WO2015197706A1 - Aptamers specific for tlr-4 and uses thereof - Google Patents

Aptamers specific for tlr-4 and uses thereof Download PDF

Info

Publication number
WO2015197706A1
WO2015197706A1 PCT/EP2015/064277 EP2015064277W WO2015197706A1 WO 2015197706 A1 WO2015197706 A1 WO 2015197706A1 EP 2015064277 W EP2015064277 W EP 2015064277W WO 2015197706 A1 WO2015197706 A1 WO 2015197706A1
Authority
WO
WIPO (PCT)
Prior art keywords
tlr
aptamer
seq
complex
aptamers
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/EP2015/064277
Other languages
English (en)
French (fr)
Inventor
Ignacio LIZASOAIN HERNÁNDEZ
Víctor Manuel GONZÁLEZ MUÑOZ
Gerónimo FERNÁNDEZ GÓMEZ-CHACÓN
María Ángeles MORO SÁNCHEZ
Mª Elena MARTÍN PALMA
Ana MORAGA YÉBENES
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Aptus Biotech SL
Original Assignee
Aptus Biotech SL
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to CN201580034070.1A priority Critical patent/CN106459980B/zh
Priority to SI201531392T priority patent/SI3161139T1/sl
Priority to JP2016575345A priority patent/JP6959738B2/ja
Priority to RU2016152094A priority patent/RU2709718C9/ru
Priority to US15/322,021 priority patent/US10196642B2/en
Priority to PL15732619T priority patent/PL3161139T3/pl
Priority to MX2016016992A priority patent/MX387405B/es
Priority to ES15732619T priority patent/ES2825106T3/es
Priority to DK15732619.0T priority patent/DK3161139T3/da
Priority to AU2015279248A priority patent/AU2015279248B2/en
Priority to BR112016030172-2A priority patent/BR112016030172B1/pt
Application filed by Aptus Biotech SL filed Critical Aptus Biotech SL
Priority to CA2953020A priority patent/CA2953020C/en
Priority to EP15732619.0A priority patent/EP3161139B1/en
Priority to KR1020177001493A priority patent/KR102454682B1/ko
Publication of WO2015197706A1 publication Critical patent/WO2015197706A1/en
Anticipated expiration legal-status Critical
Priority to ZA2017/00363A priority patent/ZA201700363B/en
Priority to US16/220,726 priority patent/US10808252B2/en
Priority to US17/022,984 priority patent/US11591603B2/en
Priority to US18/156,936 priority patent/US20230279402A1/en
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/005Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K49/00Preparations for testing in vivo
    • A61K49/001Preparation for luminescence or biological staining
    • A61K49/0013Luminescence
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K49/00Preparations for testing in vivo
    • A61K49/04X-ray contrast preparations
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K51/00Preparations containing radioactive substances for use in therapy or testing in vivo
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00Drugs for skeletal disorders
    • A61P19/02Drugs for skeletal disorders for joint disorders, e.g. arthritis, arthrosis
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/30Drugs for disorders of the nervous system for treating abuse or dependence
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/30Drugs for disorders of the nervous system for treating abuse or dependence
    • A61P25/36Opioid-abuse
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P27/00Drugs for disorders of the senses
    • A61P27/02Ophthalmic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/04Antibacterial agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • A61P37/02Immunomodulators
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • A61P9/10Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1138Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against receptors or cell surface proteins
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/115Aptamers, i.e. nucleic acids binding a target molecule specifically and with high affinity without hybridising therewith ; Nucleic acids binding to non-nucleic acids, e.g. aptamers
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/566Immunoassay; Biospecific binding assay; Materials therefor using specific carrier or receptor proteins as ligand binding reagents where possible specific carrier or receptor proteins are classified with their target compounds
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6893Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to diseases not provided for elsewhere
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/16Aptamers
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/50Physical structure
    • C12N2310/53Physical structure partially self-complementary or closed
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/435Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
    • G01N2333/705Assays involving receptors, cell surface antigens or cell surface determinants
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/435Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
    • G01N2333/705Assays involving receptors, cell surface antigens or cell surface determinants
    • G01N2333/70596Molecules with a "CD"-designation not provided for elsewhere in G01N2333/705
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00Detection or diagnosis of diseases
    • G01N2800/16Ophthalmology
    • G01N2800/164Retinal disorders, e.g. retinopathy
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00Detection or diagnosis of diseases
    • G01N2800/28Neurological disorders
    • G01N2800/2871Cerebrovascular disorders, e.g. stroke, cerebral infarct, cerebral haemorrhage, transient ischemic event

Definitions

  • the present invention provides nucleic acid aptamers with the capability of binding specifically to and inhibiting TLR-4 and uses thereof.
  • CNS Central Nervous System
  • TLR toll-like receptors
  • TLR4 was the first TLR characterized in mammals. Exogenous ligands have been described for this TLR, such as lipopolysaccharide (LPS) of gram-negative bacteria, lipoteichoic acid (LTA) of gram-positive bacteria, or protein F of syncytial respiratory virus. Furthermore, the most important endogenous ligands are HMBG1 , HSP-60 of an endogenous origin or derived from Chlamydia pneumoniae, HPS-70, fibronectin, fibrinogen, hyaluronic acid, etc., all derived from tissue damage, cell damage and/or from the host's vessels.
  • TLR4 is involved in a large number of highly prevalent pathologies, such as stroke or cerebrovascular disease, acute myocardial infarction, sepsis, atherosclerosis, multiple sclerosis, rheumatoid arthritis, a retinal degenerative disease, and drug addiction, inter alia.
  • TLR antagonists are being studied in sepsis, in atherosclerosis, in chronic pain and in colitis; in fact there are several antagonists, eritoran (phase III), ibudilast (Av41 1 ; phase II) and NI-0101 antibodies (pre-clinical phase), which are being studied in these pathologies.
  • Patent document WO 2006/138681 describes a method for inhibiting intrahepatic activated T-cell deletion by means of administering a TLR-4 inhibitor, among which TLR-4-specific aptamers are mentioned.
  • the present invention relates to a nucleic acid aptamer with the capability of binding specifically to and inhibiting TLR-4 and comprising a sequence selected from the group consisting of SEQ ID NO: 1 and SEQ ID NO: 2 or a functionally equivalent variant thereof.
  • the present invention relates to a complex comprising the aptamer of the invention and a functional group.
  • the present invention relates to the use of the aptamer of the invention or of the complex of the invention for detecting TLR-4.
  • the present invention relates to the in vitro use of the aptamer of the invention or of the complex of the invention for inhibiting TLR-4.
  • the present invention relates to an in vitro method for the detection of TLR-4 in a sample comprising
  • the present invention relates to an in vitro method for inhibiting TLR-4 in a sample, which comprises contacting a sample comprising TLR-4 with an aptamer according to the invention, or a complex according to the invention, in conditions suitable for inhibiting TLR-4.
  • the present invention relates to an aptamer of the invention for use in the treatment of a pathology characterized by an increase in expression of TLR4 and/or an increase in activation of TLR-4.
  • the present invention relates to a pharmaceutical composition
  • a pharmaceutical composition comprising at least one aptamer according to the invention or at least one complex according to the invention, optionally in combination with one or more pharmaceutically acceptable carriers, excipients or solvents.
  • FIG. 1 Recognition of the TLR-4 protein by the aptamers selected by means of ELONA.
  • the human recombinant TLR-4 protein (6xHIS-TLR-4) was cultured at a concentration of 100 ng/well in 96-well microtiter plates and incubated at 4°C for 16 h. Subsequently, 20 pmol of each of the aptamers labeled with digoxigenin were added to each well and the plate was incubated for 1 h at 37°C. Finally, the plate was incubated with peroxidase-conjugated anti-digoxigenin antibodies and developed using ABTS. An anti-Li H2A DNA aptamer was used as a positive control (Martin et al., 2013, PLoS ONE 8: e78886). All the experiments were performed in triplicate.
  • FIG. 4 Antagonist effect of aptamers TLRApt#1 R (SEQ ID NO: 3) and TLRApt#4F (SEQ ID NO: 4) on HEK-Blue hTLR4 cells and antagonist LPS-RS-UP (2 ng/ ⁇ ; 20 ng) as control. Aptamers were applied at end concentrations of 0.2, 2, 20 and 200 nM or the antagonist control LPS-RS-UP (2 ng/ ⁇ ; 20 ng).
