WO2015199386A1 - 가용성 단백질 발현량이 증대된 헬리코박터 파일로리 유래 α-1,2 푸코실 전달효소의 유전자와 단백질 및 α-1,2 푸코실올리고당 생산에의 응용 - Google Patents
가용성 단백질 발현량이 증대된 헬리코박터 파일로리 유래 α-1,2 푸코실 전달효소의 유전자와 단백질 및 α-1,2 푸코실올리고당 생산에의 응용 Download PDFInfo
- Publication number
- WO2015199386A1 WO2015199386A1 PCT/KR2015/006271 KR2015006271W WO2015199386A1 WO 2015199386 A1 WO2015199386 A1 WO 2015199386A1 KR 2015006271 W KR2015006271 W KR 2015006271W WO 2015199386 A1 WO2015199386 A1 WO 2015199386A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- fucosyl transferase
- fucosyl
- protein
- host cell
- vector
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P19/00—Preparation of compounds containing saccharide radicals
- C12P19/18—Preparation of compounds containing saccharide radicals produced by the action of a glycosyl transferase, e.g. alpha-, beta- or gamma-cyclodextrins
Definitions
- the present invention relates to an enzyme engineering through an increase in soluble protein expression and a protein engineering mutation of an ⁇ -1,2 fucosyl transferase derived from Helicobacter pylori, and a protein engineering mutation.
- the present invention relates to the synthesis of fucosyl oligosaccharides using ⁇ -1,2 fucosyl transferase with an improved gene, an expression vector including the same, a method of expressing the gene, and an amount of soluble protein expressed.
- Breast milk not only provides essential nutrients for infants, but also provides a variety of health benefits beyond the concept of nutrients.
- Breast milk oligosaccharides consist of functional ingredients and contain 5-10 g oligosaccharides per liter, 100-200 times more than milk, and more than 130 breast milk oligosaccharides have been identified to date. The content and structural diversity of these oligosaccharides is very specific for breast milk, unlike milk. Among breast milk oligosaccharides, fucosyl oligosaccharides are contained in milk at less than 1%, while breast milk is present in large quantities at around 50-80%.
- 2'-fucosyllactose which has lactose at the reducing end and has a fucose to ⁇ -1,2 bond to galactose, is not present in milk but is present in breast milk. It contains about 2.6 g / L.
- breast milk-derived fucosyloligosaccharides it is the first prebiotics that promote the growth of useful intestinal microorganisms such as Lactobacillus and Bifidobacteria, while Clostridium and Prevents the growth of the same harmful pathogens.
- useful intestinal microorganisms such as Lactobacillus and Bifidobacteria
- Clostridium and Prevents the growth of the same harmful pathogens This is due to the bifidus bacteria, which can use short chains of fucosyloligosaccharides as carbon sources, and by balancing these useful microbial flora, health such as treatment and prevention of infection, anticancer activity, stimulation of host immune function, and vitamin uptake. It has been studied to be effective in enhancement.
- fucosyloligosaccharides have been studied as inhibitors that prevent host cells from adhering to the intestinal epithelial surface during early bacterial or viral infections.
- 2'-fucosyllactose (Fuc ( ⁇ -1,2) Gal ⁇ 1,4Glc) is known as Campylobacter jejuni, Helicobacter pylori, Enteroxigenic E. coli) and Salmonella typhimurium, Clostridium perfringens and norovirus receptors that cause food poisoning, competitively inhibiting their invasion can do.
- Various breast milk-derived fucosyl oligosaccharides containing 2'-fucosyllactose which plays such a role, can be used for various industrial applications such as infant food and functional food, as well as medicine.
- breast milk oligosaccharides are difficult to mass-produce when extracted from colostrum, and in the case of chemical synthesis of fucosyl oligosaccharides, complex protection-deprotection is required to control the oligosaccharide conformation and maintain selectivity. It is difficult to develop a generalized process in the food or pharmaceutical industry due to the problem of the reaction and the use of toxic reagents.
- ⁇ -1,2 fucosyl transferase used in the present invention is an enzyme that transfers fucose with ⁇ -1,2 bond to the second carbon of galactose (galactose), derived from Helicobacter pylori 26695 strain, Diane E in 1999 It was first cloned by the Taylor group [Wang G., Molecular genetic basis for the variable expression of Lewis Y antigen in Helicobacter pylori: analysis of the alpha (1,2) fucosyltransferase gene, Molecular Microbiol ogy, 1999, Vol. 31 , 1265p].
- the FKP enzyme has a relatively higher level of soluble protein expression and enzyme activity in E. coli than ⁇ -1,2 fucosyl transferase. Since it is high, it has been confirmed that the fucosyl transferase reaction itself is a rate determining step in this reaction. In order to enhance the fucosyl transfer reaction, which is a rate determining step, it is very necessary to increase soluble protein expression and enzyme activity in E. coli of ⁇ -1,2 fucosyl transferase.
- the present invention provides a variant of ⁇ -1,2 fucosyl transferase with an increased amount of soluble protein through sequencing and protein engineering in the production of ⁇ -1,2 fucosyl oligosaccharides. It is aimed at increasing the yield and productivity by applying to the production of ⁇ -1,2 fucosyl oligosaccharides.
- An object of the present invention is to prepare a variant of the nucleotide sequence optimized ⁇ -1,2 fucosyl transferase and ⁇ -1,2 fucosyl transferase, and to effectively produce ⁇ -1,2 fucosyl oligosaccharides will be.
- an object of the present invention is to provide a substrate binding-model structure through protein structure modeling, alanine scanning and substrate structure docking for protein engineering variation of ⁇ -1,2 fucosyl transferase.
- the mutation candidate amino acid used is selected.
- the present invention provides optimized gene sequence information encoding an active type ⁇ -1,2 fucosyl transferase with increased soluble protein expression.
- a recombinant DNA vector comprising an optimized gene encoding an active ⁇ -1,2 fucosyl transferase, a DNA encoding the fusion protein is located in front of the DNA encoding an ⁇ -1,2 fucosyl transferase.
- Recombinant DNA vector characterized in that having a spacer consisting of 3 to 60 nucleotides between the DNA encoding the gene of ⁇ -1,2 fucosyl transferase and the DNA encoding the fusion protein Provided host cells transformed with the DNA vector.
- the present invention provides a recombinant DNA vector that increases the solubility of a protein through the introduction of a fusion protein to a fucosyl transferase with increased expression and a method for effectively expressing the gene.
- the present invention provides a method for increasing the solubility of a protein through co-expression with chaperone and a method for effectively expressing the gene.
- the mutant of SEQ ID NO: 6 having a single amino acid changed for ⁇ -1,2 fucosyl transferase with an increased soluble protein, DNA sequence information encoding the same, and a recombinant DNA vector comprising the same, and a recombinant DNA vector To provide a transformed host cell.
- the present invention also provides the production of ⁇ -1,2 fucosyl oligosaccharides using ⁇ -1,2 fucosyl transferase.
- the present invention is a variation using a substrate binding-model structure through protein structure modeling, alanine scanning and substrate structure docking for protein engineering variation of ⁇ -1,2 fucosyl transferase
- the present invention provides the following.
- the present invention provides a DNA encoding an ⁇ -1,2 fucosyl transferase, having a homology of 88% or more with SEQ ID NO: 1, a recombinant DNA vector comprising the DNA, and a host cell transformed with the recombinant DNA vector. , And extracts of host cells.
- the recombinant DNA vector characterized in that the DNA encoding the fusion protein is located in front of the DNA encoding the ⁇ -1,2 fucosyl transferase, and the gene encoding the ⁇ -1,2 fucosyl transferase
- a DNA vector comprising a spacer consisting of 6 to 30 nucleotides between DNA and DNA encoding the fusion protein.
- the 249 th amino acid of ⁇ -1,2 fucosyl transferase represented by SEQ ID NO: 2 provides an ⁇ -1,2 fucosyl transferase variant substituted with other amino acids, the substituted amino acid tyrosine (tyrosine ), ⁇ -1,2 fucosyl transferase variant represented by the amino acid sequence of SEQ ID NO: 6, and provides a DNA represented by SEQ ID NO: 7, encoding the amino acid sequence of SEQ ID NO: 6.
- the present invention provides a DNA vector comprising the DNA represented by SEQ ID NO: 7, a host cell transformed with the DNA vector, and an extract of the host cell.
- polypeptide of ⁇ -1,2 fucosyl transferase expressed from the transformed host cell of the present invention polypeptide of ⁇ -1,2 fucosyl transferase variant of the present invention, or ⁇ -1 of the present invention
- a polypeptide comprising a peptide linker consisting of 5 to 20 amino acids following the polypeptide of the, 2 fucosyl transferase variant is provided.
- a host cell transformed with a vector comprising a DNA encoding ⁇ -1,2 fucosyl transferase having at least 88% homology with SEQ ID NO: 1 or an extract of the host cell is used as a biocatalyst.
- a method for producing ⁇ -1,2 fucosyl oligosaccharide is provided.
- the vector encoding the fusion protein may be introduced in front of the DNA encoding the ⁇ -1,2 fucosyl transferase, wherein the vector is 0.005 mM to 5 at a temperature of 15 °C to 38 °C Inducers of mM can be used.
- the host cell may be one that is further transformed with a recombinant DNA vector encoding a chaperone protein, at this time, induction factors of 0.001 mM to 2 mM at a temperature of 10 °C to 35 °C Can be used.
- the concentration of the sugar receptor substrate can be used above the concentration of the guanosine 5'-diphosphate fucose (GDP-fuc) substrate, which is a donor of fucose.
- GDP-fuc guanosine 5'-diphosphate fucose
- the present invention provides a method for searching for ⁇ -1,2 fucosyl transferase variant comprising the following steps.
- the ⁇ -1,2 fucosyl transferase significantly improved in the amount of the soluble protein of the present invention can be applied to the production of various high value ⁇ -1,2 fucosyl oligosaccharides as well as 2'-fucosyllactose, a milk-derived oligosaccharide. have.
- the amount of soluble protein can be increased by using the mutant of ⁇ -1,2 fucosyl transferase and ⁇ -1,2 fucosyl transferase which have optimized the nucleotide sequence of the present invention.
- '-It can be applied to the production of various high value ⁇ -1,2 fucosyl oligosaccharides as well as fucosylactose.
- the ⁇ -1,2 fucosyl oligosaccharide production method of the present invention significantly increases the production yield and productivity of ⁇ -1,2 fucosyl oligosaccharides, thereby reducing production costs and obtaining high added value due to products.
- the mass production of the ⁇ -1,2 fucosyl oligosaccharides can be utilized in various fields such as infant food, health supplement additives, therapeutic agents, cosmetics, medicines, and diagnostic fields.
- 1 is a one-port reaction schematic of 2'-fucosyl oligosaccharide synthesis using FKP and 2'-fucosyl transferase from L-fucose with ATP, GTP and receptor substrates.
- Figure 2 shows the SDS-PAGE of the ⁇ -1,2 fucosyl transferase cell extract with increased total protein expression and soluble protein through sequence optimization and co-expression with chaperone.
- T stands for total protein after cell disruption
- S stands for soluble protein.
- 2 (a) shows the amount of protein expressed in ⁇ -1,2 fucosyl transferase and ⁇ -1,2 fucosyl transferase after sequencing optimization, and (b) shows chaperon after sequencing optimization. Soluble protein increase according to the concentration optimization of IPTG used as an inducer in co-expression of
- Figure 3 expresses the various fusion proteins in front of the nucleotide sequence optimized in the present invention shows the amount of protein with respect to their cell extract in SDS-PAGE. Arrows indicate the protein size of ⁇ -1,2 fucosyl transferase expressed with the fusion protein.
- Figure 4 shows the yield (%) and yield (g / L) for producing 2'-fucosyllactose from guanosine 5'-diphosphate-fucose substrate according to sequencing optimization, co-expression with chaperon, fusion protein expression Indicates.
- the optimization of sequencing and introduction of the fusion protein Optimized 2'FT + fusion protein + Rxn optimization was performed with reaction optimization to increase production yield and productivity.
- Fig. 5 shows the yield of producing 2′-fucosyllactose in a one-port reaction using ATP, GTP, MnSO 4 , and the like with FKP enzyme from L-fucose substrates according to co-expression with chaperones and fusion protein expression. (%) And yield (g / L).
- fusion protein and optimization of reaction Optimized 2'FT + fusion protein + Rxn optimization
- reaction optimization receptor substrate concentration and buffer solution optimization
- Figure 6 shows the total protein and soluble protein production of S249Y and wild-type cell extracts of the single amino acid substitution variants of the present invention by SDS-PAGE.
- Fucosyl transferase means an enzyme that transfers fucose from the sugar donor guanosine 5'-diphosphate-fucose to the sugar receptor substance.
- ' ⁇ -1,2 fucosyl transferase' is an enzyme that transfers fucose at ⁇ -1,2 bonds to carbon 2 of galactose, and is a preferred example. It refers to a protein having ⁇ -1,2 fucosyl transferase activity derived from DNA having a homology of 88% or more with nucleotide sequence 1 of the present invention.
- One of the receptor substrates, lactose is an oligosaccharide composed of Gal ⁇ 1,4Glc (galactose and glucose linked by ⁇ 1,4 bonds).
- 2'-fucosyl oligosaccharides are oligosaccharides in which fucose is connected to the galactose moiety by ⁇ -1,2 bond, and is a structure in which other sugars are further bonded to galactose.
- 2'-fucosyllactose means a tritane substance composed of (Fuc ( ⁇ -1,2) Gal ⁇ 1,4Glc) (fucose is linked to ⁇ -1,2 bond to lactose galactose) do.
- (5) 'Transformation means that DNA is introduced into a host so that the DNA can be replicated as an extrachromosomal factor or by chromosomal integration.
- Cell extract means a microbial extract of the present invention expressing fucosyl transferase.
- the reaction using the cell extract means a reaction using the whole cell without breaking down the cell containing the specific enzyme and using the cell contents or separating and purifying the enzyme.
- Codon optimization of a protein does not change the amino acid sequence, but changes the nucleotide sequence encoding the amino acid. It is usually used to increase the protein expression in the desired host cell, and codon optimization may vary depending on the principle such as codon usage,% GC sequence, RNA secondary structure formation, elimination of repetitive sequence, tRNA preference, etc. However, it is not limited to any one principle.
- Amino acids of small size refer to amino acids with small functional groups, and include glycine, alanine, serine, threonine, and cystein.
- the fusion protein refers to a protein that is fused to the N-terminus of the desired protein to induce the correct folding of the desired protein, and there is no limitation on the type of fusion protein.
- PCR is a polymerase chain reaction, and means a method of specifically amplifying a certain region of DNA.
- Saturation mutagenesis refers to the introduction of changes in various nucleotide sequences at designated locations of genes.
- Saturation mutation refers to inserting the mutation through PCR by inserting the NNK codon instead of the sequence to be mutated on the primer of the complementary sequence that binds to the template strand.
- N in the NNK codon means A, T, G, C of the nucleotides and K means T, G.
- a vector refers to a polynucleotide consisting of single-stranded, double-stranded, circular or ultra-stranded DNA or RNA, and may include components that are operably linked at a suitable distance to produce a recombinant protein.
- Such components may include replication origins, promoters, enhancers, 5'mRNA leader sequences, ribosomal binding sites, nucleic acid cassettes, termination and polyadenylation sites, or selectable label formats, and such components may be used for specific applications. So one or more may be missing.
- the nucleic acid cassette may comprise restriction enzyme sites for insertion of the recombinant protein to be expressed.
- the nucleic acid cassette contains a nucleic acid sequence to be expressed that includes a translation initiation and termination site, and may use a vector capable of inserting two kinds of cassettes into the vector, if necessary, and the functions mentioned above may be added. Can be sequenced.
- E. coli strains BW25113 (DE3), BL21 (DE3), etc. may be used, but may vary depending on the type of the inserted vector.
- Such vectors and expression strains can be readily selected by those skilled in the art.
- pH indicator is used mainly to know the neutralization point while titrating or to know the concentration of hydrogen ion.
- Indicators are acid-type and base-type according to the hydrogen ion index, and the color tone is different, and this area is called discoloration area.
- the concentration of hydrogen ions according to the absorbance can be measured by spectrophotometry.
- Specific activity refers to the activity per unit amount of pure protein from which impurities and other proteins have been removed through enzymatic purification. Usually, the amount of enzyme that catalyzes the change of substrate by 1 ⁇ mol per minute is 1 unit per mg. It is expressed in the unit number.
- the present invention provides DNA encoding ⁇ -1,2 fucosyl transferase, having at least 88% homology with SEQ ID NO: 1.
- the DNA represented by SEQ ID NO: 1 is codon optimized from SEQ ID NO: 3 replacing 12 nucleotides of DNA encoding an amino acid sequence (SEQ ID NO: 2) of ⁇ -1,2 fucosyl transferase derived from Helicobacter pylori 26695 Can be obtained by The obtained DNA of SEQ ID NO: 1 and the DNA of SEQ ID NO: 3 have 87% homology. Optimized SEQ ID NO: 1 of the present invention, the total protein expression than the case of SEQ ID NO: 3 has an excellent effect.
- the present invention provides a recombinant DNA vector comprising a DNA encoding the ⁇ -1,2 fucosyl transferase.
- DNA encoding the fusion protein may be located in front of the DNA encoding the ⁇ -1,2 fucosyl transferase (N-terminus).
- a fusion protein is a protein that is fused to the N-terminus of a desired protein to induce the correct folding of the desired protein. Examples of the fusion protein that can be used include F-ePGK, N-ePGK, ArsC, GMPK, ACK, etc., but is not limited thereto.
- the DNA encoding the gene of ⁇ -1,2 fucosyl transferase and the DNA encoding the fusion protein may have a spacer consisting of nucleotides, and the spacer may include a sequence that recognizes a restriction enzyme.
- a spacer means a DNA sequence between genes, and the nucleotides of the spacer are preferably 3 to 60, more preferably 3 to 45, and most preferably 6 to 30.
- the present invention provides a host cell and a cell extract of the host cell transformed with the recombinant DNA vector.
- the host cell may be further transfected with a recombinant DNA vector encoding a chaperone protein.
- the DNA encoding the chaperone protein may be included in the same vector as the DNA encoding ⁇ -1,2 fucosyl transferase, or may be included in different vectors, respectively. Can be transformed sequentially.
- the chaperone may include dnaK-dnaJ-grpE, a chaperone including a trigger factor, but is not limited thereto. GroEL / GroES chaperone was used as an embodiment of the present invention.
