both CD and UC include aminosalicylates (e.g., 5 -aminosalicylic acid, sulfasalazine, and mesalamine), antibiotics (e.g., ciprofloxacin and metronidazole), corticosteroids (e.g., budesonide or prednisone), immunosuppressants (e.g., azathioprine or methotrexate), and tumor necrosis factor (TNF) antagonists (e.g., infliximab (Remicade ® )).
- NNF tumor necrosis factor
- TGF- ⁇ acts as a potent immunoregulator able to control mucosal intestinal inflammation.
- TGF- ⁇ binds a heterodimeric transmembrane serine/threonine kinase receptor containing two subunits, TGF- ⁇ Rl and TGF- ⁇ R2.
- TGF- ⁇ Rl receptor Upon ligand binding, the TGF- ⁇ Rl receptor is phosphorylated by the constitutively active TGF- ⁇ R2 receptor and signal is propagated to the nucleus by proteins belonging to the SMAD family.
- SMAD7 SMAD7
- TGF- ⁇ Rl Activated TGF- ⁇ Rl directly phosphorylates SMAD2 and SMAD3 proteins, which then interact with SMAD4.
- SMAD7 another SMAD protein, SMAD7, also plays a role in inflammation.
- SMAD7 an intracellular protein, has been shown to interfere with binding of SMAD2/SMAD3 to the TGF- ⁇ Rl , preventing phosphorylation and activation of these proteins.
- increased expression of SMAD7 protein is associated with an inhibition of TGF- ⁇ mediated-signaling.
- Mucosal samples from IBD patients are characterized by high levels of SMAD7 and reduced levels of phosphorylated-SMAD3 indicating that TGF- ⁇ -mediated signaling is compromised in these patients.
- the present invention is based on the development of methods for treating patient having inflammatory bowel disease using antisense therapeutics directed against SMAD7 that are tailored to the particular polymorphic form(s) of SMAD7 present in the patient.
- SMAD7 single nucleotide polymorphism
- the presence of a single nucleotide polymorphism that is present within nucleotides 108-128 of the coding sequence of SMAD7, which corresponds to the region of the SMAD7 mRNA targeted by the antisense therapeutic Mongersen, can make it desirable to target this region using a modified form of Mongersen that includes the polymorphism.
- the present invention features methods for treating subjects having polymorphism(s) in the SMAD7 mRNA sequence using an antisense therapeutic having a sequence specific for (e.g., matches exactly) the polymorphic gene sequence.
- the invention also features antisense oligonucleotides that include the
- the invention features a method for treating or managing inflammatory bowel disease (IBD; e.g., Crohn's disease (CD) or ulcerative colitis (UC)) in a patient having IBD that carries at least one copy of a first polymorphic form of SMAD7 that differs from the consensus SMAD7 nucleotide sequence.
- the method includes administering to said patient an effective amount of a first SMAD7 antisense oligonucleotide that specifically targets said first polymorphic form of SMAD7.
- the polymorphic form of SMAD7 may include a single nucleotide polymorphism (SNP) and/or may include a polymorphism listed in Table 1 or in Table 2.
- the first polymorphic form may include a polymorphism in the region corresponding to nucleic acid positions 108-128 of SEQ ID NO: 1 (e.g. , an adenosine ("A") or a guanine ("G") at position 1 14 of SEQ ID NO: 1); for example, where the polymorphic form includes the nucleic acid sequence of SEQ ID NO: 9 (5'-GCTGCGG4GAGAAGGGGCGAC -3 ').
- the first polymorphic form may include the nucleic acid sequence of SEQ ID NO:3 (5 '- GCTGCGGGGAGAAGGGGCGAC -3 ').
- the first SMAD7 antisense oligonucleotide includes the nucleotide sequence of SEQ ID NO: 1 1 (5 '-
- GTCGCCCCTTCTCICCGCAGC-3 ' for example, where the first SMAD7 antisense oligonucleotide is an antisense oligonucleotide phosphorothioate including the following sequence: 5 '-GTXGCCCCTTCTCICXGCAGC-3 ' (SEQ ID NO: 13) where X is 5-methyl- 2'-deoxycytidine and where all internucleotide linkages are phosphorothioate linkages.
- the first SMAD7 antisense oligonucleotide includes the nucleotide sequence of SEQ ID NO:5 (5 '-GTCGCCCCTTCTC CCGCAGC-3 '), for example, where the first SMAD7 antisense oligonucleotide is an antisense oligonucleotide phosphorothioate including the following sequence: 5 '-GTXGCCCCTTCTC CXGCAGC-3 ' (SEQ ID NO: 7) where X is 5-methyl-2'-deoxycytidine and where all internucleotide linkages are phosphorothioate linkages.
- the invention features a method for treating or managing IBD (e.g., CD or UC) in a patient having IBD.
- the method includes (a) analyzing the presence or absence of one or more SMAD7 polymorphic forms in the patient; and (b) administering one or more SMAD7 antisense oligonucleotides to the patient, based on the presence or absence of said polymorphic forms, where: (i) if a first SMAD7 polymorphic form (e.g., the wild type form) is present in the patient, then administering to the patient a first SMAD7 antisense oligonucleotide targeting the first SMAD7 polymorphic form; or (ii) if a second SMAD7 polymorphic form is present in the patient, then administering to the patient a second
- IBD e.g., CD or UC
- the polymorphism can include an SNP and/or can include a polymorphism listed in Table 1 or in Table 2.
- the first polymorphism can occur in the region corresponding to nucleic acid positions 108-128 of SEQ ID NO: 1 (e.g., where the first SMAD7 polymorphic variant includes a guanine ("G") at position 1 14 of SEQ ID NO: 1).
- the second SMAD7 can occur in the region corresponding to nucleic acid positions 108-128 of SEQ ID NO: 1 (e.g., where the first SMAD7 polymorphic variant includes a guanine ("G") at position 1 14 of SEQ ID NO: 1).
- G guanine
- the polymorphic form can include an adenine ("A") at position 1 14 of SEQ ID NO: 1.
- the first SMAD7 polymorphic form includes the nucleic acid sequence of SEQ ID NO:3 (5 '-GCTGCGGGGAGAAGGGGCGAC -3 ').
- the first SMAD7 antisense oligonucleotide includes the nucleotide sequence of SEQ ID NO:5 (5 '- GTCGCCCCTTCTC CCGCAGC-3 '), for example, where the first SMAD7 antisense oligonucleotide is an antisense oligonucleotide phosphorothioate including the following sequence: 5 '-GTXGCCCCTTCTCCCXGCAGC-3 ' (SEQ ID NO:7) where X is 5-methyl-2'- deoxycytidine and where all internucleotide linkages are phosphorothioate linkages.
- the second SMAD7 polymorphic form includes the nucleic acid sequence of SEQ ID NO:9 (5 '-GCTGCGG4GAGAAGGGGCGAC-3 ').
- the second SMAD7 antisense oligonucleotide includes the nucleotide sequence of SEQ ID NO: 1 1 (5 '-GTCGCCCCTTCTCJCCGCAGC-3 '), for example, where the second SMAD7 antisense oligonucleotide is an antisense oligonucleotide phosphorothioate including the sequence 5 '-GTXGCCCCTTCTCICXGCAGC-3 ' (SEQ ID NO: 13) where X is 5- methyl-2'-deoxycytidine and where all internucleotide linkages are phosphorothioate linkages.
- the presence or absence of the one or more SMAD7 polymorphic forms may be analyzed by DNA sequencing, by gene-expression profiling, using next-generation sequencing, or using gene expression microarray analysis.
- the presence or absence of the one or more SMAD7 polymorphic forms may be analyzed in a sample (e.g., a liquid, a biopsy sample, or a tissue sample) obtained from the patient.
- the first and/or the second SMAD7 antisense oligonucleotide may be administered to the patient having IBD at a dose of between 10 mg/day to about 300 mg/day, for example, at a dose of about 10 mg/day, 20 mg/day, about 30 mg/day, about 40 mg/day, about 50 mg/day, about 60 mg/day, about 70 mg/day, about 80 mg/day, about 90 mg/day, about 100 mg/day, about 1 10 mg/day, about 120 mg/day, about 130 mg/day, about 140 mg/day, about 150 mg/day, about 160 mg/day, about 170 mg/day, about 180 mg/day, about 190 mg/day, about 200 mg/day, about 210 mg/day, about 220 mg/day, about 230 mg/day, about 240 mg/day, about 250 mg/day, about 260 mg/day, about 270 mg/day, about 280 mg/day, about 290 mg/day, or about 300 mg
- the first and/or the second SMAD7 antisense oligonucleotide is administered at a dose of about 40 mg/day, about 80 mg/day, or about 160 mg/day.
- the invention features: (a) a SMAD7 antisense oligonucleotide that includes the nucleotide sequence of SEQ ID NO: l 1 , (b) a SMAD7 antisense
- oligonucleotide that includes the nucleotide sequence of SEQ ID NO: 13, where X is a nucleotide including 5-methyl-2'-deoxycytidine and where all internucleotide linkages are phosphorothioate linkages; or (c) a SMAD7 antisense oligonucleotide that includes the nucleotide sequence of SEQ ID NO: 13, where X is 5-methyl-2'-deoxycytidine, or a complement thereof.
- the SMAD7 antisense oligonucleotide may include at least one internucleotide linkage that is a phosphorothioate linkage, e.g., where all internucleotide linkages are phosphorothioate linkages.
- the oligonucleotide may have 2'- deoxyribonucleotides replaced by corresponding ribonucleotides.
- the invention also features a pharmaceutical composition (e.g., a composition suitable for oral administration) including the SMAD7 antisense oligonucleotide and a pharmaceutically acceptable adjuvant and/or excipient.
- the invention features a method of treating IBD (e.g., CD or UC), including administering (e.g., orally) to a patient in need thereof an effective amount of the SMAD7 antisense oligonucleotide of the previous aspect, where the SMAD7 antisense oligonucleotide is effective to treat IBD.
- IBD e.g., CD or UC
- Antisense oligonucleotides are short synthetic oligonucleotide sequences that are complementary to a messenger RNA (mRNA) transcribed from a target gene (e.g. , a polymorphic form of SMAD7).
- Antisense oligonucleotide sequences hybridize to the mRNA and produce a double-strand hybrid that can lead to the activation of ubiquitary catalytic enzymes, such as RNase H, which degrades DNA/RNA hybrid strands, thus preventing protein translation.
- an antisense oligonucleotide provided herein can hybridize to its target sequence as RNA or DNA. Thus, even if a DNA sequence is provided as target, the corresponding RNA sequence (including uracil instead of thymine) is included.
- the present invention provides an antisense therapeutic directed against SMAD7 as described above for use as a medicament.
- the present invention provides an antisense therapeutic directed against SMAD7 which has been tailored to the particular polymorphic form(s) of SMAD7 present in the patient, for use in a method for treating patient having inflammatory bowel disease.
- the presence of a single nucleotide polymorphism that is present within nucleotides 108-128 of the coding sequence of SMAD7, which corresponds to the region of the SMAD7 mRNA targeted by the antisense therapeutic Mongersen, can make it desirable to target this region using a modified form of Mongersen that includes the polymorphism.