  • the agonist LPS-EK-UP (0.02 ng/ ⁇ ) (A) or lysates from HEK293 cells (Damage-associated molecular pattern; DAMP) (B) were used as agonist control and secreted alkaline phosphatase (SEAP) activity was measured after 24 h using QUANTI-BlueTM substrate at 630 nm. Data are expressed as the percentage of SEAP activity relative to the control cells. All the experiments were done in triplicate and average of 7-9 different experiments is shown in the figure. Statistical significance ( * P ⁇ 0.05, ** P ⁇ 0.01 and *** P ⁇ 0.001 ).
  • FIG. 5 Effect of aptamers TLRApt#4F-T (SEQ ID NO: 2) and TLRApt#4F (SEQ ID NO: 4) on macrophages stimulated in the presence of 500 ng/ml LPS. Nitrites release was studied by the Griess reaction at 24 h aptamer addiction. Samples were assayed in duplicate. The differences were analyzed by one-way ANOVA followed by Bonferroni test. The result is the average of three experiments tested in duplicate. Statistical significance ( *** P ⁇ 0.001 ).
  • 38x is the oligonucleotide of sequence SEQ ID NO: 7, which is a nonspecific sequence that is not able to adopt any secondary structure; Inh: hispanolone derivative compound 1 1 (Giron et al., 2008, Toxicol Appl Pharmacol 228:179-89).
  • Figure 7 Effect of the intraperitoneal injection of 1 nmol of aptamers TLRApt#1 R-T (SEQ ID NO: 1 ), TLRApt#4F-T (SEQ ID NO: 2) and TLRApt#4F (SEQ ID NO: 4) or 38x(AG) (SEQ ID NO: 7) or vehicle (PBS + 1 mM Mg 2+ ) in the reduction of the infarcted area in animals used in experiments.
  • mice were anesthetized with isoflurane and 24 hours after MCAO, the size of the infarction was evaluated by MRI.
  • T2WI The images highlighted in T2 (T2WI) have been acquired in a BIOSPEC BMT 47/40 operating at 4.7 T (Bruker- Medical, Ettlingen, Germany; MRI Unit, Instituto Pluri infrastructurer, UCM) and the damaged area is quantified by means of Image J 1 .41 (NIH, Bethesda, Washington). Statistical significance ( * P ⁇ 0.05). Keys: 1 RT, TLRApt#1 R-T; 4 FT, TLRApt#4F-T; 4F, TLRApt#4F.
  • Figure 8 Dose-response curve. Effect of the intraperitoneal injection of different amounts of aptamers TLRApt#4F-T (SEQ ID NO: 2) and TLRApt#4F (SEQ ID NO: 4) or vehicle (PBS + 1 mM Mg2 +) in the reduction of the infarcted area in animals used in experiments.
  • TLRApt#4F-T SEQ ID NO: 2
  • TLRApt#4F SEQ ID NO: 4
  • vehicle PBS + 1 mM Mg2 +
  • T2WI The images highlighted in T2 (T2WI) have been acquired in a BIOSPEC BMT 47/40 operating at 4.7 T (Bruker-Medical, Ettlingen, Germany; MRI Unit, Instituto Pluri infrastructurer, UCM) and the damaged area is quantified by means of Image J 1 .41 (NIH, Bethesda, Washington). Statistical significance ( * P ⁇ 0.05).
  • Figure 9 Flow cytometry assays.
  • Human HEK293 (left panel) and 293- hTLR4A (right panel) cell lines were incubated with 20 nM Alexa fluor 488-labeled aptamers for 30 min at room temperature. The cells were washed with 2 ml of PBS and resuspended in 1 mL PBS for analysis. In each figure, the ordinate represents the frequency of events (or cell number) while the abscissa indicates the fluorescence intensity (FL1 ).
  • the human 293- hTLR4A cell line is activated with LPS-EK-UP and then incubated 30 min with 20 nM of Alexa Fluor 488-labeled aptamers for 30 min at room temperature. The cells are washed with 2 ml PBS and resuspended in 1 mL PBS for analysis. In each figure, the ordinate represents the frequency of events (or cell number) while the abscissa indicates the fluorescence intensity (FL1 ).
  • Figure 10 Analysis of the half-life of the aptamers in vitro. Three hundred ng of folded aptamers were incubated with 2 units of ⁇ Exonuclease or DNAse I for several periods of time at 37°C. Afterward, samples were solved on a 3% agarose gel and bands visualized by GelRed and quantified using Image Studio Digits V3.1 software.
  • the authors of the present invention have selected and characterized two molecules which, due to their sequences, can be three-dimensionally structured in certain pH, temperature and saline concentration conditions, giving them the capability to recognize specifically the TLR-4 protein and modulate its activity. These molecules can inhibit cellular response mediated by receptor TLR-4 in vivo and can reduce the size of brain infarction in animal models of ischemic stroke, giving them a potential therapeutic role.
  • the present invention relates to a nucleic acid aptamer with the capability of binding specifically to and inhibiting TLR-4, hereinafter referred to as the "aptamer of the invention", and comprising a sequence selected from the group consisting of SEQ ID NO: 1
  • TGGCCCTAAATACGAG TGGCCCTAAATACGAG
  • aptamer in the context of the present invention, refers to single- stranded nucleic acid chains adopting a specific tertiary structure that allows them to bind to molecular targets with high specificity and affinity, comparable to that of monoclonal antibodies, through interactions other than conventional Watson-Crick base pairing.
  • nucleic acid in the context of the present invention, refers to any type of nucleic acid, such as DNA and RNA, and to variants thereof, such as peptide nucleic acid (PNA), locked nucleic acid (LNA), as well as combinations thereof, modifications thereof, including modified nucleotides, etc.
  • PNA peptide nucleic acid
  • LNA locked nucleic acid
  • Nucleic acids can be purified from natural sources, produced using recombinant expression systems and, optionally, purified, chemically synthesized, etc.
  • the nucleic acids can comprise nucleoside analogues such as analogues having chemically modified bases or sugars, modifications of the backbone, etc.
  • a nucleic acid sequence is represented in 5'-3' direction unless indicated otherwise.
  • TLR-4 refers to membrane receptor toll-like receptor 4.
  • Receptor TLR-4 can also be referred to as ARMD10, CD284, TLR4 or hTOLL.
  • receptor TLR-4 was registered in GenBank under accession number O00206.2 on 27 th May, 2014, and it is encoded by the TLR4 gene. It is made up of 839 amino acids, of which residues 1 -23 constitute the signal sequence, residues 24-631 constitute the extracellular domain, residues 632-652 constitute the transmembrane domain, and residues 653-839 constitute the cytoplasmic domain.
  • the aptamer can bind specifically to the extracellular domain of TLR-4 (amino acids 24-631 ).
  • the present invention contemplates an aptamer comprising a sequence selected from the group consisting of SEQ ID NO: 1 (CCGGCACGGGACAAGGCGCGGGACGGCGTAGATCAGGTCGACACC) and SEQ ID NO: 2 (GGTGTGCCAATAAACCATATCGCCGCGTTAGCATGTACTCGGT
  • TGGCCCTAAATACGAG TGGCCCTAAATACGAG
  • the present invention also contemplates aptamers of the invention that are made up of nucleic acids such as DNA and RNA, as well as of nucleic acid variants and analogues and combinations thereof, modifications thereof, including, without limitation, modified nucleic acid backbones, substitution bonds, modified nucleotides, and ribose or deoxyribose analogues, modified nucleotides, etc., with a capability of binding specifically to and inhibiting TLR-4 of at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% of the capability of specifically binding to and inhibiting TLR-4 of the aptamer of sequence SEQ ID NO: 1 or SEQ ID NO: 2.
  • nucleic acid variants and analogues include, without limitation, PNA, LNA and TNA.
  • nucleic acid variant or nucleic acid analogue in the context of the present invention, refers to nucleic acid variants and analogues including, without limitation, modified nucleic acid backbones, substitution bonds, modified nucleotides, and ribose or deoxyribose analogues.
  • nucleic acid variants according to the present invention can comprise structures with analogue synthetic backbones of the typical phosphodiester backbone.