- the cell extract means a microbial extract of the present invention in which the fucosyl transferase is expressed.
- the present invention provides an ⁇ -1,2 fucosyl transferase variant, characterized in that the 249th amino acid of ⁇ -1,2 fucosyl transferase represented by SEQ ID NO: 2 is substituted with an amino acid other than serine. .
- the 249th amino acid of the variant may be substituted with any amino acid, preferably the substituted amino acid is tyrosine (Y).
- the amino acid sequence substituted with tyrosine is shown in SEQ ID NO: 6, and the DNA encoding the same is shown in SEQ ID NO: 7. Due to the substitution of the amino acid sequence No. 249, there is an effect of increasing the fucosyl transferase soluble protein.
- the present invention is a recombinant vector comprising the DNA of SEQ ID NO: 7, coding for the ⁇ -1,2 fucosyl transferase variant, the host cell and the extract of the host cell transformed with the recombinant vector comprising the DNA of SEQ ID NO: To provide.
- the present invention provides a peptide linker consisting of amino acids after the polypeptide of ⁇ -1,2 fucosyl transferase.
- the linker is preferably a small or flexible amino acid, more preferably a group consisting of glycine, alanine, serine, threonine, and cysteine It consists of one or more selected from.
- the amino acid of the peptide linker is preferably 2 to 40, more preferably 4 to 30 and most preferably 5 to 20 amino acid residues.
- a vector comprising ⁇ -1,2 fucosyl transferase-peptide linker-tag gene can be prepared.
- a tag can be used for enzyme purification using affinity chromatography, and a person skilled in the art can select a preferred tag.
- the tag may include both a peptide tag and a protein tag.
- a histidine tag is used.
- the present invention uses a host cell transformed with a vector comprising a DNA encoding ⁇ -1,2 fucosyl transferase or an extract of the host cell as a biocatalyst having at least 88% homology with SEQ ID NO: 1.
- a method for producing ⁇ -1,2 fucosyl oligosaccharides is provided.
- DNA encoding the fusion protein may be introduced in front of the DNA encoding ⁇ -1,2 fucosyl transferase.
- the DNA encoding the gene of ⁇ -1,2 fucosyl transferase and the DNA encoding the fusion protein may have a spacer consisting of nucleotides, and the spacer may include a sequence that recognizes a restriction enzyme.
- the nucleotides of the spacer are preferably 3 to 60, more preferably 3 to 45, most preferably 6 to 30.
- an inducer of 0.005 mM to 5 mM is preferably used at a temperature of 15 ° C. to 38 ° C., more preferably 0.01 at a temperature of 17 ° C. to 38 ° C.
- Inducers from mM to 3 mM are used, most preferably from 0.1 mM to 1 mM inducers at temperatures of 18 ° C. to 37 ° C. If the above conditions are satisfied, there is an excellent effect of increasing the amount of soluble protein expression of ⁇ -1,2 fucosyl transferase.
- the inducer means a substance that promotes the expression of the protein.
- lac operon there is IPTG (Isopropyl ⁇ -D-1-thiogalactopyranoside), and when using ara operon, arabinose (trbin), trp Indole acrylic acid may be used when using operon, but is not limited thereto.
- a recombinant DNA vector encoding chaperone protein may be additionally transduced.
- the DNA encoding the chaperone protein may be included in the same vector as the DNA encoding ⁇ -1,2 fucosyl transferase, or may be included in different vectors, respectively. Can be transformed sequentially.
- an inducer of 0.001 mM to 2 mM is used at a temperature of 10 ° C. to 35 ° C., more preferably 12 ° C. to 30 ° C.
- the inducer means a substance that promotes the expression of the protein.
- lac operon there is IPTG (Isopropyl ⁇ -D-1-thiogalactopyranoside), and when using ara operon, arabinose (trbin), trp Indole acrylic acid may be used when using operon, but is not limited thereto.
- the present invention is characterized in that the concentration of the sugar receptor substrate is used above the concentration of guanosine 5'-diphosphate fucose (GDP-fuc) substrate, which is a donor of fucose. And 2 a method for producing fucosyl oligosaccharides.
- the concentration of the sugar receptor substrate is 1.1 to 20 times, preferably 1.5 to 10 times, more preferably 2 to 5 times, the concentration of guanosine 5'-diphosphate-fucose.
- the sugar receptor substrate refers to a sugar substrate capable of receiving fucose by ⁇ -1,2 fucosyl transferase, and examples thereof include, but are not limited to, galactose or lactose.
- the present invention provides a method for searching for ⁇ -1,2 fucosyl transferase variant comprising the following steps.
- ⁇ -derived from Helicobacter pylori 26695 having an amino acid sequence of SEQ ID NO: 2 through activity measurement among prokaryote-derived ⁇ -1,2 fucosyl transferase candidate groups to synthesize ⁇ -1,2 fucosyl oligosaccharides 1,2 fucosyl transferase was selected.
- This ⁇ -1,2 fucosyl transferase was described in 2006 by Eric Samain group [Sophie Drouillard, Large-scale synthesis of H-antigen oligosaccharides by expressing Helicobacter pylori ⁇ 1,2-fucosyltransferase in metabolically engineered Escherichia coli cells, Angewandte Chemie , 2006 , Vol.
- nucleotide sequence of SEQ ID NO: 3 was optimized in consideration of codon usage, GC codon%, and stable secondary structure formation of RNA using the "POMBE" program, and the original nucleotide sequence of SEQ ID NO: ⁇ -1,2 fucosyl transferase of SEQ ID NO: 1 having a homology of 3 to 87% was obtained.
- the optimized nucleotide sequence 1 of the present invention remains intact in the original nucleotide sequence 3, without being deleted, substituted, or added to the TAA-like repeat sequence and the AAAAAAG sequence where mutation or frame shift may occur.
- the chaperone of GroEL / GroES is used alone as a specific example, various chaperons including dnaK-dnaJ-grpE and a trigger factor may be used.
- the vector containing SEQ ID NO: 1 and the vector containing GroEL / GroES were simultaneously transformed into the BW25113 (DE3) strain to control the expression temperature and the concentration of IPTG. As shown in FIG. Using IPTG of 0.5 mM or less, preferably 0.1 mM or less, more preferably 0.01 mM or less, as an inducer, it was possible to produce 60% or more soluble protein relative to the total protein amount.
- a method for increasing the amount of soluble protein of ⁇ -1,2 fucosyl transferase with increased total protein expression, N-terminal of ⁇ -1,2 fucosyl transferase encoded by SEQ ID NO: 1 Introduced a fusion protein.
- ⁇ -1,2 fucosyl transferase of the present invention as a result of protein structure modeling, is unlikely to form a dimer of the protein (dimer), especially a structure that can cause steric hindrance around the N-terminus of the protein There is an advantage that the introduction of the fusion protein does not inhibit the activity of the enzyme.
- fusion proteins used in the present invention include F-ePGK (E. coli phosphoglycerate kinase, E. coli phosphoglycerate kinase, 40 kDa), N-ePGK (N-domain of E. coli phosphoglycerate kinase , 21 kDa) [Korean Patent Application No. 10-2012-0017666], ArsC (E. coli arsenate reductase, 16 kDa) [Jong-Am Song, A novel Escherichia coli solubility enhancer protein for fusion expression of aggregation-prone heterologous proteins, Enzyme and Microbial Technol ogy, 2011, Vol.
- F-ePGK E. coli phosphoglycerate kinase
- E. coli phosphoglycerate kinase 40 kDa
- N-ePGK N-domain of E. coli phosphoglycerate kinase , 21
- GMPK Guanosine monophosphate kinase, 23 kDa
- ACK E. coli acetate kinase, 44 kDa
- C30K9 silica
- GST glutathione S-transferases, 25 kDa
- the fusion protein that can be introduced into the N-terminus of the ⁇ -1,2 fucosyl transferase encoded by SEQ ID NO: 1 is not limited to the fusion proteins, and other fusions capable of maintaining the expression and structural stability of the native soluble state. Proteins are also possible.
- the gene encoding the fusion protein was followed by a spacer consisting of 6 to 30 nucleotides containing a restriction enzyme site, followed by the gene of SEQ ID NO: 1, and finally a recombinant DNA vector of SEQ ID NO: 1 to which the fusion protein was linked. It was.
- the present invention it was intended to obtain an active ⁇ -1,2 fucosyl transferase with an increased amount of soluble protein using the generated DNA vector.
- the vector was transformed into BW25113 (DE3) strain to express the protein using an inducer of 0.1 mM to 1 mM at a temperature of 18 °C to 37 °C, as shown in Figure 3 by the most fusion proteins ⁇ - It was confirmed that the expression of soluble 1,2-fucosyl transferase was induced.
- the activity of the ⁇ -1,2 fucosyl transferase to which the fusion protein is linked is 2 ′ using 5 mM guanosine 5′-diphosphate-fucose, 2.5 mM lactose, 2.5 mM MgCl 2 using a cell extract.
- the results were proportional to the expression level of soluble protein.
- GMPK, ACK, ArsC, N-ePGK and F-ePGK which are similar to or above the yield of the fucosilactose production using the ⁇ -1,2 fucosyl transferase co-expressed with the chaperones performed in the present invention.
- Fused ⁇ -1,2 fucosyl transferase may be used, and more preferably, ⁇ -1,2 fucosyl transferase fused with F-ePGK, N-ePGK and ArsC may be used.
- ⁇ -1,2 fucosyl oligosaccharide, 2′-fucosyllactose, derived from breast milk was produced using ⁇ -1,2 fucosyl transferase with increased soluble protein expression. Yield (%) of 2'-fucosyllactose production using 5 mM guanosine 5'-diphosphate-fucose, 2.5 mM lactose, 2.5 mM MgCl 2 using a cell extract co-expressed with chaperone as mentioned above As a result, as shown in FIG. 4, the yield of 24.7% was improved by 3.2 times compared to the yield before the sequence optimization (7.7%).
- the reaction conditions were optimized to further increase the productivity and yield of 2'-fucosyllactose, and the concentration of guanosine 5'-diphosphate-fucose, a sugar donor substrate, was fixed at 5 mM under sodium phosphate buffer.
- the concentration of lactose, the receptor substrate, to 10-20 mM the reaction rate was more than twice as fast as in the reaction. This not only speeds up the enzyme reaction by increasing the concentration of the receptor substrate, but also increases the yield by increasing the amount of lactose substrate, which is relatively inexpensive compared to guanosine 5'-diphosphate-fucose substrate, to increase yield. Economic production of lactose was made possible.
- 2'-fucosyllactose was produced by introducing the optimized method using cell extracts of cells producing ⁇ -1,2 fucosyl transferase linked to F-ePGK. Likewise, the production yield of 2'-fucosyllactose was improved to 90%, producing 2.2 g / L of 2'-fucosyllactose. Productivity (g / L / h) also decreased from the previous 12 hours of reaction time to 3 hours, 0.73 g / L, 14 times more than 0.05 g / L / h when expressed with chaperone prior to optimizing the reaction conditions. / h.
- the concentration of the receptor substrate was optimized from 5 mM L-fucose substrate using cell extracts of cells producing ⁇ -1,2 fucosyl transferase linked to the FKP enzyme of the salvage pathway.
- 2'-fucosyllactose was produced in 84% yield (2.05 g / L) in 8 hours, which was used to optimize the concentration of the sugar receptor substrate when using the fusion protein. 1.7 times more yield and 4.4 times more productivity (0.26 g / L / h) than before.
- the yield in the one pot reaction is shown in FIG. 5.
- the concentration of L-fucose used in the one-pot reaction of the present invention can be further improved, thereby also increasing the 2'-fucosyllactose production.
- ⁇ -1,2 fucosyl transferase did not have high homology among the proteins whose crystal structure was found, the secondary structure of the protein was extracted from the amino acid sequence to perform profile alignment.
- the homology between these template proteins and ⁇ -1,2 fucosyl transferase of the present invention is 15, 14 and 12%, respectively.
- alignment is performed by aligning the conserved sequence through multiple sequence alignment with the ⁇ -1,2 fucosyl transferase using the amino acid sequences of the searched template proteins and filling the gaps. It was.
- amino acid sequence alignment optimizes the energy of the protein's global structure and increase the accuracy of the amino acid side chain structure.
- binding site of the guanosine 5'-diphosphate-fucose, a donor substrate is the PDB structure having the highest structural similarity among all proteins to which the guanosine 5'-diphosphate-fucose is bound, C.elegans Guanosine 5′-diphosphate-fucose was docked in the model structure using Fucosyl transferase I derived from
- lactose a receptor substrate
- glutamate and aspartate candidates were selected to be candidates for key key amino acid residues that could act in the fucosyl transferase reaction to find binding sites.
- Aspartate 115 (D115) was searched for a complete decrease in activity.
- the lactose substrates were docked based on D115 to search for 7 residues within 5-10 ⁇ s around lactose and saturation mutations were performed on them.
- the gene of SEQ ID NO: 1 to which the fusion protein is linked was used as template DNA for mutant generation. Screening was effectively performed by colorimetric method using a pH indicator due to the increase in the amount of soluble protein after saturation mutation.
- the single amino acid substitution variant S249Y of S249 of ⁇ -1,2 fucosyl transferase S249Y represents the amino acid sequence of SEQ ID NO: 6 and the 249th amino acid position is substituted with ⁇ -1,2 with all possible amino acids other than serine All enzymes with the activity of fucosyl transferase are possible.
- DNA encoding the protein of SEQ ID NO: 6 may also include any DNA sequence SEQ ID NO: 7 and encoding all other possible substitutable amino acids at the 249th amino acid position.
- fusion protein- ⁇ -1,2 fucosyl transferase-peptide linker-tag gene A vector containing was constructed.
- the tag may be used for enzyme purification using affinity chromatography, and may include both a peptide tag and a protein tag.
- Peptide linkers may also be linkers consisting of small size or flexible amino acids such as glycine or serine. In the present invention, 5 to 20 glycine and serine amino acids were used as linkers, histidine tags were used, and as a result, purification of soluble proteins of ⁇ -1,2 fucosyl transferase was possible with high purity.
- Enzymatic Activity of 0.13 nmol / min / mg on Os Substrate [Sophie Drouillard, Large-scale synthesis of H-antigen oligosaccharides by expressing Helicobacter pylori ⁇ 1,2-fucosyltransferase in metabolically engineered Escherichia coli cells, Angewandte Chemie , 2006, Vol. 45 , 1778p], 3380 times higher.
- the intrinsic activity of variant S249Y showed almost the same value as that of wild strain.
- the ⁇ -1,2 fucosyl transferase with increased soluble protein production through the present invention is not only produced 2'-fucosyllactose, but also lactodifucotetraose (Lactodifucotetraose, Fuc ( ⁇ -1,2) Gal ⁇ 1 4Glc ( ⁇ -1,3) Fuc), LNFPI (Fuc ( ⁇ -1,2) Gal ⁇ 1,3GlcNAc ⁇ 1,3Gal ⁇ 1,4Glc), TFLNH (Trifucosyllactose-N-hexose), and LNDFHI (Lacto-N-difucohexoseI) Likewise, it can be applied to various ⁇ -1,2 fucosyl oligosaccharide production.
- codon usage GC codon%, using the “POMBE” program while maintaining the original amino acid sequence (SEQ ID NO: 2) of SEQ ID NO: 3 encoding ⁇ -1,2 fucosyl transferase And optimized in consideration of both stable secondary structure formation of RNA, and synthesized the gene of SEQ ID NO: 1 having a homology of 87% with SEQ ID NO: 3 of the original base sequence.
- a sense primer having a Nde I restriction enzyme recognition sequence for cloning the expression vector SEQ ID NO: 4
- An antisense primer SEQ ID NO: 5
- PCR was performed by adding 100 pmol of the primer polymer set forth in SEQ ID NOS: 4 and 5 and 50-100 ng of the template DNA cloned into the DNA polymerase reaction buffer, 0.2 mM dNTP, 2.5 mM MgCl 2 , and T-vector. It was performed using pfu DNA polymerase.
- the reaction conditions were performed a total of 30 times after 95 °C 5 minutes, 95 °C / 30 seconds (denatured), 55 °C / 1 minutes (annealing), 72 °C / 1 minutes (extension).
- the amplified PCR product was treated with restriction enzymes Nde I and Xho I, respectively, and inserted into pET24ma vector with T7 promoter.
- the vector used in the present invention may also include all expression vectors having various promoters, including the T7 promoter.
- the chaperone was expressed together to increase the amount of soluble protein of ⁇ -1,2 fucosyl transferase.
- PBAD vector containing GroEL / GroES was transformed to the BW25113 (DE3) strain simultaneously with the pET24ma vector cloned with SEQ ID NO: 1, and inoculated in LB medium containing ampicillin and kanamycin antibiotics at 5 to 30 to 37 ° C. After shaking culture for 10 to 10 hours, a portion of the culture solution Inoculated into 50 mL of LB medium containing ampicillin, kanamycin antibiotic and 1 mM arabinose. After incubation at 30-37 ° C., at 0.5-1 in OD600, 0.01-0.5 mM IPTG was added and expression was induced for 15-20 hours at temperatures below 25 ° C.
- a vector was constructed at which the fusion protein was introduced at the end.
- the fusion protein gene was cloned into the pET24ma vector.
- gene sequences of F-ePGK, N-ePGK, ArsC, GMPK and ACK were extracted using a database of NCBI.
- the primer for the following was produced.
- the sense primers were prepared to have Nde I restriction enzyme recognition sequences, and the antisense primers were prepared to have Sac I restriction enzyme recognition sequences.
- each primer pair prepared above was prepared by using DNA polymerase reaction buffer solution, 0.2 mM dNTP, 2.5 mM MgCl 2 , and 50 ng of genomic DNA of E. coli K12 as template DNA. 100 pmol was added and the reaction was performed using pfu DNA polymerase. The reaction conditions were performed a total of 30 times after 95 °C 5 minutes, 95 °C / 30 seconds (denatured), 55 °C / 1 minutes (annealing), 72 °C / 1 minutes (extension).
- the amplified PCR product was treated with restriction enzymes Nde I and Sac I, respectively, and inserted into pET24ma vector with T7 promoter.
- the vector used in the present invention may also include all expression vectors having various promoters, including the T7 promoter.
- C30K9 the cloned form of pET28a was used as a template DNA, and the C30K9 gene was amplified with Nde I and Sac I restriction enzyme recognition sequences under the above conditions, and cloned into pET24ma vector treated with Nde I and Sac I restriction enzymes. .
