WO2016057772A1 - Methods and systems for distinguishing irritable bowel syndrome from inflammatory bowel disease and celiac disease - Google Patents
Methods and systems for distinguishing irritable bowel syndrome from inflammatory bowel disease and celiac disease Download PDFInfo
- Publication number
- WO2016057772A1 WO2016057772A1 PCT/US2015/054655 US2015054655W WO2016057772A1 WO 2016057772 A1 WO2016057772 A1 WO 2016057772A1 US 2015054655 W US2015054655 W US 2015054655W WO 2016057772 A1 WO2016057772 A1 WO 2016057772A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- ibs
- antibodies
- vinculin
- cdtb
- level
- Prior art date
Links
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
- G01N33/6854—Immunoglobulins
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/564—Immunoassay; Biospecific binding assay; Materials therefor for pre-existing immune complex or autoimmune disease, i.e. systemic lupus erythematosus, rheumatoid arthritis, multiple sclerosis, rheumatoid factors or complement components C1-C9
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/195—Assays involving biological materials from specific organisms or of a specific nature from bacteria
- G01N2333/205—Assays involving biological materials from specific organisms or of a specific nature from bacteria from Campylobacter (G)
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2800/00—Detection or diagnosis of diseases
- G01N2800/06—Gastro-intestinal diseases
- G01N2800/065—Bowel diseases, e.g. Crohn, ulcerative colitis, IBS
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2800/00—Detection or diagnosis of diseases
- G01N2800/52—Predicting or monitoring the response to treatment, e.g. for selection of therapy based on assay results in personalised medicine; Prognosis
Definitions
- This invention relates to irritable bowel syndrome, the diagnosis and treatments thereof.
- IBS Irritable bowel syndrome
- IBS is a condition that results in chronic changes in bowel function including diarrhea, constipation and alternating patterns, as well as abdominal symptoms including pain and bloating.
- IBS organic diseases
- IBD organic diseases
- celiac disease the diagnosis of IBS is often made after excluding organic diseases.
- IBS experts agreed that these subjects suffer from significant changes in bowel habit and bloating as principal symptoms.
- identification of subjects is based on a "diagnosis of exclusion" approach. This approach involves a great deal of expense and morbidity to patients with IBS, particularly those with D-IBS, including frequent body imaging, endoscopy and blood testing to rule out alternative organic explanations for their symptoms.
- Rome criteria have been valuable in the standardization of IBS recruitment for clinical trials, these criteria still rely on a "diagnosis of exclusion" approach as they are non-specific. For example, the majority of subjects with Crohn's disease or ulcerative colitis satisfy the Rome Criteria. The Rome II Criteria were further helpful in defining IBS based on predominant bowel pattern such as diarrhea and constipation predominant forms. This approach led to drug pipelines for IBS treatment based on controlling symptoms in IBS. Prokinetics and secretagogues have been developed for C-IBS and anti-kinetics for D-IBS. However, these therapies are not based on causative mechanism of IBS and are instead based on symptom control. As a result, they can result in creating opposite symptoms.
- Various embodiments of the present invention pro vie for a method of distinguishing irritable bowel syndrome (IBS) from inflammatory bowel disease (IBD), celiac disease, or both, comprising: obtaining a biological sample from a subject desiring a diagnosis to distinguish IBS from IBD, celiac disease, or both; detecting in the biological sample, levels of anti-vinculin and anti-CdtB antibodies; and making a diagnosis of IBS if the level of anti-vinculin antibodies is higher than an established control level of anti-vinculin antibodies, the level of anti-CdtB antibodies is higher than an established control level of anti-CdtB antibodies, or both levels of anti-vinculin antibodies and anti-CdtB antibodies are higher than the established control levels of anti-vinculin antibodies and anti-CdtB antibodies, or making a diagnosis of IBD, suspicion of IBD, celiac disease or suspicion of celiac disease if the level of anti-vinculin antibodies is not higher than the established control
- the biological sample can be whole blood, serum, or plasma.
- detecting in the biological sample can comprise using enzyme-linked immunosorbent assay (ELISA).
- detecting in the biological sample can comprise using immunohistochemistry, flow cytometry, fluorescence in situ hybridization (FISH), radioimmuno assays, or affinity purification.
- ELISA enzyme-linked immunosorbent assay
- FISH fluorescence in situ hybridization
- the anti-vinculin antibodies can be capable of binding specifically to an epitope on vinculin or SEQ ID NO:7.
- the anti-CdtB antibodies can be capable of binding specifically to an epitope on CdtB of Campylobacter jejuni or SEQ ID NO:5.
- the diagnosis of IBS can be made if the level of anti- vinculin antibodies is higher than the established control level of anti-vinculin antibodies. In certain embodiments, the diagnosis of IBS can be made if the level of anti-CdtB antibodies is higher than the established control level of anti-CdtB antibodies. In varous embodiments, the diagnosis of IBS can be made if both levels of anti-vinculin antibodies and anti-CdtB antibodies are higher than the established control levels of anti-vinculin antibodies and anti- CdtB antibodies.
- the established control level of anti-vinculin antibodies, anti-CdtB antibodies, or both can be an optical density measurement.
- Various embodiments of the present invention provide for a method of selecting a treatment for irritable bowel syndrome (IBS), inflammatory bowel disease (IBD), or celiac disease, comprising: obtaining a biological sample from a subject desiring a diagnosis to distinguish IBS from IBD, celiac disease, or both; detecting in the biological sample, levels of anti-vinculin and anti-CdtB antibodies; making a diagnosis of IBS if the level of anti-vinculin antibodies is higher than an established control level of anti-vinculin antibodies, the level of anti-CdtB antibodies is higher than an established control level of anti-CdtB antibodies, or both levels of anti-vinculin antibodies and anti-CdtB antibodies are higher than the established control levels of anti-vinculin antibodies and anti-CdtB antibodies, or making a diagnosis of IBD, suspicion of IBD, celiac disease or suspicion of celiac disease if the level of anti-vinculin antibodies is not higher than the established control level of
- the biological sample can be whole blood, serum, or plasma.
- detecting in the biological sample can comprise using enzyme-linked immunosorbent assay (ELISA).
- detecting in the biological sample can comprise using immunohistochemistry, flow cytometry, fluorescence in situ hybridization (FISH), radioimmuno assays, or affinity purification.
- ELISA enzyme-linked immunosorbent assay
- FISH fluorescence in situ hybridization
- the anti-vinculin antibodies can be capable of binding specifically to an epitope on vinculin or SEQ ID NO:7.
- the anti-CdtB antibodies can be capable of binding specifically to an epitope on CdtB of Campylobacter jejuni or SEQ ID NO:5.
- the established control level of anti-vinculin antibodies, anti-CdtB antibodies, or both can be an optical density measurement.
- the diagnosis of IBS can be made if the level of anti- vinculin antibodies is higher than the established control level of anti-vinculin antibodies. In certain embodiments, the diagnosis of IBS can be made if the level of anti-CdtB antibodies is higher than the established control level of anti-CdtB antibodies. In certain embodiments, the diagnosis of IBS can be made if both levels of anti-vinculin antibodies and anti-CdtB antibodies are higher than the established control levels of anti-vinculin antibodies and anti- CdtB antibodies.
- Figure 1A depicts comparison of anti-CdtB antibody OD among the groups in accordance with various embodiments of the present invention.
- Figure IB depicts comparison of optical density (OD) for the anti-CdtB antibody among the groups. Dots represent outlier subjects beyond the whisker plot. Titers were higher in IBS subjects in comparison to any other group (p ⁇ 0.001) Titers were higher in subjects with celiac disease as compared to healthy controls and IBD subjects (p ⁇ 0.001)
- Figure 2A depicts comparison of anti-vinculin antibody OD among the groups in accordance with various embodiments of the present invention.
- Figure 2B depicts comparison of optical density (OD) for the anti-vinculin antibody among the groups. Dots represent outlier subjects beyond the whisker plot. Titers were higher in IBS subjects as compared to any other group (p ⁇ 0.001)
- Figure 3A depicts receiver operator curve (ROC) comparing anti-CdtB and anti-vinculin levels between IBS subjects and all non-IBS subjects in the study in accordance with various embodiments of the present invention.
- ROC receiver operator curve
- Figure 3B depicts receiver operator curve (ROC) comparing anti-CdtB and anti-vinculin levels between IBS subjects and IBD subjects in the study.
- AUC Area under the curve; CI, confidence interval.
- Figure 3C depicts receiver operator curve (ROC) comparing anti-CdtB and anti-vinculin levels between IBS subjects and healthy subjects in the study. (Anti-CdtB - top line; anti-vinculin - bottom line.)
- Figure 4 depicts receiver operator curve (ROC) comparing anti-CdtB and anti- vinculin levels between IBS subjects and all IBD subjects in the study in accordance with various embodiments of the present invention.
- ROC receiver operator curve
- Figure 5 depicts receiver operator curve (ROC) comparing anti-CdtB and anti- vinculin levels between IBS and celiac subjects.
- ROC receiver operator curve
- Figure 6 depicts receiver operator curve (ROC) comparing anti-CdtB and anti- vinculin levels between IBS and non-IBS subjects with chronic diarrhea (i.e., CD, UC and celiac disease).
- ROC receiver operator curve
- Figure 7 depicts receiver operator curve (ROC) comparing anti-CdtB and anti- vinculin levels between IBS and CD subjects. (Anti-CdtB - top line; anti-vinculin - bottom line.)
- Figure 8 depicts receiver operator curve (ROC) comparing anti-CdtB and anti- vinculin levels between IBS and UC subjects.
- ROC receiver operator curve
- mammal refers to any member of the class Mammalia, including, without limitation, humans and nonhuman primates such as chimpanzees, and other apes and monkey species; farm animals such as cattle, sheep, pigs, goats and horses; domestic mammals such as dogs and cats; laboratory animals including rodents such as mice, rats and guinea pigs, and the like.
- the term does not denote a particular age or sex. Thus adult and newborn subjects, as well as fetuses, whether male or female, are intended to be including within the scope of this term.
- Treatment and “treating,” as used herein refer to both therapeutic treatment and prophylactic or preventative measures (e.g., to reduce the likelihood of having the condition or disease condition), wherein the object is to prevent or slow down (lessen) the targeted pathologic condition or disorder even if the treatment is ultimately unsuccessful.
- Those in need of treatment include those already with the condition or disorder as well as those prone to have the condition or disorder or those in whom the condition or disorder is to be prevented (e.g., reducing the likelihood of having the condition or disorder).
- Antibody or “antibodies” as used herein include polyclonal antibodies, monoclonal antibodies, antibody variants such as single chain (recombinant) Fv, human antibodies, humanized antibodies, chimeric antibodies, and immunologically active fragments of antibodies.
- Boinds specifically refers to the act of an antibody binding to its antigen and is intended to exclude low-level, non-specific binding that may occur between random proteins. "Binds specifically” as used herein is not intended and does not imply that the antibody will not bind to any protein other than the proteins or polypeptides as disclosed herein since antibodies can cross-react with any protein that includes the relevant epitope.
- PI-IBS post-infectious IBS
- Campylobacter jejuni A newly validated animal model of post-infectious IBS (PI-IBS) based on infection with Campylobacter jejuni suggests that AGE precipitates PI-IBS, leading to significant alterations in small bowel microbial colonization.
- CdtB cytolethal distending toxin B
- the presence of circulating antibodies to CdtB and vinculin in the animal model is associated with the development of altered gut microbial populations and changes in the gut neuromuscular apparatus, including significant reductions in the numbers of interstitial cells of Cajal (ICC) in the deep muscular plexus.