  • phosphorothioate include, without limitation, phosphorothioate, phosphorodithioate, methylphosphonate, phosphoramidate, alkyl phosphotriester, sulfamate, 3'-thioacetal, methylene(methylimino), 3'-N-carbamate, morpholine carbamate and peptide nucleic acids (PNA), methylphosphonate bonds or alternating methylphosphonate and phosphodiester and benzylphosphonate.
  • PNA peptide nucleic acids
  • Nucleic acid variants can also contain one or more "substitution” bonds, as is generally understood in the art. Some of these substitution bonds are apolar and contribute to providing the aptamer with a capability of spreading through the membranes. These "substitution” bonds are herein defined as conventional alternative bonds, such as phosphorothioate or phosphoramidate, and are synthesized as described in the commonly available literature.
  • Alternative binding groups include, in a non-limiting manner, embodiments in which a moiety of formula P(0)S, ("thioate”) , P(S)S ("dithioate”), P(0)NR' 2 , P(0)R ⁇ P(0)OR 6 , CO, or CONR' 2 , wherein R' is H (or a salt) or an alkyl group of 1 -12 carbon atoms and R 6 is an alkyl group of 1 -9 carbon atoms, which binds to adjacent nucleotides through -S- or -0-. Dithioate bonds are described in US patent application 248517.
  • the present invention also contemplates the use of substitution bonds including internucleotide bonds not based on phosphorus, such as 3'-thioformacetal, (-S-CH 2 -0-), formacetal (-0-CH 2 -0-) and 3'-amine internucleotide bonds (-NH-CH 2 -CH 2 -) described in US patent applications 690786 and 763130.
  • substitution bonds including internucleotide bonds not based on phosphorus, such as 3'-thioformacetal, (-S-CH 2 -0-), formacetal (-0-CH 2 -0-) and 3'-amine internucleotide bonds (-NH-CH 2 -CH 2 -) described in US patent applications 690786 and 763130.
  • One or more substitution bonds can be used in the aptamers of the invention for the purpose of even further facilitating binding to TLR-4 or for increasing the stability of the aptamers against nucleases, as well as for providing permeation capability.
  • nucleic acid variants according to the present invention can also contain ribose or deoxyribose analogue forms which are well-known in the art, including without limitation sugars substituted at 2', such as 2'-0-methyl-ribose, 2'- fluoro-ribose or 2'-azido-ribose, carbocyclic analogues of sugars, a-anomeric sugars, epimeric sugars such as arabinose, xyloses or lyxoses, pyranose sugars, furanose sugars and sedoheptuloses.
  • sugars substituted at 2' such as 2'-0-methyl-ribose, 2'- fluoro-ribose or 2'-azido-ribose
  • carbocyclic analogues of sugars such as arabinose, xyloses or lyxoses, pyranose sugars, furanose sugars and sedoheptuloses.
  • the nucleic acids can also contain threose nucleic acid (TNA, also referred to as alpha-threofuranosyl oligonucleotides) (see, for example, Schong et al., Science 2000, November 17, 290 (5495): 1347-1351 ).
  • TAA threose nucleic acid
  • the substitution in the position 2' of the residue of furanose is particularly important with respect to the improvement in nuclease stability.
  • nucleotide in the context of the present invention, refers to the monomers making up the nucleic acids.
  • the nucleotides are formed by a pentose, a nitrogenous base and a phosphate group, and are bound by means of phosphodiester bonds.
  • the nucleotides that are part of DNA and RNA differ in the pentose, this being deoxyribose and ribose, respectively.
  • the nitrogenous bases are divided into purine nitrogenous bases, which are adenine (A) and guanine (G), and into pyrimidine nitrogenous bases, which are thymine (T), cytosine (C) and uracil (U).
  • modified nucleotide in the context of the present invention, refers to known natural nucleotides analogues, with similar or improved binding properties.
  • Analogue forms of purines and pyrimidines are well-known in the art and include, without limitation, aziridinylcytosine, 4-acetylcytosine, 5-fluorouracil, 5-bromouracil, 5- carboxymethylaminomethyl-2-thiouracil, 5-carboxymethylaminomethyluracil, inosine, N 6 -isopentenyladenine, 1 -methyladenine, 1 -methylpseudouracil, 1 -methylguanine, 1 - methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3- methylcytosine, 5-methylcytosine, N 6 -methyladenine, 7-methylguanine, 5- methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, beta-D- mannosylkeosine, 5-methoxyuracil, 2-methylthio-N-6-isopentenyladenine, urac
  • nucleic acid variants comprised in the invention also include PNA, LNA and 5'-5' or 3'-3' chains.
  • locked nucleic acid refers to a modified RNA nucleotide the ribose moiety of which is modified with an additional bond connecting the oxygen at 2' with the carbon at 4', locking the ribose in the 3'-endo conformation.
  • the term "functionally equivalent variant” refers to aptamers with sequences substantially similar to SEQ ID NO: 1 or SEQ ID NO: 2 maintaining the capability of specifically binding to and inhibiting TLR-4.
  • a functionally equivalent variant of the aptamer of the invention can be a nucleic acid sequence derived from SEQ ID NO: 1 or SEQ ID NO: 2 comprising the addition, substitution or modification of one or more nucleotides.
  • functionally equivalent variants of the aptamer of the invention include sequences comprising the addition of 1 nucleotide, 2 nucleotides, 3 nucleotides, 4 nucleotides, 5 nucleotides, 10 nucleotides, 15 nucleotides, 20 nucleotides, 25 nucleotides, 30 nucleotides, 35 nucleotides, 40 nucleotides, 45 nucleotides, 50 nucleotides, 60 nucleotides, 70 nucleotides, 80 nucleotides, 90 nucleotides, 100 nucleotides, 150 nucleotides, 200 nucleotides, at least 500 nucleotides, at least 1000 nucleotides or more at the 5' end of the sequence SEQ ID NO: 1 or SEQ ID NO: 2, and/or comprising the addition of 1 nucleotide, 2 nucleotides, 3 nucleotides, 4 nucleotides, 5 nucleot
  • the present invention also includes aptamers comprising nucleotide sequences with a sequence identity of at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% with the sequences SEQ ID NO: 1 or SEQ ID NO: 2 and maintaining a capability of specifically binding to and inhibiting TLR- 4 of at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% of the capability of specifically binding to and inhibiting TLR-4.
  • identity in the context of two or more nucleic acids, refer to two or more sequences or subsequences that are the same or have a specified percentage of nucleotides or amino acid residues that are the same, when compared and aligned (introducing gaps, if necessary) for maximum correspondence, not considering any conservative amino acid substitutions as part of the sequence identity.
  • the percent identity can be measured using sequence comparison software or algorithms or by visual inspection.
  • Various algorithms and software are known in the art that can be used to obtain alignments of amino acid or nucleotide sequences.
  • One such non-limiting example of a sequence alignment algorithm is the algorithm described in Karlin et al., 1990, Proc. Natl. Acad.
  • Gapped BLAST can be used as described in Altschul et al., 1997, Nucleic Acids Res. 25:3389-402.
  • BLAST-2 Altschul et al., 1996, Methods in Enzymology, 266:460-80
  • ALIGN ALIGN-2
  • ALIGN-2 Genentech, South San Francisco, California
  • Megalign Megalign
  • the percent identity between two nucleotide sequences is determined using the GAP program in GCG software (e.g., using a NWSgapdna.CMP matrix and a gap weight of 40, 50, 60, 70, or 90 and a length weight of 1 , 2, 3, 4, 5, or 6).
  • the GAP program in the GCG software package which incorporates the algorithm of Needleman and Wunsch (J. Mol. Biol. 48:444-53 (1970)) can be used to determine the percent identity between two amino acid sequences (e.g., using either a Blossum 62 matrix or a PAM250 matrix, and a gap weight of 16, 14, 12, 10, 8, 6, or 4 and a length weight of 1 , 2, 3, 4, 5).
  • the percent identity between nucleotide or amino acid sequences is determined using the algorithm of Myers and Miller (CABIOS, 4:1 1 -7 (1989)).
  • the percent identity can be determined using the ALIGN program (version 2.0) and using a PAM120 with residue table, a gap length penalty of 12 and a gap penalty of 4.
  • Appropriate parameters for maximal alignment by particular alignment software can be determined by one skilled in the art.