- Primers were prepared to clone the genes of ⁇ -1,2 fucosyl transferase of SEQ ID NO: 1 into the pET24ma vector, which is cloned with F-ePGK, N-ePGK, ArsC, GMPK, ACK and C30K9 genes.
- the sense primers were prepared so that the ⁇ -1,2 fucosyl transferase gene was sequentially released after a spacer consisting of 6 to 30 nucleotides containing the restriction enzyme recognition sequence of Sac I, which has the following nucleotide sequence.
- 'GCATGAGCTCGACGATGACGATAAAATGGCCTTTAAGGTG' or 'GCATGAGCTCATTGATGGCCGCATGGCCTTTAAGGTG' or 'GCATGAGCTCGGTGGAGGCGGTTCAGGCGGAGGTATGGCCTTTAAGGTG' may be used.
- the anticent primer was constructed by having a restriction enzyme recognition sequence of XhoI and a peptide linker consisting of 5 to 20 glycine or serine included after the ⁇ -1,2 fucosyl transferase gene, which has the following sequence number.
- the ⁇ -1,2 fucosyl transferase gene was amplified using the vector prepared in Example 1-1 as template DNA under the above PCR reaction conditions, and treated with Sac I and Xho I restriction enzymes.
- the amplified ⁇ -1,2 fucosyl transferase gene was cloned by treating the cloned vector with Sac I and Xho I restriction enzymes.
- the ⁇ -1,2 fucosyl transferase gene was amplified with SmaI and XhoI restriction enzyme recognition sequences using the pGEX 4T-1 vector in which the GST gene was recombined. Cloned into vector.
- the recombinant vector cloned with the fusion protein and ⁇ -1,2 fucosyl transferase was transformed into E. coli BW25113 (DE3) strain, and inoculated into LB medium containing kanamycin antibiotic for 5 to 10 hours at 30 to 37 ° C. After shaking culture, part of the culture 50 mL of LB medium containing 50 ⁇ gmL- 1 kanamycin antibiotic was inoculated. After incubation at 30 to 37 °C, when 0.5 to 1 in OD600, 0.1 to 1 mM of IPTG was added and expression was induced for 15 to 20 hours at a temperature of 18 to 37 °C.
- the cultured E. coli cells were centrifuged at 4000 rpm for 10 minutes to recover the cells, and the cells were resuspended in distilled water and centrifuged for 10 minutes. The supernatant was separated and distilled water was removed. The recovered cell precipitate was suspended in 5 mL of 20 mM sodium phosphate buffer, and the cells were crushed by an acoustic wave crusher to obtain a total fraction of protein (soluble protein + insoluble aggregate), centrifuged at 15000 rpm for 30 minutes, and then the supernatant was removed. Isolation yielded only soluble protein.
- NNK sequence (wherein N is A, C, G or T, and K is G or T) is substituted with an arbitrary sequence of the TCG sequence corresponding to amino acid position 249 of ⁇ -1,2 fucosyl transferase.
- the library was constructed by PCR of the entire vector using the primers.
- ⁇ -1,2 fucosyl transferase of the present invention is the first methionine sequence from the first methionine (methionine) sequence number is methionine.
- the amplified gene of the fusion protein-fucosyl transferase with an increased amount of soluble protein including the vector sequence was transformed into E. coli DH5 ⁇ after Dpn I enzyme treatment to remove the original plasmid. Mutant genes were extracted from all colonies generated and transformed into E. coli BW25113 (DE3). Each transformed colony was inoculated in 500 ⁇ L of LB medium containing kanamycin on 96-well and shaken incubated at 30 to 37 ° C. for 18 to 24 hours, and then a portion of the culture solution contained 50 ⁇ g mL ⁇ 1 kanamycin and IPTG. Inoculated in 500 ⁇ L of fresh LB medium and incubated for 18 to 40 hours at 18-30 °C.
- the cultured cells were centrifuged, and the cells were resuspended with 50 ⁇ L of BugBuster protein extraction reagent to obtain cell extracts after centrifugation, of which 10-20 ⁇ L was used for the variant search reaction.
- 80-90 ⁇ L of the reaction solution contains 1-10 mM Tris buffer pH 8.0, 1-5 mM guanosine 5′-diphosphate-fucose, 5-10 mM lactose, 0.1-1 mM pH indicator and fucosyl
- the absorbance was measured at a time interval of 30 minutes.
- the colorimetric method of sugar transfer enzymes is a measure of pH change due to hydrogen ions generated when glycosidic bonds between sugar donors and receptors are formed, which is proportional to the productivity of fucosylactose.
- the decrease in absorbance at 560 nm in which the red color of the indicator phenol red decreases was analyzed by using a spectral machine (Korean Patent No. 10-2013-0039938).
- Wild strains and variants of ⁇ -1,2 fucosyl transferase linked to the fusion protein were transformed into E. coli BW25113 (DE3), expressed in 50 mL culture volume using IPTG, and then disrupted with a sonic crusher. Cell extracts were obtained after centrifugation. Cell extracts were added to a column equilibrated with 50 mM Tris buffer solution (pH8.0) containing 5 mM imidazole and 300 mM sodium chloride, followed by binding to nickel resin (resin) at 0 ° C. for 1 hour. Then, the protein that failed to bind to the resin was drained and other proteins that were not specifically bound were removed with Tris buffer containing 50 mM imidazole.
- Tris buffer solution pH8.0
- Resin nickel resin
- the intrinsic activity of wild and single amino acid substitution variants of ⁇ -1,2 fucosyl transferase was determined using 50 mM sodium phosphate in 5 mM GDP-fuc, 10-20 mM Lactose, 5 mM MgCl 2 , using the same amount of protein, respectively.
- the mixture was mixed in a buffer solution and reacted at 37 ° C. for 15 to 30 minutes, and the product was quantified using Bio-LC by the method described in Example 2.
- the reaction was calculated as activity per mg of enzyme when showing a conversion yield of 10-25% relative to the initial donor substrate concentration.
- the enzyme activity (Unit) at this time was defined as the amount of enzyme required to produce 1 ⁇ mole of 2'-fucosyllactose per minute at 37 °C.
- the present invention provides a variant of ⁇ -1,2 fucosyl transferase with an increased amount of soluble protein through sequencing and protein engineering in the production of ⁇ -1,2 fucosyl oligosaccharides.
- ⁇ -1,2 fucosyl transferase with an increased amount of soluble protein through sequencing and protein engineering in the production of ⁇ -1,2 fucosyl oligosaccharides.
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Biomedical Technology (AREA)
- Biochemistry (AREA)
- Molecular Biology (AREA)
- Medicinal Chemistry (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Enzymes And Modification Thereof (AREA)
Abstract
본 발명은 헬리코박터 파일로리 26695(Helicobacter pylori 26695) 유래의 α-1,2 푸코실 전달효소 (α-1,2 fucosyltransferase)의 난발현성 재조합 단백질에 대한 가용성 단백질 발현을 증가시키는 방법과 그로 인해 생성된 α-1,2 푸코실 전달효소를 코딩하는 유전자, 상기 유전자의 발현 방법, 단백질 및 이 효소를 이용한 α-1,2 푸코실올리고당의 합성에 관한 것이다.
Description
본 발명은 헬리코박터 파일로리 유래의 α-1,2 푸코실 전달효소의 난발현성 재조합 단백질에 대한 가용성 단백질 발현의 증가와 단백질 공학적 변이를 통한 효소 엔지니어링에 관한 것으로, 활성형의 푸코실 전달효소를 코딩하는 최적화된 유전자와 이를 포함하는 발현벡터, 상기 유전자의 발현 방법 및 가용성 단백질 발현량이 향상된 α-1,2 푸코실 전달효소를 이용하여 푸코실올리고당을 합성하는 것에 관한 발명이다.
모유는 유아에게 필수적인 영양소를 제공하는 것뿐 아니라 단순한 영양소의 개념을 넘어 다양한 건강상의 이익을 제공한다. 모유 올리고당은 기능성 성분으로 구성되어 있으며 우유보다 100-200배 많은, 1L당 5-10 g의 올리고당을 포함하며, 지금까지 130 종류 이상의 모유 올리고당이 확인되었다. 이들 올리고당의 함유량과 구조적 다양성은 우유와 달리 모유에 있어서 매우 특이적이다. 모유 올리고당 중, 푸코실올리고당은 우유에 1% 미만으로 함유되어있는 반면, 모유에는 50-80% 가량으로 대량 존재한다. 특히, 환원 말단에 락토오스 (lactose)를 가지며 갈락토오스 (galactose)에 푸코오스 (fucose)가 α-1,2 결합으로 연결된 2'-푸코실락토오스 (2'-fucosyllactose)는 우유에는 존재하지 않지만 모유에는 2.6 g/L 정도가 함유되어있다.
모유 유래 푸코실올리고당의 인체 내 기능을 살펴보면, 첫 번째로 프리바이오틱스 (prebiotics)로서 젖산균 (Lactobacillus) 및 비피더스균 (Bifidobacteria)과 같은 장내 유용한 미생물의 생장을 촉진시키는 반면 클로스트리디움 (Clostridium)과 같은 유해 병원균의 생장을 막는 역할을 한다. 이는 짧은 길이(chain)의 푸코실올리고당을 탄소원으로 사용할 수 있는 비피더스균에 기인하며 이와 같은 유용한 미생물 균총의 균형을 유지함으로써 감염증 치료 및 예방, 항암작용, 숙주면역기능 자극, 비타민 섭취 증진과 같은 건강 증진에 효능이 있는 것으로 연구되어왔다.
두 번째로, 푸코실올리고당은 유해 박테리아나 바이러스 초기 감염 과정에서의 숙주세포의 장내 상피표면에의 부착을 막는 저해제로서 연구가 되어왔다. 2'-푸코실락토오스 (Fuc(α-1,2)Galβ1,4Glc)는 유아의 설사를 유발하는 캄필로박터 제주니(Campylobacter jejuni), 헬리코박터 파일로리 (Helicobacter pylori), 장독성원소 대장균 (Enterotoxigenic E. coli) 및 식중독을 유발하는 쥐티푸스 균 (Salmonella typhimurium), 클로스트리디움 퍼프린젠스(Clostridium perfringens)와 노로바이러스 (norovirus)의 수용체에 대한 인식 물질이 될 수 있어, 이들의 침입을 경쟁적으로 저해할 수 있다. 이와 같은 역할을 하는 2'-푸코실락토오스를 포함하는 다양한 모유 유래 푸코실올리고당은 유아식품과 기능성 식품 분야뿐 아니라 의약분야 등의 다양한 산업적 응용이 가능하다.
그러나, 모유 올리고당은 초유에서 추출하여 공급하는 경우 대량생산을 하기 어려운 단점이 있으며, 푸코실올리고당의 화학적합성의 경우, 올리고당 입체구조의 조절 및 선택성 유지를 위하여 복잡한 보호-탈보호(protection-deprotection) 반응을 거쳐야 하는 것과, 독성시약을 사용해야 한다는 문제점으로 인해 식품 또는 제약산업에 있어서 일반화된 공정으로 개발되기 어렵다는 단점을 가지고 있다.
이러한 측면에서 생물공학적 공정을 통한 합성기술이 경제적 규모의 올리고당 생산을 위한 최선의 대안으로 인식되어 이들에 대한 연구가 진행되고 있다. 푸코실올리고당의 생물공학적 공정은 푸코오스의 공여체인 구아노신 5'-이인산-푸코오스 (guanosine 5'-diphosphate fucose, GDP-fuc)라는 매우 고가의 기질이 필요하기 때문에, 구아노신 5'-이이산-만노오스 (GDP-mannose) 또는 푸코오스로부터 구아노신 5'-이인산-푸코오스를 생산하고 푸코실 전달효소를 이용하여 푸코실올리고당을 생산하는 연구가 진행되어왔다. 푸코당 공여체인 구아노신 5'-이인산-푸코오스로부터 수용체 기질로 푸코오스를 효율적으로 전달하기 위해서는 푸코실 전달효소의 촉매능력이 매우 중요하다고 볼 수 있다.
본 발명에 이용된 α-1,2 푸코실 전달효소는 갈락토오스 (galactose)의 2번 탄소에 α-1,2 결합으로 푸코오스를 전달하는 효소로서, 헬리코박터 파일로리 26695 균주에서 유래하며 1999년 Diane E. Taylor 그룹에 의해 처음으로 클로닝 되었다 [Wang G., Molecular genetic basis for the variable expression of Lewis Y antigen in Helicobacter pylori: analysis of the alpha (1,2) fucosyltransferase gene, Molecular Microbiology, 1999, Vol.31, 1265p]. 이 α-1,2 푸코실 전달효소는, 이후 2006년에 에릭 사맹(Eric Samain) 그룹에 의해 효소의 발현에 있어서 프레임 시프트(frame shift)를 일으킬 수 있는 14개의 시토신을 다른 12개의 뉴클레오티드 (nucleotide)로 대체되었고, 락토 N-테트라오스 (lacto-N-tetraose)및 락토오스에 대한 기질활성을 밝히게 되었다 [Sophie Drouillard, Large-scale synthesis of H-antigen oligosaccharides by expressing Helicobacter pylori α1,2-fucosyltransferase in metabolically engineered Escherichia coli cells, Angewandte Chemie, 2006, Vol.45, 1778p].
α-1,2 결합을 가지는 모유 유래 푸코실올리고당을 포함한 다양한 α-1,2 푸코실올리고당의 생산 효율을 증가시키기 위해서는 위에서 명시한 α-1,2 푸코실 전달효소의 효율적인 효소활성이 매우 중요하며, 이들을 푸코실올리고당 생산에 응용하기 위한 발명을 수행하였다.
푸코실올리고당을 합성하기 위해 푸코오스의 공여체인 구아노신 5'-이인산-푸코오스의 합성과 푸코실 전달효소 발현을 동시에 이용한 생체 내 (in vivo)와 생체 외 (in vitro) 반응이 시행되어왔다. 푸코실 전달효소의 푸코오스의 공여체인 구아노신 5'-이인산-푸코오스는 샐비지 경로 (salvage pathway)의 두 가지 효소활성을 가지는 FKP (L-fucokinase/GDP-fucose pyrophosphorylase) 효소에 의해 L-푸코오스로부터 생성될 수 있으며, 이로부터 푸코실 전달효소에 의해 푸코오스를 수용체 (예: 락토오스)로 전달할 수 있다. 헬리코박터 파일로리 26695 유래의 α-1,2 푸코실 전달효소를 이용한 상기 생체 내외 반응에 있어서, FKP 효소는 α-1,2 푸코실 전달효소에 비해 상대적으로 대장균에서의 가용성 단백질 발현량 및 효소 활성이 높기 때문에, 이 반응에 있어서 푸코실 전달효소반응 자체가 속도 결정 단계 (rate determining step)인 것으로 확인되었다. 속도 결정단계인 푸코실 전달반응을 증대시키기 위해서는, α-1,2 푸코실 전달효소의 대장균에서의 가용성 단백질 발현 및 효소 활성 증대가 매우 필요하다.
한편, 헬리코박터 파일로리 유래 α-1,2 푸코실 전달효소는 지금까지 대장균 내에서 전체 단백질 발현량 및 가용성 단백질의 발현량이 낮아 생체 내 및 생체 외 반응에 있어서 푸코실 전달반응이 느린 어려움이 있어 왔다. α-1,2 푸코실 전달효소의 경우, 프레임 시프트로 인해 절단 (truncation)된 형태의 단백질이 발현되는 것을 에릭 사맹(Eric Samain) 그룹에서 유전자 시퀀스 변환으로 이를 막았고 대장균 내에서 낮은 가용성 단백질 발현량을 높이기 위해 tac, T7등의 강력한 프로모터 (promoter)의 사용과 티오레독신(thioredoxine), GST와 같은 융합단백질을 함께 발현하는 것을 시도하였으나, 효소 활성이 매우 약하고 융합단백질의 발현은 오히려 효소활성을 70%이상 감소시켰으며 융합 단백질 없이 락토 N-테트라오스 기질에 대해 0.13 nmol/min/mg의 효소활성을 나타내었다 [Sophie Drouillard, Large-scale synthesis of H-antigen oligosaccharides by expressing Helicobacter pylori α1,2-fucosyltransferase in metabolically engineered Escherichia coli cells, Angewandte Chemie, 2006, Vol.45, 1778p]. 또한 Endo, Tetsuo에 의하여 2'-푸코실 전달효소의 유전자를 박테리아에서 사용빈도가 높은 코돈 (codon) 서열로 치환시켜서 모유 올리고당인 2'-푸코실락토오스를 생산하기 위한 시도가 있었으나, 1 L당 그램 (g) 이상의 수율을 얻기 위해서는 24 내지 48 시간 이상의 반응 시간이 필요하다는 단점이 있었다 [WO 01/046400].
생체 내 또는 생체 외 반응에 있어서 α-1,2 푸코실올리고당을 산업적으로 대량생산하기 위해서는 수율 증대와 생산성 증가 면에서 가용성 단백질의 발현량 증가와 함께 효소활성 증가가 필요하다. 하지만 현재까지 낮은 가용성 단백질 발현량으로 인해 효소 공학 수행 시, 효율적인 스크리닝 (screening) 방법을 적용하기가 어렵고 α-1,2 푸코실 전달효소의 밝혀진 결정 구조가 전혀 없어 단백질 공학적 변이를 통한 효소 엔지니어링의 시도가 전무하였다.
본 발명은, α-1,2 푸코실올리고당을 생산함에 있어서 염기서열 치환과 단백질 공학 변이를 통하여 가용성 단백질 양이 증대된 α-1,2 푸코실 전달효소의 변이체를 만들고 효소 반응 최적화와 함께 이를 α-1,2 푸코실올리고당 생산에 적용하여 수율 및 생산성을 증가시키는 것을 골자로 하고 있다.
본 발명의 목적은 염기서열이 최적화된 α-1,2 푸코실 전달효소 및 α-1,2 푸코실 전달효소의 변이체를 제조하고, 이를 이용하여 α-1,2 푸코실올리고당을 효과적으로 생산하는 것이다.
또한, 본 발명의 목적은 샤페론 발현, 융합단백질 도입, 및 반응조건 최적화를 통하여, α-1,2 푸코실올리고당의 생산성 및 효율을 향상시키는 것이다.