- ICC Cajal
- Described herein we describe a biomarker for D-IBS based on, without wishing to being bound by any specific theory, a pathophysiologic mechanism of postinfectious IBS and the subsequent development of autoantibodies to vinculin in the host. The test appears specific not only for diagnosing D-IBS but in the workup of chronic diarrhea, can differentiate D-IBS subjects from those with IBD.
- PI-IBS occurs primarily, though not exclusively, after bacterial infections such as Campylobacter jejuni, Salmonella, E. coli and Shigella.
- Salmonella Salmonella
- E. coli Salmonella
- Shigella Shigella.
- One toxin commonly produced by all four of these organisms is cyto lethal distending toxin, a heterotrimeric complex of three subunits, CdtA, CdtB, and CdtC, of which CdtB is the active subunit.
- a validated animal model developed using C. jejuni 81-176 has been shown to exhibit an IBS-like phenotype. Significantly, these rats exhibit changes in stool form, small intestinal bacterial overgrowth (SIBO) and the increased rectal intra-epithelial lymphocytes characteristic of humans with IBS. In this model the effects appeared to be due to changes in gut neuroanatomy, with a notable reduction in interstitial cells of Cajal. Further, rats infected with a mutant C. jejuni strain lacking CdtB exhibited a significantly mitigated IBS-like phenotype compared to those infected with wild-type C. jejuni, suggesting that CdtB was important in the development of IBS in this model.
- SIBO small intestinal bacterial overgrowth
- CdtB appeared not to simply be acting through direct toxicity but rather through the cross-reaction of antibodies to CdtB with the host protein vinculin.
- levels of circulating antibodies to CdtB and vinculin correlated with the development and levels of SIBO in these animals.
- Vinculin is a 117-kDa cytoplasmic actin-binding protein that is a key component of both focal adhesions and adherens junctions, forming the link between integrins or cadherins respectively and the actin cytoskeleton. Furthermore, vinculin appears important in neuronal cell motility and contractility and cardiac formation, as evidenced by the neural tube, myocardial and endocardial defects in vinculin knockout mice, as well as stress-induced cardiomyopathy in heterozygous mutants.
- Cdt from Helicobacter pullorum has been shown to target vinculin in intestinal epithelial cells, triggering an atypical derealization of vinculin from focal adhesions coupled with decreased cellular adherence.
- Another study demonstrated that vinculin is used by the IpA toxin of Shigella to achieve cell entry.
- the test has a high specificity for identifying D-IBS compared to IBD. Since tTG is a robust test for celiac disease, in the workup of chronic diarrhea, a real unmet need is a biomarker that could reliably distinguish IBS from IBD. Interestingly anti-CdtB, but not anti-vinculin, was high in celiac disease as well. Another significant unmet need for celiac disease is a test that readily distinguishes functional symptoms from ongoing gluten exposure. Studies suggest that after gluten exposure, IBS is the second most common cause of non-responsive celiac disease, and therefore, a test that could distinguish between these causes of symptoms would be useful clinically.
- circulating anti-CdtB and anti-vinculin antibodies are biomarkers for D-IBS and offer some unique perspectives on the pathophysiology of PI-IBS. While not wishing to be bound by any particular theory, first, these are biomarkers based on a mechanism for the development of IBS which may involve alterations to the enteric nervous system and gut motility. Secondly, they represent the first opportunity to make IBS a diagnosis of inclusion rather than a "diagnosis of exclusion". Since not all D-IBS subjects test positive for these biomarkers, it is also possible that these antibodies identify a subgroup of IBS for which a mechanism and therapies could be developed. Finally, it suggests that IBS may have an organic basis.
- measurements of anti-vinculin and anti-CdtB antibodies could help to identify D-IBS without excessive investigation and may help to target investigations in those where the test is negative.
- the test has a lower specificity for identifying D-IBS compared to celiac disease, concomitant testing with anti-tTG should compensate for this.
- Various embodiments of the present invention provide for methods, assays and systems of distinguishing IBS from IBD and Celiac disease.
- the method can comprise providing a biological sample from a subject desiring a diagnosis to distinguish IBS from IBD and Celiac disease, detecting in the biological sample, a presence of anti-vinculin antibodies, and making a diagnosis of IBS if the presence of anti-vinculin antibodies is detected, or making a diagnosis of IBD, suspicion of IBD, Celiac disease or suspicion of Celiac disease if there is an absence of anti-vinculin antibodies.
- the method further comprises analyzing the biological sample for the presence or absence of anti-vinculin antibodies.
- the method further comprises selecting an IBS treatment if IBS is diagnosed, selecting an IBD treatment if IBD is diagnosed or suspected, or selecting a Celiac disease treatment of Celiac disease is diagnosed or suspected.
- the method can comprise providing a biological sample from a subject desiring a diagnosis to distinguish IBS from IBD and Celiac disease, detecting in the biological sample, a level of anti-vinculin antibodies, and making a diagnosis of IBS if the level of anti-vinculin antibodies is higher than an established control level, or making a diagnosis of IBD, suspicion of IBD, Celiac disease, or suspicion of Celiac disease if the level of anti-vinculin antibodies is equal or lower than the established control level.
- the established control level is a level of anti-vinculin antibodies within two standard deviations of anti-vinculin antibody levels from healthy subjects without IBS, IBD, Celiac disease or combinations thereof.
- the method further comprises analyzing the biological sample for a level of anti-vinculin antibodies.
- the method can comprise providing a biological sample from a subject desiring a diagnosis to distinguish IBS from IBD and Celiac disease, detecting in the biological sample, a level of anti-vinculin antibodies, and making a diagnosis of IBS if the level of anti-vinculin antibodies is significantly higher than an established control level, or making a diagnosis of IBD, suspicion of IBD, Celiac disease or suspicion of Celiac disease if the level of anti-vinculin antibodies is not significantly higher than the established control level.
- the established control level is a level of anti-vinculin antibodies from subjects without IBS, IBD, Celiac disease or combinations thereof.
- the method further comprises analyzing the biological sample for a level of anti-vinculin antibodies.
- the method further comprises selecting an IBS treatment if IBS is diagnosed, selecting an IBD treatment if IBD is diagnosed or suspected, or selecting a Celiac disease treatment of Celiac disease is diagnosed or suspected.
- the method can comprise providing a biological sample from a subject desiring a diagnosis to distinguish IBS from IBD and Celiac disease, detecting in the biological sample, a presence of anti-CdtB antibodies, and making a diagnosis of IBS if the presence of anti-CdtB antibodies is detected, or making a diagnosis of IBD, suspicion of IBD, Celiac disease or suspicion of Celiac disease if there is an absence of anti-CdtB antibodies.
- the method further comprises analyzing the biological sample for the presence or absence of anti-CdtB antibodies.
- the method further comprises selecting an IBS treatment if IBS is diagnosed, selecting an IBD treatment if IBD is diagnosed or suspected, or selecting a Celiac treatment if Celiac disease is diagnosed or suspected.
- the method can comprise providing a biological sample from a subject desiring a diagnosis to distinguish IBS from IBD and Celiac disease, detecting in the biological sample, a level of anti-CdtB antibodies, and making a diagnosis of IBS if the level of anti-CdtB antibodies is higher than an established control level, or making a diagnosis of IBD, suspicion of IBD, Celiac disease or suspicion of Celiac disease if the level of anti-CdtB antibodies is equal or lower than the established control level.
- the established control level is a level of anti-CdtB antibodies within two standard deviations of anti-CdtB antibody levels from healthy subjects without IBS, IBD, Celiac disease or combinations thereof.
- the method further comprises analyzing the biological sample for a level of anti-CdtB antibodies. In certain embodiments, the method further comprises selecting an IBS treatment if IBS is diagnosed, selecting an IBD treatment if IBD is diagnosed or suspected, or selecting a Celiac disease treatment of Celiac disease is diagnosed or suspected.
- the method can comprise providing a biological sample from a subject desiring a diagnosis to distinguish IBS from IBD and Celiac disease, detecting in the biological sample, a level of anti-CdtB antibodies, and making a diagnosis of IBS if the level of anti-CdtB antibodies is significantly higher than an established control level, or making a diagnosis of IBD, suspicion of IBD, Celiac disease or suspicion of Celiac disease if the level of anti-CdtB antibodies is not significantly higher than the established control level.
- the established control level is a level of anti-CdtB antibodies from subjects without IBS, IBD, Celiac disease or combinations thereof.
- the method further comprises analyzing the biological sample for a level of anti-CdtB antibodies.
- the method further comprises selecting an IBS treatment if IBS is diagnosed, or selecting an IBD treatment if IBD is diagnosed or suspected.
- the method can comprise providing a biological sample from a subject desiring a diagnosis to distinguish IBS from IBD and Celiac disease, detecting in the biological sample, a presence of anti-vinculin and anti-CdtB antibodies, and making a diagnosis of IBS if the presence of anti-vinculin and anti-CdtB antibodies are detected, or making a diagnosis of IBD, suspicion of IBD, Celiac disease or suspicion of Celiac disease if there are an absence of anti-vinculin and anti-CdtB antibodies.
- the method further comprises analyzing the biological sample for the presence or absence of anti-vinculin and anti-CdtB antibodies.
- the method further comprises selecting an IBS treatment if IBS is diagnosed, selecting an IBD treatment if IBD is diagnosed or suspected, or selecting a Celiac treatment if Celiac disease is diagnosed or suspected.
- the method can comprise providing a biological sample from a subject desiring a diagnosis to distinguish IBS from IBD and Celiac disease, detecting in the biological sample, a level of anti-vinculin and anti-CdtB antibodies, and making a diagnosis of IBS if the levels of anti-vinculin and anti-CdtB antibodies are higher than an established control level, or making a diagnosis of IBD, suspicion of IBD, Celiac disease or suspicion of Celiac disease if the levels of anti-vinculin and anti-CdtB antibodies are equal or lower than the established control levels.
- the established control levels are levels of anti-vinculin and anti-CdtB antibodies within two standard deviations of anti-vinculin and anti-CdtB antibody levels from healthy subjects without IBS, IBD, Celiac disease or combinations thereof.
- the method further comprises analyzing the biological sample levels of anti-vinculin and anti- CdtB antibodies.
- the method further comprises selecting an IBS treatment if IBS is diagnosed, selecting an IBD treatment if IBD is diagnosed or suspected, or selecting a Celiac disease treatment if Celiac disease is diagnosed or suspected.
- the method can comprise providing a biological sample from a subject desiring a diagnosis to distinguish between IBS and IBD, detecting in the biological sample, a level of anti-vinculin and anti-CdtB antibodies, and making a diagnosis of IBS if the level of anti-vinculin and anti-CdtB antibodies is significantly higher than an established control level, or making a diagnosis of IBD, suspicion of IBD, Celiac disease or suspicion of Celiac disease if the level of anti-vinculin and anti-CdtB antibodies is not significantly higher than the established control levels.
- the established control levels are levels of anti-vinculin and anti-CdtB antibodies from subjects without IBS, IBD, Celiac disease or combinations thereof.
- the method further comprises analyzing the biological sample for levels of anti-vinculin and anti- CdtB antibodies. In certain embodiments, the method further comprises selecting an IBS treatment if IBS is diagnosed, selecting an IBD treatment if IBD is diagnosed or suspected, or selecting a Celiac disease treatment if Celiac disease is diagnosed or suspected.
- the system can comprise an isolated biological sample from a subject desiring distinguishing IBS from IBD and Celiac disease, and an assay for detecting in the biological sample, a presence of an anti-vinculin antibody or a level of anti-vinculin antibody to distinguish IBS from IBD and Celiac disease.