- the present invention also provides an antisense therapeutic for use in a method for treating subjects having polymorphism(s) in the SMAD7 mR A sequence, said antisense therapeutic having a sequence specific for (e.g., matches exactly) the polymorphic gene sequence.
- the present invention also provides a SMAD7 antisense oligonucleotide for use in a method for treating or managing inflammatory bowel disease (IBD; e.g., Crohn's disease (CD) or ulcerative colitis (UC)) in a patient having IBD that carries at least one copy of a first polymorphic form of SMAD7 that differs from the consensus SMAD7 nucleotide sequence.
- IBD inflammatory bowel disease
- CD Crohn's disease
- UC ulcerative colitis
- the SMAD7 antisense oligonucleotide specifically targets said first polymorphic form of SMAD7.
- the polymorphic form of SMAD7 may include a single nucleotide polymorphism (SNP) and/or may include a polymorphism listed in Table 1 or in Table 2 or as listed in paragraph [0007].
- the present invention also provides a SMAD7 antisense oligonucleotide for use in a method of treating or managing inflammatory bowel disease (IBD; e.g., Crohn's disease (CD) or ulcerative colitis (UC)) in a patient having IBD.
- IBD inflammatory bowel disease
- CD Crohn's disease
- UC ulcerative colitis
- the method(a) analyzing the presence or absence of one or more SMAD7 polymorphic forms in the patient; and (b) administering one or more SMAD7 antisense oligonucleotides to the patient, based on the presence or absence of said polymorphic forms, where: (i) if a first SMAD7 polymorphic form (e.g., the wild type form) is present in the patient, then administering to the patient a first SMAD7 antisense oligonucleotide targeting the first SMAD7 polymorphic form; or (ii) if a second SMAD7 polymorphic form is present in the patient, then administering to the patient a second SMAD7 antisense oligonucleotide targeting the second SMAD7
- a first SMAD7 polymorphic form e.g., the wild type form
- the polymorphism can include an SNP and/or can include a polymorphism listed in Table 1 or in Table 2 or as listed in paragraph [0008].
- the invention provides an effective amount of the SMAD7 antisense oligonucleotide as described above for use in a method of treating IBD (e.g., CD or UC),wherein said method includes administering (e.g., orally) to a patient in need thereof an effective amount of the SMAD7 antisense oligonucleotide, where the SMAD7 antisense oligonucleotide is effective to treat IBD.
- An antisense oligonucleotide that "specifically targets" a polymorphic form of a gene that differs from a consensus sequence includes a nucleotide sequence with a substitution, relative to the gene or transcript consensus sequence, that increases
- the "consensus" SMAD7 nucleotide sequence means the RNA sequence or DNA sequences associated with the "wild-type" sequence of a gene described in the reference databases.
- consensus sequences for SMAD7 can be found under Accession numbers NM_005904.3 , NM_001190821.1, NM_001190822.1 , and NM_001190823.1, which are reference transcripts for human SMAD7 in the National Center for Biotechnology Information (NCBI) database.
- NCBI National Center for Biotechnology Information
- treating is meant reducing at least one symptom associated with the disease or condition being treated.
- management generally mean controlling the severity or manifestation of symptoms of a disease, or the means of treating the disease. Generally, management is used to obtain a desired
- the effect may be therapeutic in terms of partially or completely curing a disease and/or adverse effect attributed to the disease or ensuring that a particular symptom or manifestation of the disease does not occur or reoccur in a patient or does not rise to an undesirable or intolerable level in a patient.
- management covers any management of a disease in a mammal, particularly a human, and includes: (a) inhibiting the disease, i.e., preventing the disease from increasing in severity or scope; (b) relieving the disease, i.e., causing partial or complete amelioration of the disease; or (c) preventing relapse of the disease, e.g., preventing the disease from returning to an active state following previous successful treatment of symptoms of the disease or treatment of the disease. "Management” as used herein may also be used with reference to administration of a specific treatment for the disease, for example, a SMAD7 antisense oligonucleotide.
- a "subject” or “patient” as described herein refers to any animal at risk for, suffering from or diagnosed for IBD, including, but not limited to, mammals, primates, and humans.
- the subject may be a non-human mammal such as, for example, a cat, a dog, or a horse.
- the subject is a human subject.
- a subject may be an individual diagnosed with a high risk of developing IBD, someone who has been diagnosed with IBD, someone who previously suffered from IBD, or an individual evaluated for symptoms or indications of IBD, for example, a high CDAI index score.
- a patient with IBD refers to a patient suffering from any of the symptoms or manifestations of IBD, a patient who may suffer from any of the symptoms or manifestations of IBD, or any patient who might benefit from a method of the invention for treating or evaluating treatment for IBD.
- a patient in need may include a patient who is diagnosed with a risk of developing IBD, a patient who has suffered from IBD in the past, or a patient who has previously been treated for IBD. Of particular relevance are individuals that suffer from IBD associated with increased levels of CRP, TNFa, and/or IL8 expression.
- the patient with IBD is a Crohn's disease (CD) patient.
- the patient with IBD is an ulcerative colitis (UC) patient.
- CDAI Crohn's Disease Activity Index
- CDAI scores of 150 or below are generally associated with inactive disease and are indicative of better prognosis than higher scores. Values above 150 are generally associated with active disease and values above 450 are associated with extremely severe disease.
- CDAI scores may be used to determine how well a patient is responding to therapy and may be used to identify patients in remission. In certain embodiments, a benchmark clinical response means that the subject displays a decrease in CDAI score by at least 100 points. In a clinical trial, a CDAI score of 150 or below is generally associated with remission.
- UCDAI Ultra Colitis Disease Activity Index
- the UCDAI is a series of qualifiers about the symptoms of UC including stool frequency, rectal bleeding, the appearance of the colon lining, and a physician's rating of disease activity. Each of these qualifiers is given a number from 0 to 3, with 3 being the highest disease activity. In a clinical trial, remission is often defined as a UCDAI score of 1 or less, and improvement is a reduction of 3 or more points from the score at the beginning of the trial.
- UCDAI may be used in clinical trials to determine how well a patient is responding to therapy and may be used to identify patients in remission.
- Other commonly used indices for measuring disease severity in UC patients include the Truelove and Witts Index, the St. Mark's Index, the Simple Clinical Colitis Activity Index (SCCAI), the Lichtiger Index, the Ulcerative Colitis Symptom Score (UCSS), and the Mayo Clinic Score.
- SMAD7 also known as CRCS3, FLJ16482, MADH7, MADH8, MAD (mothers against decapentaplegic, Drosophila) homo log 7, MAD homolog 8, SMAD, mothers against DPP homolog 7, mothers against DPP homolog 8
- SMAD7 means the human protein or any of the mRNA transcripts encoded by the gene identified by Entrez GenelD No. 4092 and allelic variants thereof.
- CRP C-reactive protein, pentraxin-related
- Pentraxin means the human protein or any of the mRNA transcripts encoded by the gene identified by Entrez GenelD No. 1401 and allelic variants thereof.
- IL8 also known as Interleukin-8 (IL-8); Tumor Necrosis Factor- Induced Gene 1; NAF; Granulocyte Chemotactic Protein 1 (GCPl); LECT; LUCT; Protein 3- 10C; Beta-Thromboglobulin-Like Protein; Neutrophil- Activating Peptide 1; Neutrophil- Activating Protein 1 (NAP1; NAP-1); Emoctakin; GCP-1; LYNAP; Lymphocyte Derived Neutrophil Activating Peptide; Lung Giant Cell Carcinoma-Derived Chemotactic Protein; Small Inducible Cytokine Subfamily B, Member 8; Beta Endothelial Cell-Derived Neutrophil Activating Peptide; Monocyte-Derived Neutrophil Chemotactic Factor (MDNCF);
- MDNCF Monocyte-Derived Neutrophil Chemotactic Factor
- MONAP Monocyte-Derived Neutrophil- Activating Peptide
- Chemotactic Factor I means the human protein or any of the mRNA transcripts encoded by the gene identified by Entrez GenelD No. 3576 and allelic variants thereof.
- TNFa also known as Tumor Necrosis Factor, DIF, Tumor
- Necrosis Factor Ligand Superfamily Member 2 (TNFSF2), APCl Protein, cachectin, Tumor Necrosis Factor A (TNFA), Tumor Necrosis Factor-a (TNF-a), and Tumor Necrosis Factor- alpha (TNF-alpha)) means the human protein or any of the mRNA transcripts encoded by the gene identified by Entrez GenelD No. 7124 and allelic variants thereof.
- the present invention relates to methods for treating inflammatory bowel disease (IBD; e.g., Crohn's disease and ulcerative colitis) in patients that have a polymorphic form of the SMAD7 gene.
- IBD inflammatory bowel disease
- This approach uses antisense oligonucleotides specifically designed to target the SMAD7 transcripts containing the polymorphism, thus allowing for targeting those patient with greater efficacy. This approach is explained in greater detail below.
- the methods and antisense oligonucleotides of the invention can target any SMAD7 polymorphism.
- the targeted polymorphisms are present in the mRNA sequence.
- SNPs found in the SMAD7 mRNA include those listed in Table 1. Although the sequences of the SMAD7 SNPs in Table 1 are shown as DNA sequences, the skilled artisan will appreciate that hybridization in a cell can occur with RNA, which contains uracil (U) instead of thymine (T). SNPs within the SMAD7 coding sequence are listed in Table 2.
- the presence of a SMAD7 polymorphic variant can be accomplished using any method known in the art. In general, presence is detected in a sample taken from the patient. Identification of the presence of a SMAD7 polymorphism in a patient can be accomplished using standard techniques, including hybridization-based techniques, sequencing techniques, and array-based techniques.
- the determination of the presence of a SMAD7 polymorphic variant can be detected in any biological sample and can be any specimen obtained from a patient or test subject that contains a nucleic acid (e.g., genomic DNA or RNA) that encodes SMAD7.
- exemplary samples include a tissue biopsy, cell, bodily fluid (e.g., blood, serum, plasma, semen, urine, saliva, amniotic fluid, or cerebrospinal fluid).
- Hybridization approaches include dynamic allele-specific hybridization (Howell et al., Nat. Biotechnol. 17:87, 1999). This approach relies on differential melting temperatures between the sequence containing the polymorphism as compared to the sequence without the polymorphism. Briefly, a DNA region of interest is amplified by PCR using a biotintylated primer. The resulting PCR product is attached to a streptavidin support and is hybridized to an allele-specific probe in the presence of a DNA duplex-binding fluorescent molecule. The duplex is heated, and the temperature at which the duplex denatures is determined based on loss of fluorescence. The denaturation temperature is determinative of the presence or absence of the polymorphism.
- Another hybridization approach for identifying the presence of SNPs is the use of nucleic acid arrays designed for this purpose.
- the Genome- Wide Human SNP Array 6.0 (Affymetrix, Part # 901182) can be used to detect the presence of certain SNPs in samples taken from a patient.