또한, 본 발명의 목적은 α-1,2 푸코실 전달효소의 단백질 공학적 변이를 위하여 단백질 구조 모델링 (modeling), 알라닌 스캐닝 (alanine scanning) 및 기질 구조 도킹 (docking)을 통해 기질 결합-모델 구조를 이용한 변이 후보 아미노산을 선정하는 것이다.
본 발명은 가용성 단백질 발현량이 증대된 활성형의 α-1,2 푸코실 전달효소를 코딩하는 최적화된 유전자 서열정보를 제공한다.
또한, 활성형의 α-1,2 푸코실 전달효소를 코딩하는 최적화된 유전자를 포함하는 재조합 DNA 벡터, α-1,2 푸코실 전달효소를 코딩하는 DNA 앞에 융합단백질을 코딩하는 DNA가 위치하는 것을 특징으로 하는 재조합 DNA 벡터, α-1,2 푸코실 전달효소의 유전자를 코딩하는 DNA와 상기 융합단백질을 코딩하는 DNA의 사이에 3개 내지 60개의 뉴클레오티드로 이루어진 스페이서를 가지는 것을 특징으로 하는 재조합 DNA 벡터로 형질 전환된 숙주세포를 제공한다.
또한, 발현량이 증가한 푸코실 전달효소에 대해 융합 단백질 도입을 통하여 단백질의 용해도를 증가시킨 재조합 DNA 벡터 및 상기 유전자를 효과적으로 발현하는 방법을 제공한다.
또한, 발현량이 증가한 푸코실 전달효소에 대해 샤페론과의 동시 발현을 통하여 단백질의 용해도 (solubility)를 증가시키는 방법과, 상기 유전자를 효과적으로 발현하는 방법을 제공한다.
또한, 본 발명에서는 가용성 단백질이 증대된 α-1,2 푸코실 전달효소에 대해서 단일 아미노산이 변화한 서열번호 6의 변이체와 이를 코딩하는 DNA 서열 정보 및 이를 포함하는 재조합 DNA 벡터, 그리고 재조합 DNA 벡터로 형질 전환된 숙주세포를 제공한다.
또한, 본 발명에서는 α-1,2 푸코실 전달효소를 이용하여 α-1,2 푸코실올리고당을 생산하는 것을 제공한다.
또한, 본 발명은 α-1,2 푸코실 전달효소의 단백질 공학적 변이를 위하여 단백질 구조 모델링 (modeling), 알라닌 스캐닝 (alanine scanning) 및 기질 구조 도킹 (docking)을 통해 기질 결합-모델 구조를 이용한 변이 후보 아미노산 선정 방법을 제공한다.
구체적으로 본 발명은 하기를 제공한다.
본 발명은 서열번호 1과 88% 이상의 상동성을 가지고, α-1,2 푸코실 전달효소를 코딩하는 DNA를 제공하며, 상기 DNA 를 포함하는 재조합 DNA 벡터, 재조합 DNA 벡터로 형질 전환된 숙주세포, 및 숙주세포의 추출물을 제공한다.
또한, 상기 α-1,2 푸코실 전달효소를 코딩하는 DNA 앞에 융합단백질을 코딩하는 DNA가 위치하는 것을 특징으로 하는 재조합 DNA 벡터, 및 상기 α-1,2 푸코실 전달효소의 유전자를 코딩하는 DNA와 상기 융합단백질을 코딩하는 DNA의 사이에 6개 내지 30개의 뉴클레오티드로 이루어진 스페이서를 가지는 것을 특징으로 하는 DNA 벡터를 제공한다.
또한 상기 벡터로 형질 전환된 것을 특징으로 하는, 형질 전환된 숙주세포, 및 숙주세포의 추출물을 제공한다.
또한, 샤페론 단백질을 코딩하는 재조합 DNA 벡터가 추가로 형질 전환된 것을 특징으로 하는, 형질 전환된 숙주세포, 및 숙주세포의 추출물을 제공한다.
또한, 서열번호 2 로 표시되는 α-1,2 푸코실 전달효소의 249 번째의 아미노산이 다른 아미노산으로 치환된 α-1,2 푸코실 전달효소 변이체를 제공하며, 상기 치환된 아미노산이 타이로신(tyrosine)인, 서열번호 6의 아미노산 서열로 표시되는 α-1,2 푸코실 전달효소 변이체를 제공하고, 서열번호 6의 아미노산 서열을 코딩하는, 서열번호 7로 표시되는 DNA를 제공한다. 또한 서열번호 7로 표시되는 DNA를 포함하는 DNA 벡터 및, 상기 DNA 벡터로 형질 전환된 숙주세포, 숙주세포의 추출물을 제공한다.
또한, 본 발명의 형질 전환된 숙주세포로부터 발현된 α-1,2 푸코실 전달효소의 폴리펩타이드, 본 발명의 α-1,2 푸코실 전달효소 변이체의 폴리펩타이드, 또는 본 발명의 α-1,2 푸코실 전달효소 변이체의 폴리펩타이드 뒤에 5개 내지 20개의 아미노산으로 이루어진 펩타이드 (peptide) 링커를 포함하는 폴리펩타이드를 제공한다.
또한, 서열번호 1과 88% 이상의 상동성을 갖는, α-1,2 푸코실 전달효소를 코딩하는 DNA를 포함하는 벡터로 형질 전환된 숙주세포 또는 상기 숙주세포의 추출물을 생촉매로 사용한 것을 특징으로 하는, α-1,2 푸코실올리고당의 제조 방법을 제공한다.
상기 제조방법에 있어서, 상기 벡터는 α-1,2 푸코실 전달효소를 코딩하는 DNA의 앞에 융합단백질을 코딩하는 DNA가 도입될 수 있으며, 이 때 15℃ 내지 38℃의 온도에서 0.005 mM 내지 5 mM의 유도인자(inducer)를 사용할 수 있다.
또한 상기 제조방법에 있어서, 상기 숙주세포는 샤페론 단백질을 코딩하는 재조합 DNA 벡터가 추가로 형질 전환된 것을 사용할 수 있으며, 이 때, 10℃ 내지 35℃의 온도에서 0.001 mM 내지 2 mM의 유도인자를 사용할 수 있다.
또한 상기 제조방법에 있어서, 당 수용체 기질의 농도를 푸코오스의 공여체인 구아노신 5'-이인산-푸코오스(guanosine 5'-diphosphate fucose, GDP-fuc) 기질 농도 이상으로 사용할 수 있다.
또한, 본 발명은 하기의 단계를 포함하는 α-1,2 푸코실 전달효소 변이체의 탐색 방법을 제공한다.
(1) α-1,2 푸코실 전달효소의 결정 구조 또는 모델 구조의 아스파테이트 115번(D115)으로부터 5 내지 10 Å 이내에서 선택된 잔기, 또는 α-1,2 푸코실 전달효소의 기질 결합 모델 구조로부터 수용체 기질이 결합하는 부위로부터 5 내지 10 Å 이내에서 선택된 잔기 중에서, 다수 서열 정렬과 알라닌 스캐닝을 통해 포화변이를 수행할 기능적 잔기를 분석하는 단계,
(2) pH 지시약을 이용한 비색법(colorimetric method)을 수행하는 단계.
본 발명의 가용성 단백질의 양이 획기적으로 향상된 α-1,2 푸코실 전달효소는 모유 유래 올리고당인 2'-푸코실락토오스 뿐만 아니라 다양한 고부가가치의 α-1,2 푸코실올리고당 생산에 적용할 수 있다.
구체적으로, 본 발명의 염기서열 최적화를 시킨 α-1,2 푸코실 전달효소 및 α-1,2 푸코실 전달효소의 변이체를 이용하여 가용성 단백질의 양을 증가시킬 수 있으며, 모유 유래 올리고당인 2'-푸코실락토오스 뿐만 아니라 다양한 고부가가치의 α-1,2 푸코실올리고당의 생산에 적용할 수 있다. 본 발명의 α-1,2 푸코실올리고당 생산방법은 α-1,2 푸코실올리고당의 생산 수율 및 생산성을 현저하게 증가시키므로, 생산 비용 절감 및 생산물로 인한 고부가가치 획득이 가능하게 한다.
또한, α-1,2 푸코실 전달효소의 가용성 단백질양의 획기적인 증가로 인해 단백질 공학을 이용한 효소 변이 이후의 스크리닝이 가능하게 되었으며 앞으로의 α-1,2 푸코실 전달효소의 결정 구조 (crystal structure) 파악 및 α-1,2 푸코실 전달효소를 이용한 연구에 이용될 수 있다.
이에 따라, 상기 α-1,2 푸코실올리고당 의 대량생산을 통하여 유아식품, 건강보조 첨가제, 치료제, 화장품, 의약품, 진단 분야 등의 다양한 분야에 활용이 가능하다.
도 1은 L-푸코오스로부터 ATP, GTP 및 수용체 기질과 함께 FKP와 2'-푸코실 전달효소를 이용한 2'-푸코실 올리고당 합성의 원 포트 반응 도식도이다.
도 2는 본 발명에서 염기서열 최적화와 샤페론과의 동시발현을 통해 전체 단백질 발현량 및 가용성 단백질이 증대된 α-1,2 푸코실 전달효소 세포 추출액에 대한 SDS-PAGE를 나타낸다. T는 세포 파쇄후의 전체 단백질 분획 (total protein)을 나타내며, S는 가용성 단백질 (soluble protein)을 나타낸다. 도 2의 (a)는 본래의 α-1,2 푸코실 전달효소와 염기서열 최적화 후의 α-1,2 푸코실 전달효소의 발현된 단백질 양을 나타내며, (b)는 염기서열 최적화 이후 샤페론과의 동시 발현에 있어서 유도인자로 사용한 IPTG의 농도 최적화에 따른 가용성 단백질 증가를 나타낸다.
도 3은 본 발명에서 최적화된 염기서열의 앞에 다양한 융합 단백질을 발현하여 이들의 세포 추출액에 대해서 단백질의 양을 SDS-PAGE로 나타낸 것이다. 화살표는 융합단백질과 함께 발현된 α-1,2 푸코실 전달효소의 단백질 크기를 나타낸다.
도 4는 염기서열 최적화, 샤페론과의 동시발현, 융합 단백질 발현에 따른 구아노신 5'-이인산-푸코오스 기질로부터 2'-푸코실락토오스를 생산하는 수율 (%) 및 생산량 (g/L)을 나타낸다. 이와 함께 염기서열 최적화와 융합단백질의 도입 (Optimized 2'FT + fusion protein + Rxn optimization) 부분은 생산 수율과 생산성을 높이기 위한 반응 최적화가 함께 이루어졌다.
도 5는 샤페론과의 동시발현, 융합 단백질 발현에 따른 L-푸코오스 기질로부터 FKP 효소와 함께 ATP, GTP, MnSO4 등을 기질로 하는 원 포트 반응에서의 2'-푸코실락토오스를 생산하는 수율 (%) 및 생산량 (g/L)을 나타낸다. 이와 함께 융합단백질의 도입과 반응의 최적화 (Optimized 2'FT + fusion protein + Rxn optimization)는 생산 수율과 생산성을 높이기 위한 반응 최적화 (수용체 기질 농도 및 완충용액 최적화)가 함께 이루어졌다.
도 6은 본 발명에서 탐색한 단일 아미노산 치환 변이체인 S249Y와 야생주의 세포 추출물에 대한 전체 단백질 및 가용성 단백질 생산량을 SDS-PAGE로 나타낸 것이다.
본 발명에서 사용되는 용어는 당업계에서 통상적으로 사용되는 것으로 당업자라면 그 의미를 누구나 이해할 수 있을 것이나, 본 명세서에서 간략히 설명하면 다음과 같다:
(1) 푸코실 전달효소는 당 공여체인 구아노신 5'-이인산-푸코오스로부터 푸코오스를 당 수용체 물질에 전달하는 효소를 의미한다.
본 발명의 명세서에서 특별한 언급이 없는 한, 'α-1,2 푸코실 전달효소'는 갈락토오스 (galactose)의 2번 탄소에 α-1,2 결합으로 푸코오스를 전달하는 효소로서, 바람직한 예시로서 본 발명의 염기서열 1과 88% 이상의 상동성을 갖는 DNA로부터 유래한, α-1,2 푸코실 전달효소 활성을 갖는 단백질을 의미한다.
(2) 수용체 기질 중 하나인, 락토오스는 Galβ1,4Glc (갈락토오스와 글루코오스가 β1,4 결합으로 연결됨)로 구성된 올리고당이다.
(3) 2'-푸코실올리고당은 푸코오스가 갈락토오스 부분에 α-1,2 결합으로 연결된 올리고당을 의미하며, 갈락토오스에 다른 당이 더 결합된 구조이다.
(4) 2'-푸코실락토오스는 (Fuc(α-1,2)Galβ1,4Glc) (푸코오스가 락토오스의 갈락토오스에 α-1,2 결합으로 연결됨)로 구성된 삼탄당 (triose) 물질을 의미한다.
(5) '형질전환'은 DNA를 숙주로 도입하여 DNA가 염색체 외 인자로서 또는 염색체 통합완성에 의해 복제 가능하게 되는 것을 의미한다.
(6) 세포추출물은 푸코실 전달효소가 발현된 본 발명의 미생물 추출물을 의미한다.
(7) 세포추출물을 이용한 반응은 특정 효소를 포함하는 세포를 파쇄하여 세포 내용물을 이용하거나 또는 효소를 분리정제하지 않고 온전한 세포 전체를 이용한 반응을 의미한다.
(8) 단백질의 코돈 최적화란 아미노산 서열은 변화하지 않고, 해당 아미노산을 코딩하는 뉴클레오티드 서열을 변화시키는 것이다. 보통 원하는 숙주세포에서의 단백질 발현을 높이고자 사용되며, 코돈 최적화는 코돈 사용빈도, GC 서열 %, RNA 2차 구조 형성, 반복서열의 제거 유무, tRNA 선호도 등 그 원리가 필요에 따라 다양할 수 있으며, 어느 하나의 원리에 제한된 것은 아니다.
(9) 작은 크기의 아미노산은 기능기가 작은 아미노산을 말하며, 글리신 (glycine), 알라닌 (alanine), 세린 (serine), 트레오닌 (threonine), 시스테인 (cystein)을 포함한다.
(10) 융합단백질이란 원하는 단백질의 올바른 접힘 (folding)을 유도하기 위해 원하는 단백질의 N-말단에 융합하여 사용하는 단백질을 의미하며, 융합 단백질의 종류에는 제한이 없다.
(11) PCR은 중합 효소 연쇄반응(Polymerase Chain Reaction)으로서, DNA의 어떤 영역을 특이적으로 증폭시키는 방법을 의미한다.
(12) 포화 변이 (saturation mutagenesis)는 유전자의 지정된 위치에 다양한 염기배열의 변화를 도입하는 것을 말한다. 포화 변이는 주형가닥에 결합하는 상보적인 서열의 프라이머 (primer)상에 변이시키고자 하는 서열대신 NNK 코돈을 삽입하여 PCR을 통해 변이를 삽입시키는 것을 말한다. 이 때, NNK 코돈에서 N은 뉴클레오디드의 A, T, G, C를 의미하며 K는 T, G를 의미한다.
(13) 벡터는 단일가닥, 이중가닥, 원형 또는 초나선 DNA 또는 RNA로 이루어진 폴리뉴클레오티드를 의미하며, 재조합 단백질을 생산할 수 있도록 적절한 거리에 작동적으로 연결되어 있는 구성요소들을 포함할 수 있다.
이러한 구성요소에는 복제 오리진, 프로모터, 인핸서, 5'mRNA 리더 서열, 리보솜 결합부위, 핵산 카세트, 종결 및 폴리아데닐화 부위, 또는 선별 가능한 표지 서식 등이 포함될 수 있으며, 상기 구성요소들은 특이적인 용도에 따라 하나 또는 그 이상이 빠질 수도 있다. 핵산 카세트는 발현할 재조합 단백질의 삽입을 위한 제한효소 부위를 포함할 수 있다. 기능적 벡터에 있어서, 핵산 카세트는 번역 개시 및 종결 부위를 포함하는 발현될 핵산 서열을 함유하며, 필요에 따라 벡터에 내에 두 종류의 카세트를 삽입할 수 있는 벡터를 사용하기도 하며 상기 언급한 기능들이 부가적으로 서열화 될 수 있다.
(14) 재조합 벡터에 삽입된 유전자는 발현용 대장균 균주 BW25113(DE3), BL21(DE3) 등을 사용할 수 있으나, 삽입된 벡터의 종류에 따라 달라질 수 있다. 이러한 벡터 및 발현 균주는 당업자라면 용이하게 선택할 수 있다.
(15) pH 지시약 (pH indicator)은 적정을 하면서 중화점을 알기 위해, 혹은 수소이온의 농도를 알기 위해서 주로 사용되는 것을 말한다. 지시약은 수소이온 지수에 따라 산형 및 염기형으로 되어 색조가 다르며 이 영역을 변색영역이라 부른다. 분광광도법에 의해 흡광도에 따른 수소 이온의 농도를 측정할 수 있다.
(16) 고유활성도 (specific activity)는 효소정제를 통해 불순물 및 다른 단백질을 제거한 순수한 단백질의 단위량 당 활성을 나타내는 것으로 보통 1분간에 1 μmol의 기질 변화를 촉매하는 효소량을 1단위로 하여 1mg당 단위수로 표시한다.
이하, 본 발명에 대하여 보다 상세히 설명한다.
본 발명은 서열번호 1과 88% 이상의 상동성을 가지고, α-1,2 푸코실 전달효소를 코딩하는 DNA를 제공한다.
상기 서열번호 1로 표시되는 DNA는, 헬리코박터 파일로리 26695 유래의 α-1,2 푸코실 전달효소의 아미노산 서열(서열번호 2)을 코딩하는 DNA의 12개 뉴클레오티드를 대체한 서열번호 3으로부터, 코돈 최적화를 수행하여 수득할 수 있다. 수득된 서열번호 1의 DNA와 서열번호 3의 DNA는 87%의 상동성을 갖는다. 본 발명의 최적화된 서열번호 1은, 서열번호 3의 경우보다 전체 단백질 발현량이 우수한 효과가 있다.
본 발명은 상기 α-1,2 푸코실 전달효소를 코딩하는 DNA를 포함하는 재조합 DNA 벡터를 제공한다.