- the IBS can be C-IBS, D-IBS, A-IBS (also known as
- the IBS is D-IBS.
- a diagnosis or suspicion of IBD if a diagnosis or suspicion of IBD is made, it can be further correlated with IBD symptoms to further confirm IBD. In other embodiments, additional IBD testing can be done to further confirm IBD. [0068] In various embodiments, if a diagnosis or suspicion of Celiac disease is made, it can be further correlated with Celiac disease symptoms to further confirm Celiac disease. In other embodiments, additional celiac disease testing can be done to further confirm Celiac disease; for example, measurement of serum tissue transglutaminase.
- the assay is an enzyme-linked immunosorbent assay
- ELISA including but not limited to indirect ELISA, sandwich ELISA, competitive ELISA, multiple and portable ELISA.
- the assay comprises a first reagent to react with the biological sample if the biological sample comprises the anti-vinculin antibody (if anti- vinculin antibodies are not present, then the first reagent will not react the biological sample, but the first reagent is still present in the assay), a second reagent (e.g., secondary antibody) to react with the anti-vinculin antibody or a second reagent to react with the first reagent, and a substrate.
- the first reagent is vinculin or a fragment thereof.
- the second reagent comprises a label to produce a signal to indicate the presence of the anti-vinculin antibody.
- the label is a radiolabel, a chromophore, a fluorophore, a quantum dot, an enzyme, horseradish peroxidase (HRP), an alkaline phosphatase (AP), biotin, or a combination thereof.
- the label is an enzyme that will react with the substrate.
- the first reagent is on a solid phase (e.g., plate, multi-well plate).
- the assay comprises a first reagent to react with the anti-vinculin antibody.
- the first reagent comprises a label to produce a signal to indicate the presence of the anti-vinculin antibody.
- the label is a radiolabel, a chromophore, a fluorophore, a quantum dot, an enzyme, horseradish peroxidase (HRP), an alkaline phosphatase (AP), biotin, or a combination thereof.
- the reagent is on a solid phase (e.g., plate, multi-well plate).
- the system further comprises a machine for determining a presence or likely presence of IBS if the presence of anti-vinculin antibodies, anti-CdtB antibodies or both is detected, or determining the presence or likely presence of IBD or Celiac disease if there is an absence of anti-vinculin antibodies, anti-CdtB antibodies or both.
- the machine is a computer.
- the computer comprises a display element for displaying whether the patient likely has IBS, IBD or Celiac disease.
- the system further comprises a machine for determining a presence or likely presence of IBS if the level of anti-vinculin antibodies, anti- CdtB antibodies, or both is higher than an established control level(s), or determining a presence or likely presence of IBD if the level of anti-vinculin antibodies, anti-CdtB antibodies, or both is equal or lower than the established control level(s).
- the established control level is a level of anti-vinculin antibodies, anti-CdtB antibodies, or both within two standard deviations of the level of anti-vinculin antibodies, anti-CdtB antibodies, or both from healthy subjects without IBS, IBD, Celiac disease or combinations thereof.
- the method further comprises analyzing the biological sample for a level of anti-vinculin antibodies.
- the system further comprises a machine for determining a presence or likely presence of IBS if the level of anti-vinculin antibodies, anti- CdtB antibodies, or both is significantly higher than an established control level, or determining a presence or likely presence of IBD if the level of anti-vinculin antibodies, anti- CdtB antibodies, or both is not significantly higher than the established control level.
- the established control level is a level of anti-vinculin antibodies, anti- CdtB antibodies, or both from healthy subjects without IBS, IBD, Celiac disease or combinations thereof.
- the method further comprises analyzing the biological sample for a level of anti-vinculin antibodies, anti-CdtB antibodies, or both.
- the machine is a computer.
- the computer comprises a display element for displaying whether the patient likely has IBS, IBD or Celiac disease.
- Various embodiments provide for treating IBS in a subject who may have IBS,
- the method comprises providing an IBS therapy and administering the IBS therapy to a subject diagnosed with IBS using the methods of the present invention. That is, the subject has been diagnosed with IBS via the detection of the presence of anti- vinculin and anti-CdtB antibodies in accordance with the methods of the present invention as discussed herein.
- the IBS therapy is a therapy as described herein.
- the IBS therapy comprises administering a course of antibiotic therapy to treat IBS.
- the IBS therapy is an available therapy in the prior art.
- the IBS therapy is a course of antibiotic therapy as described herein.
- the IBS treated can be C-IBS, D-IBS, A-IBS (also known as M-IBS), or post-infectious irritable bowel syndrome (PI-IBS).
- the IBS is D-IBS.
- Various embodiments of the present invention provide for methods, assays and systems of distinguishing between IBS and IBD.
- the method can comprise providing a biological sample from a subject desiring a diagnosis to distinguish between IBS and IBD, detecting in the biological sample, a presence of anti-vinculin antibodies, and making a diagnosis of IBS if the presence of anti- vinculin antibodies is detected, or making a diagnosis of IBD or suspicion of IBD if there is an absence of anti-vinculin antibodies.
- the method further comprises analyzing the biological sample for the presence or absence of anti-vinculin antibodies.
- the method further comprises selecting an IBS treatment if IBS is diagnosed, or selecting an IBD treatment if IBD is diagnosed or suspected.
- the method can comprise providing a biological sample from a subject desiring a diagnosis to distinguish between IBS and IBD, detecting in the biological sample, a level of anti-vinculin antibodies, and making a diagnosis of IBS if the level of anti-vinculin antibodies is higher than an established control level, or making a diagnosis of IBD or suspicion of IBD if the level of anti-vinculin antibodies is equal or lower than the established control level.
- the established control level is a level of anti-vinculin antibodies within two standard deviations of anti-vinculin antibody levels from healthy subjects without IBS, IBD or both.
- the method further comprises analyzing the biological sample for a level of anti-vinculin antibodies.
- the method can comprise providing a biological sample from a subject desiring a diagnosis to distinguish between IBS and IBD, detecting in the biological sample, a level of anti-vinculin antibodies, and making a diagnosis of IBS if the level of anti-vinculin antibodies is significantly higher than an established control level, or making a diagnosis of IBD or suspicion of IBD if the level of anti-vinculin antibodies is not significantly higher than the established control level.
- the established control level is a level of anti-vinculin antibodies from subjects without IBS, IBD or both.
- the method further comprises analyzing the biological sample for a level of anti-vinculin antibodies.
- the method further comprises selecting an IBS treatment if IBS is diagnosed, or selecting an IBD treatment if IBD is diagnosed or suspected.
- the method can comprise providing a biological sample from a subject desiring a diagnosis to distinguish between IBS and IBD, detecting in the biological sample, a presence of anti-CdtB antibodies, and making a diagnosis of IBS if the presence of anti-CdtB antibodies is detected, or making a diagnosis of IBD or suspicion of IBD if there is an absence of anti-CdtB antibodies.
- the method further comprises analyzing the biological sample for the presence or absence of anti-CdtB antibodies.
- the method further comprises selecting an IBS treatment if IBS is diagnosed, or selecting an IBD treatment if IBD is diagnosed or suspected.
- the method can comprise providing a biological sample from a subject desiring a diagnosis to distinguish between IBS and IBD, detecting in the biological sample, a level of anti-CdtB antibodies, and making a diagnosis of IBS if the level of anti-CdtB antibodies is higher than an established control level, or making a diagnosis of IBD or suspicion of IBD if the level of anti-CdtB antibodies is equal or lower than the established control level.
- the established control level is a level of anti-CdtB antibodies within two standard deviations of anti-CdtB antibody levels from healthy subjects without IBS, IBD or both.
- the method further comprises analyzing the biological sample for a level of anti-CdtB antibodies.
- the method further comprises selecting an IBS treatment if IBS is diagnosed, or selecting an IBD treatment if IBD is diagnosed or suspected.
- the method can comprise providing a biological sample from a subject desiring a diagnosis to distinguish between IBS and IBD, detecting in the biological sample, a level of anti-CdtB antibodies, and making a diagnosis of IBS if the level of anti-CdtB antibodies is significantly higher than an established control level, or making a diagnosis of IBD or suspicion of IBD if the level of anti-CdtB antibodies is not significantly higher than the established control level.
- the established control level is a level of anti-CdtB antibodies from subjects without IBS, IBD or both.
- the method further comprises analyzing the biological sample for a level of anti-CdtB antibodies.
- the method further comprises selecting an IBS treatment if IBS is diagnosed, or selecting an IBD treatment if IBD is diagnosed or suspected.
- the method can comprise providing a biological sample from a subject desiring a diagnosis to distinguish between IBS and IBD, detecting in the biological sample, a presence of anti-vinculin and anti-CdtB antibodies, and making a diagnosis of IBS if the presence of anti-vinculin and anti-CdtB antibodies is detected, or making a diagnosis of IBD or suspicion of IBD if there are an absence of anti-vinculin and anti-CdtB antibodies.
- the method further comprises analyzing the biological sample for the presence or absence of anti-vinculin and anti-CdtB antibodies. In certain embodiments, the method further comprises selecting an IBS treatment if IBS is diagnosed, or selecting an IBD treatment if IBD is diagnosed or suspected.
- the method can comprise providing a biological sample from a subject desiring a diagnosis to distinguish between IBS and IBD, detecting in the biological sample, a level of anti-vinculin and anti-CdtB antibodies, and making a diagnosis of IBS if the levels of anti-vinculin and anti-CdtB antibodies are higher than an established control level, or making a diagnosis of IBD or suspicion of IBD if the levels of anti-vinculin and anti-CdtB antibodies are equal or lower than the established control levels.
- the established control levels are levels of anti-vinculin and anti- CdtB antibodies within two standard deviations of anti-vinculin and anti-CdtB antibody levels from healthy subjects without IBS, IBD or both.
- the method further comprises analyzing the biological sample levels of anti-vinculin and anti-CdtB antibodies.
- the method further comprises selecting an IBS treatment if IBS is diagnosed, or selecting an IBD treatment if IBD is diagnosed or suspected.
- the method can comprise providing a biological sample from a subject desiring a diagnosis to distinguish between IBS and IBD, detecting in the biological sample, a level of anti-vinculin and anti-CdtB antibodies, and making a diagnosis of IBS if the level of anti-vinculin and anti-CdtB antibodies is significantly higher than an established control level, or making a diagnosis of IBD or suspicion of IBD if the level of anti-vinculin and anti-CdtB antibodies is not significantly higher than the established control levels.
- the established control levels are levels of anti- vinculin and anti-CdtB antibodies from subjects without IBS, IBD or both.
- the method further comprises analyzing the biological sample for levels of anti-vinculin and anti-CdtB antibodies. In certain embodiments, the method further comprises selecting an IBS treatment if IBS is diagnosed, or selecting an IBD treatment if IBD is diagnosed or suspected.
- the system can comprise an isolated biological sample from a subject desiring distinguishing between IBS and IBD, and an assay for detecting in the biological sample, a presence of an anti-vinculin antibody or a level of anti- vinculin antibody to distinguish between IBS and IBD.
- the IBS can be C-IBS, D-IBS, A-IBS (also known as
- the IBS is D-IBS.
- a diagnosis or suspicion of IBD is made, it can be further correlated with IBD symptoms to further confirm IBD. In other embodiments, additional IBD testing can be done to further confirm IBD.
- the assay is an enzyme-linked immunosorbent assay
- ELISA including but not limited to indirect ELISA, sandwich ELISA, competitive ELISA, multiple and portable ELISA.