- Still other approaches for identification of SNP include sequence approaches. As high throughput genomic screening (e.g., so-called "next-generation” sequencing) becomes technologically feasible, such approaches can also be used to identify the presence of SNPs within a patient. These approaches include single-molecule real time sequencing ( Pacific Biosciences), ion semiconductor (Ion Torrent Sequencing; Life Technologies),
- the antisense oligonucleotide can be administered to any patient for which a decrease in SMAD7 activity is desirable. Because SMAD7 is known to be associated with inflammation in inflammatory bowel disorders such as ulcerative colitis and Crohn's disease, it can be beneficial to reduce SMAD7 activity in such patients. [0038]
- the compositions and methods of the invention can be used to treat patients that are steroid-resistant, patients that are steroid-dependent, or patients that are resistant to another anti-SMAD7 therapy (e.g., resistant to treatment with an oligonucleotide that has a nucleotide mismatch relative to at least one of the corresponding nucleotides present in a patient's genome).
- the patient is a subject identified as having altered levels of a bio marker that is associated with IBD or with inflammation.
- the patient may have elevated levels of interleukin-8 (IL-8), tumor necrosis factor-a (TNF-a), or C-reactive protein (CRP) relative to a normal control or a normal control value.
- IL-8 interleukin-8
- TNF-a tumor necrosis factor-a
- CRP C-reactive protein
- a patient is selected if the patient shows some likelihood of responsiveness to anti-SMAD7 therapy.
- Likelihood of responsiveness to anti- SMAD7 therapy is premised in part on determining levels of CRP, TNFa, and/or IL8 in a patient with IBD, for example, preexisting levels of CRP, TNFa, and/or IL8 (i.e., levels of CRP, TNFa, and/or IL8 in a patient prior to administration of an initial dose of a SMAD7 antisense oligonucleotide) or levels of CRP, TNFa, and/or IL8 determined after an initial dose or one or more subsequent doses of SMAD7 antisense oligonucleotide.
- preexisting levels of CRP, TNFa, and/or IL8 i.e., levels of CRP, TNFa, and/or IL8 in a patient prior to administration of an initial dose of a SMAD7 antisense oligonucleotide
- levels of CRP, TNFa, and/or IL8 determined after an
- a patient will be selected for treatment or further treatment with a SMAD7 antisense oligonucleotide after detecting or analyzing absolute or relative CRP, TNFa, and/or IL8 levels or changes in CRP, TNFa, and/or IL8 levels.
- Levels of CRP, TNFa, and/or IL8 in a patient with IBD may be compared to a normal level of CRP, TNFa, and/or IL8, for example, normal levels of CRP, TNFa, and/or IL8 as defined by median CRP, TNFa, and/or IL8 levels in a matched control group or absolute levels of CRP, TNFa, and/or IL8.
- a patient is selected for treatment with anti- SMAD-7 therapy if the CRP level in the blood is greater than 3.0 mg/ml, greater than 3.5 mg/ml, or greater than 4.0 mg/ml
- a patient will be selected for treatment or further treatment with a SMAD7 antisense oligonucleotide if the levels of CRP, TNFa, and/or IL8 in the patient are more than 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% elevated relative to the average, median or mean levels of CRP, TNFa, and/or IL8 in a matched control group.
- a patient will be selected for treatment or further treatment with a SMAD7 antisense oligonucleotide if the level of CRP, TNFa, and/or IL8 in the patient are more than 2-fold, more than 3-fold, more than 4-fold, more than 5-fold, more than 6-fold, more than 7-fold, more than 8-fold, more than 9-fold or more than 10-fold elevated relative to the average, median or mean levels of CRP, TNFa, and/or IL8 in a matched control group.
- CRP, TNFa, and/or IL8 levels will be measured in terms of a
- concentration for instance, mass of CRP, TNFa, and/or IL8 protein, peptide, or RNA per volume of sample, for example, volume of blood or tissue.
- selection of patients for initial or continued treatment may be tied to CRP, TNFa, and/or IL8 levels in the patient, such that, for example, high initial levels of CRP, TNFa, and/or IL8 may indicate a potential for responsiveness to SMAD7 antisense oligonucleotide treatment.
- high levels of CRP, TNFa, and/or IL8 may indicate a need for increased doses of SMAD7 antisense oligonucleotide
- normal or below normal levels of CRP, TNFa, and/or IL8 may indicate a need for decreased or unchanged doses of SMAD7 antisense oligonucleotide, especially following one or more doses.
- continued levels of above normal levels of CRP, TNFa, and/or IL8 after repeated doses may indicate that the patient is not responsive to treatment.
- a control level of CRP, TNFa, and/or IL8 may be determined by determining the level of CRP, TNFa, and/or IL8 protein or mRNA transcript in a sample (e.g., a blood sample) obtained from the subject prior to treatment with an anti-SMAD7 therapy.
- the control level of CRP, TNFa, and/or IL8 may provide a baseline for monitoring a subject's response to treatment.
- a control sample may be obtained from the subject on the day the anti-SMAD7 therapy is first administered (e.g., Day 1 of a treatment regimen), for example, immediately after administration of at least one anti-SMAD7 therapy.
- a control sample may be obtained from a subject one day prior to the start of an anti-SMAD7 therapy (e.g., Day 0 of a treatment regimen).
- a control sample may be obtained from a subject 2, 3, 4, 5, 6, 7, or more days prior to the start of an anti-SMAD7 therapy.
- the increase or decrease in IL8 concentration may be measured prior to treatment (e.g., in a control sample), during treatment, and/or after treatment to monitor a subject's response to therapy, e.g., an anti-SMAD7 therapy.
- a control level may be established for a subject based on long-term monitoring of circulating CRP, TNFa, and/or IL8 concentration in the subject.
- a subject may undergo multiple rounds of treatment with an anti-SMAD7 therapy.
- the circulating CRP, TNFa, and/or IL8 concentration detected following multiple rounds of treatment may be compared to a prior control level of CRP, TNFa, and/or IL8 for the subject to determine whether the subject has responded to therapy and/or is likely to respond to further treatment with an anti-SMAD7 therapy.
- a control or baseline level for a subject may be established based on an average measurement of a circulating CRP, TNFa, and/or IL8 concentration determined from multiple baseline samples obtained over time (e.g., obtained over the course of days, weeks, months, or years). Accordingly, any test or assay conducted as disclosed herein may be compared with a previous or established control level and it may not be necessary to obtain a new control sample from the subject for comparison, e.g., if the subject is receiving more than one round of treatment with an anti-SMAD7 therapy.
- Normal levels of CRP, TNFa, and/or IL8 may be determined based on numerical reference values or with respect to levels of CRP, TNFa, and/or IL8 in a healthy control group.
- normal levels of CRP, TNFa, and/or IL8 are defined as median levels of CRP, TNFa, and/or IL8 in a healthy control group.
- a healthy control group may be defined based on various criteria related to genetic background, habits, and physical attributes matched to the same set of criteria in the patient. For instance, in some embodiments, the healthy control group and the patient having IBD are matched with respect to age, gender, ethnic origin, smoking habits, dietary habits, body-mass index (BMI), recreational drug use, medical drug use, drug use related to IBD, and/or exercise habits.
- BMI body-mass index
- Other factors that can be matched between the patient and control group include, but are not limited to, clinical criteria (e.g., CDAI score, Mayo score, severity of IBD-related symptoms), metabolism, IBD patient's personal disease history, genetic factors, IBD patient's family disease history, exposure to environmental factors (e.g., pollutants, toxins, allergens), and life-style (e.g., urban, suburban, or rural place of work and/or domicile).
- clinical criteria e.g., CDAI score, Mayo score, severity of IBD-related symptoms
- metabolism e.g., IBD patient's personal disease history, genetic factors, IBD patient's family disease history, exposure to environmental factors (e.g., pollutants, toxins, allergens), and life-style (e.g., urban, suburban, or rural place of work and/or domicile).
- control group is the patient receiving a treatment with an SMAD7 antisense oligonucleotide prior to receiving an initial dose of the SMAD7 antisense oligonucleotide.
- patient is a treatment naive patient.
- the anti-SMAD7 antisense oligonucleotides used in the methods and compositions described herein are specifically targeted to the patient's specific SMAD7 sequence (e.g., containing one or more polymorphisms).
- the SMAD7 antisense oligonucleotide may incorporate a sequence that corresponds to the presence of any polymorphism in SMAD7, e.g., a polymorphism detected in a patient.
- the polymorphism may include any of those described in the SMAD7 transcript (see, e.g., Table 1) or in the SMAD7 coding region (see, e.g., Table 2).
- the SMAD7 oligonucleotide sequence is that of Mongersen (SEQ ID NO:7).
- This sequence targets nucleic acids 108-128 of the SMAD7 coding sequence (SEQ ID NO: l, which corresponds to nucleotides 396-416 of the mR A transcript of Accession number NM 005904.3).
- This region contains SNP rsl44204026, which involves a G ⁇ A substitution.
- an antisense oligonucleotide containing the corresponding polymorphism in its sequence can be used (e.g., SEQ ID NOS : 10- 13).
- Antisense oligonucleotides provided herein can increase efficacy in reducing SMAD7 expression relative to an oligonucleotide that lacks the exact corresponding sequence.
- the patient is heterozygous for a polymorphism (i.e., has one copy of the SMAD7 gene that contains the polymorphism such as SNP rs 144204026 and one copy of the SMAD7 containing the consensus sequence) within the antisense sequence
- a combination of antisense oligonucleotides either as a mixture or in two separate compositions, one that corresponds to the consensus sequence (e.g., SEQ ID NO: 1 and NM 005904.3) and one that corresponds to the sequence containing the consensus sequence.
- polymorphism e.g., SEQ ID NOS:9 and 10
- SEQ ID NOS:9 and 10 The appropriate oligonucleotide or
- combination of oligonucleotides for any particular patient can be determined based on whether the patient in question is carrier of the polymorphism. Identification of the presence (or absence) of any polymorphism can be achieved, for example, using any of the methods described herein.
- oligonucleotides targeting a consensus sequence e.g., the SMAD7 antisense oligonucleotide including the nucleotide sequence of SEQ ID NO:7
- SMAD7 antisense oligonucleotide including the nucleotide sequence of SEQ ID NO:7 can be administered to a patient that is homozygous or heterozygous for a SMAD7 polymorphism lacking the exact corresponding target sequence of the antisense oligonucleotide, e.g., the SMAD7 antisense oligonucleotide including the nucleotide sequence of SEQ
- oligonucleotides e.g., the SMAD7 antisense oligonucleotide including the nucleotide sequence of SEQ ID NO:7, can reduce the expression of SMAD7 polymorphic forms lacking the exact corresponding target sequence of the antisense oligonucleotide.
- an anti-SMAD7 antisense oligonucleotide may target site 403, 233, 294, 295, 296, 298, 299, and/or 533 ⁇ i.e., nucleotides 403, 233, 294, 295, 296, 298, 299, and 533, respectively) of the human SMAD7 mRNA (e.g., NCBI Reference
- oligonucleotides targeting nucleotide 403 can be designed to incorporate the rs 144204026 polymorphism.