상기 재조합 DNA 벡터는, α-1,2 푸코실 전달효소를 코딩하는 DNA 앞(N-말단)에 융합단백질을 코딩하는 DNA가 위치할 수 있다. 융합단백질이란 원하는 단백질의 올바른 접힘 (folding)을 유도하기 위해 원하는 단백질의 N-말단에 융합하여 사용하는 단백질을 의미하며, 사용할 수 있는 융합단백질의 종류로는 F-ePGK, N-ePGK, ArsC, GMPK, ACK 등이 있으나, 이에 제한되지 않는다.
α-1,2 푸코실 전달효소의 유전자를 코딩하는 DNA와 융합단백질을 코딩하는 DNA 사이에는 뉴클레오티드로 이루어진 스페이서 (spacer)를 가질 수 있으며, 스페이서는 제한효소를 인식하는 서열을 포함할 수 있다.
스페이서는 유전자간의 DNA 배열을 의미하며, 상기 스페이서의 뉴클레오티드는 바람직하게는 3개 내지 60개, 보다 바람직하게는 3개 내지 45개, 가장 바람직하게는 6개 내지 30개 이다.
본 발명은 상기 재조합 DNA 벡터로 형질 전환된 숙주세포 및 숙주세포의 세포추출물을 제공한다.
상기 숙주세포에는 샤페론 단백질을 코딩하는 재조합 DNA 벡터가 추가적으로 형질 도입될 수 있다. 샤페론 단백질을 코딩하는 DNA는 α-1,2 푸코실 전달효소를 코딩하는 DNA와 동일한 벡터에 포함되거나, 상이한 벡터에 각각 포함될 수 있으며, 상이한 벡터에 각각 포함된 경우, 숙주세포에 동시에 형질전환 되거나 순차적으로 형질전환 될 수 있다.
상기 샤페론은 dnaK-dnaJ-grpE, 촉발인자 (trigger factor)를 포함하는 샤페론이 사용될 수 있으나, 이에 제한되지 않는다. 본 발명의 일 실시예로서 GroEL/GroES 샤페론을 사용하였다.
상기 세포추출물은 푸코실 전달효소가 발현된 본 발명의 미생물 추출물을 의미한다.
본 발명은 서열번호 2 로 표시되는 α-1,2 푸코실 전달효소의 249 번째의 아미노산이 세린 이외의 다른 아미노산으로 치환된 것을 특징으로 하는, α-1,2 푸코실 전달효소 변이체를 제공한다.
상기 변이체의 249번째의 아미노산은 임의의 아미노산으로 치환될 수 있으며, 바람직하게는 상기 치환된 아미노산은 타이로신(tyrosine; Y)이다. 타이로신으로 치환된 아미노산 서열은 서열번호 6에 나타내었으며, 이를 코딩하는 DNA는 서열번호 7에 나타내었다. 상기 서열번호 249번째 아미노산의 치환으로 인하여, 푸코실 전달효소 가용성 단백질이 증가하는 효과가 있다.
본 발명은 상기 α-1,2 푸코실 전달효소 변이체를 코딩하는, 서열번호 7의 DNA를 포함하는 재조합 벡터, 서열번호 7의 DNA를 포함하는 재조합 벡터로 형질전환된 숙주세포 및 숙주세포의 추출물을 제공한다.
본 발명은 α-1,2 푸코실 전달효소의 폴리펩타이드 뒤에 아미노산으로 이루어진 펩타이드(peptide) 링커를 제공한다. 상기 링커는 바람직하게는 크기가 작은, 또는 유연한(flexible) 아미노산이고, 보다 바람직하게는 글리신(glycine), 알라닌(alanine), 세린(serine), 트레오닌(threonine), 및 시스테인(cystein)으로 이루어진 군에서 선택된 하나 이상으로 구성된다. 펩타이드 링커의 아미노산은 바람직하게는 2 내지 40개, 보다 바람직하게는 4 내지 30개, 가장 바람직하게는 5 내지 20개의 아미노산 잔기이다.
상기 펩타이드 링커의 연결을 통하여, α-1,2 푸코실 전달효소 - 펩타이드 링커 - 태그 (tag) 유전자를 포함하는 벡터를 제조할 수 있다. 태그 (tag)란, 친화 크로마토그래피를 이용한 효소 정제에 이용될 수 것으로서, 통상의 기술자라면 바람직한 태그를 선택할 수 있다. 태그는 펩타이드 태그와 단백질 태그가 모두 포함될 수 있으며, 본 발명의 일 실시예로는 히스티딘 태그를 사용하였다. 상기 링커 태그 유전자를 포함하는 벡터를 사용하면, α-1,2 푸코실 전달효소의 가용성 단백질을 높은 순도로 정제하는 것이 가능하다.
본 발명은 서열번호 1과 88% 이상의 상동성을 갖는, α-1,2 푸코실 전달효소를 코딩하는 DNA를 포함하는 벡터로 형질 전환된 숙주세포 또는 상기 숙주세포의 추출물을 생촉매로 사용한 것을 특징으로 하는, α-1,2 푸코실올리고당의 제조 방법을 제공한다.
상기 제조방법에서 사용된 벡터는, α-1,2 푸코실 전달효소를 코딩하는 DNA의 앞에 융합단백질을 코딩하는 DNA가 도입될 수 있다.
α-1,2 푸코실 전달효소의 유전자를 코딩하는 DNA와 융합단백질을 코딩하는 DNA 사이에는 뉴클레오티드로 이루어진 스페이서를 가질 수 있으며, 스페이서는 제한효소를 인식하는 서열을 포함할 수 있다. 스페이서의 뉴클레오티드는 바람직하게는 3개 내지 60개, 보다 바람직하게는 3개 내지 45개, 가장 바람직하게는 6개 내지 30개 이다.
융합단백질을 코딩하는 DNA가 도입된 경우, 바람직하게는 15℃ 내지 38℃의 온도에서 0.005 mM 내지 5 mM의 유도인자(inducer)를 사용하고, 보다 바람직하게는 17℃ 내지 38℃의 온도에서 0.01 mM 내지 3 mM의 유도인자를 사용하며, 가장 바람직하게는 18℃ 내지 37℃의 온도에서 0.1 mM 내지 1 mM의 유도인자를 사용할 수 있다. 상기의 조건을 만족할 경우, α-1,2 푸코실 전달효소의 가용성 단백질 발현량이 증가하는 우수한 효과가 있다.
상기 유도인자는 단백질의 발현을 촉진시키는 물질을 의미하며, 그 예로서, lac 오페론을 사용할 경우 IPTG(Isopropyl β-D-1-thiogalactopyranoside)가 있으며, ara 오페론을 사용할 경우 아라비노스 (arabinose), trp 오페론을 사용할 경우 인돌아크릴산 등이 사용될 수 있으나, 이에 제한되지 않는다.
상기 제조방법에서 사용된 숙주세포는, 샤페론 단백질을 코딩하는 재조합 DNA 벡터가 추가적으로 형질 도입될 수 있다. 샤페론 단백질을 코딩하는 DNA는 α-1,2 푸코실 전달효소를 코딩하는 DNA와 동일한 벡터에 포함되거나, 상이한 벡터에 각각 포함될 수 있으며, 상이한 벡터에 각각 포함된 경우, 숙주세포에 동시에 형질전환 되거나 순차적으로 형질전환 될 수 있다.
샤페론 단백질을 코딩하는 재조합 DNA 벡터가 숙주세포에 추가적으로 형질 도입된 경우, 바람직하게는, 10℃ 내지 35℃의 온도에서 0.001 mM 내지 2 mM의 유도인자를 사용하고, 보다 바람직하게는 12℃ 내지 30℃의 온도에서 0.005 mM 내지 1 mM의 유도인자를 사용하고, 가장 바람직하게는 15℃ 내지 25℃의 온도에서 0.01 mM 내지 0.5 mM의 유도인자를 사용할 수 있다. 상기의 조건을 만족할 경우, α-1,2 푸코실 전달효소의 가용성 단백질 발현량이 증가하는 우수한 효과가 있다.
상기 유도인자는 단백질의 발현을 촉진시키는 물질을 의미하며, 그 예로서, lac 오페론을 사용할 경우 IPTG(Isopropyl β-D-1-thiogalactopyranoside)가 있으며, ara 오페론을 사용할 경우 아라비노스 (arabinose), trp 오페론을 사용할 경우 인돌아크릴산 등이 사용될 수 있으나, 이에 제한되지 않는다.
본 발명은 당 수용체 기질의 농도를 푸코오스의 공여체인 구아노신 5'-이인산-푸코오스(guanosine 5'-diphosphate fucose, GDP-fuc) 기질 농도 이상으로 사용하는 것을 특징으로 하는, α-1,2 푸코실올리고당의 제조 방법을 제공한다. 당 수용체 기질의 농도는 구아노신 5'-이인산-푸코오스의 농도의 1.1배 내지 20배, 바람직하게는 1.5배 내지 10배, 보다 바람직하게는 2배 내지 5배 이다.
상기 당 수용체 기질은, α-1,2 푸코실 전달효소에 의해 푸코오스를 전달받을 수 있는 당 기질을 의미하며, 그 예로서 갈락토오스 또는 락토오스가 있으나, 이에 제한되지 않는다.
본 발명은 하기의 단계를 포함하는 α-1,2 푸코실 전달효소 변이체의 탐색 방법을 제공한다.
(1) α-1,2 푸코실 전달효소의 결정 구조 또는 모델 구조의 아스파테이트 115번(D115)으로부터 5 내지 10 Å 이내에서 선택된 잔기, 또는 α-1,2 푸코실 전달효소의 기질 결합 모델 구조로부터 수용체 기질이 결합하는 부위로부터 5 내지 10 Å 이내에서 선택된 잔기 중에서, 다수 서열 정렬과 알라닌 스캐닝을 통해 포화변이를 포화변이를 수행할 기능적 잔기를 분석하는 단계,
(2) pH 지시약을 이용한 비색법(colorimetric method)을 수행하는 단계.
이하, 실시예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로서, 본 발명의 요지에 따라 본 발명의 범위가 이들 실시예에 의해 제한되지 않는다는 것은 본 발명이 속하는 기술분야에서 통상의 지식을 가진 자에게 있어서 자명할 것이다.
푸코실 전달효소의 염기 서열 최적화
본 발명에서는 α-1,2 푸코실 올리고당을 합성하기 위하여 원핵생물 유래 α-1,2 푸코실 전달효소 후보군들 중에서, 활성측정을 통해 서열번호 2의 아미노산 서열을 가지는 헬리코박터 파일로리 26695 유래의 α-1,2 푸코실 전달효소를 선택하였다. 이 α-1,2 푸코실 전달효소는 2006년에 Eric Samain 그룹 [Sophie Drouillard, Large-scale synthesis of H-antigen oligosaccharides by expressing Helicobacter pylori α1,2-fucosyltransferase in metabolically engineered Escherichia coli cells, Angewandte Chemie, 2006, Vol.45, 1778p]에 의해 발표된 바와 같이 효소의 발현에 있어서 mRNA 번역시 프레임 시프트(frame shift)를 일으킬 수 있는 14개의 시토신 염기를 프롤린 (proline)을 코딩할 수 있는 다른 12개의 뉴클레오티드로 대체시켰다 (서열번호 3). 그러나, 온도와 유도인자인 IPTG(Isopropyl β-D-1-thiogalactopyranoside)의 농도를 조절하였음에도 불구하고 도 2(a)에서와 같이 전체 단백질 발현량 및 가용성 단백질 (soluble protein) 발현량이 매우 적어 푸코올리고당인 푸코실락토오스 생산에 있어서 푸코오스 전달반응이 속도 결정단계임이 확인되었다.
이에 있어서, 서열번호 3의 뉴클레오티드 서열을 “POMBE” 프로그램을 사용하여 코돈 사용빈도 (codon usage), GC 코돈 % 및 RNA의 안정한 2차 구조 형성을 모두 고려하여 최적화 하였으며, 본래의 염기서열인 서열번호 3과 87%의 상동성을 갖는 서열번호 1의 α-1,2 푸코실 전달효소를 획득하였다. 본 발명의 최적화된 염기서열 1은 본래의 염기서열 3 에 있어서, 돌연변이나 프레임시프트가 일어날 수 있는 TAA 유사 반복 서열과 AAAAAAG 서열에 대해서 결실, 치환, 또는 부가된 것 없이 본래와 같이 유지된 상태로 최적화 되었으며, 도 2(a)에서와 같이 33 kDa의 크기로 전체 단백질 발현량이 염기서열 3의 발현보다 5배 이상 증가하였다. 또한 본 발명에서는, 최적화된 염기서열인 서열번호 1과 함께 서열번호 1과 88% 이상의 상동성을 가지며 α-1,2 푸코실 전달효소의 활성을 가지는 단백질을 코딩하는 염기서열이 포함될 수 있다.
푸코실 전달효소의 가용성 단백질 발현량 증대
본 발명을 통해 전체 단백질 발현량이 증가된 α-1,2 푸코실 전달효소의 가용성 단백질의 양을 증대시키기 위한 방법으로서, 샤페론 (chaperone) 을 함께 발현하는 방법과 융합단백질을 도입하는 방법이 사용되었다.
본 발명에서는, 구체적인 예로 GroEL/GroES의 샤페론이 단독으로 사용되었으나, dnaK-dnaJ-grpE, 촉발인자 (trigger factor)를 포함하는 다양한 샤페론이 사용될 수 있다. 서열번호 1을 포함하는 벡터와 GroEL/GroES를 포함하는 벡터를 동시에 BW25113 (DE3) 균주에 형질 전환하여 발현 온도 및 IPTG의 농도를 조절하여 확인한 결과, 도 2(b)에서와 같이 25℃ 이하에서 0.5 mM 이하, 바람직하게는 0.1 mM 이하, 더 바람직하게는 0.01 mM 이하의 IPTG를 유도인자로 사용한 결과, 전체 단백질 양 대비 60% 이상의 가용성 단백질을 생산할 수 있었다. 상기 샤페론이 동시 발현된 세포추출물을 이용하여 5 mM 구아노신 5'-이인산-푸코오스, 2.5 mM 락토오스, 2.5 mM MgCl2를 이용하여 2'-푸코실락토오스 생산 수율 (%)을 비교한 결과, 도 4에서와 같이 서열최적화 전의 수율 (7.7%)에 비하여 3.2배 향상된 24.7%의 수율을 나타내었다.
또한 본 발명에서는 전체 단백질 발현량이 증가된 α-1,2푸코실 전달효소의 가용성 단백질의 양을 증대시키기 위한 방법으로서, 서열번호 1이 코딩하는 α-1,2푸코실 전달효소의 N-말단에 융합단백질을 도입하였다. 본 발명의 α-1,2푸코실 전달효소는 단백질 구조 모델링의 결과로 볼 때, 단백질이 이합체 (dimer)를 이룰 확률이 낮으며 특히 단백질의 N-말단 주변에 입체 장애를 일으킬 수 있는 구조가 없기 때문에 융합 단백질의 도입이 효소의 활성을 저해하지 않는 장점이 있다.
본 발명에서 사용한 융합 단백질의 예는 F-ePGK (대장균의 포스포글리세르산 인산화효소, E.coli phosphoglycerate kinase, 40 kDa), N-ePGK (대장균의 포스포글리세르산 인산화효소의 N-도메인, 21 kDa) [한국 출원번호10-2012-0017666], ArsC (대장균의 비산 환원효소, arsenate reductase, 16 kDa) [Jong-Am Song, A novel Escherichia coli solubility enhancer protein for fusion expression of aggregation-prone heterologous proteins, Enzyme and Microbial Technology, 2011, Vol.49, 124p], GMPK (대장균의 구아노신 일인산 인산화 효소, guanosine monophosphate kinase, 23 kDa), ACK (대장균의 아세테이트 인산화효소, acetate kinase, 44 kDa), C30K9 (누에 유래 단백질, 30 kDa) 및 GST (glutathione S-transferases, 25 kDa) 등이다. 그러나 서열번호 1이 코딩하는 α-1,2푸코실 전달효소의 N-말단에 도입 가능한 융합단백질은 상기 융합단백질들에 국한된 것은 아니며, 본연의 가용성 상태의 발현 및 구조 안정성을 유지할 수 있는 다른 융합단백질들도 가능하다.
상기 융합 단백질을 코딩하는 유전자에 이어 제한효소 사이트가 포함되는 6개 내지 30개의 뉴클레오티드로 이루어진 스페이서에 이어 뒤따라 서열번호 1의 유전자를 연결하였고 최종적으로 융합단백질이 연결된 서열번호 1의 재조합 DNA 벡터를 생성하였다.
본 발명에서는 상기 생성한 DNA 벡터를 이용하여 가용성 단백질의 양이 증대된 활성형의 α-1,2 푸코실 전달효소를 얻고자 하였다. 상기 벡터를 BW25113 (DE3) 균주에 형질 전환하여 18℃ 내지 37℃의 온도에서 0.1 mM 내지 1 mM의 유도인자를 사용하여 단백질을 발현하였고, 도 3에서와 같이 대부분의 융합 단백질들에 의하여 α-1,2푸코실 전달효소의 가용성으로의 발현이 유도된 것이 확인되었다.
본 발명에서 사용된 상기 융합 단백질들은 모두 융합 단백질을 각각 단독으로 발현하였을 때, 전체 단백질 발현량 및 가용성도가 매우 높았고, 융합 단백질과 α-1,2푸코실 전달효소가 연결된 단백질을 발현한 경우에는 융합 단백질의 종류에 따라 유도된 α-1,2푸코실 전달효소의 가용성도가 다소 다르게 나타났으며 융합단백질과 α-1,2푸코실 전달효소를 합한 크기의 단백질이 관찰되었다 (F-ePGK: 73 kDa, N-ePGK: 54 kDa, ArsC: 49 kDa, GMPK: 56 kDa, ACK: 77 kDa, C30K9: 63 kDa, GST: 58 kDa). 도 3에서와 같이 α-1,2푸코실 전달효소의 가용성 단백질 발현량은 GST와 C30K9 융합단백질을 제외하고 융합단백질의 사용전보다 증가하였다.