- the assay comprises a first reagent to react with the biological sample if the biological sample comprises the anti-vinculin antibody (if anti- vinculin antibodies are not present, then the first reagent will not react the biological sample, but the first reagent is still present in the assay), a second reagent (e.g., secondary antibody) to react with the anti-vinculin antibody or a second reagent to react with the first reagent, and a substrate.
- the first reagent is vinculin or a fragment thereof.
- the second reagent comprises a label to produce a signal to indicate the presence of the anti-vinculin antibody.
- the label is a radiolabel, a chromophore, a fluorophore, a quantum dot, an enzyme, horseradish peroxidase (HRP), an alkaline phosphatase (AP), biotin, or a combination thereof.
- the label is an enzyme that will react with the substrate.
- the first reagent is on a solid phase (e.g., plate, multi-well plate).
- the assay comprises a first reagent to react with the anti-vinculin antibody.
- the first reagent comprises a label to produce a signal to indicate the presence of the anti-vinculin antibody.
- the label is a radiolabel, a chromophore, a fluorophore, a quantum dot, an enzyme, horseradish peroxidase (HRP), an alkaline phosphatase (AP), biotin, or a combination thereof.
- the reagent is on a solid phase (e.g., plate, multi-well plate).
- the system further comprises a machine for determining a presence or likely presence of IBS if the presence of anti-vinculin antibodies, anti-CdtB antibodies or both is detected, or determining the presence or likely presence of IBD if there is an absence of anti-vinculin antibodies, anti-CdtB antibodies or both.
- the machine is a computer.
- the computer comprises a display element for displaying whether the patient likely has IBS or IBD.
- the system further comprises a machine for determining a presence or likely presence of IBS if the level of anti-vinculin antibodies, anti- CdtB antibodies, or both is higher than an established control level(s), or determining a presence or likely presence of IBD if the level of anti-vinculin antibodies, anti-CdtB antibodies, or both is equal or lower than the established control level(s).
- the established control level is a level of anti-vinculin antibodies, anti-CdtB antibodies, or both within two standard deviations of the level of anti-vinculin antibodies, anti-CdtB antibodies, or both from healthy subjects without IBS, IBD or both.
- the method further comprises analyzing the biological sample for a level of anti-vinculin antibodies.
- the system further comprises a machine for determining a presence or likely presence of IBS if the level of anti-vinculin antibodies, anti- CdtB antibodies, or both is significantly higher than an established control level, or determining a presence or likely presence of IBD if the level of anti-vinculin antibodies, anti- CdtB antibodies, or both is not significantly higher than the established control level.
- the established control level is a level of anti-vinculin antibodies, anti- CdtB antibodies, or both from healthy subjects without IBS, IBD or both.
- the method further comprises analyzing the biological sample for a level of anti-vinculin antibodies, anti-CdtB antibodies, or both.
- the machine is a computer.
- the computer comprises a display element for displaying whether the patient likely has IBS or IBD.
- the method comprises: providing a biological sample from a subject desiring diagnosis of IBS, detecting in the biological sample, a presence of anti-vinculin and anti-CdtB antibodies, and determining a presence or likely presence of IBS if the presence of anti-vinculin and anti-CdtB antibodies are detected, or determining an absence or likely absence of IBS if the absence of anti-vinculin and anti-CdtB antibodies are detected.
- the method further comprises analyzing the biological sample for the presence or absence of anti-vinculin and anti-CdtB antibodies.
- the method comprises: providing a biological sample from a subject desiring diagnosis of IBS, detecting in the biological sample, a level of anti- vinculin and anti-CdtB antibodies, and determining a presence or likely presence of IBS if the level of an anti-vinculin and anti-CdtB antibody is higher than an established control level, or determining the absence or likely absence of IBS if the level of anti-vinculin and anti-CdtB antibody is equal or lower than the established control level.
- the established control level is a level of anti-vinculin and anti-CdtB antibodies within two standard deviations of anti-vinculin and anti-CdtB antibody levels from subjects without IBS.
- the method further comprises analyzing the biological sample for a level of anti-vinculin and anti-CdtB antibodies.
- the method comprises: providing a biological sample from a subject desiring diagnosis of IBS, detecting in the biological sample, a level of anti- vinculin and anti-CdtB antibodies, and determining a presence or likely presence of IBS if the level of anti-CdtB antibodies is significantly higher than an established control level, or determining the absence or likely absence of IBS if the level of anti-vinculin and anti-CdtB antibodies is not significantly higher than the established control level.
- the established control level is a level of anti-vinculin and anti-CdtB antibodies from subjects without IBS.
- the method further comprises analyzing the biological sample for a level of anti-vinculin and anti-CdtB antibodies.
- the method comprises: providing a biological sample from a subject desiring diagnosis of IBS, detecting in the biological sample, a presence of anti-vinculin antibodies, and determining a presence or likely presence of IBS if the presence of anti-vinculin antibodies are detected, or determining an absence or likely absence of IBS if there is an absence of anti-vinculin antibodies.
- the method further comprises analyzing the biological sample for the presence or absence of anti-vinculin antibodies.
- the method comprises: providing a biological sample from a subject desiring diagnosis of IBS, detecting in the biological sample, a level of anti- vinculin antibodies, and determining a presence or likely presence of IBS if the level of an anti-vinculin antibody is higher than an established control level, or determining the absence or likely absence of IBS if the level of an anti-vinculin antibody is equal or lower than the established control level.
- the established control level is a level of anti-vinculin antibodies within two standard deviations of anti-vinculin antibody levels from subjects without IBS.
- the method further comprises analyzing the biological sample for a level of anti-vinculin antibodies.
- the method comprises: providing a biological sample from a subject desiring diagnosis of IBS, detecting in the biological sample, a level of anti- vinculin antibodies, and determining a presence or likely presence of IBS if the level of anti- vinculin antibodies is significantly higher than an established control level, or determining the absence or likely absence of IBS if the level of anti-vinculin antibodies is not significantly higher than the established control level.
- the established control level is a level of anti-vinculin antibodies from subjects without IBS.
- the method further comprises analyzing the biological sample for a level of anti-vinculin antibodies.
- the method comprises: providing a biological sample from a subject desiring diagnosis of IBS, detecting in the biological sample, a presence of anti-CdtB antibodies, and determining a presence or likely presence of IBS if the presence of anti-CdtB antibodies are detected, or determining an absence or likely absence of IBS if there is an absence of anti-CdtB antibodies.
- the method further comprises analyzing the biological sample for the presence or absence of anti-CdtB antibodies.
- the method comprises: providing a biological sample from a subject desiring diagnosis of IBS, detecting in the biological sample, a level of anti- CdtB antibodies, and determining a presence or likely presence of IBS if the level of an anti- CdtB antibody is higher than an established control level, or determining the absence or likely absence of IBS if the level of an anti-CdtB antibody is equal or lower than the established control level.
- the established control level is a level of anti-CdtB antibodies within two standard deviations of anti-CdtB antibody levels from subjects without IBS.
- the method further comprises analyzing the biological sample for a level of anti-CdtB antibodies.
- the method comprises: providing a biological sample from a subject desiring diagnosis of IBS, detecting in the biological sample, a level of anti- CdtB antibodies, and determining a presence or likely presence of IBS if the level of anti- CdtB antibodies is significantly higher than an established control level, or determining the absence or likely absence of IBS if the level of anti-CdtB antibodies is not significantly higher than the established control level.
- the established control level is a level of anti-CdtB antibodies from subjects without IBS.
- the method further comprises analyzing the biological sample for a level of anti-CdtB antibodies.
- the IBS can be C-IBS, D-IBS, A-IBS (also known as
- the IBS is D-IBS.
- the system comprises: an isolated biological sample from a subject desiring diagnosis of IBS, and an assay for detecting in the biological sample, a presence or level of anti-vinculin and anti-CdtB antibodies.
- the system comprises: an isolated biological sample from a subject desiring diagnosis of IBS, and an assay for detecting in the biological sample, a presence or level of an anti-vinculin antibody.
- the system comprises: an isolated biological sample from a subject desiring diagnosis of IBS, and an assay for detecting in the biological sample, a presence or level of an anti-CdtB antibody.
- the assay is an enzyme-linked immunosorbent assay
- ELISA including but not limited to indirect ELISA, sandwich ELISA, competitive ELISA, multiple and portable ELISA.
- the assay comprises a first reagent to react with the biological sample, a second reagent (e.g., secondary antibody) to react with the anti-vinculin antibody, and a substrate.
- the first reagent is vinculin or a fragment thereof, which will react with the anti-vinculin antibody if present in the biological sample.
- the second reagent comprises a label to produce a signal to indicate the presence of the anti-vinculin antibody.
- the label is a radiolabel, a chromophore, a fluorophore, a quantum dot, an enzyme, horseradish peroxidase (HRP), an alkaline phosphatase (AP), biotin, or a combination thereof.
- the label is an enzyme that will react with the substrate.
- the first reagent is on a solid phase (e.g., plate, multi-well plate).
- the assay comprises a first reagent to react with the anti-vinculin antibody.
- the first reagent comprises a label to produce a signal to indicate the presence of the anti-vinculin antibody.
- the label is a radiolabel, a chromophore, a fluorophore, a quantum dot, an enzyme, horseradish peroxidase (HRP), an alkaline phosphatase (AP), biotin, or a combination thereof.
- the reagent is on a solid phase (e.g., plate, multi-well plate).
- the system further comprises a machine for determining a presence or likely presence of IBS if the presence of anti-vinculin antibodies is detected, or determining an absence or likely absence of IBS if the absence of anti-vinculin antibodies is detected.
- the machine is a computer.
- the computer comprises a display element for displaying whether there is a presence or absence of IBS.
- the system further comprises a machine for determining a presence or likely presence of IBS if the level of anti-vinculin antibodies is higher than an established control level, or determining an absence or likely absence of the IBS if the level of anti-vinculin antibodies is equal or lower than the established control level.
- the established control level is a level of anti-vinculin antibodies within two standard deviations of anti-vinculin antibody levels from subjects without IBS.
- the method further comprises analyzing the biological sample for a level of anti-vinculin antibodies.
- the system further comprises a machine for determining a presence or likely presence of IBS if the level of anti-vinculin antibodies is significantly higher than an established control level, or determining an absence or likely absence of IBS if the level of anti-vinculin antibodies is not significantly higher than the established control level.
- the established control level is a level of anti-vinculin antibodies from subjects without IBS.
- the method further comprises analyzing the biological sample for a level of anti-vinculin antibodies.
- the assay comprises a first reagent to react with the biological sample, a second reagent (e.g., secondary antibody) to react with the anti-CdtB antibody, and a substrate.
- the first reagent is CdtB or a fragment thereof, which will react with the anti-CdtB antibody if present in the biological sample.
- the second reagent comprises a label to produce a signal to indicate the presence of the anti-CdtB antibody.
- the label is a radiolabel, a chromophore, a fluorophore, a quantum dot, an enzyme, horseradish peroxidase (HRP), an alkaline phosphatase (AP), biotin, or a combination thereof.
- the label is an enzyme that will react with the substrate.
- the first reagent is on a solid phase (e.g., plate, multi-well plate).
- the assay comprises a first reagent to react with the anti-CdtB antibody.
- the first reagent comprises a label to produce a signal to indicate the presence of the anti-CdtB antibody.
- the label is a radiolabel, a chromophore, a fluorophore, a quantum dot, an enzyme, horseradish peroxidase (HRP), an alkaline phosphatase (AP), biotin, or a combination thereof.