- oligonucleotides that target sites 294, 295, 296, 298, or 299 may target the SMAD7 mRNA containing the rs374325868 polymorphism at position 277 of the transcript.
- the antisense oligonucleotide targeting SMAD7 may comprise a mixed-backbone wherein the cytosine residues in a CpG pair are replaced by 5 '-methylcytosine (abbreviated as Me-dC). Methylphosphonate linkages may also be placed at the 5' and/or 3' ends of an antisense oligonucleotide (abbreviated as MeP).
- Exemplary antisense oligonucleotide therapies that target polymorphic forms of SMAD7 include, but are not limited to 5 '-GTXYCCCCTTCTCJCXYCAGC-3 ' (SEQ ID NO:21), wherein X is a nucleotide comprising a nitrogenous base selected from the group consisting of cytosine and 5-methylcytosine or a 2'-0-methylcytosine nucleotide, and wherein Y is a nucleotide comprising a nitrogenous base selected from the group consisting of guanine and 5-methylguanine or a 2'-0-methylguanine nucleotide, optionally provided that at least one of the nucleotides X or Y comprises a methylated nitrogenous base;
- Disclosed therapies may, when administered orally to a subject suffering from IBD, deliver an effective amount of an antisense oligonucleotide to the intestinal system of a patient, e.g., deliver an effective amount of an antisense oligonucleotide to the terminal ileum and/or right colon of a patient.
- Contemplated antisense oligonucleotides include those comprising SEQ ID NO:5 or SEQ ID NO: l l : 5'-GTC* GCC CCT TCT C(C/T)C C*GC AGC-3', where C* represents 5-methyl-2'-deoxycytidine.
- at least one of the internucleotide linkages of a contemplated antisense oligonucleotide is an 0,0-linked phosphorothioate, for example, each of the 20 internucleotide linkages of SEQ ID NO: 5 may be an O, O- linked phosphorothioate.
- the contemplated antisense oligonucleotide is an antisense oligonucleotide comprising SEQ ID NO: 7 or 13, wherein each of the 20 internucleotide linkages is an ⁇ , ⁇ - linked phosphorothioate linkage.
- contemplated antisense oligonucleotide is an antisense oligonucleotide comprising SEQ ID NO:7, wherein each of the 20 internucleotide linkages is an 0,0-linked phosphorothioate linkage, referred to herein as "Mongersen.”
- contemplated compositions disclosed herein may include a pharmaceutically acceptable salt, e.g., a sodium salt of the antisense oligonucleotide of SEQ ID NOs:5, 7, 11 or 13, that optionally may include 1 to 20 ⁇ , ⁇ - linked phosphorothioate internucleotide linkages.
- Contemplated salts of oligonucleotides include those that are fully neutralized, e.g., each phosphorothioate linkage is associated with an ion such as Na + .
- Oligonucleotides may include naturally occurring nucleobases, sugars, and covalent internucleotide (backbone) linkages as well as non-naturally occurring portions.
- Table 3 lists the target sequences of exemplary SMAD7 antisense oligonucleotides and the regions in the SMAD7 coding sequence of SEQ ID NO: 1 that are targeted by the SMAD7 antisense oligonucleotides.
- Target sequences are shown as DNA target sequences. However, the corresponding RNA target sequences can also be targeted by the listed SMAD7 antisense oligonucleotides of Table 3.
- compositions containing an antisense oligonucleotide against SMAD7 can be presented in a dosage unit form and can be prepared by any suitable method.
- a pharmaceutical composition should be formulated to be compatible with its intended route of administration.
- Useful formulations can be prepared by methods well known in the pharmaceutical art. For example, see Remington 's
- compositions preferably are sterile. Sterilization can be accomplished, for example, by filtration through sterile filtration membranes. Where the composition is lyophilized, filter sterilization can be conducted prior to or following lyophilization and reconstitution.
- the anti-SMAD7 therapy may be suitable for oral delivery, e.g., tablets, that include an enteric coating, e.g., a gastro -resistant coating, such that the compositions may deliver the antisense compound to, e.g., the terminal ileum and right colon of a patient.
- an enteric coating e.g., a gastro -resistant coating
- such administration may result in a topical effect, substantially topically applying the antisense compound directly to an affected portion of the intestine of a subject.
- Such administration may, in some embodiments, substantially avoid unwanted systemic absorption of the antisense compound.
- a tablet for oral administration may comprise granules ⁇ e.g., is at least partially formed from granules) that include a disclosed antisense compound, e.g., the SMAD7 antisense oligonucleotides provided herein, and pharmaceutically acceptable excipients.
- a tablet may be coated with an enteric coating.
- Contemplated tablets may include pharmaceutically acceptable excipients such as fillers, binders, disintegrants, and/or lubricants, as well as coloring agents, release agents, coating agents, sweetening, flavoring such as wintergreen, orange, xylitol, sorbitol, fructose, and maltodextrin, and perfuming agents, preservatives and/or antioxidants.
- contemplated pharmaceutical formulations include an mtragranular phase that includes a contemplated antisense compound or a pharmaceutically acceptable salt, e.g., the SMAD7 antisense oligonucleotides provided herein, and a pharmaceutically acceptable filler.
- a SMAD7 antisense oligonucleotide provided herein and a filler may be blended together, with optionally other excipients, and formed into granules.
- the intragranular phase may be formed using wet granulation, e.g., a liquid ⁇ e.g., water) is added to the blended antisense compound and filler, and then combination is dried, milled and/or sieved to produce granules.
- wet granulation e.g., a liquid ⁇ e.g., water
- contemplated formulations include an extra-granular phase, which may include one or more pharmaceutically acceptable excipients, and which may be blended with the intragranular phase to form a disclosed formulation.
- An anti-SMAD7 therapy formulation may include an intragranular phase that includes a filler.
- exemplary fillers include, but are not limited to, cellulose, gelatin, calcium phosphate, lactose, sucrose, glucose, mannitol, sorbitol, microcrystalline cellulose, pectin, polyacrylates, dextrose, cellulose acetate, hydroxypropylmethyl cellulose, partially pregelatinized starch, calcium carbonate, and others including combinations thereof.
- an anti-SMAD7 therapy formulation may include an intragranular phase and/or an extragranular phase that includes a binder, which may generally function to hold the ingredients of the pharmaceutical formulation together.
- binders include invention may be, but are not limited to, the following: starches, sugars, cellulose or modified cellulose such as hydroxypropyl cellulose, lactose, pregelatinized maize starch, polyvinyl pyrrolidone, hydroxypropyl cellulose, hydroxypropylmethyl cellulose, low substituted hydroxypropyl cellulose, sodium carboxymethyl cellulose, methyl cellulose, ethyl cellulose, sugar alcohols and others including combinations thereof.
- Contemplated anti-SMAD7 therapy formulations e.g., that include an
- intragranular phase and/or an extragranular phase may include a disintegrant such as but are not limited to, starch, cellulose, crosslinked polyvinyl pyrrolidone, sodium starch glycolate, sodium carboxymethyl cellulose, alginates, corn starch, crosmellose sodium, crosslinked carboxymethyl cellulose, low substituted hydroxypropyl cellulose, acacia, and others including combinations thereof.
- a disintegrant such as but are not limited to, starch, cellulose, crosslinked polyvinyl pyrrolidone, sodium starch glycolate, sodium carboxymethyl cellulose, alginates, corn starch, crosmellose sodium, crosslinked carboxymethyl cellulose, low substituted hydroxypropyl cellulose, acacia, and others including combinations thereof.
- an intragranular phase and/or an extragranular phase may include a disintegrant.
- a contemplated anti-SMAD7 therapy formulation includes an intra-granular phase comprising a disclosed antisense compound and excipients chosen from mannitol, microcrystalline cellulose, hydroxypropylmethyl cellulose, and sodium starch glycolate or combinations thereof, and an extra-granular phase comprising one or more of microcrystalline cellulose, sodium starch glycolate, and magnesium stearate or mixtures thereof.
- a contemplated anti-SMAD7 therapy formulation may include a lubricant, e.g. , an extra-granular phase may contain a lubricant.
- Lubricants include but are not limited to talc, silica, fats, stearin, magnesium stearate, calcium phosphate, silicone dioxide, calcium silicate, calcium phosphate, colloidal silicon dioxide, metallic stearates, hydrogenated vegetable oil, corn starch, sodium benzoate, polyethylene glycols, sodium acetate, calcium stearate, sodium lauryl sulfate, sodium chloride, magnesium lauryl sulfate, talc, and stearic acid.
- the pharmaceutical formulation comprises an enteric coating.
- enteric coatings create a barrier for the oral medication that controls the location at which the drug is absorbed along the digestive track.
- Enteric coatings may include a polymer that disintegrates a different rates according to pH.
- Enteric coatings may include, for example, cellulose acetate phthalate, methyl acrylate-methacrylic acid
- Exemplary enteric coatings include Opadry ® AMB, Acryl-EZE ® , Eudragit ® grades. In some embodiments, an enteric coating may comprise about 5% to about 10%, about 5% to about 20%, 8 to about 15%, about 8% to about 18%, about 10% to about 12%, or about 12 to about 16%, of a contemplated tablet by weight.
- enteric coatings may include an ethylacrylate-methacrylic acid copolymer.
- the anti-SMAD7 therapy may be a tablet for oral use comprising: about 0.5%> to about 10%> by weight of an antisense oligonucleotide described herein or a pharmaceutically acceptable salt thereof; about 30% to about 50% by weight mannitol; and about 10% to about 30% by weight microcrystalline cellulose.
- an anti-SMAD7 therapy in the form of a tablet comprises or consists essentially of about 0.5%> to about 70%>, e.g., about 0.5%> to about 10%>, or about 1% to about 20%, by weight of an antisense oligonucleotide or a pharmaceutically acceptable salt thereof ⁇ e.g., a SMAD7 antisense oligonucleotide provided herein).
- Such a tablet may include for example, about 0.5% to about 60% by weight of mannitol, e.g., about 30%) to about 50%) by weight mannitol, e.g., about 40%> by weight mannitol; and/or about 20%) to about 40%) by weight of microcrystalline cellulose, or about 10%> to about 30%> by weight of microcrystalline cellulose.
- a contemplated tablet may comprise an intragranular phase that includes about 30%> to about 60%>, e.g., about 45% to about 65%> by weight, or alternatively, about 5% to about 10%> by weight of a SMAD7 antisense
- oligonucleotide provided herein, about 30%> to about 50%>, or alternatively, about 5% to about 15%o by weight mannitol, about 5% to about 15% microcrystalline cellulose, about 0% to about 4%o, or about 1% to about 7% hydroxypropylmethylcellulose, and about 0% to about 4%o, e.g., about 2% to about 4% sodium starch glycolate by weight.
- a pharmaceutically acceptable tablet for oral administration includes an intra-granular phase that may comprise about 50%) by weight of a SMAD7 antisense oligonucleotide provided herein (or salt thereof), about 11.5% by weight mannitol, about 10% by weight microcrystalline cellulose, about 3% by weight hydroxypropylmethylcellulose, and about 2.5% by weight sodium starch glycolate; and an extra-granular phase that may comprise about 20% by weight microcrystalline cellulose, about 2.5% by weight sodium starch glycolate, and about 0.5% by weight magnesium stearate.