상기 융합단백질이 연결되어있는 α-1,2푸코실 전달효소의 활성을 세포추출물을 이용하여 5 mM 구아노신 5'-이인산-푸코오스, 2.5 mM 락토오스, 2.5 mM MgCl2를 이용하여 2'-푸코실락토오스 생산 수율을 상대적으로 비교한 결과, 가용성 단백질의 발현량과 비례적인 결과를 얻을 수 있었다. 본 발명에서 수행한 상기 샤페론이 함께 발현된 α-1,2푸코실 전달효소를 이용한 푸코실락토오스 생산 반응의 수율과 비슷하거나 또는 그 이상으로서, GMPK, ACK, ArsC, N-ePGK 및 F-ePGK가 융합된 α-1,2푸코실 전달효소가 사용될 수 있으며, 더 바람직하게는 F-ePGK, N-ePGK 및 ArsC가 융합된 α-1,2푸코실 전달효소가 사용될 수 있다.
가용성 단백질 발현량이 증대된 α-1,2 푸코실 전달효소를 이용한 푸코실락토오스 생산
본 발명을 통해 가용성 단백질 발현량이 증대된 α-1,2 푸코실 전달효소를 이용하여 모유 유래 α-1,2 푸코실 올리고당인 2'-푸코실락토오스를 생산하였다. 위에서 언급한 바와 같이 샤페론이 동시 발현된 세포추출물을 이용하여 5 mM 구아노신 5'-이인산-푸코오스, 2.5 mM 락토오스, 2.5 mM MgCl2를 이용하여 2'-푸코실락토오스 생산 수율 (%)을 비교한 결과, 도 4에서와 같이 서열최적화 전의 수율 (7.7%)에 비하여 3.2배 향상된 24.7%의 수율을 나타내었다. 또한 융합 단백질이 α-1,2 푸코실 전달효소의 N-말단에 도입된 경우에는 샤페론과의 동시 발현한 경우와 비슷하거나 또는 1.4배 이상에서 2배까지 2'-푸코실락토오스의 생산 수율이 증가하였다.
본 발명에서는 2'-푸코실락토오스의 생산성 및 수율을 더욱 높이고자 반응 조건을 최적화하였으며, 인산 나트륨 완충용액 하에서 당 공여체 기질인 구아노신 5'-이인산-푸코오스의 농도를 5 mM로 고정하고, 수용체 기질인 락토오스의 농도를 10 내지 20 mM까지 증가시킴으로써 반응 속도를 상기 반응에서보다 2배 이상 빠르게 하였다. 이는 수용체 기질의 농도를 높여 효소의 반응 속도를 빠르게 할 뿐 만 아니라, 구아노신 5'-이인산-푸코오스 기질에 비하여 상대적으로 매우 값싼 락토오스 기질의 양을 높여 수율을 증대시킴으로써 2'-푸코실락토오스의 경제적 생산을 가능하게 하였다. 융합단백질 중, F-ePGK가 연결된 α-1,2 푸코실 전달효소를 생산하는 세포의 세포추출물을 이용하여 상기 최적화한 방법을 도입하여 2'-푸코실락토오스를 생산하였을 때, 도 4에서와 같이 2'-푸코실락토오스의 생산 수율이 90%로 향상되었으며, 2.2 g/L의 2'-푸코실락토오스를 생산하였다. 생산성 (g/L/h) 또한 기존 12시간의 반응 시간에서 3시간으로 감소하여 반응 조건을 최적화하기 이전에 샤페론과 함께 발현한 경우의 0.05 g/L/h 보다 14배 이상 향상된 0.73 g/L/h를 나타내었다.
또한 샐비지 경로의 FKP 효소와 융합단백질이 연결된 α-1,2 푸코실 전달효소를 생산하는 세포의 세포추출물을 이용하여 5 mM의 L-푸코오스 기질로부터 상기 수용체 기질의 농도를 최적화한 조건으로 원 포트 (one-pot) 반응을 수행하였을 때, 8시간 만에 84%의 수율 (2.05 g/L)로 2'-푸코실락토오스를 생산하였으며, 이는 융합단백질 사용시 당 수용체 기질의 농도를 최적화하기 전보다 1.7배의 수율 증가와 4.4배의 생산성 (0.26 g/L/h) 증가를 나타내었다. 원 포트 반응에서의 수율은 도 5에 나타내었다.
본 발명의 원 포트 반응에서 사용된 L-푸코오스의 농도는 더 향상될 수 있으며, 이에 따른 2'-푸코실락토오스 생산량 또한 함께 증가할 수 있다.
α-1,2 푸코실 전달효소의 기질 결합-모델 구조를 이용한 변이 후보 아미노산 선정 및 변이체 선별
α-1,2 푸코실 전달효소는 결정구조가 밝혀진 단백질 중 상동성이 높은 효소가 없었기 때문에 아미노산의 서열로부터 단백질의 2차 구조를 추출하여 프로파일-프로파일 (profile) 얼라인먼트 (alignment)를 수행하였고 이를 통해 Bradyrhizobium 유래의 α-1,6 푸코실 전달효소, 사람 유래의 α-1,6 푸코실 전달효소 및 대장균 유래의 헵토실 전달효소(heptosyltransferase Ⅰ&Ⅱ)의 주형 단백질을 탐색하였다. 이들 주형 단백질과 본 발명의 α-1,2 푸코실 전달효소와의 상동성은 각각 15, 14, 12%이다. 이후 탐색된 주형 단백질들의 아미노산 서열을 이용하여 α-1,2 푸코실 전달효소와 함께 다중서열배치 (multiple sequence alignment)를 통해 보존되어 있는 서열을 정렬하고 갭 (gap)을 채우는 방식으로 얼라인먼트를 수행하였다.
최종적으로 아미노산 서열 얼라인먼트, 단백질 2차 구조 얼라인먼트 및 “Fold Finder” (KIAS)를 통해 단백질의 글로벌 구조의 에너지를 최적화하고 아미노산 측쇄 구조의 정확성을 높였다. 또한 공여체 기질인 구아노신 5'-이인산-푸코오스의 결합 자리는 구아노신 5'-이인산-푸코오스가 결합되어 있는 모든 단백질 중 구조 유사성이 가장 높은 PDB 구조인 예쁜꼬마선충 (C.elegans) 유래의 푸코실 전달효소Ⅰ 을 이용하여 구아노신 5'-이인산-푸코오스를 모델구조에 도킹하였다.
수용체 기질인 락토오스의 경우, 결합 자리를 찾기 위해 푸코실 전달효소 반응에서 작용할 수 있는 필수 주요 아미노산 잔기 (key residue)의 후보가 될 수 있는 글루타메이트 및 아스파테이트 후보를 선택하였고, 이들을 알라닌으로 치환한 결과 활성이 완전히 감소한 아스파테이트 115번 (D115)를 탐색하였다. D115를 기준으로 락토오스 기질을 도킹하여 락토오스 주변의 5 내지 10 Å 이내 잔기 7개를 탐색하였고 이들에 대해 포화변이를 수행하였다. 융합단백질이 연결된 서열번호 1의 유전자를 변이체 생성의 주형 DNA로 사용하였으며, 포화 변이 수행 이후 가용성 단백질양의 증대로 인해 pH 지시약을 이용한 비색법을 통해 스크리닝이 효과적으로 수행되었다.
본 발명의 변이체 중, 단일 아미노산 치환 변이체인 S249Y의 세포추출물을 이용하여 2'-푸코실락토오스의 생산 실험을 한 결과, 야생주에 비해 초기 반응 속도의 U/mL이 0.96 U/mL로서, 야생주 (0.72 U/mL)보다 33% 높았다. 변이체의 세포추출물에 대한 전체 발현량 및 가용성 단백질 양을 확인할 결과, 도 6에서와 같이 변이체가 야생주에 비해 가용성 단백질의 양이 많은 것으로 나타났다.
본 발명에서 α-1,2 푸코실 전달효소의 S249의 단일 아미노산 치환 변이주 S249Y는 서열번호 6의 아미노산 서열을 나타내며 249번째의 아미노산 위치가 세린 이외의 다른 모든 가능한 아미노산으로 치환된 α-1,2 푸코실 전달효소의 활성을 가지는 효소도 모두 가능하다. 서열번호 6의 단백질을 코딩하는 DNA는 서열번호 7이며 249번째 아미노산 위치의 다른 모든 가능한 치환될 수 있는 아미노산을 코딩하는 모든 DNA 서열 또한 포함할 수 있다.
α-1,2 푸코실 전달효소의 정제 및 고유활성도 측정
가용성 단백질의 양이 증대된 α-1,2 푸코실 전달효소라 하더라도 단백질의 정제가 어려웠던 점에 기인하여, 융합단백질-α-1,2 푸코실 전달효소 - 펩타이드 링커 - 태그 (tag) 유전자를 포함하는 벡터를 구축하였다. 태그 (tag)란, 친화 크로마토그래피를 이용한 효소 정제에 이용될 수 것으로서 펩타이드 태그와 단백질 태그가 모두 포함될 수 있다. 또한, 펩타이드 링커란 글리신 또는 세린과 같이 작은 크기 또는 유연한 아미노산으로 이루어진 링커가 될 수 있다. 본 발명에서는 5 내지 20개의 글리신과 세린 아미노산을 링커로 사용하고, 히스티딘 태그를 이용하였으며, 결과적으로 높은 순도로서 α-1,2 푸코실 전달효소의 가용성 단백질의 정제를 가능케 하였다.
본 발명에서 야생주에 대해서 2'-푸코실락토오스 생산의 고유 활성도를 측정한 결과 0.44 μmole/min/mg 으로서, 기존의 동일한 아미노산 서열을 가지는 α-1,2 푸코실 전달효소의 락토 N-테트라오스 기질에 대한 0.13 nmol/min/mg의 효소활성 [Sophie Drouillard, Large-scale synthesis of H-antigen oligosaccharides by expressing Helicobacter pylori α1,2-fucosyltransferase in metabolically engineered Escherichia coli cells, Angewandte Chemie, 2006, Vol.45, 1778p]과 비교했을 때, 3380배가 높았다. 반면, 변이체 S249Y의 고유활성도는 야생주의 값과 거의 동일한 값을 나타내었다.
본 발명을 통해 가용성 단백질 생산량이 증대된 α-1,2 푸코실 전달효소는 상기 언급한 2'-푸코실락토오스 생산뿐 만 아니라 락토디푸코테트라오스(Lactodifucotetraose, Fuc(α-1,2)Galβ1,4Glc(α-1,3)Fuc), LNFPⅠ(Fuc(α-1,2)Galβ1,3GlcNAcβ1,3Galβ1,4Glc), TFLNH (Trifucosyllactose-N-hexose), 및 LNDFHⅠ (Lacto-N-difucohexoseⅠ)과 같이 다양한 α-1,2 푸코실 올리고당 생산에 적용할 수 있다.
본 발명의 구체적인 방법을 실시예로서 상세히 설명하나, 본 발명의 기술적 범위가 이들 실시예에 한정되는 것은 아니다.
[실시예 1]:
α-1,2푸코실 전달효소의 유전자를 포함하는 발현 벡터의 제조 및 가용성 단백질 발현량 증대
1-1. α-1,2푸코실 전달효소의 유전자를 포함하는 발현 벡터의 제조
본 발명에서는α-1,2 푸코실 전달효소를 코딩하는 서열번호 3을 본래의 아미노산 서열 (서열번호 2)을 유지한 채로 “POMBE” 프로그램을 사용하여 코돈 사용빈도 (codon usage), GC 코돈 % 및 RNA의 안정한 2차 구조 형성을 모두 고려하여 최적화 하였으며, 본래의 염기서열인 서열번호 3과 87%의 상동성을 갖는 서열번호 1의 유전자를 합성하였다.
본 발명에서는 서열번호 1의 α-1,2 푸코실 전달효소를 코딩하는 유전자를 T-벡터에 클로닝한 이후, 이를 발현 벡터에 클로닝하기 위하여 NdeⅠ 제한효소 인식서열을 갖는 센스 프라이머 (서열번호 4)와 XhoⅠ 제한효소 인식서열을 갖는 안티센스 프라이머 (서열번호 5)를 제작하였다. PCR은 DNA 중합효소 반응용 완충용액, 0.2 mM dNTP, 2.5 mM MgCl2, T-벡터에 클로닝 되어있는 주형 DNA 50-100 ng 및 서열번호 4와 5로 기재되는 프라이머 쌍을 각각 100 pmol을 넣은 다음 pfu DNA 중합효소를 이용하여 수행되었다. 반응 조건은 95℃ 5분 이후, 95℃/30초 (변성), 55℃/1분 (어닐링), 72℃/1분 (신장)으로 총 30회를 수행하였다. 증폭된 PCR 산물은 제한효소 NdeⅠ과 XhoⅠ으로 각각 처리하여 T7 프로모터를 갖는 pET24ma 벡터에 삽입하였다. 본 발명에서 사용된 벡터는 T7 프로모터를 포함한 다양한 프로모터를 갖는 발현벡터 또한 모두 포함될 수 있다.
1-2. 샤페론을 이용한 α-1,2 푸코실 전달효소의 가용성 단백질 증대
본 발명에서는 α-1,2 푸코실 전달효소의 가용성 단백질의 양을 증대시키기 위하여 샤페론을 함께 발현하였다. GroEL/GroES를 포함하는 pBAD 벡터를 서열번호 1이 클로닝 되어있는 pET24ma 벡터와 함께 동시에 BW25113 (DE3) 균주에 형질전환 하였고, 암피실린과 카나마이신 항생제가 포함되어있는 LB 배지에 접종하여 30 내지 37℃에서 5 내지 10시간 동안 진탕 배양 후, 배양액 일부를 암피실린, 카나마이신 항생제와 1 mM의 아라비노스 (arabinose)가 포함되어있는 LB 배지 50 mL에 접종하였다. 30 내지 37℃에서 배양한 이후, OD600에서 0.5 내지 1이 되었을 때, 0.01 내지 0.5 mM의 IPTG를 첨가하였고 25℃ 이하의 온도에서 15 내지 20시간 동안 발현을 유도하였다.
상기 샤페론과의 동시 발현을 한 결과, 전체 단백질 양 대비 60% 이상의 가용성 단백질을 생산할 수 있었으며, 상기의 샤페론이 동시 발현된 세포추출물을 이용하여 5 mM 구아노신 5'-이인산-푸코오스, 2.5 mM 락토오스, 2.5 mM MgCl2를 이용하여 2'-푸코실락토오스 생산 수율 (%)을 비교한 결과, 도 4에서와 같이 서열최적화 전의 수율 (7.7%)에 비하여 3.2배 향상된 24.7%의 수율을 나타내었다.
1-3. 융합 단백질을 이용한 α-1,2 푸코실 전달효소의 가용성 단백질 증대
본 발명에서는 또한 α-1,2푸코실 전달효소의 가용성 단백질의 양을 증대시키기 위하여, 실시예 1-1에서 획득한 α-1,2푸코실 전달효소의 염기서열(서열번호 1)의 N-말단에 융합단백질이 도입된 벡터를 구축하였다. 먼저 융합단백질 유전자를 pET24ma 벡터에 클로닝하는 작업을 수행하였고 융합 단백질 중, F-ePGK, N-ePGK, ArsC, GMPK 및 ACK의 유전자 서열은 NCBI의 데이터베이스를 이용하여 추출하였으며, 이를 토대로 상기 유전자들을 클로닝하기 위한 프라이머를 제작하였다. 센스 프라이머는 NdeⅠ 제한효소 인식서열을 갖도록 제작하였으며, 안티센스 프라이머는 SacⅠ 제한효소 인식서열을 갖도록 각각 제작하였다. 융합 단백질의 유전자를 증폭하기 위한 PCR 방법으로서, DNA 중합효소 반응용 완충용액, 0.2 mM dNTP, 2.5 mM MgCl2, 대장균 K12의 genomic DNA 50 ng을 주형 DNA로 하여 상기 제작한 각각의 프라이머쌍을 각각 100 pmol을 넣은 다음 pfu DNA 중합효소를 이용하여 반응을 진행하였다. 반응 조건은 95℃ 5분 이후, 95℃/30초 (변성), 55℃/1분 (어닐링), 72℃/1분 (신장)으로 총 30회를 수행하였다.
증폭된 PCR 산물은 제한효소 NdeⅠ과 SacⅠ으로 각각 처리하여 T7 프로모터를 갖는 pET24ma 벡터에 삽입하였다. 본 발명에서 사용된 벡터는 T7 프로모터를 포함한 다양한 프로모터를 갖는 발현벡터 또한 모두 포함될 수 있다. 또한 C30K9의 경우에, pET28a에 클로닝 되어있는 형태를 주형 DNA로 하여 상기 조건으로 C30K9 유전자를 NdeⅠ과 SacⅠ 제한효소 인식서열이 있는 상태로 증폭하였고 NdeⅠ과 SacⅠ의 제한효소가 처리된 pET24ma 벡터에 클로닝하였다.
F-ePGK, N-ePGK, ArsC, GMPK, ACK 및 C30K9 의 유전자가 클로닝이 되어있는 pET24ma 벡터에 서열번호 1의 α-1,2푸코실 전달효소의 유전자를 클로닝 하고자 프라이머를 제작하였다. 센스 프라이머는 SacⅠ의 제한효소 인식서열이 포함된 6개 내지 30개의 뉴클레오티드로 이루어진 스페이서 이후 α-1,2푸코실 전달효소 유전자가 순차적으로 나오도록 제작하였으며, 이는 하기의 염기서열을 갖는다. 하기의 염기서열의 예로는, 'GCATGAGCTCGACGATGACGATAAAATGGCCTTTAAGGTG' 또는 'GCATGAGCTCATTGATGGCCGCATGGCCTTTAAGGTG' 또는 'GCATGAGCTCGGTGGAGGCGGTTCAGGCGGAGGTATGGCCTTTAAGGTG'가 사용될 수 있다.
안티센트 프라이머는 XhoⅠ의 제한효소 인식서열을 갖고 5 내지 20개의 글리신 또는 세린으로 이루어진 펩타이드 링커가 α-1,2푸코실 전달효소 유전자 뒤에 포함되도록 하여 제작하였으며, 이는 하기의 서열번호를 갖는다.
상기 서열번호의 예로는, 'ATATCTCGAGAGAGCCTCCTGAACCATCTAAAGCGTTATACTTCTG' 또는 'ATATCTCGAGTGAACCTCCGCCAGAGCCTCCACCATCTAAAGCGTTATACTTCTG' 또는 'ATATCTCGAGAGAGCCACCTCCGCCTGAACCGCCTCCACCATCTAAAGCGTTATACTTCTG'가 사용될 수 있다.