- the reagent is on a solid phase (e.g., plate, multi-well plate).
- the system further comprises a machine for determining a presence or likely presence of IBS if the presence of anti-CdtB antibodies is detected, or determining an absence or likely absence of IBS if the absence of anti-CdtB antibodies is detected.
- the machine is a computer.
- the computer comprises a display element for displaying whether there is a presence or absence of IBS.
- the system further comprises a machine for determining a presence or likely presence of IBS if the level of anti-CdtB antibodies is higher than an established control level, or determining an absence or likely absence of the IBS if the level of anti-CdtB antibodies is equal or lower than the established control level.
- the established control level is a level of anti-CdtB antibodies within two standard deviations of anti-CdtB antibody levels from subjects without IBS.
- the method further comprises analyzing the biological sample for a level of anti-CdtB antibodies.
- the system further comprises a machine for determining a presence or likely presence of IBS if the level of anti-CdtB antibodies is significantly higher than an established control level, or determining an absence or likely absence of IBS if the level of anti-CdtB antibodies is not significantly higher than the established control level.
- the established control level is a level of anti-CdtB antibodies from subjects without IBS.
- the method further comprises analyzing the biological sample for a level of anti-CdtB antibodies.
- the assay comprises assays (e.g., as described above) for the detection of the levels of anti-vinculin antibodies and anti-CdtB antibodies.
- the determining the presence or level of anti-vinculin antibodies and/or anti-CdtB antibodies comprises adding vinculin or a fragment thereof as discussed herein and/or CdtB or a fragment thereof as discussed herein to a biological sample from a subject desiring a determination regarding IBS, wherein anti-vinculin and/or anti- CdtB antibodies (if present in the biological sample) specifically binds to the vinculin or the fragment thereof and/or the CdtB or the fragment thereof in the biological sample; measuring the levels the anti-vinculin antibodies and the anti-CdtB antibodies in the biological sample; and identifying that the subject has IBS if the levels of the anti-vinculin antibodies is higher than the levels of the anti-CdtB antibodies.
- the assay comprises adding vinculin or a fragment thereof as discussed herein and/or CdtB or a fragment thereof as discussed herein to a biological sample from a subject desiring a determination regarding IBS, wherein anti- vinculin and/or anti-CdtB antibodies (if present in the biological sample) specifically binds to the vinculin or the fragment thereof and/or the CdtB or the fragment thereof in the biological sample; measuring the levels the anti-vinculin antibodies and the anti-CdtB antibodies in the biological sample; and identifying that the subject has IBS if the levels of the anti-vinculin antibodies is higher than the levels of the anti-CdtB antibodies.
- Various embodiments provide for a method of selecting a therapy for IBS for a subject in need thereof.
- the method comprises: detecting the presence of anti- vinculin antibodies and anti-CdtB antibodies in a subject who desires a diagnosis to distinguish IBS from IBD, Celiac Disease or both; and selecting a therapy to treat IBS.
- the method comprises: detecting the presence of anti- vinculin antibodies in a subject who desires a diagnosis to distinguish IBS from IBD, Celiac Disease or both; and selecting a therapy to treat IBS.
- the method comprises: detecting the presence of anti-
- Selecting a therapy as used herein includes but is not limited to selecting, choosing, prescribing, advising, recommending, instructing, or counseling the subject with respect to the treatment.
- the method further comprises administering the therapy to treat IBS.
- the therapy is a therapy as described herein.
- the available therapy comprises administering a course of antibiotic therapy to treat IBS.
- the therapy is an available therapy in the prior art.
- the method comprises: detecting the presence of anti- vinculin antibodies and anti-CdtB antibodies; and selecting a course of antibiotic therapy to treat IBS. In various embodiments, the method further comprises administering the course of antibiotic therapy treat IBS.
- the method comprises: detecting the presence of anti- vinculin antibodies; and selecting a course of antibiotic therapy to treat IBS. In various embodiments, the method further comprises administering the course of antibiotic therapy treat IBS.
- the method comprises: detecting the presence of anti-
- the method further comprises administering the course of antibiotic therapy treat IBS.
- detecting the presence of anti-vinculin antibodies, anti-CdtB antibodies or both can be performed as described by the methods or systems of the present invention.
- the subject can be a subject presenting one or more symptoms of IBS; for example, as discussed herein.
- antibiotics include but are not limited to aminoglycosides (e.g., amikacin, gentamicin, kanamycin, neomycin, netilmicin, streptomycin, tobramycin, paromomycin), ansamycins (e.g., geldanamycin, herbimycin), carbacephems (e.g., loracarbef), carbapenems (e.g., ertapenem, doripenem, imipenem, cilastatin, meropenem), cephalosporins (e.g., first generation: cefadroxil, cefazolin, cefalotin or cefalothin, cefalexin; second generation: cefaclor, cefamandole, cefoxitin, cefprozil, cefuroxime; third generation: cefixime, cefdinir, cefditoren, cefoperazone, cefotaxime, ce
- the antibiotics are a combination of rifaximin and neomycin. In various embodiments, the antibiotics are a combination of rifaximin and doxycycline. In various embodiments, the antibiotics are a combination of rifaximin and metronidazole. [0140] In various embodiments, the antibiotics are non-absorbable antibiotics.
- non-absorbable antibiotics include but are not limited to rifaximin, neomycin, Bacitracin, vancomycin, teicoplanin, ramoplanin, and paramomycin.
- the IBS treated can be C-IBS, D-IBS, A-IBS (also known as M-IBS), or post-infectious irritable bowel syndrome (PI-IBS).
- the IBS is D-IBS.
- Various embodiments provide for treating IBS in a subject.
- the method comprises providing an IBS therapy and administering the IBS therapy to a subject diagnosed with IBS using the methods of the present invention. That is, the subject has been diagnosed with IBS via the detection of the presence of anti-vinculin and anti-CdtB antibodies in accordance with the methods of the present invention as discussed herein.
- the IBS therapy is a therapy as described herein.
- the IBS therapy comprises administering a course of antibiotic therapy to treat IBS.
- the IBS therapy is an available therapy in the prior art.
- the IBS therapy is a course of antibiotic therapy as described herein.
- the IBS treated can be C-IBS, D-IBS, A-IBS (also known as M-IBS), or post-infectious irritable bowel syndrome (PI-IBS).
- the IBS is D-IBS.
- optical density is used to measure the level of anti-vinculin antibodies and/or anti-CDT antibodies.
- the optical density serves as the established control level in various embodiments.
- OD optical density
- these OD numbers are based on a dilution of the biological sample of 1 :32 and antigen concentration of 1.2ug/ml.
- OD of anti-CDT antibodies when the OD of anti-CDT antibodies (ODC DT ) is greater than 2.48 or 2.79, the subject is determined to have IBS. In various embodiments, when the OD of anti-CDT antibodies (OD CDT ) is greater than 2.00, 2.25, 2.50, 2.75, 3.00, the subject is determined to have IBS. In certain embodiments, these OD numbers are based on a dilution of the biological sample of 1 :512 and antigen concentration of 1.2ug/ml.
- the ODy and the ODC DT cutoff points can be determined based on different dilutions of the biological sample and the antigens and are included within the embodiments of the present invention.
- the above determinations may be used to direct the treatment for the subject.
- a subject with the likely presence of IBS or a likelihood of having IBS may be treated with one or more therapies for IBS.
- IBS based on the diagnosis of IBS.
- antibiotics such as rifaximin and neomycin can be used to treat IBS.
- rifaximin can be used to treat diarrhea-predominant IBS
- a rifaximin/neomycin combination can be used to treat constipation-predominant IBS.
- the anti-vinculin antibody detected in these methods or systems is an antibody that binds specifically to vinculin.
- the anti-vinculin antibody is an antibody that binds specifically to a 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22 residue peptide that has at least 95%, 96%, 97%, 98%, 99% or 100% homology with 5, 6, 7, 8, 9, 10,
- the anti-vinculin antibody binds specifically to a polypeptide comprising 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22 residues that has at least 95%, 96%, 97%, 98%, 99% or 100% homology with 5, 6, 7, 8, 9, 10,
- the anti-vinculin antibody binds specifically to a polypeptide comprising or consisting of 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20,
- the anti-vinculin antibody is an antibody that binds specifically to SEQ ID NO:7.
- the anti-vinculin antibody is an antibody that binds specifically to a 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22 residue peptide that has at least 95%, 96%, 97%, 98%, 99% or 100% homology with 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22 contiguous residues of SEQ ID NO:7.
- the anti-vinculin antibody binds specifically to a polypeptide comprising 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22 residues that has at least 95%, 96%, 97%, 98%, 99% or 100% homology with 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22 contiguous residues of SEQ ID NO:7.
- the anti-vinculin antibody binds specifically to a polypeptide comprising or consisting of 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22 contiguous residues of SEQ ID NO:7.
- Contiguous residues of vinculin or SEQ ID NO: 7 include those beginning at any amino acid and ending at any amino acid of vinculin or SEQ ID NO:7.
- detecting the presence or absence of the antibody is performed on a biological sample obtained from the subject. In another embodiment, detecting the presence or absence of the antibody is performed on a blood, serum, or stool sample obtained from the subject.
- detecting the presence or absence of the antibody is performed on a blood, serum, or stool sample obtained from the subject.
- methods and systems that can be used to detect the presence or absence of an antibody that binds specifically to vinculin, SEQ ID NO: 7 or a fragment thereof. These methods and systems include but are not limited to ELISA, immunohistochemistry, flow cytometry, fluorescence in situ hybridization (FISH), radioimmuno assays, and affinity purification.
- vinculin, SEQ ID NO: 7 or a fragment thereof is used as a substrate or reagent (e.g., collector, trap) to bind anti-vinculin antibodies (if present).
- reagent e.g., collector, trap
- detecting the presence or absence of an antibody that binds specifically to vinculin, SEQ ID NO: 7 or a fragment thereof may be performed by contacting vinculin, SEQ ID NO: 7 or a fragment thereof to a biological sample obtained from the subject to isolate the antibody that binds specifically to vinculin, SEQ ID NO: 7 or a fragment thereof, wherein the isolation of the antibody that binds specifically to vinculin, SEQ ID NO: 7 or a fragment thereof indicates the presence of the antibody and the lack of isolation of the antibody that binds specifically to vinculin, SEQ ID NO: 7 or a fragment thereof indicates the lack of the antibody.
- the fragment of vinculin or SEQ ID NO: 7 may be the fragments as described herein.
- an affinity matrix comprising vinculin, SEQ ID NO: 7 or a fragment thereof can be bound to a solid support; the biological sample can be contacted to the affinity matrix to produce an affinity matrix-antibody complex (if the antibody is present); the affinity matrix-antibody complex can be separated from the remainder of the biological sample; and the antibody can be released from the affinity matrix.
- a label e.g., fluorescent label
- the labeled vinculin, SEQ ID NO: 7 or a fragment thereof can be contacted with a biological sample to allow the antibody (if present) to bind specifically to the labeled vinculin, SEQ ID NO: 7 or a fragment thereof.
- the labeled vinculin, SEQ ID NO: 7 or a fragment thereof can be separated out and analyzed for its binding to the antibody.
- the anti-CdtB antibody is an antibody that binds specifically to CdtB subunit of CDT.
- An example of a CdtB amino acid sequence is Campylobacter jejuni cytolethal distending toxin B, which has the amino acid sequence (SEQ ID NO: 5).
- Another example of a CdtB amino acid sequence is Campylobacter coli cytolethal distending toxin B, which has the amino acid sequence (SEQ ID NO: 1) and nucleic acid sequence (SEQ ID NO:2).