- the tablet may also include an enteric coating.
- a pharmaceutically acceptable tablet for oral administration includes or consists essentially of: an intra-granular phase that may comprise or consist essentially of about 5% to about 10%, e.g., about 8% by weight of a SMAD7 antisense oligonucleotide provided herein ⁇ e.g., wherein the internucleotide linkages are each ⁇ , ⁇ - linked phophorothioates, and/or salt thereof, e.g., a sodium salt), about 40% by weight mannitol, about 8% by weight microcrystalline cellulose, about 5% by weight hydroxypropylmethylcellulose, and about 2% by weight sodium starch glycolate; and an extra-granular phase that may comprise about 17% by weight microcrystalline cellulose, about 2% by weight sodium starch glycolate, and about 0.4% by weight magnesium stearate.
- an intra-granular phase that may comprise or consist essentially of about 5% to about 10%, e.g., about 8% by weight of a SMAD7 antisense
- compositions of the invention can be formulated for parenteral administration, e.g., formulated for injection via the intravenous, intramuscular,
- an aqueous composition such as an aqueous pharmaceutical composition containing a SMAD7 inhibitor
- compositions can be prepared as injectables, either as liquid solutions or suspensions; solid forms suitable for using to prepare solutions or suspensions upon the addition of a liquid prior to injection can also be prepared; and the preparations can also be emulsified.
- the pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions; formulations including sesame oil, peanut oil or aqueous propylene glycol; and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions.
- the form must be sterile and must be fluid to the extent that easy syringability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms, such as bacteria and fungi.
- Solutions of active compounds as free base or pharmacologically acceptable salts can be prepared in water suitably mixed with a surfactant, such as hydroxypropylcellulose. Dispersions can also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof and in oils. In addition, sterile, fixed oils may be employed as a solvent or suspending medium. For this purpose any bland fixed oil can be employed including synthetic mono- or diglycerides. In addition, fatty acids such as oleic acid can be used in the preparation of injectables.
- the sterile injectable preparation may also be a sterile injectable solution, suspension, or emulsion in a nontoxic parenterally acceptable diluent or solvent, for example, as a solution in 1,3-butanediol.
- a nontoxic parenterally acceptable diluent or solvent for example, as a solution in 1,3-butanediol.
- acceptable vehicles and solvents that may be employed are water, Ringer's solution, U.S. P., and isotonic sodium chloride solution.
- the SMAD7 inhibitor may be suspended in a carrier fluid comprising 1% (w/v) sodium carboxymethylcellulose and 0.1% (v/v) TWEENTM 80. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms.
- Injectable preparations for example, sterile injectable aqueous or oleaginous suspensions may be formulated according to the known art using suitable dispersing or wetting agents and suspending agents.
- dispersions are prepared by incorporating the various sterilized active ingredients into a sterile vehicle which contains the basic dispersion medium and the required other ingredients from those enumerated above.
- Sterile injectable solutions of the invention may be prepared by incorporating a SMAD7 inhibitor in the required amount of the appropriate solvent with various of the other ingredients enumerated above, as required, followed by filtered sterilization.
- the preferred methods of preparation are vacuum-drying and freeze-drying techniques which yield a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.
- the injectable formulations can be sterilized, for example, by filtration through a bacteria-retaining filter.
- Suitable preservatives for use in such a solution include benzalkonium chloride, benzethonium chloride, chlorobutanol, thimerosal and the like.
- Suitable buffers include boric acid, sodium and potassium bicarbonate, sodium and potassium borates, sodium and potassium 10 carbonate, sodium acetate, sodium biphosphate and the like, in amounts sufficient to maintain the pH at between about pH 6 and pH 8, and preferably, between about pH 7 and pH 7.5.
- Suitable tonicity agents are dextran 40, dextran 70, dextrose, glycerin, potassium chloride, propylene glycol, sodium chloride, and the like, such that the sodium chloride equivalent of the ophthalmic solution is in the range 0.9 plus or minus 0.2%.
- Suitable antioxidants and stabilizers include sodium bisulfite, sodium metabisulfite, sodium thiosulfite, thiourea and the like.
- Suitable wetting and clarifying agents include polysorbate 80, polysorbate 20, poloxamer 282 and tyloxapol.
- Suitable viscosity-increasing agents include dextran 40, dextran 70, gelatin, glycerin, hydroxyethylcellulose, hydroxymethylpropylcellulose, lanolin, methylcellulose, petrolatum, polyethylene glycol, polyvinyl alcohol, polyvinylpyrrolidone, carboxymethylcellulose and the like.
- a pharmaceutical composition for subcutaneous administration of an antisense oligonucleotide against SMAD7 comprises an antisense oligonucleotide such as that represented by SEQ ID NO: 7, or a pharmaceutically acceptable salt thereof (such as a sodium salt), and a pharmaceutically acceptable carrier.
- Contemplated tablets may also include an enteric coating, e.g., a disclosed tablet may include about 13%, about 14%, about 15%, about 16%, about 17% by weight of an enteric coating, e.g., ethylacrylate-methacrylic acid copolymers ⁇ e.g., AcrylEZE ® ).
- an enteric coating e.g., ethylacrylate-methacrylic acid copolymers ⁇ e.g., AcrylEZE ®
- the anti-SMAD7 therapy may be in the form of a pharmaceutically acceptable tablet for oral use comprising an intra-granular phase and extra-granular phase, wherein for example, the intra-granular phase comprises about 5% to about 10%, by weight (for example about 8% by weight) of an antisense oligonucleotide represented by SEQ ID NO:7 or a pharmaceutically acceptable salt thereof, about 40% by weight mannitol, about 8% by weight microcrystalline cellulose, about 5% by weight hydroxypropylmethyl cellulose, and about 2% by weight sodium starch glycolate, and for example, the extra-granular phase comprises about 17% by weight microcrystalline cellulose, about 2% by weight sodium starch glycolate, and about 0.4% by weight magnesium stearate, where the tablet may further comprise an enteric coating.
- the intra-granular phase comprises about 5% to about 10%, by weight (for example about 8% by weight) of an antisense oligonucleotide represented by SEQ ID NO:7 or a pharmaceutically acceptable salt thereof
- Contemplated formulations when orally administered to the patient may result in minimal plasma concentration of the oligonucleotide in the patient.
- contemplated formulations when orally administered to a patient, topically deliver to the terminal ileum and/or right colon of a patient, e.g., to an affected or diseased intestinal site of a patient. Administration and Dosing
- Exemplary formulations include dosage forms that include or consist essentially of about 10 mg to about 500 mg of an antisense oligonucleotide against SMAD7.
- formulations that include about 10 mg, about 15 mg, about 20 mg, about 25 mg, about 30 mg, about 35 mg, about 40 mg, about 50 mg, about 60 mg, about 70 mg, about 80 mg, about 90 mg, about 100 mg, about 110 mg, about 120 mg, about 130 mg, about 140 mg, about 150 mg, about 160 mg, about 200 mg, or about 250 mg of an antisense oligonucleotide against SMAD7 are contemplated herein.
- a formulation may include about 40 mg, 80 mg, or 160 mg of an antisense oligonucleotide against SMAD7.
- a formulation may include at least 100 ⁇ g of an antisense oligonucleotide against SMAD7.
- formulations may include about 0.1 mg, 0.2 mg, 0.3 mg, 0.4 mg, 0.5 mg, 1 mg, 5 mg, 10 mg, 15 mg, 20 mg, or 25 mg of an antisense oligonucleotide against SMAD7.
- the amount administered will depend on variables such as the type and extent of disease or indication to be treated, the overall health and size of the patient, the in vivo potency of the antisense oligonucleotide, the pharmaceutical formulation, and the route of administration.
- the initial dosage can be increased beyond the upper level in order to rapidly achieve the desired blood-level or tissue level.
- the initial dosage can be smaller than the optimum, and the dosage may be progressively increased during the course of treatment.
- Human dosage can be optimized, e.g., in a conventional Phase I dose escalation study designed to run from 40 mg to 160 mg. Dosing frequency can vary, depending on factors such as route of administration, dosage amount and the disease being treated.
- Exemplary dosing frequencies are once per day, once per week and once every two weeks. In some embodiments, dosing is once per day for 7 days.
- the anti-SMAD7 therapy may be administered following or concurrently with other treatments, for instance, but not limited to, a steroid or steroids, an immunomodulator or immunomodulators, and/or mesalamine.
- the anti-SMAD7 therapy may be administered following or concurrently with any combination of these treatments.
- the anti-SMAD7 therapy may be administered with only a steroid or steroids, only an immunomodulator or
- immunomodulators only mesalamine, a steroid or steroids and an immunomodulator or immunomodulators, a steroid or steroids and mesalamine, or an immunomodulator or immunomodulators and mesalamine.
- immunomodulators include azathioprine, mercaptopurine, methotrexate, cyclosporine A, and tacrolimus.
- steroids include corticosteroids, for example, prednisone, dexamethasone, hydrocortisone, methylprednisolone, prednisone, and budesonide.
- a different salicylate for example, sulfasalazine, may be administered in place of mesalamine.
- the steroid(s), immunomodulator(s), or mesalamine may be administered by the same route as the anti-SMAD7 therapy (i.e., orally).
- the steroid(s), immunomodulator(s), or mesalamine may be administered by a different route than the anti- SMAD7 therapy.
- the steroid(s), immunomodulator(s), or mesalamine may be administered parenterally, rectally, intravenously, topically, or by inhalation spray.
- the effectiveness of the antisense therapy in treating inflammatory bowel disease can be monitored using any appropriate approach.
- any of the biomarkers known to be associated with inflammatory bowel disease or excess SMAD7 activity can be used to monitor the effectiveness of therapy in a patient as can any subjective or objective clinical scale.
- Monitoring treatment may be useful in terms of assessing treatment efficacy and safety, as well as evaluating the need to modulate treatment. Monitoring treatment may also be useful for evaluating whether the amount of SMAD7 antisense oligonucleotide being administered to a patient or which will be administered to a patient should be increased or decreased or whether the antisense is effective.
- monitoring treatment may be useful in terms of determining the amount or relative amount by which a dose of SMAD7 antisense oligonucleotide should be modulated, i.e., increased or decreased.
- Monitoring for example, the level of a bio marker or a combination of biomarkers (e.g., CRP, TNFa, and IL8) in a patient having IBD, may commence prior to, during, or after an initial dose of a SMAD7 antisense oligonucleotide. Furthermore, monitoring may continue after an initial dose. For example monitoring may be performed after administration of an initial dose. Monitoring may also be performed before, during, or after a subsequent dose of SMAD7 antisense oligonucleotide.