상기 제작한 프라이머를 이용하여 위의 PCR 반응 조건하에서 실시예 1-1에서 제조한 벡터를 주형 DNA로 이용하여 α-1,2푸코실 전달효소 유전자를 증폭하였고 SacⅠ과 XhoⅠ 제한효소를 처리하였다. 또한 융합단백질이 클로닝 된 벡터를 SacⅠ과 XhoⅠ 제한효소로 처리하여 증폭된 α-1,2푸코실 전달효소 유전자를 클로닝 하였다. GST 단백질 융합의 경우, GST 유전자가 재조합 되어있는 pGEX 4T-1 벡터를 이용하여 α-1,2푸코실 전달효소 유전자를 SmaⅠ과 XhoⅠ 제한효소 인식서열을 가진 것으로 증폭한 이후 해당 제한효소를 처리하여 벡터에 클로닝 하였다.
융합단백질과 α-1,2푸코실 전달효소가 클로닝 된 재조합 벡터를 대장균 BW25113 (DE3) 균주에 형질전환 하였고, 카나마이신 항생제가 포함되어있는 LB 배지에 접종하여 30 내지 37℃에서 5 내지 10시간 동안 진탕 배양 후, 배양액 일부를 50 μgmL-1 카나마이신 항생제가 포함되어있는 LB 배지 50 mL에 접종하였다. 이후 30 내지 37℃에서 배양한 이후, OD600에서 0.5 내지 1이 되었을 때, 0.1 내지 1 mM의 IPTG를 첨가하였고 18 내지 37℃의 온도에서 15 내지 20시간 동안 발현을 유도하였다.
1-4. α-1,2 푸코실 전달효소의 가용성으로 생산된 단백질 확인
샤페론 및 융합 단백질을 이용한 α-1,2푸코실 전달효소의 발현 이후에, 상기 배양한 대장균 세포를 4000 rpm으로 10분간 원심 분리하여 균체를 회수한 후 증류수로 세포를 재 부유 시키고 다시 10 분간 원심 분리하여 상등액의 증류수를 제거하였다. 회수한 균체 침전물을 5 mL의 20 mM 인산나트륨 완충용액으로 현탁하여 음파 파쇄기로 세포를 파쇄한 후 단백질의 전체 분획 (가용성 단백질+불용성 응집체)을 얻고, 15000 rpm으로 30 분간 원심 분리한 후 상등액을 분리하여 가용성 단백질만을 얻었다. 이들 전체 분획과 가용성 단백질 6 μL 각각을 3×SDS dye 3 μL와 섞어 100℃에서 10 분간 끓였다. 끓인 시료를 10% 아크릴아미드 SDS 겔에 주입하여 전개한 다음 겔을 쿠마시 염색용액으로 염색한 후 탈색하여 발현된 단백질의 양을 확인하였다.
[실시예 2]: 가용성 단백질이 증대된 α-1,2푸코실 전달효소를 이용한 푸코실락토오스의 합성
본 발명에서 2'-푸코실락토오스의 생산성 및 수율을 더욱 높이고자 최적화한 반응 조건에서, 50 mM인산 나트륨 완충용액 하에서 5 mM 구아노신 5'-이인산-푸코오스, 10 내지 20 mM의 락토오스, 5 mM MgCl2 및 전체 반응 부피의 20% 인 α-1,2 푸코실 전달효소를 넣어 37℃에서 반응을 진행하였다. 상기 반응 속도는 5 mM의 락토오스를 사용한 반응에서보다 2배 이상 빠른 것으로 확인되었다. 융합단백질이 연결된 α-1,2 푸코실 전달효소의 세포추출물을 이용하여 상기 최적화한 방법을 도입하여 2'-푸코실락토오스를 생산하였을 때, 도 4에서와 같이 2'-푸코실락토오스의 생산 수율이 90%로 향상되었으며, 2.2 g/L의 2'-푸코실락토오스를 생산하였다. 생산성 (g/L/h) 또한 기존 12시간의 반응 시간에서 3시간으로 감소하여 반응 조건을 최적화하기 이전에 샤페론과 함께 발현한 경우의 0.05 g/L/h 보다 14배 이상 향상된 0.73 g/L/h를 나타내었다.
L-푸코오스를 이용한 원 포트 반응에서는, 5 mM L-푸코오스, 5 mM ATP, 5 mM GTP, 5 mM MnSO4, 5 mM MgCl2, 10 내지 20 mM 락토오스가 포함된 50 mM 인산나트륨 완충용액에 10% (v/v) FKP 및 20% (v/v) α-1,2 푸코실 전달효소의 세포추출액을 넣어 37℃에서 반응을 진행하였다. 8시간 안에 84%의 수율 (2.05 g/L)로 2'-푸코실락토오스를 생산하였으며, 이는 락토오스 기질의 농도를 최적화하기 전보다 1.7배의 수율 증가와 4.4배의 생산성 (0.26 g/L/h) 증가를 나타내었다 (도 5).
2'-푸코실락토오스의 정량은 PA1 컬럼이 장착된 Bio-LC (Dionex, USA)를 이용하였다. 0.7 mL/min의 유속으로 7분 동안 100 mM 수산화나트륨을 등용매로 흘려준 후 24 분까지 아세트산 나트륨을 0~90 mM 로 선형적으로 증가시키는 조건으로서, 11분의 머무름 시간을 가지는 2'-푸코실락토오스를 분석하였다. 2'-푸코실락토오스의 생산 수율 (%)은 사용한 당 공여체 기질인 구아노신 5'-이인산-푸코오스의 농도를 초기 농도로 하여 (ΔP/S0)*100 의 식에 따라 계산하였다. 원 포트 반응에 있어서는, L-푸코오스의 농도를 초기 농도로 하여 수율을 계산하였다.
[실시예 3]:
α-1,2 푸코실 전달효소의 변이체 라이브러리 구축 및 스크리닝
α-1,2 푸코실 전달효소의 아미노산 위치 249에 해당하는 TCG서열을 임의의 서열로 치환한 NNK 서열 (N은 A, C, G 또는 T이고, K는 G 또는 T인 서열)이 도입된 프라이머를 이용하여 벡터 전체를 PCR하여 라이브러리를 구축하였다. 본 발명의 α-1,2 푸코실 전달효소는 첫 메티오닌 (methionine)서열부터 헤아릴 경우 메티오닌이 1번이 된다.
벡터 서열을 포함한 가용성 단백질 양이 증대된 융합단백질-푸코실 전달효소의 증폭된 유전자는 본래의 플라스미드 (plasmid)를 제거하기 위해 DpnⅠ효소 처리 후, 대장균 DH5α에 형질전환 시켰다. 발생된 모든 콜로니 (colony)로부터 변이 유전자를 추출하여 이를 대장균 BW25113 (DE3)에 형질전환 하였다. 형질전환된 각각의 콜로니를 96-정 상에서 카나마이신이 포함된 LB 배지 500 μL에 접종하여 30 내지 37℃에서 18 내지 24시간 동안 진탕 배양 후, 배양액 일부를 50 μg mL-1 카나마이신과 IPTG가 포함된 새로운 LB 배지 500 μL에 접종하여 18 내지 30℃에서 18 내지 40 시간을 배양하였다. 배양된 세포들은 원심분리 후, 세포를 50 μL의 버그 버스터 (BugBuster) 단백질 추출 시약으로 재 부유 시켜 원심분리 후에 세포 추출물을 얻어 이 중 10 내지 20 μL를 변이체 탐색 반응에 사용하였다. 80 내지 90 μL의 반응 용액은 1 내지 10 mM 트리스 완충용액 pH 8.0, 1 내지 5 mM 구아노신 5'-이인산-푸코오스와 5 내지 10 mM 락토오스, 0.1 내지 1 mM pH 지시약을 포함하며 푸코실 전달효소의 세포 추출액을 첨가함과 동시에 37℃에서 반응을 진행하여 30분의 시간간격으로 흡광도를 측정하였다. 당 전이 효소의 비색법 (colorimetric method)을 통한 활성 측정은 당 공여체와 수용체간의 글리코시드 결합이 형성될 때 발생하는 수소이온에 의한 pH의 변화를 측정하는 방법으로서 푸코실락토오스의 생산성과 비례한다. 본 발명에서는 지시약인 페놀 레드의 붉은 색이 감소하는 560 nm에서의 흡광도의 감소를 스펙트럼 기계를 이용하여 분석하였다[한국 출원번호 10-2013-0039938].
[실시예 4]: α-1,2 푸코실 전달효소의 고유 활성도 측정
융합단백질이 연결된 α-1,2 푸코실 전달효소의 야생주 및 변이체를 대장균 BW25113 (DE3)에 형질전환 시키고, 50 mL의 배양 부피로 IPTG를 이용하여 발현 한 이후, 음파 파쇄기로 세포를 파쇄하고 원심분리 후 세포 추출액을 얻었다. 5 mM 이미다졸 (imidazole)과 300 mM 염화나트륨이 첨가된 50 mM 트리스 완충용액 (pH8.0)으로 평형화 시킨 컬럼에 세포 추출액을 넣어 0℃ 에서 1 시간 동안 니켈 수지 (resin)와 결합을 시켰다. 이후 수지에 결합하지 못한 단백질을 흘려버리고 50 mM 이미다졸이 포함된 트리스 완충용액으로 비특이적으로 결합된 다른 단백질들을 제거하였다. 마지막으로 100 mM 이미다졸이 포함된 트리스 완충용액으로 원하는 단백질만을 용출하였다. 용출된 단백질은 이미다졸을 제거하기 위해 여과 컬럼을 이용한 탈염과정을 수행하여 최종적으로 활성 있는 단백질만을 얻었으며 브래드포드 (Bradford) 단백질 정량 키트를 사용하여 단백질량을 측정하여 동일한 양의 단백질을 사용하여 반응한 후, 고유 활성도를 측정하였다.
α-1,2 푸코실 전달효소의 야생주 및 단일 아미노산 치환 변이체의 고유 활성도는 각각 동일한 양의 단백질을 사용하여 5 mM GDP-fuc, 10 내지 20 mM Lactose, 5 mM MgCl2를 50 mM 인산나트륨 완충용액에 섞어 37℃에서 15 분 내지 30 분간 반응하여 생성물을 실시예 2에 언급한 방법으로 Bio-LC를 이용하여 정량 하였다. 반응은 초기 공여체 기질 농도 대비 10 내지 25%의 전환 수율을 나타냈을 때의 효소 mg 당 활성 (unit)으로 계산하였다. 이때의 효소 활성 (Unit)은 37℃에서 분당 1 μmole의 2'-푸코실락토오스를 생산하는 데 필요한 효소의 양으로 정의하였다. 본 발명의 야생주에 대한 2'-푸코실락토오스 생산의 고유활성도를 측정한 결과, 0.44 μmole/min/mg 으로 나타났으며, 변이체 S249Y의 고유활성도는 야생주의 값과 거의 동일한 값을 나타내었다.
본 발명은, α-1,2 푸코실올리고당을 생산함에 있어서 염기서열 치환과 단백질 공학 변이를 통하여 가용성 단백질 양이 증대된 α-1,2 푸코실 전달효소의 변이체를 만들고 효소 반응 최적화와 함께 이를 α-1,2 푸코실올리고당 생산에 적용하여 수율 및 생산성을 증대시키는 것으로서, 유아식품과 기능성 식품 분야뿐 아니라 의약분야 등의 다양한 산업분야에 응용이 가능하다.
<110> SNU R&DB FOUNDATION
<120> HELICOBACTER PYLORI alpha-1,2 FUCOSYLTRANSFERASE GENE AND PROTEIN
WITH IMPROVED SOLUBLE PROTEIN EXPRESSION, AND THEREOF APPLICATION
FOR SYNTHESIS OF alpha-1,2 FUCOSYLOLIGOSACCHARIDE
<130> Y14KP-019
<160> 7
<170> KopatentIn 2.0
<210> 1
<211> 906
<212> DNA
<213> optimized alpha-1,2 FUCOSYLTRANSFERASE GENE
<400> 1
atggccttta aggtggtgca aatctgtgga gggctgggta atcagatgtt tcagtatgct 60
ttcgcaaaat cattgcagaa acacagtaat acccctgtcc tgttagatat cacttctttt 120
gattggagcg atcgtaagat gcaattagaa cttttcccga ttgatctgcc gtatgcgagt 180
gcgaaagaaa ttgccatagc gaaaatgcaa cacctcccca aactagtacg cgatgcgttg 240
aagtgtatgg gattcgaccg tgttagtcag gagattgttt ttgagtacga acctaagctg 300
ctcaaaccat cgcgcctgac atattttttt ggctacttcc aggatccacg atactttgac 360
gctatatcac cgctgattaa gcaaaccttt acgctgccgc caccacctga aaataataaa 420
aataataata aaaaagagga agagtaccag tgcaagctgt ctttgatttt ggccgctaaa 480
aacagcgtgt ttgttcatat cagacgtggc gattatgtgg ggatcggttg tcagctgggt 540
attgactatc aaaaaaaggc gcttgagtat atggcaaaac gcgtgccgaa catggaactg 600
tttgtttttt gcgaagacct ggaattcacg cagaatctcg atcttggcta cccttttatg 660
gacatgacca cacgggataa agaagaagag gcctattggg acatgctgct gatgcagtct 720
tgtcagcacg gcattatagc caactcgact tatagctggt gggcagcata cctgatcgag 780
aacccggaaa aaatcattat tggtcccaaa cattggctgt tcggtcatga aaacatcctt 840
tgcaaagaat gggtcaaaat agaatcccat ttcgaggtaa aatcccagaa gtataacgct 900
ttagat 906
<210> 2
<211> 302
<212> PRT
<213> HELICOBACTER PYLORI alpha-1,2 FUCOSYLTRANSFERASE protein
<400> 2
Met Ala Phe Lys Val Val Gln Ile Cys Gly Gly Leu Gly Asn Gln Met
1 5 10 15
Phe Gln Tyr Ala Phe Ala Lys Ser Leu Gln Lys His Ser Asn Thr Pro
20 25 30
Val Leu Leu Asp Ile Thr Ser Phe Asp Trp Ser Asp Arg Lys Met Gln
35 40 45
Leu Glu Leu Phe Pro Ile Asp Leu Pro Tyr Ala Ser Ala Lys Glu Ile
50 55 60
Ala Ile Ala Lys Met Gln His Leu Pro Lys Leu Val Arg Asp Ala Leu
65 70 75 80
Lys Cys Met Gly Phe Asp Arg Val Ser Gln Glu Ile Val Phe Glu Tyr
85 90 95
Glu Pro Lys Leu Leu Lys Pro Ser Arg Leu Thr Tyr Phe Phe Gly Tyr
100 105 110
Phe Gln Asp Pro Arg Tyr Phe Asp Ala Ile Ser Pro Leu Ile Lys Gln
115 120 125
Thr Phe Thr Leu Pro Pro Pro Pro Glu Asn Asn Lys Asn Asn Asn Lys
130 135 140
Lys Glu Glu Glu Tyr Gln Cys Lys Leu Ser Leu Ile Leu Ala Ala Lys
145 150 155 160
Asn Ser Val Phe Val His Ile Arg Arg Gly Asp Tyr Val Gly Ile Gly
165 170 175
Cys Gln Leu Gly Ile Asp Tyr Gln Lys Lys Ala Leu Glu Tyr Met Ala
180 185 190
Lys Arg Val Pro Asn Met Glu Leu Phe Val Phe Cys Glu Asp Leu Glu
195 200 205
Phe Thr Gln Asn Leu Asp Leu Gly Tyr Pro Phe Met Asp Met Thr Thr
210 215 220
Arg Asp Lys Glu Glu Glu Ala Tyr Trp Asp Met Leu Leu Met Gln Ser
225 230 235 240
Cys Gln His Gly Ile Ile Ala Asn Ser Thr Tyr Ser Trp Trp Ala Ala
245 250 255
Tyr Leu Ile Glu Asn Pro Glu Lys Ile Ile Ile Gly Pro Lys His Trp
260 265 270
Leu Phe Gly His Glu Asn Ile Leu Cys Lys Glu Trp Val Lys Ile Glu
275 280 285
Ser His Phe Glu Val Lys Ser Gln Lys Tyr Asn Ala Leu Asp
290 295 300
<210> 3
<211> 906
<212> DNA
<213> HELICOBACTER PYLORI alpha-1,2 FUCOSYLTRANSFERASE GENE
<400> 3
atggctttta aggtggtgca aatttgcgga gggcttggga atcaaatgtt tcaatacgct 60
ttcgctaaaa gtttgcaaaa acactctaat acgcctgtgc tgttagatat cacttctttt 120
gattggagcg ataggaaaat gcaattagaa cttttcccta ttgatttgcc ctatgcgagc 180
gcgaaagaaa tcgctatagc taaaatgcaa cacctcccca agctagtaag agacgcgctc 240
aaatgcatgg gatttgatag ggtgagtcaa gaaatcgttt ttgaatacga gcctaaattg 300
ctaaagccaa gccgcttgac ttattttttt ggctatttcc aagatccacg atactttgat 360
gctatatccc ctttaatcaa gcaaaccttc actctaccac caccacccga aaataataag 420
aataataata aaaaagagga agaatatcag tgcaagcttt ctttgatttt agccgctaaa 480
aacagcgtgt ttgtgcatat aagaagaggg gattatgtgg ggattggctg tcagcttggt 540
attgactatc aaaaaaaggc gcttgagtat atggcaaagc gcgtgccaaa catggagctt 600
tttgtgtttt gcgaagactt agaattcacg caaaatcttg atcttggcta cccttttatg 660
gacatgacca ctagggataa agaagaagag gcgtattggg acatgctgct catgcaatct 720
tgtcagcatg gcattatcgc taatagcact tatagctggt gggcggccta tttgatagaa 780
aatccagaaa aaatcattat tggccccaaa cactggcttt ttgggcatga gaatatcctt 840
tgtaaggagt gggtgaaaat agaatcccat tttgaggtaa aatcccaaaa gtataacgct 900
ctagat 906
<210> 4
<211> 24
<212> DNA
<213> 2'FT cloning sense primer
<400> 4
tcgactcata tggcctttaa ggtg 24
<210> 5
<211> 30
<212> DNA
<213> 2'FT cloning anti sense primer
<400> 5
tcgactctcg agatctaaag cgttatactt 30
<210> 6
<211> 302
<212> PRT
<213> amino acids sequence of S249Y
<400> 6
Met Ala Phe Lys Val Val Gln Ile Cys Gly Gly Leu Gly Asn Gln Met
1 5 10 15
Phe Gln Tyr Ala Phe Ala Lys Ser Leu Gln Lys His Ser Asn Thr Pro
20 25 30
Val Leu Leu Asp Ile Thr Ser Phe Asp Trp Ser Asp Arg Lys Met Gln
35 40 45
Leu Glu Leu Phe Pro Ile Asp Leu Pro Tyr Ala Ser Ala Lys Glu Ile
50 55 60
Ala Ile Ala Lys Met Gln His Leu Pro Lys Leu Val Arg Asp Ala Leu
65 70 75 80
Lys Cys Met Gly Phe Asp Arg Val Ser Gln Glu Ile Val Phe Glu Tyr
85 90 95
Glu Pro Lys Leu Leu Lys Pro Ser Arg Leu Thr Tyr Phe Phe Gly Tyr
100 105 110
Phe Gln Asp Pro Arg Tyr Phe Asp Ala Ile Ser Pro Leu Ile Lys Gln
115 120 125
Thr Phe Thr Leu Pro Pro Pro Pro Glu Asn Asn Lys Asn Asn Asn Lys
130 135 140
Lys Glu Glu Glu Tyr Gln Cys Lys Leu Ser Leu Ile Leu Ala Ala Lys
145 150 155 160
Asn Ser Val Phe Val His Ile Arg Arg Gly Asp Tyr Val Gly Ile Gly
165 170 175
Cys Gln Leu Gly Ile Asp Tyr Gln Lys Lys Ala Leu Glu Tyr Met Ala
180 185 190
Lys Arg Val Pro Asn Met Glu Leu Phe Val Phe Cys Glu Asp Leu Glu
195 200 205
Phe Thr Gln Asn Leu Asp Leu Gly Tyr Pro Phe Met Asp Met Thr Thr
210 215 220
Arg Asp Lys Glu Glu Glu Ala Tyr Trp Asp Met Leu Leu Met Gln Ser
225 230 235 240
Cys Gln His Gly Ile Ile Ala Asn Tyr Thr Tyr Ser Trp Trp Ala Ala
245 250 255
Tyr Leu Ile Glu Asn Pro Glu Lys Ile Ile Ile Gly Pro Lys His Trp
260 265 270
Leu Phe Gly His Glu Asn Ile Leu Cys Lys Glu Trp Val Lys Ile Glu
275 280 285
Ser His Phe Glu Val Lys Ser Gln Lys Tyr Asn Ala Leu Asp
290 295 300
<210> 7
<211> 906
<212> DNA
<213> DNA sequence of S249Y
<400> 7
atggccttta aggtggtgca aatctgtgga gggctgggta atcagatgtt tcagtatgct 60
ttcgcaaaat cattgcagaa acacagtaat acccctgtcc tgttagatat cacttctttt 120
gattggagcg atcgtaagat gcaattagaa cttttcccga ttgatctgcc gtatgcgagt 180
gcgaaagaaa ttgccatagc gaaaatgcaa cacctcccca aactagtacg cgatgcgttg 240
aagtgtatgg gattcgaccg tgttagtcag gagattgttt ttgagtacga acctaagctg 300
ctcaaaccat cgcgcctgac atattttttt ggctacttcc aggatccacg atactttgac 360
gctatatcac cgctgattaa gcaaaccttt acgctgccgc caccacctga aaataataaa 420
aataataata aaaaagagga agagtaccag tgcaagctgt ctttgatttt ggccgctaaa 480
aacagcgtgt ttgttcatat cagacgtggc gattatgtgg ggatcggttg tcagctgggt 540
attgactatc aaaaaaaggc gcttgagtat atggcaaaac gcgtgccgaa catggaactg 600
tttgtttttt gcgaagacct ggaattcacg cagaatctcg atcttggcta cccttttatg 660
gacatgacca cacgggataa agaagaagag gcctattggg acatgctgct gatgcagtct 720
tgtcagcacg gcattatagc caactatact tatagctggt gggcagcata cctgatcgag 780
aacccggaaa aaatcattat tggtcccaaa cattggctgt tcggtcatga aaacatcctt 840
tgcaaagaat gggtcaaaat agaatcccat ttcgaggtaa aatcccagaa gtataacgct 900
ttagat 906
Claims (24)
- 서열번호 1과 88% 이상의 상동성을 가지고, α-1,2 푸코실 전달효소를 코딩하는 DNA.