  • the default parameters of the alignment software are used.
  • the percentage identity "X" of a first amino acid sequence to a second sequence amino acid is calculated as 100 x (Y/Z), where Y is the number of amino acid residues scored as identical matches in the alignment of the first and second sequences (as aligned by visual inspection or a particular sequence alignment program) and Z is the total number of residues in the second sequence.
  • the percent identity may be determined only in the region of overlap between said first and second sequences.
  • the same formula as above can be used but using as Z value the length of the region wherein the first and second sequence overlaps, said region having a length which is substantially the same as the length of the first sequence.
  • whether any particular polynucleotide has a certain percentage sequence identity can, in certain embodiments, be determined using the Bestfit program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, 575 Science Drive, Madison, Wl 5371 1 ). Bestfit uses the local homology algorithm of Smith and Waterman, Advances in Applied Mathematics 2:482-9 (1981 ), to find the best segment of homology between two sequences.
  • the parameters are set such that the percentage of identity is calculated over the full length of the reference nucleotide sequence and that gaps in homology of up to 5% of the total number of nucleotides in the reference sequence are allowed.
  • two nucleic acids of the invention are substantially identical, meaning they have at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, and in some embodiments at least 95%, 96%, 97%, 98%, 99% nucleotide or amino acid residue identity, when compared and aligned for maximum correspondence, as measured using a sequence comparison algorithm or by visual inspection.
  • Identity can exist over a region of the sequences that is at least about 10, about 20, about 40-60 residues in length or any integral value therebetween, and can be over a longer region than 60-80 residues, for example, at least about 90-100 residues, and in some embodiments, the sequences are substantially identical over the full length of the sequences being compared, such as the coding region of a nucleotide sequence for example.
  • binding refers to the non-covalent physical association between two molecules, the aptamer of the invention and receptor TLR-4.
  • the binding between the aptamer of the invention and receptor TLR-4 is considered specific if the binding strength between both is at least 10 times, at least 15 times, at least 20 times, at least 25 times, at least 50 times, at least 75 times or at least 100 times greater than the binding strength between the aptamer of the invention and an irrelevant molecule.
  • the binding between the aptamer of the invention and receptor TLR-4 is also considered specific if the equilibrium dissociation constant Kd is 10 "3 M or less , 10 "4 M or less, 10 "5 M or less, 10 "6 M or less, 10 "7 M or less, 10 “8 M or less, 10 "9 M or less, 10 "10 M or less, 10 "11 M or less, or 10 "12 M or less under the conditions used, for example, in physiological conditions, cell culture conditions or conditions that allow cell survival.
  • the capability of the aptamer of the invention of binding specifically to TLR-4 can be determined by means of a range of assays that are available in the art.
  • the capability of the aptamer of the invention for the specific binding to TLR- 4 is determined by means of in vitro binding assays, such as the enzyme-linked oligonucleotide assay (ELONA), the enzyme-linked aptamer sorbent assay (ELASA), precipitation and quantitative PCR (qPCR), or by fluorescence techniques such as aptahistochemistry, aptacytochemistry, fluorescence microscopy or flow cytometry.
  • ELONA enzyme-linked oligonucleotide assay
  • ELASA enzyme-linked aptamer sorbent assay
  • qPCR precipitation and quantitative PCR
  • fluorescence techniques such as aptahistochemistry, aptacytochemistry, fluorescence microscopy or flow cytometry.
  • both the capability of specific binding to TLR-4 and the affinity of the aptamer for TLR-4 can be determined by techniques well-known by the person skilled in the art, such as gel mobility shift assay, surface plasmon resonance (SPR), kinetic capillary electrophoresis and fluorescence binding assay.
  • the fluorescence binding assay consists of the incubation of magnetic balls coated with TLR-4 with different concentrations (for example, from 0 to 100 nM) of the aptamer of the invention labeled (for example, with carboxyfluorescein, FAM), and the subsequent elution and detection of the bound aptamers; the dissociation constants (Kd) are calculated by non-linear fit analysis.
  • TLR-4 refers to the blocking or disminution of the activity of TLR-4, i.e., the transduction of the receptor TLR-4-mediated signal. It is considered that the activity of TLR-4 is inhibited by an inhibitory agent or antagonist when its activity is at least 95%, at least 90%, at least 85%, at least 80%, at least 75%, at least 70%, at least 65%, at least 60%, at least 55%, at least 50%, at least 45%, at least 40%, at least 35%, at least 30%, at least 25%, at least 20%, at least 15%, at least 10%, at least 5%, at least 1 %, or less of the activity of TLR-4 in the presence of its natural agonist LPS.
  • the capability of the aptamer of the invention of inhibiting TLR-4 can be determined by means of a range of assays that are available in the art.
  • the capability of inhibiting TLR-4 of the aptamer of the invention is determined by means of in vitro assays with cells expressing recombinant TLR-4 and a reporter gene, the expression of which is associated with the activation of recombinant TLR-4.
  • the person skilled in the art will recognize that there are multiple variants of this method, depending on the cell and the recombinant gene used.
  • An example of this assay is included in the examples of the present invention (section on "Materials and methods" and Example 2).
  • Other available techniques include the determination of the levels of inflammatory cytokines, such as IL-1 , IL-8, TNF-alpha and IL-12, released by cells that express TLR-4.
  • the aptamer of the invention consists of between 30 and 200 nucleotides, preferably between 35 and 150 nucleotides, more preferably between 40 and 100 nucleotides, even more preferably between 45 and 80 nucleotides.
  • the aptamer of the invention comprises a sequence selected from the group consisting of SEQ ID NO: 3 (GTTGCTCGTATTTAGGGCCACCGGCACGGGACAAGGCGCGGGACGGCGTAG ATCAGGTCGACACCAGTCTTCATCCGC) and SEQ ID NO: 4 (GCGGATGAAGAC TGGTGTGCCAATAAACCATATCGCCGCGTTAGCATGTACTCGGTTGGCCCTAAAT ACGAGCAAC).
  • the sequence SEQ ID NO: 3 is a functionally equivalent variant of SEQ ID NO: 1
  • the sequence SEQ ID NO: 4 is a functionally equivalent variant of SEQ ID NO: 2.
  • the nucleic acid is DNA. In another particular embodiment, the nucleic acid is RNA. In another particular embodiment, the nucleic acid is PNA. In another particular embodiment, the nucleic acid is LNA. In another particular embodiment, the nucleic acid is TNA.
  • the TLR-4 is a TLR-4 selected from the group formed by mouse, rat, rabbit, pig, cat, dog, horse, primate, and human TLR-4. In a preferred embodiment, the TLR-4 is a human TLR-4.
  • the production of the aptamer of the invention can be carried out following conventional methods in the art.
  • techniques for the production of aptamers include enzymatic techniques, such as transcription, recombinant expression systems and standard solid phase (or solution phase) chemical synthesis, all commercially available.
  • the aptamer of the invention will be produced by means of chemical synthesis.
  • expression will be the technique preferred for the production of aptamers when said aptamers have a length of 200 nucleotides or more.
  • the aptamers produced by or any of the preceding techniques can optionally be purified by methods that are well known in the art.
  • the features of the small size, stability and easy production of the aptamer of the invention enable said aptamer to be presented bound to a second molecule. That is particularly advantageous when the second molecule is a functional group.
  • the result of the binding of the aptamer of the invention and a functional group is a complex presenting the combination of functions of both, i.e., a complex with the capability of specifically binding to and inhibiting TLR-4 and with the activity associated with the functional group.
  • the present invention refers to a complex, hereinafter referred to as the "complex of the invention", comprising a nucleic acid aptamer with the capability of binding specifically to and inhibiting TLR-4, comprising a sequence selected from the group consisting of SEQ I D NO: 1 and SEQ I D NO: 2 or a functionally equivalent variant thereof and a functional group.
  • the term "functional group”, in the context of the present invention, refers to compounds suitable for performing at least one function. Said function includes, without limitation, the capability of binding specifically to TLR-4 or to other receptors TLR, the capability of inhibiting TLR-4 or other receptors TLR, the capability of being both directly and indirectly detectable, the capability of inducing cell death, the capability of carrying a therapeutic payload, etc.
  • a functional group can have associated therewith one or multiple functions.