- a biomarkers e.g., CRP, TNFa, and IL8
- Monitoring may be continuous or discontinuous such that monitoring may be performed at regular intervals, for example, after each dose of a SMAD7 antisense oligonucleotide is administered to a patient, before each dose of a SMAD7 antisense oligonucleotide is administered to a patient, or before and after each dose of a SMAD7 antisense oligonucleotide is administered to a patient.
- Monitoring may be performed multiple times in a single day (for instance, 2 times, 3 times, 4 times, about five times, or about 10 times in a single day), once a day, multiple times in a single week (for instance, 2 times, 3 times, 4 times, about five times, or about 10 times in a single week), once a week, multiple times in a single month (for instance, 2 times, 3 times, 4 times, about five times, or about 10 times in a single month), or once a month.
- monitoring may be performed at various times relative to an administering step.
- monitoring may be performed immediately after, or at least 1 day, at least 3 days, at least 5 days, at least 1 week, at least 2 weeks, at least 3 weeks, at least 1 month, at least 2 months, at least 4 months, or at least 6 months after an administration step. In some embodiments, monitoring is performed about 15 days or about 28 days after an administration step.
- a normal level of CRP can be tied to a specific value, for instance, a value of about 0.01 mg/L, about 0.05 mg/L, about 0.1 mg/L, about 0.2 mg/L, about 0.3 mg/L, about 0.4 mg/L, about 0.5 mg/L, about 0.6 mg/L, about 0.7 mg/L, about 0.8 mg/L, about 0.9 mg/L, about 1.0 mg/L, about 1.5 mg/L, about 2.0 mg/L, about 2.5 mg/L, or about 3.0 mg/L.
- a normal level of TNFa may be about 11 ⁇ g/L (e.g., 11.2 ⁇ g/L), or may be another value (e.g., 5, 6, 7, 8, 9, 10, 12, 13, 14, or 15 ⁇ g/L), depending on the control subject.
- a normal level of IL8 in serum may be about 13 ⁇ g/L (e.g., 12.9 ⁇ g/L), or may be another value (e.g., 6, 7, 8, 9, 10, 11, 12, 14, 15, 16, or 17 ⁇ g/L), depending on the control subject. See, e.g., Arican et al, Mediators Inflamm.
- a normal level of the biomarker may be determined by comparison to median levels of the biomarker in a healthy control group that is matched to the patient with respect to various factors, for example, age, gender, ethnic origin, smoking habits, dietary habits, body-mass index (BMI), and/or exercise habits.
- BMI body-mass index
- a sample may be a tissue sample (e.g., a gastrointestinal tissue sample) or a bodily fluid sample (e.g., a saliva sample, a stool, a urine sample, or any liquid biopsy).
- a tissue sample e.g., a gastrointestinal tissue sample
- a bodily fluid sample e.g., a saliva sample, a stool, a urine sample, or any liquid biopsy.
- Samples may include solid tissue biopsies that contain biomarker-expressing cells, for example, epithelial colon tissue cells.
- a sample can be a sample obtained from a patient tissue biopsy, for example, a mucosal tissue biopsy, for example, an intestinal mucosal tissue biopsy.
- the sample may be a blood, serum, or plasma sample.
- a blood sample from a subject may be obtained using techniques well-known in the art.
- Blood samples may include peripheral blood mononuclear cells (PMBCs), RBC-depleted whole blood, or blood serum.
- PBMCs can be separated from whole blood samples using different density gradient (e.g., Ficoll density gradient) centrifugation procedures.
- Samples may also be obtained or extracted from the patient based on temporal parameters. For instance, samples may be taken from the same patient at different time points, for example, about every 30 minutes, about every hour, about every three hours, about every 6 hours, or about every 12 hours, throughout a given time period, for example, about 1 hour, about 6 hours, about 12 hours, about 1 day, about 3 days, about 1 week, or about 1 month. Samples may also be taken after individual meals, for example, immediately after, about 30 minutes after, about 1 hour after, about 2 hours after, about 3 hours after, about 4 hours after, about 5 hours after, or about 6 hours after a meal.
- Methods of monitoring treatment may also include methods of monitoring other factors, including, but not limited to levels of biomarkers (e.g., CRP, TNFa, and IL8), CDAI score, clinical remission, and presence or severity of IBD symptoms.
- biomarkers e.g., CRP, TNFa, and IL8
- biomarker e.g., CRP, TNFa, and IL8
- various methods may be used to measure the biomarker.
- the level of a biomarker for example, IL8, TNFa, or CRP
- the amount of a biomarker in a blood or tissue sample, or a fraction of a blood or tissue sample of a known volume may be determined by immunochemistry.
- Methods of determining biomarker concentration by immunochemistry include, but are not limited to, Western blotting, ELISA, and immunostaining methods.
- a method of determining biomarker concentration by immunochemistry is performed using an antibody that can bind to the biomarker of interest, for instance, an antibody directed against the biomarker.
- Assaying biomarker concentration by immunochemistry requires, for example, at least one antibody against the biomarker.
- a primary antibody may be tagged with a detectable label, e.g., a fluorescent marker.
- a secondary antibody tagged with a detectable label, e.g., a fluorescent marker that binds specifically to the species isotype of the primary antibody may be used to perform immunochemistry.
- Methods of determining biomarker concentration by immunochemistry may also involve the use of buffers, blocking reagents, unconjugated primary antibodies, and primary and/or secondary antibodies conjugated to tags that allow for antibody detection, such as fluorescent probes or substrate- specific enzymes.
- Methods of determining biomarker concentration by nucleotide analysis include, but are not limited to, methods of analyzing biomarker mRNA transcript levels such as Northern blotting and polymerase chain reaction methods, for example, quantitative polymerase chain reaction methods.
- Nucleotide analysis may be performed using an oligonucleotide probe that binds an biomarker nucleotide sequence (e.g., an CRP nucleotide sequence) or a pair of oligonucleotide primers capable of amplifying an biomarker nucleotide sequence via a polymerase chain reaction, for example, by a quantitative polymerase chain reaction.
- Oligonucleotide probes and oligonucleotide primers may be linked to a detectable tag, such as, for example, a fluorescent tag.
- a detectable tag such as, for example, a fluorescent tag.
- the practitioner may evaluate a particular biomarker' s mRNA transcript concentration in a sample.
- the practitioner may establish a correlation between a particular biomarker' s mRNA transcript abundance and the particular biomarker' s protein abundance in order to extrapolate biomarker protein concentration based on a measure of biomarker mRNA transcript abundance.
- Methods of the claimed invention include steps that may be carried out in vitro. For instance, it is contemplated that the steps of measuring biomarker levels in the subject, determining the levels of the biomarker in a sample, and/or determining CDAI score or taking measurements necessary to determine CDAI score may be carried out in vitro. For example, the level of a biomarker in a sample may be determined by performing
- the steps of determining and analyzing the biomarker level in a patient having IBD, determining and analyzing the biomarker level in a sample, and/or determining CDAI score or taking measurements necessary to determine CDAI score may be carried out in vivo.
- Anti-IL8 antibodies suitable for immunochemistry are commercially available, including, but not limited to, goat anti-human IL8 from Abeam (Cat. No. ab 10769), mouse anti-human IL8 from Santa Cruz (Cat. Nos. sc-73321, sc-52870, and sc-7302), mouse anti- human IL8 (3IL8-H10) from Pierce (Cat. No. M801), and a mouse anti-human IL8 from Sigma-Aldrich (Cat. No. WH0003576M5) antibody.
- Anti-TNFa antibodies suitable for immunochemistry are commercially available, including, but not limited to, rabbit anti-human TNFa from Abeam (Cat. No.
- Anti-CRP antibodies suitable for immunochemistry are commercially available, such as, for example, goat anti-human CRP polyclonal antibodies from Santa Cruz
- Biotechnology (Catalog Numbers sc- 18304 and sc- 18306), a rabbit anti-human CRP polyclonal antibody from from Santa Cruz Biotechnology (Catalog Number sc-30047), a mouse anti-human CRP monoclonal antibody from Santa Cruz Biotechnology (Catalog Number sc-70883), a mouse anti-human CRP monoclonal antibody from Sigma- Aldrich (Catalog Number C1688-.2ML), a rabbit anti-human monoclonal antibody from abeam (Catalog Number ab32412), a mouse anti- human CRP monoclonal antibody from abeam (Catalog Number ab 13426), and a goat anti-human CRP polyclonal antibody from Thermo Scientific (Catalog Number G0301-1B).
- Example 1 A patient heterozygous for the rsl44204026 SNP
- a patient is diagnosed with Crohn's disease. Prior to beginning therapy, the patient's SMAD7 gene sequence is analyzed in the patient using standard sequencing techniques to determine the presence or absence of the rs 144204026 SNP. [00108] As a result of sequencing, the patient is determined to have one copy the SMAD7 gene rs 144204026 polymorphism (i.e., an "A" at the position) and one copy of the consensus sequence (i.e., a "G" at the position).
- the patient is administered two different antisense therapeutics, one having the sequence of Mongersen (i.e., SEQ ID NO:5) and one having the sequence of Mongersen in which the nucleotide that corresponds to the rs 144204026 polymorphism has been substituted (i.e., SEQ ID NO: 11).
- SEQ ID NO: 5 the sequence of Mongersen
- SEQ ID NO: 11 the sequence of Mongersen in which the nucleotide that corresponds to the rs 144204026 polymorphism has been substituted
- Example 2 A patient homozygous for the rsl44204026 SNP
- a patient is diagnosed with Crohn's disease. Prior to beginning therapy, the patient's SMAD7 gene sequence is analyzed in the patient using standard sequencing techniques to determine the presence or absence of the rs 144204026 SNP.
- the patient is determined to have two copies the SMAD7 gene rsl44204026 polymorphism (i.e. , an "A" at the position). Based on this determination, the patient is administered a single antisense therapeutic having the sequence of Mongersen in which the nucleotide that corresponds to the rs 144204026 polymorphism has been substituted (e.g., SEQ ID NO: l 1).