- 제 1 항에 따른 DNA 를 포함하는 재조합 DNA 벡터.
- 제 2 항에 있어서, 상기 α-1,2 푸코실 전달효소를 코딩하는 DNA 앞에 융합단백질을 코딩하는 DNA가 위치하는 것을 특징으로 하는, 재조합 DNA 벡터.
- 제 3 항에 있어서, 상기 α-1,2 푸코실 전달효소의 유전자를 코딩하는 DNA와 상기 융합단백질을 코딩하는 DNA의 사이에 3개 내지 60개의 뉴클레오티드로 이루어진 스페이서를 가지는 것을 특징으로 하는 재조합 DNA 벡터.
- 제 2 항에 따른 재조합 DNA 벡터로 형질 전환된 숙주세포.
- 제 3 항에 따른 재조합 DNA 벡터로 형질 전환된 숙주 세포.
- 제 4 항에 따른 재조합 DNA 벡터로 형질 전환된 숙주세포.
- 제 5 항 내지 제 7 항 중 어느 한 항에 있어서, 상기 숙주세포는 샤페론 단백질을 코딩하는 재조합 DNA 벡터가 추가로 형질 전환된 것을 특징으로 하는, 형질 전환된 숙주세포.
- 제 5 항 내지 제 7 항 중 어느 한 항에 따른 형질 전환된 숙주세포의 추출물.
- 서열번호 2 로 표시되는 α-1,2 푸코실 전달효소의 249 번째의 아미노산이 다른 아미노산으로 치환된 것을 특징으로 하는, α-1,2 푸코실 전달효소 변이체.
- 제 10 항에 있어서, 상기 치환된 아미노산은 타이로신(tyrosine)인, 서열번호 6의 아미노산 서열로 표시되는 α-1,2 푸코실 전달효소 변이체.
- 제 11 항에 따른 α-1,2 푸코실 전달효소 변이체를 코딩하는, 서열번호 7로 표시되는 DNA.
- 제 12 항에 따른 DNA 를 포함하는 재조합 DNA 벡터.
- 제 13 항에 따른 재조합 DNA 벡터로 형질 전환된 숙주세포.
- 제 14 항에 따른 형질 전환된 숙주세포의 추출물.
- 제 5 항 내지 제 7 항 중 어느 한 항에 따른 형질 전환된 숙주세포로부터 발현된 α-1,2 푸코실 전달효소의 폴리펩타이드, 제 10 항에 따른 α-1,2 푸코실 전달효소 변이체의 폴리펩타이드, 또는 제 11 항에 따른 α-1,2 푸코실 전달효소 변이체의 폴리펩타이드 뒤에 2개 내지 40개의 아미노산으로 이루어진 펩타이드 (peptide) 링커를 포함하는 폴리펩타이드.
- 제 16 항에 있어서, 상기 펩타이드 링커는 글리신, 알라닌, 세린, 트레오닌, 및 시스테인으로 이루어진 군에서 선택된 하나 이상으로 구성된 것을 특징으로 하는, 폴리펩타이드.
- 서열번호 1과 88% 이상의 상동성을 갖는, α-1,2 푸코실 전달효소를 코딩하는 DNA를 포함하는 벡터로 형질 전환된 숙주세포 또는 상기 숙주세포의 추출물을 생촉매로 사용하는 것을 특징으로 하는, α-1,2 푸코실올리고당의 제조 방법.
- 제 18 항에 있어서, 상기 벡터는 α-1,2 푸코실 전달효소를 코딩하는 DNA의 앞에 융합단백질을 코딩하는 DNA가 도입된 것을 특징으로 하는, α-1,2 푸코실올리고당의 제조 방법.
- 제 19 항에 있어서, 15℃ 내지 38℃의 온도에서 0.005 mM 내지 5 mM의 유도인자(inducer)를 사용하는 것을 특징으로 하는, α-1,2 푸코실올리고당의 제조 방법.
- 제 18 항에 있어서, 상기 숙주세포는 샤페론 단백질을 코딩하는 재조합 DNA 벡터가 추가로 형질 전환된 것을 특징으로 하는, α-1,2 푸코실올리고당의 제조 방법.
- 제 21 항에 있어서, 10℃ 내지 35℃의 온도에서 0.001 mM 내지 2 mM의 유도인자를 사용하는 것을 특징으로 하는, α-1,2 푸코실올리고당의 제조 방법.
- 제 18 항 내지 제 22 항 중 어느 한 항에 있어서, 당 수용체 기질의 농도를 푸코오스의 공여체인 구아노신 5'-이인산-푸코오스(guanosine 5'-diphosphate fucose, GDP-fuc) 기질 농도 이상으로 사용하는 것을 특징으로 하는, α-1,2 푸코실올리고당의 제조 방법.
- 하기의 단계를 포함하는 α-1,2 푸코실 전달효소 변이체의 탐색 방법:(1) α-1,2 푸코실 전달효소의 결정 구조 또는 모델 구조의 아스파테이트 115번(D115)으로부터 5 내지 10 Å 이내에서 선택된 잔기, 또는 α-1,2 푸코실 전달효소의 기질 결합 모델 구조로부터 수용체 기질이 결합하는 부위로부터 5 내지 10 Å 이내에서 선택된 잔기 중에서, 다수 서열 정렬과 알라닌 스캐닝을 통해 포화변이를 포화변이를 수행할 기능적 잔기를 분석하는 단계,(2) pH 지시약을 이용한 비색법(colorimetric method)을 수행하는 단계.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR10-2014-0076718 | 2014-06-23 | ||
| KR1020140076718A KR101648342B1 (ko) | 2014-06-23 | 2014-06-23 | 가용성 단백질 발현량이 증대된 헬리코박터 파일로리 유래 α-1,2 푸코실 전달효소의 유전자와 단백질 및 α-1,2 푸코실올리고당 생산에의 응용 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2015199386A1 true WO2015199386A1 (ko) | 2015-12-30 |
Family
ID=54938412
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/KR2015/006271 Ceased WO2015199386A1 (ko) | 2014-06-23 | 2015-06-22 | 가용성 단백질 발현량이 증대된 헬리코박터 파일로리 유래 α-1,2 푸코실 전달효소의 유전자와 단백질 및 α-1,2 푸코실올리고당 생산에의 응용 |
Country Status (2)
| Country | Link |
|---|---|
| KR (1) | KR101648342B1 (ko) |
| WO (1) | WO2015199386A1 (ko) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2021122708A1 (en) * | 2019-12-17 | 2021-06-24 | Inbiose N.V. | Lactose converting alpha-1,2-fucosyltransferase enzymes |
| CN113528480A (zh) * | 2021-07-07 | 2021-10-22 | 上海交通大学 | 一种α-1,2-岩藻糖基转移酶突变体及其构建方法和应用 |
| CN113754785A (zh) * | 2021-09-30 | 2021-12-07 | 中南大学 | 融合蛋白及其制备方法与在制备岩藻糖基化产物中的应用 |
| EP4200318A4 (en) * | 2020-08-19 | 2024-06-12 | Conagen Inc. | BIOSYNTHETIC PRODUCTION OF 2-FUCOSYLLACTOSE |
| US20240318213A1 (en) * | 2021-02-19 | 2024-09-26 | Kyowa Hakko Bio Co., Ltd. | Modified protein having alpha1,2-fucosyltransferase activity and method for producing fucose-containing carbohydrate |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP7075494B2 (ja) | 2018-04-04 | 2022-05-25 | アドヴァンスド プロテイン テクノロジーズ コーポレーション | シュードペドバクターサルタンス由来フコース転移酵素を用いた2’-フコシルラクトースの生産方法 |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20130096111A (ko) * | 2012-02-21 | 2013-08-29 | 고려대학교 산학협력단 | 대장균 포스포글리세르산 인산화효소 유전자를 융합 파트너로서 포함하는 발현벡터 |
-
2014
- 2014-06-23 KR KR1020140076718A patent/KR101648342B1/ko active Active
-
2015
- 2015-06-22 WO PCT/KR2015/006271 patent/WO2015199386A1/ko not_active Ceased
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20130096111A (ko) * | 2012-02-21 | 2013-08-29 | 고려대학교 산학협력단 | 대장균 포스포글리세르산 인산화효소 유전자를 융합 파트너로서 포함하는 발현벡터 |
Non-Patent Citations (3)
| Title |
|---|
| DATABASE GenBank [O] 26 November 2013 (2013-11-26), YAMAOKA,Y: "Helicobacter pylori 26695-1CL DNA, complete genome", XP055248979, retrieved from ncbi Database accession no. AP 013356 * |
| DATABASE GenBank [O] 4 May 1999 (1999-05-04), WANG, G: "alpha-1,2-fucosyltransferase [Helicobacter pylori", XP055248981, retrieved from ncbi Database accession no. AAD29869 * |
| GE WANG ET AL.: "Molecular genetic basis for the variable expression of Lewis Y antigen in Helicobacter pylori: analysis of the α(1,2) fucosyltransferase gene", MOLECULAR MICROBIOLOGY., vol. 31, no. 4, 1999, pages 1265 - 1274, XP002938950, ISSN: 0950-382x * |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2021122708A1 (en) * | 2019-12-17 | 2021-06-24 | Inbiose N.V. | Lactose converting alpha-1,2-fucosyltransferase enzymes |
| CN114829592A (zh) * | 2019-12-17 | 2022-07-29 | 因比奥斯公司 | 转化乳糖的α-1,2-岩藻糖基转移酶 |
| EP4200318A4 (en) * | 2020-08-19 | 2024-06-12 | Conagen Inc. | BIOSYNTHETIC PRODUCTION OF 2-FUCOSYLLACTOSE |
| US20240318213A1 (en) * | 2021-02-19 | 2024-09-26 | Kyowa Hakko Bio Co., Ltd. | Modified protein having alpha1,2-fucosyltransferase activity and method for producing fucose-containing carbohydrate |
| CN113528480A (zh) * | 2021-07-07 | 2021-10-22 | 上海交通大学 | 一种α-1,2-岩藻糖基转移酶突变体及其构建方法和应用 |
| CN113754785A (zh) * | 2021-09-30 | 2021-12-07 | 中南大学 | 融合蛋白及其制备方法与在制备岩藻糖基化产物中的应用 |
| CN113754785B (zh) * | 2021-09-30 | 2023-07-21 | 中南大学 | 融合蛋白及其制备方法与在制备岩藻糖基化产物中的应用 |
Also Published As
| Publication number | Publication date |
|---|---|
| KR20150146300A (ko) | 2015-12-31 |
| KR101648342B1 (ko) | 2016-08-16 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| WO2015199387A2 (ko) | 가용성 단백질 발현량 및 활성이 증대된 헬리코박터 파일로리 유래 α-1,3 푸코실 전달효소의 유전자와 단백질 및 α-1,3 푸코실올리고당 생산에의 응용 | |
| WO2015199386A1 (ko) | 가용성 단백질 발현량이 증대된 헬리코박터 파일로리 유래 α-1,2 푸코실 전달효소의 유전자와 단백질 및 α-1,2 푸코실올리고당 생산에의 응용 | |
| WO2014193183A1 (ko) | 시알산 유도체의 제조방법 | |
| WO2019135639A1 (ko) | 신규 폴리펩타이드 및 이를 이용한 imp 생산방법 | |
| WO2015167282A1 (en) | A novel method for glycosylation of ginsenoside using a glycosyltransferase derived from panax ginseng | |
| WO2021201615A1 (ko) | 신규한 면역 활성 인터루킨 2 아날로그 | |
| WO2010064764A1 (en) | Method of preparing piceatannol using bacterial cytochrome p450 and composition therefor | |
| WO2022065913A1 (ko) | 요산산화효소-알부민 접합체, 그 제조방법 및 용도 | |
| WO2011158998A1 (ko) | 비타민 k2 생성능이 높은 바실러스 아미로리퀴파시엔스 균주 | |
| WO2023121426A1 (ko) | 레바우디오사이드의 생산 | |
| WO2016122058A1 (ko) | 세포성점균을 이용한 인간 페닐알라닌 수산화효소의 활성분석 방법 | |
| WO2022163951A1 (ko) | 신규한 단백질 변이체 및 이를 이용한 l-라이신 생산 방법 | |
| WO2011159092A9 (ko) | 신규 토양 미생물과 상기 토양 미생물로부터 분리된 신규한 산화환원효소, 상기 산화환원 효소를 암호화하는 유전자 및 이들을 이용한 비당체의 생산방법 | |
| WO2023068722A1 (ko) | 리바우디오사이드 d 및 리바우디오사이드 m을 제조하는 방법 | |
| WO2018182361A1 (ko) | CRISPR/Cas 시스템과 재조합 효소 및 단일가닥 올리고디옥시리보핵산을 이용한 코리네박테리움 변이균주 제조방법 | |
| WO2022225075A1 (ko) | 신규한 변이체 및 이를 이용한 xmp 또는 gmp 생산 방법 | |
| WO2024155111A1 (ko) | 염기 에디터의 염기 교정 능력을 측정하는 세포외 시험법 | |
| WO2023132543A1 (ko) | 포토박테리움 레이오그나티 유래의 우라실-dna 글리코실라제를 사용하여 핵산 증폭 반응에서의 캐리오버 오염을 제거하는 방법 | |
| WO2024123109A1 (ko) | 퓨린 뉴클레오티드를 생산하는 미생물 및 이를 이용한 퓨린 뉴클레오티드의 생산방법 | |
| WO2022164226A1 (ko) | C-글리코실전이효소 변이체 및 이의 용도 | |
| WO2026089391A1 (ko) | Udp-글루코실트랜스퍼라제 변이체, udp-글루코실트랜스퍼라제 변이체 융합효소 및 이의 스테비올 배당체 생산 용도 | |
| WO2025159542A1 (ko) | 신규한 변이형 당전이 효소 폴리펩티드 및 이를 이용한 스테비올배당체 생산 방법 | |
| WO2022164291A2 (ko) | 다량체 단백질-알부민 접합체, 제조방법, 및 그 용도 | |
| WO2025005777A1 (ko) | 신규 crispr/cas13 시스템 및 그 용도 | |
| WO2025143773A1 (ko) | 수크로우스 합성효소 변이체, udp-글루코실트랜스퍼라제 변이체 및 이들의 스테비올 배당체 생산 용도 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 15811330 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 15811330 Country of ref document: EP Kind code of ref document: A1 |