  • Non-limiting examples of functional groups include detectable reagents and drugs. These functional groups act like imaging agents, drugs, etc.
  • the functional group is selected from a detectable reagent, a drug and a nanoparticle.
  • the functional group is a detectable reagent.
  • detectable reagent imaging agent
  • contrast agent contrast agent
  • Radiopharmaceuticals are commonly labeled with positron-emitters such as 11 C, 13 N, 15 0, 18 F, 82 Rb, 62 Cu, 64 Cu, and 68 Ga 86 Y, 124 l, 213 Bi and 211 At.
  • SPECT radiopharmaceuticals are commonly labelled with positron emitters such as 94 mTc, 201 TI and 67 Ga.
  • Radionuclide imaging modalities positron emission tomography, (PET); single photon emission computed tomography (SPECT) are diagnostic cross-sectional imaging techniques that map the location and concentration of radionuclide-labeled radiotracers.
  • PET and SPECT can be used to localize and characterize a radionuclide by measuring metabolic activity. PET and SPECT provide information pertaining to information at the cellular level, such as cellular viability.
  • a positron emitter is administered to the patient, which can be monitored as the substance moves through the body.
  • a complex according to the invention is used for PET or SPECT imaging in vivo. Closely related to PET is single-photon emission computed tomography, or SPECT. The major difference between the two is that instead of a positron-emitting substance, SPECT uses a radioactive tracer that emits low-energy photons.
  • radionuclides include gamma emission isotopes, such as 99m Tc, 123 l and 111 ln, which can be used in radioscintigraphy using gamma cameras or computerized single photon emission tomography, as well as beta emitters, such as 131 1, 90 Y, 99m Tc, 177 Lu and 67 Cu".
  • beta emitters such as 131 1, 90 Y, 99m Tc, 177 Lu and 67 Cu.
  • the radionuclides may also be used for therapeutic purposes.
  • Detectable reagents for CT imaging include, for example, iodinated or brominated contrast media. Examples of these agents include iothalamate, iohexyl, diatrizoate, iopamidol, ethiodol and iopanoate. Gadolinium agents have also been reported to be of use as a CT contrast agent. For example, gadopentate agents have been used as a CT contrast agent.
  • Computerized tomography (CT) is contemplated as an imaging modality in the context of the present invention.
  • CT By taking a series of X- rays, sometimes more than a thousand, from various angles and then combining them with a computer, CT made it possible to build up a three-dimensional image of any part of the body.
  • a computer is programmed to display two-dimensional slices from any angle and at any depth.
  • intravenous injection of a radiopaque contrast agent such as those described herein can assist in the identification and delineation of soft tissue masses when initial CT scans are not diagnostic.
  • Detectable reagents for optical imaging include, for example, fluorescein, a fluorescein derivative, indocyanine green, Oregon green, a derivative of Oregon green derivative, rhodamine green, a derivative of rhodamine green, an eosin, an erythrosin, Texas red, a derivative of Texas red, malachite green, nanogold sulfosuccinimidyl ester, cascade blue, a coumarin derivative, a naphthalene, a pyridyloxazole derivative, cascade yellow dye, dapoxyl dye, and various other fluorescent compounds, such as Cy3, Cy2, Cy5, the Alexa Fluor® fluorescent label family (Molecular Probes, Inc.), carboxyfluorescein (FAM) and fluorescein isothiocyanate (FITC).
  • fluorescein a fluorescein derivative, indocyanine green, Oregon green, a derivative of Oregon green derivative, rhodamine green, a
  • the detectable reagent is a protein.
  • protein in the context of the present invention, refers to macromolecules consisting of one or more amino acid chains. The proteins are responsible for carrying out a diverse group of cell functions based on their ability to specifically bind other molecules. The proteins can be bound to other proteins as well as to small substrate molecules. Non- limiting examples of proteins suitable for the purposes of the present invention include, without limitation, enzymes, fluorescent proteins, luminescent proteins and antigens.
  • the protein is an enzyme.
  • enzyme in the context of the present invention, refers to a protein working as a highly selective catalyst, accelerating both the speed and the specificity of the metabolic reaction for which it is specific.
  • Non-limiting examples of enzymes suitable for the invention include, without limitation, horseradish peroxidase (HRP) and alkaline phosphatase.
  • HRP horseradish peroxidase
  • alkaline phosphatase alkaline phosphatase.
  • the enzymes suitable for use in the present invention are indirectly detectable as a result of their capability of catalyzing modifying a substrate in a compound detectable by colorimetry, chemiluminescence or fluorimetry.
  • Suitable substrates include, without limitation, p-Nitrophenyl phosphate (PNPP), 2,2'-azinobis[3-ethylbenzothiazolin-6- sulfonic acid] (ABTS), o-phenylenediamine (OPD), and 3,3',5,5'-tetramethylbenzidine (TMB).
  • PNPP p-Nitrophenyl phosphate
  • ABTS 2,2'-azinobis[3-ethylbenzothiazolin-6- sulfonic acid]
  • OPD o-phenylenediamine
  • TMB 3,3',5,5'-tetramethylbenzidine
  • Bioluminescent proteins or photoproteins are a particular case of oxidative enzymes capable of carrying out a chemical reaction of their specific prosthetic groups, resulting in light emission without requiring prior excitation.
  • Non-limiting examples of bioluminescent proteins include firefly luciferase, Renilla luciferase and aequorin.
  • the protein is a fluorescent protein.
  • fluorescent protein in the context of the present invention, refers to a protein with the capability of emitting light when it is excited at a wavelength suitable for excitation.
  • Non-limiting examples of fluorescent proteins that can be used in the complex of the invention include, without limitation, GFP, GFPuv, BFP, CFP, YFP, EBFP2, mCerulean, mCerulean3, mVenus, mTurquoise, T-Sapphire, citrine, amFP486, zFP506, zFP538, drFP, DsRed, mCherry, dTomate, mTFP1 , TagRFP-T, mK02, mRuby, mKate, mAmetrine, REACh, R-phycoerythrin (R-PE) and Allophycocyanin (APC).
  • the protein is a luminescent protein.
  • luminescent protein in the context of the present invention, refers to a protein capable of emitting light when it is excited at a wavelength suitable for excitation.
  • fluorescent proteins Non-limiting examples of fluorescent proteins that can be used in the complex of the invention include, without limitation, the proteins included in Table 1 , together with their corresponding excitation and emission wavelengths.
  • the protein is an antigen.
  • antigen in the context of the present invention, refers to a molecule that induces an immune response in the body. Therefore, an antigen can be used for generating an antibody that recognizes it and binds specifically to it.
  • antigens include, inter alia, tumor antigens, such as the carcinoembryonic antigen (CEA), HER2, prostate specific antigen (PSA) and tissue plasminogen activator and its recombinant variants, such as Activase®, as well as bacterial antigens, allergens, etc.
  • CEA carcinoembryonic antigen
  • PSA prostate specific antigen
  • tissue plasminogen activator tissue plasminogen activator and its recombinant variants, such as Activase®, as well as bacterial antigens, allergens, etc.
  • the antigens suitable for use in the present invention are indirectly detectable as a result of their capability of being specifically recognized by an antibody.
  • the detectable reagent is a haptene.
  • haptene in the context of the present invention, refers to a group of chemical compounds having a small molecular size ( ⁇ 10,000 Da) which are antigenic but unable to induce by themselves an specific immune reaction.
  • carrier a large immunogenic protein
  • vitamins include biotin (vitamin B7), digoxigenin, dinitrophenol (DNP) and nitro-iodophenol (NIP).
  • the vitamin is biotin.
  • biotin is indirectly detectable as a result of its capability of being specifically recognized by avidin or variants thereof, such as streptavidin and neutravidin.
  • the functional group is a drug.
  • drug in the context of the present invention, refers to a chemical substance used in the treatment, cure or prevention of a disease or condition, such as a pathology characterized by an increase in expression of TLR-4 and/or an increase in activation of TLR-4.
  • pathology characterized by an increase in expression of TLR-4 and/or an increase in activation of TLR-4" is described in detail in the context of the medical uses of the invention and its definition and particularities are herein included by reference.
  • TLR-4 antagonist agents and anti-inflammatory agents are particularly preferred.