- SEQ ID NO: 1 [0165] SEQ ID NO: 1 :
- the antibody binds specifically to SEQ
- the anti-CdtB antibody is an antibody that binds specifically to an amino acid sequence at least 80%, 85%, 90%>, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 5.
- the anti-CdtB antibody is an antibody that binds specifically to SEQ ID NO: l (CdtB of C. coli). In various embodiments, the anti-CdtB antibody is an antibody that binds specifically to an amino acid sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 1.
- the anti-CdtB antibody is an antibody that binds specifically to a 17 residue peptide of CdtB (e.g., 17 residues of SEQ. ID NOs: 1 or 5).
- the 17 residue peptide has the following sequence: LDYAITGNSNRQQTYTP (SEQ ID NO:3).
- the anti-CdtB antibody is an antibody that binds specifically to a 17 residue peptide that has at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%) or 100%) homology with 17 contiguous residues of CdtB (e.g., 17 contiguous residues of SEQ. ID NOs: 1 or 5).
- the 17 residues of CdtB have the following sequence: LDYAITGNSNRQQTYTP (SEQ ID NO:3).
- the anti-CdtB antibody is an antibody that binds specifically to a polypeptide comprising 17 residues that have at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% homology with 17 contiguous residues of CdtB (e.g., 17 residues of SEQ. ID NOs: 1 or 5).
- the 17 contiguous residues of CdtB have the following sequence: LDYAITGNSNRQQTYTP (SEQ ID NO:3).
- the anti-CdtB antibody is an antibody that antibody binds specifically to an 18 residue peptide having the following sequence: CLDYAITGNSNRQQTYTP (SEQ ID NO:4).
- the cysteine at the N-terminus was added to SEQ ID NO: 3 for purposes of conjugation.
- the anti-CdtB antibody is an antibody that binds specifically to a polypeptide comprising 18 residues that have at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% homology to CLDYAITGNSNRQQTYTP (SEQ ID NO:4).
- the anti-CdtB antibody is an antibody that binds specifically to a 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22 residue peptide that has at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% homology with 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22 contiguous residues of CdtB (e.g., 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22 contiguous residues of SEQ ID NOs: l or 5).
- the anti-CdtB antibody is an antibody that binds specifically to a polypeptide comprising 5, 6, 7, 8, 9, 10, 11, 12, 13, 14,
- Contiguous residues of SEQ ID NO: l include those beginning at any amino acid and ending at any amino acid of SEQ ID NO: l .
- Contiguous residues of SEQ ID NO: 5 include those beginning at any amino acid and ending at any amino acid of SEQ ID NO:5.
- the anti-CdtB antibody is an antibody that antibody binds specifically to a 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 residue peptide that has at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% homology with 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 contiguous residues of LDYAITGNSNRQQTYTP (SEQ ID NO:3) (e.g., 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 contiguous residues of SEQ ID NO:3).
- the purified antibody binds specifically to a polypeptide comprising 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 residues that has at least 80%>, 85%>, 90%, 95%, 96%, 97%, 98%, 99% or 100% homology with 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15,
- Contiguous residues of SEQ ID NO:3 include those beginning at any amino acid and ending at any amino acid of SEQ ID NO: 3.
- the anti-CdtB antibody is an antibody that binds specifically to a 17 residue peptide encoded by the CdtB gene sequence.
- the anti-CdtB antibody is an antibody that binds specifically to a 17 residue peptide encoded by SEQ ID NO: 2.
- the anti-CdtB antibody is an antibody that binds specifically to a 14, 15, 16, 17, 18, 19, 20, 21, or 22 residue peptide encoded by SEQ ID NO: 2.
- the purified antibody binds specifically to a 14, 15, 16, 17, 18, 19, 20, 21, or 22 residue peptide that has at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% homology to 14, 15, 16, 17, 18, 19, 20, 21, or 22 contiguous residues encoded by SEQ ID NO: 2.
- the anti-CdtB antibody is an antibody that binds specifically to a polypeptide comprising 14, 15, 16, 17, 18, 19, 20, 21, or 22 residues that have at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% homology to 14, 15, 16, 17, 18, 19, 20, 21, or 22 contiguous residues encoded by SEQ ID NO: 2.
- the anti-CdtB antibody is an antibody that binds specifically to a peptide encoded by the nucleic acid sequence having the following sequence: CTTGATTATGCAATTACAGGAAATTCAAATAGACAACAAACCTATACTCCA (SEQ ID NO:6), which encodes the 17 amino acid peptide of SEQ ID NO. 3.
- the anti-CdtB antibody is an antibody that binds specifically to a polypeptide comprising a peptide encoded by SEQ ID NO:6.
- the anti-CdtB antibody is an antibody that binds specifically to CdtB purified from E. coli overexpressing a near full-length CdtB ORF. ⁇ See Infection and Immunity, December 2000, p. 6535-6541, Vol. 68, No. 12 , herein incorporated by reference in its entirety as though fully set forth.)
- vinculin protein or a fragment thereof as described herein is used as the antigen at about 1.2 ⁇ g/ml concentration.
- the concentration can be about 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1., 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9 or 2.0 ⁇ g/ml concentration.
- an about 1 :32 dilution of the biological sample e.g., plasma
- the biological sample e.g., plasma
- an about 1 :8, 1 : 10, 1 : 12; 1 : 16, 1 :20, 1 :24, 1 :30, 1 :36, 1 :48, or 1 :64 dilution of the biological sample is used in the determination of the presence or level of anti-vinculin antibodies.
- an about 1 :8 to 1 :64 dilution of the biological sample is used in the determination of the presence or level of anti- vinculin antibodies.
- CdtB protein or a fragment thereof as described herein is used as the antigen at about 1.2 ⁇ g/ml concentration.
- the concentration can be about 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1., 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9 or 2.0 ⁇ g/ml concentration.
- a 1 :512 dilution of the biological sample e.g., plasma
- the biological sample e.g., plasma
- an about 1 : 128, 1 :256, 1 :768, or 1 :1024 dilution of the biological sample (e.g., plasma) is used in the determination of the presence or level of anti-CdtB antibodies.
- an about 1 : 100, 1 : 150, 1 :200, 1 :250, 1 :300, 1 :350, 1 :400, 1 :500, 1 :550; 1 :600, 1 :650, 1 :700, 1 :750, 1 :800, 1 :850, 1 :900, 1 :950, or 1 : 1000 dilution of the biological sample (e.g., plasma) is used in the determination of the presence or level of anti-CdtB antibodies.
- an about 1 :100 - 1 : 1000 dilution of the biological sample (e.g., plasma) is used in the determination of the presence or level of anti-CdtB antibodies.
- Antigens are immobilized for about 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 hours (e.g., overnight, >16 hours) at about 4°C onto high-binding plates (e.g., 96-well plates) in Borate Buffered Saline (BBS) at a pH of 8.2. Wells are alternately coated with antigen or left uncoated in BBS to allow determination of non-specific binding of plasma. Wells are blocked with about 3% bovine serum albumin in IxPBS for about 1 hour at about room temperature.
- BBS Borate Buffered Saline
- Coated and uncoated wells are then incubated with a 1 :512 dilution of plasma for CdtB and a 1 :32 dilution of plasma for vinculin for about 1 hour at room temperature.
- Antibodies to CdtB and vinculin are used as positive controls.
- Each step is followed by a series of washes using 0.05% PBS-Tween 20.
- a 3,3',5,5'- Tetramethylbenzidine (TMB) substrate solution is used for visualization and immediately read on a plate reader (e.g., BioTek Synergy HT; Winooski, VT).
- the optical densities (OD) are read for about 90 minutes at 370nm and used to compare levels of anti-CdtB or anti- vinculin. Raw OD values were used for the data analysis.
- the IBS detected by the methods, assays or systems is constipation predominant IBS (C-IBS), diarrhea predominant IBS (D-IBS), alternating IBS (A-IBS) (more recently re -named as mixed (M-IBS)), or post-infectious irritable bowel syndrome (PI-IBS).
- C-IBS constipation predominant IBS
- D-IBS diarrhea predominant IBS
- A-IBS alternating IBS
- M-IBS re re -named as mixed
- PI-IBS post-infectious irritable bowel syndrome
- the IBS is D-IBS.
- the subject desiring diagnosis of IBS in accordance to the methods, assays, and systems of the present invention may have one or more symptoms indicative of IBS.
- IBS symptoms include but are not limited to diarrhea, constipation, bloating, and abdominal pain.
- biological samples include but are not limited to body fluids, whole blood, plasma, stool, intestinal fluids or aspirate, and stomach fluids or aspirate, serum, cerebral spinal fluid (CSF), urine, sweat, saliva, tears, pulmonary secretions, breast aspirate, prostate fluid, seminal fluid, cervical scraping, amniotic fluid, intraocular fluid, mucous, and moisture in breath.
- the biological sample may be whole blood, blood plasma, blood serum, stool, intestinal fluid or aspirate or stomach fluid or aspirate.
- the biological sample may be whole blood.
- the biological sample may be serum.
- the biological sample may be plasma.
- D-IBS diarrhea-predominant IBS
- TARGET 3 subjects from a 180 center large scale randomized controlled therapeutic trial in diarrhea-predominant IBS
- Subjects with D-IBS were selected based on the presence of Rome III criteria.
- 6 Healthy controls were recruited from Cedars-Sinai Medical Center and the Beth Israel Deaconess Medical Center. All healthy controls were screened for prior history of gastrointestinal disease and for active gastrointestinal symptoms based on history and completion of a bowel symptom questionnaire.
- IBD inflammatory bowel disease
- celiac disease Subjects with inflammatory bowel disease (IBD) and celiac disease were recruited based on the presence of intestinal complaints and histologic confirmation of chronic inflammatory changes in the colon or small intestine consistent with Crohn's disease, ulcerative colitis (UC) or celiac disease.
- IBD inflammatory bowel disease
- UC ulcerative colitis
- Subjects were excluded from the study if they had a history of diabetes, HIV, unstable thyroid disease, and chronic narcotic use.
- bowel surgery excluding cholecystectomy or appendectomy was also an exclusion criteria.
- CdtB protein (Creative Biomart, Shirley, NY) or full length vinculin protein (Novoprotein, Short Hills, NJ) as antigens at 1.2 ⁇ g/ml concentration.
- Antigens were immobilized overnight at 4°C onto high-binding 96-well plates (Grenier Bio-One, Monroe, NC) in Borate Buffered Saline (BBS) (Medicago, Uppsala, Sweden) at a pH of 8.2.
- BBS Borate Buffered Saline
- Wells were alternately coated with antigen or left uncoated in BBS to allow determination of non-specific binding of plasma.
- Wells were blocked with 3% bovine serum albumin in IxPBS for 1 hour at room temperature.
- Normality of the data distributions was assessed using histograms with overlapping Kernel density and normal distributions curves.
- the anti-vinculin distribution was normalized by a square root transformation. Homogeneity of variance was assessed by Bartlett's test.
- Table IB Patient demographics.
- Receiver operating characteristics were used to assess the utility of anti-vinculin and anti-CdtB levels in differentiating IBS subjects from non-IBS, IBD and healthy individuals.
- Figures 3A and 4 demonstrate the ROC curves for these two tests when comparing IBS subjects to all non-IBS subjects and to IBD subjects, respectively.
- the anti- CdtB test performed better than anti-vinculin and appeared equally discriminating of IBS from all non-IBS subjects and from the IBD group alone. In subgroup analysis, there appeared to be no difference based on the type of IBD (data not shown).