- SEQ ID NO: l Coding Sequence CDS (288-1568) of NM 005904.3; Homo sapiens SMAD family member 7 (SMAD7), transcript variant 1 , mRNA) - Target sequence of Mongersen target and its derivatives underlined (108-128); SNP (g/a) double underlined;
- CTTCTGGAGC CTGGGGATCG GTCACACTGG TGCGTGGTGG CATACTGGGA
- CTGCGGCATC CAGCTGACGC GGGAGGTGGA TGGTGTGTGG GTGTACAACC
- SEQ ID NO:4 truncated Mongersen sequence; the highlighted position corresponds to the location of SNP rsl44204026 )
- SEQ ID NO:5 (Mongersen sequence; the highlighted position corresponds to the location of SNP rs 144204026)
- X is 5-methyl-2'-deoxycytidine and wherein all internucleotide linkages are phosphorothioate linkages SEQ ID NO: 7 (Mongersen; the highlighted position corresponds to the location of SNP rs 144204026)
- X is 5-methyl-2'-deoxycytidine and wherein all intemucleotide linkages are phosphorothioate linkages
- SEQ ID NO: 8 polymorphic variant of truncated Mongersen target-sequence; SNP rs 144204026 position highlighted
- SEQ ID NO:9 polymorphic variant of Mongersen target-sequence; SNP rsl44204026 position highlighted
- SEQ ID NO: 10 polymorphic variant of truncated Mongersen sequence
- SEQ ID NO: 12 polymorphic variant of truncated Mongersen; position targeting SNP rsl44204026 highlighted
- X is 5-methyl-2'-deoxycytidine and wherein all intemucleotide linkages are phosphorothioate linkages SEQ ID NO: 13 (polymorphic variant of Mongersen; position targeting SNP rsl44204026 highlighted)
- X is 5-methyl-2'-deoxycytidine and wherein all intemucleotide linkages are phosphorothioate linkages SEQ ID NO: 14 (variant of Mongersen; the highlighted position corresponds to the location of SNP rs 144204026)
- X is 5 -methyl 2'-deoxycytidine and Z is 2'-deoxyguanosine methylphosphonate
- SEQ ID NO: 15 variant of truncated Mongersen; the highlighted position corresponds to the location of SNP rsl44204026)
- X is 5 -methyl 2'-deoxycytidine and Z is 2'-deoxyguanosine methylphosphonate
- SEQ ID NO: 16 variant of Mongersen; the highlighted position corresponds to the location of SNP rs 144204026
- X is 5 -methyl 2 ' -deoxycytidine
- SEQ ID NO: 17 variant of Mongersen; the highlighted position corresponds to the location of SNP rs 144204026
- X is a nucleotide comprising a nitrogenous base selected from the group consisting of cytosine and 5-methylcytosine or a 2'-0-methylcytosine nucleotide
- Y is a nucleotide comprising a nitrogenous base selected from the group consisting of guanine and 5- methylguanine or a 2'-0-methylguanine nucleotide, provided that at least one of the nucleotides X or Y comprises a methylated nitrogenous base
- SEQ ID NO: 18 polymorphic variant of truncated Mongersen variant; position targeting SNP rs 144204026 highlighted
- X is 5 -methyl 2 '-deoxycytidine and Z is 2'-deoxyguanosine methylphosphonate
- SEQ ID NO: 19 polymorphic variant of Mongersen variant; position targeting SNP rs 144204026 highlighted
- X is 5 -methyl 2 '-deoxycytidine and Z is 2'-deoxyguanosine methylphosphonate SEQ ID NO:20 (polymorphic variant of Mongersen variant; position targeting SNP rs 144204026 highlighted)
- X is 5 -methyl 2'-deoxycytidine
- SEQ ID NO:21 polymorphic variant of Mongersen variant; position targeting SNP rs 144204026 highlighted
- X is a nucleotide comprising a nitrogenous base selected from the group consisting of cytosine and 5-methylcytosine or a 2'-0-methylcytosine nucleotide
- Y is a nucleotide comprising a nitrogenous base selected from the group consisting of guanine and 5- methylguanine or a 2'-0-methylguanine nucleotide, provided that at least one of the nucleotides X or Y comprises a methylated nitrogenous base.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Biomedical Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Public Health (AREA)
- Medicinal Chemistry (AREA)
- Animal Behavior & Ethology (AREA)
- Veterinary Medicine (AREA)
- Pharmacology & Pharmacy (AREA)
- Analytical Chemistry (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Pathology (AREA)
- Immunology (AREA)
- Epidemiology (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Priority Applications (11)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| JP2017520449A JP2017532961A (ja) | 2014-10-17 | 2015-10-16 | Smad7アンチセンスオリゴヌクレオチドによる対象を処置するための方法および組成物 |
| US15/519,468 US10337004B2 (en) | 2014-10-17 | 2015-10-16 | Methods and compositions for treating a subject with a SMAD7 antisense oligonucleotide |
| MX2017004973A MX2017004973A (es) | 2014-10-17 | 2015-10-16 | Metodos y composiciones para tratar a un sujeto con un oligonucleotido antisentido de smad7. |
| EP15781642.2A EP3207136A1 (en) | 2014-10-17 | 2015-10-16 | Methods and compositions for treating a subject with a smad7 antisense oligonucleotide |
| CA2964667A CA2964667A1 (en) | 2014-10-17 | 2015-10-16 | Methods and compositions for treating a subject with a smad7 antisense oligonucleotide |
| CN201580069041.9A CN107406851A (zh) | 2014-10-17 | 2015-10-16 | 利用smad7反义寡核苷酸治疗受试者的方法和组合物 |
| EA201790867A EA201790867A1 (ru) | 2014-10-17 | 2015-10-16 | Способы и композиции для лечения субъекта антисмысловым олигонуклеотидом smad7 |
| AU2015332624A AU2015332624A1 (en) | 2014-10-17 | 2015-10-16 | Methods and compositions for treating a subject with a SMAD7 antisense oligonucleotide |
| KR1020177012839A KR20170069262A (ko) | 2014-10-17 | 2015-10-16 | Smad7 안티센스 올리고뉴클레오티드로 대상체를 치료하기 위한 방법 및 조성물 |
| IL251717A IL251717A0 (en) | 2014-10-17 | 2017-04-13 | Methods and compositions for treating a subject with a smad7 antisense oligonucleotide |
| US16/418,108 US20190338283A1 (en) | 2014-10-17 | 2019-05-21 | Methods and compositions for treating a subject with a smad7 antisense oligonucleotide |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201462065598P | 2014-10-17 | 2014-10-17 | |
| US62/065,598 | 2014-10-17 |
Related Child Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US15/519,468 A-371-Of-International US10337004B2 (en) | 2014-10-17 | 2015-10-16 | Methods and compositions for treating a subject with a SMAD7 antisense oligonucleotide |
| US16/418,108 Division US20190338283A1 (en) | 2014-10-17 | 2019-05-21 | Methods and compositions for treating a subject with a smad7 antisense oligonucleotide |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2016059239A1 true WO2016059239A1 (en) | 2016-04-21 |
Family
ID=54330761
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/EP2015/074066 Ceased WO2016059239A1 (en) | 2014-10-17 | 2015-10-16 | Methods and compositions for treating a subject with a smad7 antisense oligonucleotide |
Country Status (12)
| Country | Link |
|---|---|
| US (2) | US10337004B2 (https=) |
| EP (1) | EP3207136A1 (https=) |
| JP (1) | JP2017532961A (https=) |
| KR (1) | KR20170069262A (https=) |
| CN (1) | CN107406851A (https=) |
| AU (1) | AU2015332624A1 (https=) |
| CA (1) | CA2964667A1 (https=) |
| EA (1) | EA201790867A1 (https=) |
| IL (1) | IL251717A0 (https=) |
| MA (1) | MA43331A (https=) |
| MX (1) | MX2017004973A (https=) |
| WO (1) | WO2016059239A1 (https=) |
Cited By (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US9791442B2 (en) | 2011-09-15 | 2017-10-17 | Nogra Pharma Limited | Methods of monitoring responsiveness to anti-SMAD7 therapy |
| US9951334B2 (en) | 2003-04-02 | 2018-04-24 | Nogra Pharma Limited | Antisense oligonucleotides (ODN) against SMAD7 and uses thereof in medical field |
| US9982264B2 (en) | 2008-11-13 | 2018-05-29 | Nogra Pharma Limited | Antisense compositions and methods of making and using same |
| US10006029B2 (en) | 2013-03-15 | 2018-06-26 | Nogra Pharma Limited | Methods of treating colorectal cancer |
| WO2018122376A1 (en) * | 2016-12-30 | 2018-07-05 | Nogra Pharma Limited | Compositions of smad7 antisense oligonucleotide and methods of treating or preventing psoriasis |
| US10081809B2 (en) | 2012-04-18 | 2018-09-25 | University Of Miami | Methods of treating diabetes and/or promoting survival of pancreatic islets after transplantation |
| US10337004B2 (en) | 2014-10-17 | 2019-07-02 | Nogra Pharma Limited | Methods and compositions for treating a subject with a SMAD7 antisense oligonucleotide |
| US10473669B2 (en) | 2014-05-09 | 2019-11-12 | Nogra Pharma Limited | Methods for treating inflammatory bowel disease |
| EP3693736A3 (en) * | 2014-10-17 | 2020-10-14 | Nogra Pharma Limited | Methods for dosing and monitoring smad7 antisense oligonucleotide treatment using biomarker levels |
| US11162097B2 (en) | 2016-02-23 | 2021-11-02 | Nogra Pharma Limited | Methods of treating intestinal fibrosis using SMAD7 inhibition |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AU2021260967A1 (en) * | 2020-04-24 | 2022-10-20 | Nogra Pharma Limited | Compositions of SMAD7 antisense oligonucleotides (ASO) and methods of using the same |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2004087920A1 (en) * | 2003-04-02 | 2004-10-14 | Giuliani International Limited | Antisense oligonucleotides (odn) against smad7 and uses in medical field thereof |
| WO2013037970A1 (en) * | 2011-09-15 | 2013-03-21 | Nogra Pharma Limited | Methods for monitoring responsiveness to anti-smad7 therapy |
| WO2015169966A2 (en) * | 2014-05-09 | 2015-11-12 | Nogra Pharma Limited | Methods for treating inflammatory bowel disease |
Family Cites Families (13)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| PT1456380E (pt) | 2001-11-02 | 2012-07-23 | Giuliani Int Ltd | Inibidores smad7 para o tratamento de doenças do snc |
| ES2627745T3 (es) | 2008-11-13 | 2017-07-31 | Nogra Pharma Limited | Composiciones antisentido, y procedimientos de fabricación y uso de las mismas |
| US9062311B2 (en) * | 2009-01-26 | 2015-06-23 | Academisch Ziekenhuis Leiden H.O.D.N. Lumc | Means and methods for modulating NOTCH3 protein expression and/or the coding region of NOTCH3; compositions and use thereof in the treatment of CADASIL |