  • the present invention contemplates that the drug is selected from the group including, without limitation, TLR-4 antagonists, such as naloxone, naltrexone, LPS, ibudilast, propentofylline, amitriptyline, ketotifen, cyclobenzaprine, mianserin and imipramine; anti-platelet drugs, such as aspirin and clopidogrel; anti-coagulants, such as heparin, acenocumarol, warfarin, dabigatran and rivaroxaban; and antioxidants, such as edaravone.
  • tissue plasminogen activator and its recombinant variants can be likewise considered as a drug due to their thrombolytic action.
  • the drug is a nucleic acid. Therefore, in a preferred embodiment the drug is a nucleic acid.
  • Nucleic acids suitable as drugs in the context of the complex of the invention include antisense RNA, antisense DNA and small interfering RNA, which have the capability of silencing the expression of genes involved in a pathology characterized by an increase in expression of TLR-4 and/or an increase in activation of TLR-4, including, without limitation, the NFKB1, RIPK3, IFNB1, LY96 ⁇ MD-2), IRF3, TLR3, TIRAP ⁇ Mai), TICAM1 ⁇ TRIF), RIPK1, TRAF6, CD14, TRAM, IKBKG ⁇ IKK-gamma), IFNA 1 and TLR4 genes.
  • antisense RNA in the context of the present invention, refers to a single-stranded RNA the nucleotide sequence of which is complementary for a target messenger RNA, thereby interfering with the expression of the respective gene.
  • antisense DNA in the context of the present invention, refers to a single-stranded DNA the nucleotide sequence of which is complementary for a target messenger RNA, thereby interfering with or silencing the expression of the respective gene.
  • small interfering RNA refers to a double-stranded RNA with a length of 20 to 25 nucleotides which is highly specific for the nucleotide sequence of its target messenger RNA, thereby interfering with the expression of the respective gene.
  • the drug is a peptide. Therefore, in a preferred embodiment the drug is a peptide.
  • the peptide will comprise at least 2 amino acids, at least 3 amino acids, at least 4 amino acids, at least 5 amino acids, at least 10 amino acids, at least 15 amino acids, at least 20 amino acids, at least 30 amino acids, at least 40 amino acids, at least 50 amino acids, at least 60 amino acids, or at least 70 amino acids.
  • Suitable for the purposes of this invention are, inter alia, peptides with the capability of binding to a target and of inducing or inhibiting cell signaling.
  • target binding peptide in the context of the present invention, refers to a peptide comprising a target binding region.
  • signal peptide in the context of the present invention, refers to a peptide with the capability of provoking cell signaling, such as cell receptor agonist peptides.
  • the amino acid sequences suitable for target molecule binding include molecular recognition consensus sequences that are well-known in the art.
  • the functional group is a nanoparticle.
  • nanoparticle in the context of the present invention, refers to colloidal systems of the spherical type, rod type, polyhedron type, etc., or similar shapes, having a size less than 1 micrometer ( ⁇ ), which are individually found or are found forming organized structures (dimers, trimers, tetrahedrons, etc.), dispersed in a fluid (aqueous solution).
  • the nanoparticles suitable for putting the invention into practice have a size less than 1 ⁇ , generally comprised between 1 and 999 nanometers (nm), typically between 5 and 500 nm, preferably between about 10 and 150 nm.
  • the nanoparticles of the invention typically have a mean particle diameter ranging from 2 to 50 nm, preferably from 5 to 20 nm, more preferably of 13 nm.
  • the mean particle diameter is the maximum mean particle dimension, with the understanding that the particles are not necessarily spherical.
  • the shape of said nanoparticles can widely vary; advantageously, said nanoparticles will adopt any optically efficient shape such as spheres, rods, stars, cubes, polyhedrons or any other variant as well as complex associations of several particles; in a particular embodiment, the shape of the nanoparticles for putting the invention into practice is spherical or substantially spherical. The shape can be suitably evaluated by conventional light or by means of electron microscopy techniques.
  • Nanoparticles suitable for use in the present invention include polymeric nanoparticles, lipid nanoparticles and metal nanoparticles.
  • Polymeric nanoparticles are formed by a polymeric matrix which is attached to the aptamer.
  • biocompatible polymers that may be useful in the polymeric nanoparticules according to the present invention include polyethylenes, polycarbonates, polyanhydrides, polyhydroxyacids, polypropylfumerates, polycaprolactones, polyamides, polyacetals, polyethers, polyesters, poly(orthoesters), polycyanoacrylates, polyvinyl alcohols, polyurethanes, polyphosphazenes, polyacrylates, polymethacrylates, polycyanoacrylates, polyureas, polystyrenes, or polyamines, polyglutamate, dextran, polyanhydrides, , polyurethanes, polymethacrylates, polyacrylates or polycyanoacrylates.
  • PDO polydioxanone
  • PDO polyhydroxyalkanoate
  • polyhydroxybutyrate poly(glycerol sebacate)
  • polyglycolide polylact
  • the nanoparticles of the invention may be lipid nanoparticles such as a liposome or a micelle.
  • lipid nanoparticles such as a liposome or a micelle.
  • formation of micelles and liposomes from, for example, vesicle- forming lipids, is known in the art.
  • Vesicle-forming lipids refer to lipids that spontaneously form lipid bilayers above their gel-to-liquid crystalline phase transition temperature range. Such lipids typically have certain features that permit spontaneous bilayer formation, such as close to identical cross-section areas of their hydrophobic and hydrophilic portions permitting packing into lamellar phases.
  • Lipids capable of stable incorporation into lipid bilayers, such as cholesterol and its various analogs, can be incorporated into the lipid bilayer during bilayer formation.
  • the vesicle-forming lipids are preferably lipids having two hydrocarbon chains, typically acyl chains, and a head group, either polar or nonpolar.
  • lipids having two hydrocarbon chains typically acyl chains, and a head group, either polar or nonpolar.
  • synthetic vesicle-forming lipids and naturally-occurring vesicle-forming lipids including the phospholipids, such as phosphatidylcholine, phosphatidylethanolamine, phosphatidic acid, phosphatidylinositol, and sphingomyelin, where the two-hydrocarbon chains are typically between about 14- 22 carbon atoms in length, and either saturated or having varying degrees of unsaturation.
  • lipids and phospholipids whose acyl chains have varying degrees of saturation can be obtained commercially or prepared according to published methods.
  • suitable lipids include phospholipids, sphingolipids, glycolipids, and sterols, such as cholesterol.
  • liposome refers to vesicles comprised of one or more concentrically ordered lipid bilayers, which encapsulate an aqueous phase.
  • the aqueous phase typically contains the compound to be delivered to a target site.
  • the liposome fuses with the plasma membranes of target cells, i.e. cells expressing TLR-4, thereby releasing the compound into the cytosol.
  • the liposome is endocytosed or otherwise taken in by the target cells as the content of a transport vesicle (e.g., an endosome or phagosome).
  • the liposome Once in the transport vesicle, the liposome either degrades or fuses with the membrane of the vesicle and releases its contents.
  • a variety of methods known to the skilled person are available for preparing liposomes, such as sonication, extrusion, high pressure/homogenization, micro fluidization, detergent dialysis, calcium-induced fusion of small liposome vehicles and ether fusion methods, all of which are well known in the art.
  • Polymeric and lipidic nanoparticles can additionally include a coating of a amphiphilic compound that surrounds the polymeric material forming a shell for the particle or a stealth material that can allow the particles to evade recognition by immune system components and increase particle circulation half-life.
  • the nanoparticles of the invention may be a metal nanoparticle.
  • metal nanoparticle refers to a nanoparticle comprising a metal and showing the optical property known as the surface plasmon phenomenon, i.e., a plasmonic metal. This phenomenon consists of the collective vibration of the electrons of the metal surface, producing an absorption band located in the ultraviolet-visible spectrum (typical of the metal and of the size of the nanoparticles) at the wavelength where the resonance condition occurs in said electrons.
  • the surface plasmon of a metal can be determined by means of any spectroscopic technique known in the state of the art, such as surface plasmon resonance (SPR) spectroscopy, whereby the metal atoms are subjected to an electromagnetic beam or surface plasmon resonance fluorescence spectroscopy (SPFS) based on the detection of the variation of the refractive index of the metal atoms when they are subjected to a photon beam.