- the ROC curve for both anti-CdtB and anti-vinculin show that D-IBS can be discriminated from healthy subjects based on this test.
- optical density (OD) levels for each test were then used to determine the ideal threshold for identification of D-IBS.
- Tables 2A and 3 A demonstrate some potential optical density thresholds for the identification of IBS based on sensitivity, specificity and likelihood ratio. For D-IBS, a higher specificity even when associated with a lower sensitivity is more desirable. In D-IBS an ideal test would definitively diagnose IBS, thus reducing the need for invasive testing. So specificity and likelihood ratio was deemed more important. Based on the ROC curves, the ideal level for anti-CdtB appeared to be a level of >2.48 and for anti-vinculin the optimal level was of > 1.62 appear to optimize specificity with relatively limited effects on sensitivity.
- Receiver operating characteristics were used to assess the utility of anti-vinculin and anti-CdtB levels in differentiating D-IBS subjects from IBD subjects.
- Figure 3B demonstrates the ROC curves for these two tests when comparing D-IBS subjects to IBD subjects. While both tests were effective at discriminating D-IBS subjects from the IBD group, the area-under-the-curve (AUC) for the diagnosis of D-IBS vs. IBD was higher for anti-CdtB than for anti-vinculin (0.81 and 0.62, respectively). In subgroup analysis, there appeared to be no difference based on the type of IBD (data not shown). The ROC curves for D-IBS compared to non-IBS, celiac subjects and healthy controls were also discriminatory.
- optical density (OD) levels for each test were then used to determine the ideal threshold for identification of D-IBS as compared to IBD.
- Tables 2B and 3B demonstrate some potential optical density thresholds for the identification of D-IBS based on sensitivity, specificity and likelihood ratio. An ideal test would definitively diagnose IBS, thus reducing the need for invasive testing. Therefore, we focused on specificity and positive likelihood ratio. Based on this, the ideal threshold for anti-CdtB to identify D-IBS appeared to be >2.80, while for anti-vinculin the optimal threshold appeared to be >1.68.
- Table 2B Favorable cut offs for anti-CdtB for the diagnosis of D-IBS over IBD
- Table 3B Favorable cut offs for anti-vinculin for the diagnosis of D-IBS over IBD
- Anti-CdtB and anti-vinculin levels were also compared in females only and in males only. Despite gender differences between subjects with D-IBS and control groups, both biomarkers could be used to successfully identify D-IBS in both males and females.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Immunology (AREA)
- Engineering & Computer Science (AREA)
- Hematology (AREA)
- Molecular Biology (AREA)
- Chemical & Material Sciences (AREA)
- Biomedical Technology (AREA)
- Urology & Nephrology (AREA)
- Biotechnology (AREA)
- General Health & Medical Sciences (AREA)
- Cell Biology (AREA)
- Pathology (AREA)
- Food Science & Technology (AREA)
- Medicinal Chemistry (AREA)
- Physics & Mathematics (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- General Physics & Mathematics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Rehabilitation Therapy (AREA)
- Rheumatology (AREA)
- Peptides Or Proteins (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Priority Applications (11)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
JP2017518834A JP6784669B2 (ja) | 2014-10-09 | 2015-10-08 | 炎症性腸疾患及びセリアック病から過敏性腸症候群を識別するための方法及びシステム |
AU2015330872A AU2015330872B2 (en) | 2014-10-09 | 2015-10-08 | Methods and systems for distinguishing irritable bowel syndrome from inflammatory bowel disease and celiac disease |
NZ730490A NZ730490A (en) | 2014-10-09 | 2015-10-08 | Methods and systems for distinguishing irritable bowel syndrome from inflammatory bowel disease and celiac disease |
CN201580067387.5A CN107003308B (zh) | 2014-10-09 | 2015-10-08 | 用于区分肠易激综合征与炎性肠病和乳糜泻的方法和系统 |
SG11201702395WA SG11201702395WA (en) | 2014-10-09 | 2015-10-08 | Methods and systems for distinguishing irritable bowel syndrome from inflammatory bowel disease and celiac disease |
CA2962493A CA2962493C (en) | 2014-10-09 | 2015-10-08 | Methods and systems for distinguishing irritable bowel syndrome from inflammatory bowel disease and celiac disease |
RU2017115663A RU2706361C2 (ru) | 2014-10-09 | 2015-10-08 | Способы и системы для отличия синдрома раздраженного кишечника от воспалительного заболевания кишечника и глютеновой болезни |
KR1020177011301A KR102426541B1 (ko) | 2014-10-09 | 2015-10-08 | 과민성 장 증후군을, 염증성 장 질환 및 셀리악 병과 구별하기 위한 방법 및 시스템 |
MX2017004516A MX2017004516A (es) | 2014-10-09 | 2015-10-08 | Métodos y sistemas para distinguir el síndrome del intestino irritable de la enfermedad inflamatoria intestinal y la enfermedad celíaca. |
EP15849701.6A EP3204771A4 (en) | 2014-10-09 | 2015-10-08 | Methods and systems for distinguishing irritable bowel syndrome from inflammatory bowel disease and celiac disease |
IL251606A IL251606B (en) | 2014-10-09 | 2017-04-05 | Methods and systems for diagnosing irritable bowel syndrome from inflammatory bowel disease and celiac disease |
Applications Claiming Priority (4)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US201462061877P | 2014-10-09 | 2014-10-09 | |
US62/061,877 | 2014-10-09 | ||
US201462085825P | 2014-12-01 | 2014-12-01 | |
US62/085,825 | 2014-12-01 |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2016057772A1 true WO2016057772A1 (en) | 2016-04-14 |
Family
ID=55653760
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/US2015/054655 WO2016057772A1 (en) | 2014-10-09 | 2015-10-08 | Methods and systems for distinguishing irritable bowel syndrome from inflammatory bowel disease and celiac disease |
Country Status (13)
Country | Link |
---|---|
US (2) | US10132814B2 (ko) |
EP (1) | EP3204771A4 (ko) |
JP (1) | JP6784669B2 (ko) |
KR (1) | KR102426541B1 (ko) |
CN (1) | CN107003308B (ko) |
AU (1) | AU2015330872B2 (ko) |
CA (1) | CA2962493C (ko) |
IL (1) | IL251606B (ko) |
MX (1) | MX2017004516A (ko) |
NZ (1) | NZ730490A (ko) |
RU (1) | RU2706361C2 (ko) |
SG (1) | SG11201702395WA (ko) |
WO (1) | WO2016057772A1 (ko) |
Cited By (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US9702884B2 (en) | 2012-09-17 | 2017-07-11 | Cedars-Sinai Medical Center | Methods for detecting the presence of irritable bowel syndrome and system for diagnosing same |
US9851361B2 (en) | 2013-10-09 | 2017-12-26 | Cedars-Sinai Medical Center | Methods of comparing anti-vinculin and anti-cytolethal distending toxin antibodies as they relate to irritable bowel syndrome |
US9869676B2 (en) | 2009-02-11 | 2018-01-16 | Cedars-Sinai Medical Center | Antibody to cytolethal distending toxin of Campylobacter jejuni |
US10132814B2 (en) | 2014-10-09 | 2018-11-20 | Cedars-Sinai Medical Center | Methods for distinguishing irritable bowel syndrome from inflammatory bowel disease and celiac disease |
US11693009B2 (en) | 2009-02-11 | 2023-07-04 | Cedars-Sinai Medical Center | Methods for detecting post-infectious irritable bowel syndrome |
Families Citing this family (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP3913371A1 (en) | 2020-05-18 | 2021-11-24 | Neuroimmun GmbH | Method and kit for diagnosting irritable bowel syndrome and for its relief through dietary interventions |
CN113447649B (zh) * | 2021-07-01 | 2022-04-19 | 浙江大学 | 一种检测抗粘着斑蛋白-IgG抗体的试剂盒 |
Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US4946778A (en) | 1987-09-21 | 1990-08-07 | Genex Corporation | Single polypeptide chain binding molecules |
US5585089A (en) | 1988-12-28 | 1996-12-17 | Protein Design Labs, Inc. | Humanized immunoglobulins |
US20110305704A1 (en) * | 2009-02-11 | 2011-12-15 | Cedars-Sinai Medical Center | Antibody to cytolethal distending toxin of campylobacter jejuni |
WO2014042828A2 (en) | 2012-09-17 | 2014-03-20 | Cedars-Sinai Medical Center | Diagnosis and treatment of motility disorders of the gut and bladder, and of fibromyalgia |
Family Cites Families (24)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US5691151A (en) * | 1994-10-07 | 1997-11-25 | Regents Of University Of California | Methods of screening for ulcerative colitis and crohn's disease by detecting VH3-15 autoantibody and panca |
US7048906B2 (en) | 1995-05-17 | 2006-05-23 | Cedars-Sinai Medical Center | Methods of diagnosing and treating small intestinal bacterial overgrowth (SIBO) and SIBO-related conditions |
US6562629B1 (en) | 1999-08-11 | 2003-05-13 | Cedars-Sinai Medical Center | Method of diagnosing irritable bowel syndrome and other disorders caused by small intestinal bacterial overgrowth by detecting the presence of anti-saccharomyces cerivisiae antibodies (asca) in human serum |
US6861053B1 (en) | 1999-08-11 | 2005-03-01 | Cedars-Sinai Medical Center | Methods of diagnosing or treating irritable bowel syndrome and other disorders caused by small intestinal bacterial overgrowth |
FR2806805A1 (fr) | 2000-03-22 | 2001-09-28 | Centre Nat Rech Scient | SEQUENCE PEPTIDIQUES COMPRENANT UN OU PLUSIEURS MOTIFS DE LIAISON AUX PROTEINES DE LA FAMILLE Ena/VASP, ET LEURS UTILISATIONS |
US20040018528A1 (en) | 2002-05-17 | 2004-01-29 | Sugen, Inc. | Novel biomarkers of tyrosine kinase inhibitor exposure and activity in mammals |
EP1578364A4 (en) | 2002-09-16 | 2011-06-08 | Genentech Inc | COMPOSITIONS AND METHODS FOR TREATING IMMUNE DISEASES |
US7595386B2 (en) | 2003-01-24 | 2009-09-29 | William Beaumont Hospital | Methods and compositions for heat activated gene therapy using cytolethal distending toxin |
JP4711963B2 (ja) | 2003-09-15 | 2011-06-29 | オクラホマ メディカル リサーチ ファウンデーション | 炎症性疾患および自己免疫疾患を診断、治療および評価するためにサイトカインアッセイを用いる方法 |
JP4624927B2 (ja) | 2003-12-05 | 2011-02-02 | 扶桑薬品工業株式会社 | 細胞膨張化致死毒およびそれを標的としたカンピロバクター属に属する細菌の検出 |
US20080085524A1 (en) | 2006-08-15 | 2008-04-10 | Prometheus Laboratories Inc. | Methods for diagnosing irritable bowel syndrome |
US8148067B2 (en) | 2006-11-09 | 2012-04-03 | Xdx, Inc. | Methods for diagnosing and monitoring the status of systemic lupus erythematosus |