| EP3628750A1 (en) * | 2010-02-08 | 2020-04-01 | Ionis Pharmaceuticals, Inc. | Selective reduction of allelic variants |
| US10081809B2 (en) | 2012-04-18 | 2018-09-25 | University Of Miami | Methods of treating diabetes and/or promoting survival of pancreatic islets after transplantation |
| US10006029B2 (en) | 2013-03-15 | 2018-06-26 | Nogra Pharma Limited | Methods of treating colorectal cancer |
| RU2674147C2 (ru) | 2013-03-15 | 2018-12-05 | Ногра Фарма Лимитед | Способы лечения колоректального рака |
| US20170233736A1 (en) | 2014-10-17 | 2017-08-17 | Nogra Pharma Limited | Methods for dosing and monitoring smad7 antisense oligonucleotide treatment using biomarker levels |
| WO2016059239A1 (en) | 2014-10-17 | 2016-04-21 | Nogra Pharma Limited | Methods and compositions for treating a subject with a smad7 antisense oligonucleotide |
| WO2015011694A2 (en) | 2014-10-17 | 2015-01-29 | Celgene Corporation | Isotopologues of smad7 antisense oligonucleotides |
| MA41271A (fr) | 2014-12-26 | 2017-10-31 | Celgene Alpine Invest Company Ii Llc | Méthodes d'utilisation d'oligonucléotides antisens ciblant smad7 |
| MX2018003699A (es) | 2015-09-30 | 2018-08-01 | Celgene Alpine Invest Company Ii Llc | Moduladores de tlr y metodos de uso. |
| EP3355896A2 (en) | 2015-09-30 | 2018-08-08 | Nogra Pharma Limited | Methods of using smad7 antisense oligonucleotides based on biomarker expression |
-
2015
- 2015-10-16 WO PCT/EP2015/074066 patent/WO2016059239A1/en not_active Ceased
- 2015-10-16 EP EP15781642.2A patent/EP3207136A1/en not_active Withdrawn
- 2015-10-16 AU AU2015332624A patent/AU2015332624A1/en not_active Abandoned
- 2015-10-16 MX MX2017004973A patent/MX2017004973A/es unknown
- 2015-10-16 JP JP2017520449A patent/JP2017532961A/ja active Pending
- 2015-10-16 CN CN201580069041.9A patent/CN107406851A/zh active Pending
- 2015-10-16 US US15/519,468 patent/US10337004B2/en not_active Expired - Fee Related
- 2015-10-16 EA EA201790867A patent/EA201790867A1/ru unknown
- 2015-10-16 KR KR1020177012839A patent/KR20170069262A/ko not_active Withdrawn
- 2015-10-16 CA CA2964667A patent/CA2964667A1/en not_active Abandoned
- 2015-10-16 MA MA043331A patent/MA43331A/fr unknown
-
2017
- 2017-04-13 IL IL251717A patent/IL251717A0/en unknown
-
2019
- 2019-05-21 US US16/418,108 patent/US20190338283A1/en not_active Abandoned
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2004087920A1 (en) * | 2003-04-02 | 2004-10-14 | Giuliani International Limited | Antisense oligonucleotides (odn) against smad7 and uses in medical field thereof |
| WO2013037970A1 (en) * | 2011-09-15 | 2013-03-21 | Nogra Pharma Limited | Methods for monitoring responsiveness to anti-smad7 therapy |
| WO2015169966A2 (en) * | 2014-05-09 | 2015-11-12 | Nogra Pharma Limited | Methods for treating inflammatory bowel disease |
Non-Patent Citations (5)
| Title |
|---|
| DATABASE dbSNP [online] "Reference SNP (refSNP) Cluster Report: rs144204026", XP002752629, retrieved from NCBI Database accession no. rs144204026 * |
| GIOVANNI MONTELEONE ET AL: "Mongersen, an Oral SMAD7 Antisense Oligonucleotide, and Crohn's Disease", NEW ENGLAND JOURNAL OF MEDICINE, vol. 372, no. 12, 19 March 2015 (2015-03-19), pages 1104 - 1113, XP055195699, ISSN: 0028-4793, DOI: 10.1056/NEJMoa1407250 * |
| GIOVANNI MONTELEONE: "Role of Smad7 in inflammatory bowel diseases", WORLD JOURNAL OF GASTROENTEROLOGY, vol. 18, no. 40, 28 October 2012 (2012-10-28), pages 5664 - 5668, XP055197821, ISSN: 1007-9327, DOI: 10.3748/wjg.v18.i40.5664 * |
| MONTELEONE G ET AL: "BLOCKING SMAD7 RESTORES TGF-BETA1 SIGNALING IN CHRONIC INFLAMMATORY BOWEL DISEASE", JOURNAL OF CLINICAL INVESTIGATION, vol. 108, no. 4, 1 August 2001 (2001-08-01), pages 601 - 609, XP001152527, ISSN: 0021-9738, DOI: 10.1172/JCI200112821 * |
| MONTELEONE G ET AL: "Phase i clinical trial of smad7 knockdown using antisense oligonucleotide in patients with active crohn's disease", MOLECULAR THERAPY, vol. 20, no. 4, April 2012 (2012-04-01), pages 870 - 876, XP008158192, ISSN: 1525-0016, DOI: 10.1038/MT.2011.290 * |
Cited By (15)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US9951334B2 (en) | 2003-04-02 | 2018-04-24 | Nogra Pharma Limited | Antisense oligonucleotides (ODN) against SMAD7 and uses thereof in medical field |
| US10738309B2 (en) | 2003-04-02 | 2020-08-11 | Nogra Pharma Limited | Antisense oligonucleotides (ODN) against SMAD7 and uses thereof in medical field |
| US10633660B2 (en) | 2003-04-02 | 2020-04-28 | Nogra Pharma Limited | Antisense oligonucleotides (ODN) against SMAD7 and uses thereof in medical field |
| US10036022B2 (en) | 2003-04-02 | 2018-07-31 | Nogra Pharma Limited | Antisense oligonucleotides (ODN) against Smad7 and uses thereof in medical field |
| US10272047B2 (en) | 2008-11-13 | 2019-04-30 | Nogra Pharma Limited | Antisense compositions and methods of making and using same |
| US9982264B2 (en) | 2008-11-13 | 2018-05-29 | Nogra Pharma Limited | Antisense compositions and methods of making and using same |
| US9791442B2 (en) | 2011-09-15 | 2017-10-17 | Nogra Pharma Limited | Methods of monitoring responsiveness to anti-SMAD7 therapy |
| US10443056B2 (en) | 2012-04-18 | 2019-10-15 | Nogra Pharma Limited | Methods of treating diabetes and/or promoting survival of pancreatic islets after transplantation |
| US10081809B2 (en) | 2012-04-18 | 2018-09-25 | University Of Miami | Methods of treating diabetes and/or promoting survival of pancreatic islets after transplantation |
| US10006029B2 (en) | 2013-03-15 | 2018-06-26 | Nogra Pharma Limited | Methods of treating colorectal cancer |
| US10473669B2 (en) | 2014-05-09 | 2019-11-12 | Nogra Pharma Limited | Methods for treating inflammatory bowel disease |
| US10337004B2 (en) | 2014-10-17 | 2019-07-02 | Nogra Pharma Limited | Methods and compositions for treating a subject with a SMAD7 antisense oligonucleotide |
| EP3693736A3 (en) * | 2014-10-17 | 2020-10-14 | Nogra Pharma Limited | Methods for dosing and monitoring smad7 antisense oligonucleotide treatment using biomarker levels |
| US11162097B2 (en) | 2016-02-23 | 2021-11-02 | Nogra Pharma Limited | Methods of treating intestinal fibrosis using SMAD7 inhibition |
| WO2018122376A1 (en) * | 2016-12-30 | 2018-07-05 | Nogra Pharma Limited | Compositions of smad7 antisense oligonucleotide and methods of treating or preventing psoriasis |
Also Published As
| Publication number | Publication date |
|---|---|
| JP2017532961A (ja) | 2017-11-09 |
| EA201790867A1 (ru) | 2017-08-31 |
| US10337004B2 (en) | 2019-07-02 |
| KR20170069262A (ko) | 2017-06-20 |
| MX2017004973A (es) | 2017-12-07 |
| CA2964667A1 (en) | 2016-04-21 |
| CN107406851A (zh) | 2017-11-28 |
| EP3207136A1 (en) | 2017-08-23 |
| AU2015332624A1 (en) | 2017-05-04 |
| MA43331A (fr) | 2017-08-23 |
| IL251717A0 (en) | 2017-06-29 |
| US20190338283A1 (en) | 2019-11-07 |
| US20170240893A1 (en) | 2017-08-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US10337004B2 (en) | Methods and compositions for treating a subject with a SMAD7 antisense oligonucleotide | |
| JP7030685B2 (ja) | Dcr3又はdcr3ネットワーク遺伝子に遺伝子変異を有する患者における自己免疫状態を治療する方法 | |
| JP7231326B2 (ja) | Il-33媒介性障害のための治療及び診断方法 | |
| CN107530431B (zh) | 生物标志物 | |
| KR20240095481A (ko) | Rnaset2를 통한 염증성 장 질환의 진단 방법 | |
| JP2012511895A (ja) | ヒト認知の原因となる遺伝子変異体及び診断標的及び治療標的としてのそれらを使用する方法 | |
| EP3213070A2 (en) | Methods for dosing and monitoring smad7 antisense oligonucleotide treatment using biomarker levels | |
| WO2016042114A1 (en) | Cxcl14 as a biomarker of hedgehog pathway activity for the diagnosis, prognosis and treatment of idiopathic pulmonary fibrosis | |
| CN101103124A (zh) | 用于检测原发性动脉高压风险的方法和试剂盒 | |
| DK3277835T3 (en) | GENETIC PREDICTORS OF A REACTION ON TREATMENT WITH CRHR1 ANTAGONISTS | |
| EP3126521B1 (en) | Hnf4g-rspo2 fusion gene | |
| WO2018049410A1 (en) | Use of recombinant lymphocyte activation gene-3 | |
| US12365946B2 (en) | Compositions and methods for the diagnosis and treatment of lymphatic system disorders | |
| MX2014006186A (es) | Capacidad de respuesta a los inhibidores de la angiogenesis. | |
| JP4242590B2 (ja) | 慢性関節リウマチの疾患感受性遺伝子、及びその利用 | |
| KR102202120B1 (ko) | 알츠하이머 질환의 진단 또는 치료를 위한 Ube2h의 용도 | |
| US20240417801A1 (en) | Compositions and methods for assessing the efficacy of polynucleotide delivery and cancer therapy | |
| JP2012080777A (ja) | ネフローゼ症候群の検査方法、並びにネフローゼ症候群の予防又は治療薬およびそのスクリーニング方法 | |
| JP2025042914A (ja) | もやもや病の発症を予測する方法 | |
| US20110151456A1 (en) | Test method for type-2 diabetes using gene polymorphism | |
| KR101082138B1 (ko) | 아스피린 과민성 천식 진단용 il17ra 유전자 다형성 마커 | |
| JP4869834B2 (ja) | 抗ヒトTNFαキメラ抗体を含有する薬剤に対する副作用に関連する多型、およびその利用 | |
| WO2013035861A1 (ja) | 加齢黄斑変性の易罹患性判定方法、プライマー対、プローブ、加齢黄斑変性診断キット、加齢黄斑変性の治療薬及び加齢黄斑変性の治療薬のスクリーニング方法 | |
| EP4118236A1 (en) | Therapeutic methods for the treatment of subjects with risk alelles in il33 | |
| KR20140064924A (ko) | 항-혈관신생 치료와 연관된 고혈압 위험성의 예측 방법 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 15781642 Country of ref document: EP Kind code of ref document: A1 |
|
| ENP | Entry into the national phase |
Ref document number: 2964667 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 251717 Country of ref document: IL |
|
| ENP | Entry into the national phase |
Ref document number: 2017520449 Country of ref document: JP Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 15519468 Country of ref document: US |
|
| WWE | Wipo information: entry into national phase |
Ref document number: MX/A/2017/004973 Country of ref document: MX |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 2015332624 Country of ref document: AU Date of ref document: 20151016 Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 20177012839 Country of ref document: KR Kind code of ref document: A |
|
| REEP | Request for entry into the european phase |
Ref document number: 2015781642 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 201790867 Country of ref document: EA |