  • SPR surface plasmon resonance
  • SPFS surface plasmon resonance fluorescence spectroscopy
  • a "plasmonic metal” is a metal characterized by showing the property of optics known as the surface plasmon phenomenon. The variation of the plasmonic response is particularly evident when several nanoparticles are located close to one another, given that this causes the coupling of their respective near fields, generating a new surface plasmon.
  • said metal is selected from the group consisting of gold, silver, copper, aluminum, platinum, iron, cobalt, palladium and combinations thereof.
  • a preferred embodiment of metal nanoparticles is a core-shell nanoparticle, which contains a metal core and a porous shell.
  • core-shell metal nanoparticles include magnetic mesoporous silica nanoparticles, which are well-known in the art.
  • the nanoparticle is a magnetic mesoporous silica nanoparticle.
  • the nanoparticles may be functionalized by adding a coating on its surface.
  • the surface coating should be polar to give high aqueous solubility and prevent nanoparticle aggregation.
  • highly charged coatings promote non-specific binding, whereas polyethylene glycol linked to terminal hydroxyl or methoxy groups repel non-specific interactions.
  • Aptamers can be linked to nanoparticles ideally by a covalent link, preferably on the nanoparticle surface.
  • aptamers should be present in a controlled number per nanoparticle.
  • Binding between an aptamer of the invention and a functional group for generating the complex of the invention can be carried out by means of conjugation techniques that are well-known by the person skilled in the art. The result is a covalent bond between the aptamer of the invention and the functional group.
  • the conjugation can involve binding of primary amines of the 3' or 5' ends of the aptamer of the invention to the functional group during chemical synthesis of the aptamer.
  • conjugation can be done by means of conventional cross-linking reactions, having the advantage of the much greater chemical reactivity of primary alkyl-amine labels with respect to the aryl amines of the nucleotides themselves.
  • cross-linking reagents contain at least two reactive groups which target groups such as primary amines, sulfhydryls, aldehydes, carboxyls, hydroxyls, azides and so on and so forth, in the molecule to be conjugated.
  • the cross-linking agents differ in their chemical specificity, spacer arm length, spacer arm composition, cleavage spacer arm, and structure.
  • conjugation of complexes according to the invention can be carried out directly or through a linking moiety, through one or more non-functional groups in the aptamer and/or the functional group, such as amine, carboxyl, phenyl, thiol or hydroxyl groups. More selective bonds can be achieved by means of the use of a heterobifunctional linker.
  • linkers such as diisocyanates, diisothiocyanates, bis (hydroxysuccinimide) esters, carbodiimides, maleimide-hydroxysuccinimide esters, glutaraldehyde and the like, or hydrazines and hydrazides, such as 4-(4-N-maleimidophenyl) butyric acid hydrazide (MPBH).
  • linkers such as diisocyanates, diisothiocyanates, bis (hydroxysuccinimide) esters, carbodiimides, maleimide-hydroxysuccinimide esters, glutaraldehyde and the like
  • hydrazines and hydrazides such as 4-(4-N-maleimidophenyl) butyric acid hydrazide (MPBH).
  • Another approach consists of labeling the aptamers during synthesis by means of PCR using primers labeled, for example, with a fluorophore.
  • primers labeled for example, with a fluorophore.
  • binding between an aptamer according to the invention and the radionuclide can be carried out by means of chemical coordination, wherein the atoms of the aptamer involved in the binding donate electrons to the radionuclide.
  • Coordination reactions are well-known in the art and will depend on the radionuclide and the reactive group involved in the aptamer.
  • the present invention also contemplates in vitro uses of a nucleic acid aptamer with the capability of binding specifically to and inhibiting TLR-4 and comprising a sequence selected from the group consisting of SEQ ID NO: 1 and SEQ ID NO: 2 or a functionally equivalent variant thereof, and of a complex comprising a nucleic acid aptamer with the capability of binding specifically to and inhibiting TLR-4 and comprising a sequence selected from the group consisting of SEQ ID NO: 1 and SEQ ID NO: 2 or a functionally equivalent variant thereof and a functional group, for detecting TLR-4.
  • the present invention refers to an in vitro use of a nucleic acid aptamer with the capability of binding specifically to and inhibiting TLR-4 and comprising a sequence selected from the group consisting of SEQ ID NO: 1 and SEQ ID NO: 2 or a functionally equivalent variant thereof for detecting TLR-4.
  • an aptamer according to the invention of binding specifically to TLR-4 can be exploited for the indirect detection of TLR-4 through the aptamer according to the invention.
  • Aptamer detection techniques are well-known in the art and include, for example, the use of antibodies or probes specific for the aptamer. Therefore, once the aptamer according to the invention is bound to TLR-4, an antibody or probe specific for the aptamer, which in turn can be labeled with a detectable reagent, or which can be detected indirectly by means of a secondary antibody or probe, would be applied.
  • the technique used for detecting TLR- 4 will then depend on the type of detectable reagent, being able to be techniques based, for example, on fluorimetry, colorimetry or radioactivity.
  • probe or “hybridization probe”, in the context of the present invention, refers to a variable-length DNA or RNA fragment, generally between 10 and 1000 bases in length, which is used for detecting the presence of single-stranded nucleic acids (DNA or RNA) which are complementary to the sequence in the probe.
  • the probe is hybridized to the target single-stranded nucleic acid, the base sequence of which allows base pairing due to complementarity between the probe and the target nucleic acid.
  • the probe is labeled with a detectable reagent, such as a radionuclide, a fluorophore or digoxigenin, inter alia.
  • the detection of TLR-4 with the aptamer of the invention can be carried out by means of in vitro binding assays, such as the enzyme-linked oligonucleotide assay (ELONA), the enzyme-linked aptamer sorbent assay (ELASA), precipitation and quantitative PCR (qPCR), gel mobility shift assay, Western Blotting, surface plasmon resonance (SPR), kinetic capillary electrophoresis, the fluorescence binding assay, aptahistochemistry, aptacytochemistry, fluorescence microscopy or flow cytometry.
  • in vitro binding assays such as the enzyme-linked oligonucleotide assay (ELONA), the enzyme-linked aptamer sorbent assay (ELASA), precipitation and quantitative PCR (qPCR), gel mobility shift assay, Western Blotting, surface plasmon resonance (SPR), kinetic capillary electrophoresis, the fluorescence binding assay, aptahistochemistry, aptacytochemistry, fluorescence micro
  • the detection of TLR-4 is performed by means of a method selected from the group consisting of ELONA, aptacytochemistry, aptahistochemistry and flow cytometry.
  • ELONA enzyme-linked oligonucleotide assay
  • ELISA enzyme-linked immunosorbent assay
  • the ELISA assay is based on the use of antigens or antibody labeled, for example, with enzymes, such that the complexes formed between the target antigen and the labeled antibody are enzymatically active complexes.
  • the antigen:antibody complexes are immobilized to the carrier and can therefore be detected by means of the addition of a substrate specific for the enzyme.
  • the detection aptamer can be covalently bound to an enzyme, or it can be detected by itself by a secondary antibody specific for the aptamer that is conjugated to an enzyme. Said enzyme catalyzes the transformation of a specific substrate to produce a visible signal. This technique can be modified to exchange the enzyme for another detectable reagent, such as a fluorophore.
  • ELONA and ELASA, or enzyme-linked aptamer sorbent assay are used interchangeably herein.
  • the detection of TLR-4 is performed by means of ELONA.
  • the terms "aptacytochemistry” and "aptahistochemistry”, in the context of the present invention refer to techniques analogous to immunocytochemistry and immunohistochemistry for the detection of TLR-4 on cells and histological sections, respectively, wherein the antibody that is used for detecting the molecule of interest, in this case TLR-4, is exchanged for an aptamer specific for said molecule.
  • the detection aptamer can be bound covalently to an enzyme, or it can be detected by itself by a secondary antibody specific for the aptamer that is conjugated to an enzyme. Said enzyme catalyzes the transformation of a specific substrate to produce a visible signal.
  • This technique can be modified to exchange the enzyme for another detectable reagent, such as a fluorophore.
  • the detection of TLR-4 is performed by means of aptacytochemistry.
  • the detection of TLR-4 is performed by means of aptahistochemistry.
  • ELONA aptacytochemistry
  • aptahistochemistry can be adapted for exchanging the detection antibody for a probe specific for the aptamer.