EP2223121B1 (en) | 2007-12-20 | 2012-07-25 | Index Diagnostics AB (publ) | Method and kit for use in the differentiation of ibd and ibs and further distinction between disease types of ibd |
WO2010045180A1 (en) | 2008-10-13 | 2010-04-22 | Metabolon, Inc. | Biomarkers for inflammatory bowel disease and methods using the same |
WO2010060098A1 (en) | 2008-11-24 | 2010-05-27 | Cedars-Sinai Medical Center | Antioxidant camptothecin derivatives and antioxidant antineoplastic nanospheres thereof |
EP2396029A4 (en) | 2009-02-11 | 2012-08-08 | Cedars Sinai Medical Center | ANTIBIOTIC THERAPY TO REDUCE THE RISK OF DEVELOPING POST-INFECTIOUS IRRITABLE COLON SYNDROME |
US10132814B2 (en) | 2014-10-09 | 2018-11-20 | Cedars-Sinai Medical Center | Methods for distinguishing irritable bowel syndrome from inflammatory bowel disease and celiac disease |
FR2942541A1 (fr) | 2009-02-25 | 2010-08-27 | Assist Publ Hopitaux De Paris | Procede de diagnostic d'une vascularite |
RU2397178C1 (ru) * | 2009-02-27 | 2010-08-20 | Федеральное государственное учреждение науки "Центральный научно-исследовательский институт эпидемиологии" Федеральной службы по надзору в сфере защиты прав потребителей и благополучия человека | Диагностическая тест-система в формате иммуночипа и способ серологической дифференциальной диагностики сифилиса |
IT1400989B1 (it) | 2010-07-13 | 2013-07-05 | Segix Italia S R L Ora Istituto Biochimico Naz Savio S R L | Forme di somministrazione orale a rilascio controllato di rifampicina per il trattamento di infezioni batteriche dell' apparato intestinale. |
GB201017520D0 (en) | 2010-10-15 | 2010-12-01 | Sense Proteomic Ltd | Biomarkers |
JP5477671B2 (ja) | 2012-02-28 | 2014-04-23 | 三菱マテリアル株式会社 | サーミスタ用金属窒化物材料及びその製造方法並びにフィルム型サーミスタセンサ |
WO2015054529A1 (en) | 2013-10-09 | 2015-04-16 | Cedars-Sinai Medical Center | Diagnosis and treatment of irritable bowel syndrome and inflammatory bowel disease |
AU2018212924A1 (en) | 2017-01-30 | 2019-07-04 | Cedars-Sinai Medical Center | Diagnosis of scleroderma |
-
2015
- 2015-10-08 US US14/878,416 patent/US10132814B2/en active Active
- 2015-10-08 WO PCT/US2015/054655 patent/WO2016057772A1/en active Application Filing
- 2015-10-08 CN CN201580067387.5A patent/CN107003308B/zh active Active
- 2015-10-08 AU AU2015330872A patent/AU2015330872B2/en active Active
- 2015-10-08 SG SG11201702395WA patent/SG11201702395WA/en unknown
- 2015-10-08 JP JP2017518834A patent/JP6784669B2/ja active Active
- 2015-10-08 MX MX2017004516A patent/MX2017004516A/es unknown
- 2015-10-08 RU RU2017115663A patent/RU2706361C2/ru active IP Right Revival
- 2015-10-08 CA CA2962493A patent/CA2962493C/en active Active
- 2015-10-08 NZ NZ730490A patent/NZ730490A/en unknown
- 2015-10-08 KR KR1020177011301A patent/KR102426541B1/ko active IP Right Grant
- 2015-10-08 EP EP15849701.6A patent/EP3204771A4/en active Pending
-
2017
- 2017-04-05 IL IL251606A patent/IL251606B/en active IP Right Grant
-
2018
- 2018-10-05 US US16/152,806 patent/US10690679B2/en active Active
Patent Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US4946778A (en) | 1987-09-21 | 1990-08-07 | Genex Corporation | Single polypeptide chain binding molecules |
US5585089A (en) | 1988-12-28 | 1996-12-17 | Protein Design Labs, Inc. | Humanized immunoglobulins |
US20110305704A1 (en) * | 2009-02-11 | 2011-12-15 | Cedars-Sinai Medical Center | Antibody to cytolethal distending toxin of campylobacter jejuni |
WO2014042828A2 (en) | 2012-09-17 | 2014-03-20 | Cedars-Sinai Medical Center | Diagnosis and treatment of motility disorders of the gut and bladder, and of fibromyalgia |
Non-Patent Citations (16)
Title |
---|
BIRD, SCIENCE, vol. 242, 1988, pages 423 - 42 |
D. LANE: "Antibodies: A Laboratory Manual2", 2013, COLD SPRING HARBOR PRESS |
HOLLIGER P., NAT. BIOTECHNOL., vol. 23, no. 9, September 2005 (2005-09-01), pages 1126 - 36 |
HUSTON ET AL., PROC. NATL. ACAD. SCI. USA, vol. 85, 1988, pages 5879 - 5883 |
INFECTION AND IMMUNITY, vol. 68, no. 12, December 2000 (2000-12-01), pages 6535 - 6541 |
KOHLERMILSTEIN, EUR. J. IMMUNOL., vol. 6, 1976, pages 511 |
NOVAK, K.: "A Serologic Test for Irritable Bowel Syndrome and Other News from ACG", GASTROENTEROLOGY PRESS HIGHLIGHTS, 21 October 2013 (2013-10-21), pages 1 - 2., XP055428930, Retrieved from the Internet <URL:www.gastrojournal.org/pb/assets/raw/Health%20Advance/journals/ygast/November26_PressHighlight3.pdf> * |
PIMENTEL ET AL.: "Development and Validation of a Biomarker for Diarrhea-Predominant Irritable Bowel Syndrome in Human Subjects", PLOS ONE, vol. 10, no. 5, 13 May 2015 (2015-05-13), pages 1 - 12, XP055269121 * |
RIECHMANN ET AL., NATURE, vol. 332, 1988, pages 323 |
SAMBROOKRUSSEL: "Molecular Cloning: A Laboratory Manual", 2012, COLD SPRING HARBOR LABORATORY PRESS |
See also references of EP3204771A4 |
SINGLETON ET AL.: "Dictionary of Microbiology and Molecular Biology", 2006, J. WILEY & SONS |
TOMLINSON IHOLLIGER P, METHODS ENZYMOL, vol. 326, 2000, pages 461 - 479 |
TURKAY ET AL.: "Noninvasive Methods in Evaluation of Inflammatory Bowel Disease: Where Do We Stand Now? An Update", CLINICS, vol. 65, no. 2, 1 February 2010 (2010-02-01), pages 221 - 231, XP055126148, doi:10.1590/S1807-59322010000200015 * |
VIRANDERA P. BHALLA ET AL., GASTEROENTEROLOGY, vol. 144, no. 5, 2013, pages s914 |
WARD ET AL., NATURE, vol. 334, 1989, pages 544 - 54 |
Cited By (11)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US9869676B2 (en) | 2009-02-11 | 2018-01-16 | Cedars-Sinai Medical Center | Antibody to cytolethal distending toxin of Campylobacter jejuni |
US10151752B2 (en) | 2009-02-11 | 2018-12-11 | Cedars-Sinai Medical Center | Antibody to cytolethal distending toxin of Campylobacter jejuni |
US10527621B2 (en) | 2009-02-11 | 2020-01-07 | Cedars-Sinai Medical Center | Antibody to cytolethal distending toxin of Campylobacter jejuni |
US11693009B2 (en) | 2009-02-11 | 2023-07-04 | Cedars-Sinai Medical Center | Methods for detecting post-infectious irritable bowel syndrome |
US9702884B2 (en) | 2012-09-17 | 2017-07-11 | Cedars-Sinai Medical Center | Methods for detecting the presence of irritable bowel syndrome and system for diagnosing same |
US9952223B2 (en) | 2012-09-17 | 2018-04-24 | Cedars-Sinai Medical Center | Method for detecting anti-vinculin antibodies in a subject with an IBS symptom |
US10466254B2 (en) | 2012-09-17 | 2019-11-05 | Cedars-Sinai Medical Center | Method of measuring a level of anti-vinculin antibodies in a biological sample |
US9851361B2 (en) | 2013-10-09 | 2017-12-26 | Cedars-Sinai Medical Center | Methods of comparing anti-vinculin and anti-cytolethal distending toxin antibodies as they relate to irritable bowel syndrome |
US10352944B2 (en) | 2013-10-09 | 2019-07-16 | Cedars-Sinai Medical Center | Method of determinig levels of anti-vinculin and anti-cytolethal distending toxin antibodies in subjects desiring to distinguish irritable bowel syndrome from inflammatory bowel disease |
US10132814B2 (en) | 2014-10-09 | 2018-11-20 | Cedars-Sinai Medical Center | Methods for distinguishing irritable bowel syndrome from inflammatory bowel disease and celiac disease |
US10690679B2 (en) | 2014-10-09 | 2020-06-23 | Cedars-Sinai Medical Center | Methods and systems for distinguishing irritable bowel syndrome from inflammatory bowel disease and celiac disease |
Also Published As
Publication number | Publication date |
---|---|
RU2017115663A (ru) | 2018-11-13 |
JP6784669B2 (ja) | 2020-11-11 |
IL251606A0 (en) | 2017-06-29 |
CA2962493A1 (en) | 2016-04-14 |
SG11201702395WA (en) | 2017-04-27 |
AU2015330872A1 (en) | 2017-04-13 |
EP3204771A1 (en) | 2017-08-16 |
US10690679B2 (en) | 2020-06-23 |
CA2962493C (en) | 2023-01-10 |
US10132814B2 (en) | 2018-11-20 |
US20160103136A1 (en) | 2016-04-14 |
US20190187153A1 (en) | 2019-06-20 |
NZ730490A (en) | 2021-07-30 |
EP3204771A4 (en) | 2018-03-14 |
CN107003308B (zh) | 2020-02-11 |
IL251606B (en) | 2020-08-31 |
AU2015330872B2 (en) | 2021-04-22 |
RU2017115663A3 (ko) | 2019-05-16 |
KR20170067795A (ko) | 2017-06-16 |
CN107003308A (zh) | 2017-08-01 |
KR102426541B1 (ko) | 2022-07-29 |
MX2017004516A (es) | 2017-10-12 |
RU2706361C2 (ru) | 2019-11-18 |
JP2017531801A (ja) | 2017-10-26 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US10690679B2 (en) | Methods and systems for distinguishing irritable bowel syndrome from inflammatory bowel disease and celiac disease | |
KR102259588B1 (ko) | 과민성 장 증후군 및 염증성 장 질환의 진단 및 치료 | |
US20210405046A1 (en) | Diagnosis of scleroderma | |
US20200271665A1 (en) | Diagnosis and treatment of motility disorders of the gut and bladder, and of fibromyalgia | |
US20240159772A1 (en) | Methods for Detecting and Treating Irritable Bowel Syndrome |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 15849701 Country of ref document: EP Kind code of ref document: A1 |
|
ENP | Entry into the national phase |
Ref document number: 2962493 Country of ref document: CA |
|
REEP | Request for entry into the european phase |
Ref document number: 2015849701 Country of ref document: EP |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2015849701 Country of ref document: EP |
|
WWE | Wipo information: entry into national phase |
Ref document number: 251606 Country of ref document: IL |
|
WWE | Wipo information: entry into national phase |
Ref document number: MX/A/2017/004516 Country of ref document: MX |
|
ENP | Entry into the national phase |
Ref document number: 2017518834 Country of ref document: JP Kind code of ref document: A |
|
NENP | Non-entry into the national phase |
Ref country code: DE |
|
ENP | Entry into the national phase |
Ref document number: 2015330872 Country of ref document: AU Date of ref document: 20151008 Kind code of ref document: A |
|
ENP | Entry into the national phase |
Ref document number: 20177011301 Country of ref document: KR Kind code of ref document: A |
|
ENP | Entry into the national phase |
Ref document number: 2017115663 Country of ref document: RU Kind code of ref document: A |