  • flow cytometry in the context of the present invention, refers to a cell analysis technique that involves measuring the fluorescence and light dispersion features that the cells have as they pass through a ray of light. In addition to light dispersion, if prior to analysis the cells are placed in the presence of aptamers labeled with fluorescent molecules, it is possible to evaluate which cells have antigens complementary to the aptamers used. The detection of fluorescence is performed with flow cytofluorimeters (known as “cytometers” or “FACS” (fluorescence-activated cell sorter)). This technique, like the preceding techniques, was initially developed for use with fluorescently labeled antibodies but can be readily adapted for use with the aptamer of the invention.
  • cytometers flow cytofluorimeters
  • a complex comprising a nucleic acid aptamer with the capability of binding specifically to and inhibiting TLR-4 and comprising a sequence selected from the group consisting of SEQ ID NO: 1 and SEQ ID NO: 2 or a functionally equivalent variant thereof and a detectable reagent is particularly advantageous for detecting TLR-4, since said detectable reagent enables the detection of the aptamer comprised in the complex when it is bound to TLR-4.
  • the technique used for detecting TLR-4 will depend on the type of detectable reagent, being able to be techniques based, for example, on fluorimetry, colorimetry or radioactivity.
  • the present invention relates to a complex comprising a nucleic acid aptamer with the capability of binding specifically to and inhibiting TLR-4 and comprising a sequence selected from the group consisting of SEQ ID NO: 1 and SEQ ID NO: 2 or a functionally equivalent variant thereof and a functional group for detecting TLR-4.
  • the functional group is a detectable reagent.
  • the detection of TLR-4 is performed by means of a method selected from the group consisting of ELONA, aptacytochemistry, aptahistochemistry and flow cytometry.
  • a nucleic acid aptamer with the capability of binding specifically to and inhibiting TLR-4 and comprising a sequence selected from the group consisting of SEQ ID NO: 1 and SEQ ID NO: 2 or a functionally equivalent variant thereof can inhibit the activity of TLR-4, reducing the levels of pro-inflammatory cytokines released as a result of the activation thereof.
  • the present invention also contemplates in vitro uses of a nucleic acid aptamer with the capability of binding specifically to and inhibiting TLR-4 and comprising a sequence selected from the group consisting of SEQ ID NO: 1 and SEQ ID NO: 2 or a functionally equivalent variant thereof, and of a complex comprising a nucleic acid aptamer with the capability of binding specifically to and inhibiting TLR-4 and comprising a sequence selected from the group consisting of SEQ ID NO: 1 and SEQ ID NO: 2 or a functionally equivalent variant thereof and a functional group, for inhibiting TLR-4.
  • the present invention relates to an in vitro use of a nucleic acid aptamer with the capability of binding specifically to and inhibiting TLR-4 and comprising a sequence selected from the group consisting of SEQ ID NO: 1 and SEQ ID NO: 2 or a functionally equivalent variant thereof for inhibiting TLR-4.
  • the present invention relates to an in vitro use of a complex comprising a nucleic acid aptamer with the capability of binding specifically to and inhibiting TLR-4 and comprising a sequence selected from the group consisting of SEQ ID NO: 1 and SEQ ID NO: 2 or a functionally equivalent variant thereof and a functional group, for inhibiting TLR-4.
  • the present invention relates to an in vitro method for the detection of TLR-4 in a sample, hereinafter "the first in vitro method for the detection of TLR-4 of the invention" comprising
  • nucleic acid aptamer with the capability of binding specifically to and inhibiting TLR-4 and comprising a sequence selected from the group consisting of SEQ ID NO: 1 and SEQ ID NO: 2 or a functionally equivalent variant thereof,
  • the first in vitro method for detection of the invention comprises contacting said sample with a nucleic acid aptamer with the capability of binding specifically to and inhibiting TLR-4 and comprising a sequence selected from the group consisting of SEQ ID NO: 1 and SEQ ID NO: 2 or a functionally equivalent variant thereof.
  • sample refers to a cell culture or to isolated biological material from a subject.
  • the biological sample can contain any biological material suitable for detecting the desired biomarker and can comprise cells and/or non-cellular material from the subject.
  • the sample can be isolated from any suitable tissue or biological fluid such as, for example, blood, plasma, serum, urine, cerebrospinal fluid (CSF), heart, brain.
  • CSF cerebrospinal fluid
  • the samples used for the detection of TLR-4 are preferably biological fluids.
  • the samples are biofluid samples.
  • biological fluid and
  • biofluid are used interchangeably herein and refer to aqueous fluids of a biological origin.
  • the biofluid can be obtained from anywhere (such as blood, plasma, serum, urine, bile, cerebrospinal fluid, vitreous or aqueous humor, or any bodily secretion), an exudate (such as the fluid obtained from an abscess or any other site of infection or inflammation), or the fluid obtained from a joint (such as a normal joint or a joint affected by a disease such as rheumatoid arthritis).
  • the biofluids used for the detection of TLR-4 are preferably blood, plasma, serum or cerebrospinal fluid samples.
  • the aptamer according to the invention is applied on the sample in a buffer suitable for allowing the binding of the aptamer to the TLR-4 molecules that may be present in the sample.
  • buffers suitable for allowing the binding of the aptamer of the invention and TLR-4 include PBS, TBS, phosphate buffer and citrate buffer.
  • these buffers contain 1 mM MgCI 2 .
  • the amount of aptamer required for detecting the TLR-4 molecules present in the sample will depend on both the size of the sample and on the amount of TLR-4 present therein, and it could be readily determined by optimization methods commonly used in the art.
  • the aptamer concentration is at least 1 fM, at least 10 fM, at least 100 fM, at least 1 pM, at least 10 pM, at least 100 pM, at least 1 nM, at least 10 nM, at least 100 nM, at least 1 ⁇ , at least 10 ⁇ , at least 100 ⁇ or more.
  • the aptamer concentration is between 100 fM and 1 ⁇ , more preferably between 1 pM and 100 nM, even more preferably between 100 pM and 1 nM.
  • the aptamer is incubated with the sample at a suitable temperature and for a time sufficient for allowing the binding of the aptamer to the TLR-4 molecules that may be present in the sample.
  • the temperature is preferably between 20°C and 37°C.
  • the aptamer will be incubated with the sample for at least 5 min, at least 10 min, at least 15 min, at least, 20 min, at least 30 min, at least 60 min, at least 120 min or more.
  • the sample is washed to remove the aptamer molecules that have not bound to TLR-4.
  • a third step the presence of the aptamer bound to the TLR-4 present in the sample is detected.
  • the step of detection is a step of indirect detection through a second detectable molecule which binds specifically to the aptamer.
  • the detection of the aptamer bound to TLR-4 can be carried out with virtually any known antibody or reagent that binds with high affinity to the aptamer of the invention. Nevertheless, the use of an antibody specific for the aptamer, for example, polyclonal serum, hybridoma supernatant, monoclonal or humanized antibodies and fragments thereof, is preferred.
  • Said antibody specific for the aptamer is suitably labeled with a detectable reagent.
  • detectable reagent has been described in detail above and its definition and particularities are herein included by reference.
  • Said reagent can be detected by means of fluorimetry or colorimetry using apparatuses suitable for the type of reagents and the type of sample, which are known by the person skilled in the art.
  • the sample with the aptamer bound to the TLR-4 molecules present is incubated with an antibody specific for the aptamer that is conjugated with an enzyme, in conditions similar to the conditions of incubation with the aptamer, and the TLR-4- aptamer-antibody complexes are detected with the addition of a substrate that is converted by the enzyme into a detectable product, for example, by means of fluorimetry in a fluorescence microscope or by colorimetry in a spectrophotometer.
  • detection can be done in an analogous manner by means of the use of a probe specific for the aptamer suitably labeled with a detectable reagent.
  • the first in vitro method of the invention can be carried out as part of detection techniques such as ELONA, ELASA, precipitation and qPCR, gel mobility shift assay, Western Blotting, surface plasmon resonance, kinetic capillary electrophoresis, fluorescence binding assay, aptahistochemistry, aptacytochemistry, fluorescence microscopy or flow cytometry.
  • detection techniques such as ELONA, ELASA, precipitation and qPCR, gel mobility shift assay, Western Blotting, surface plasmon resonance, kinetic capillary electrophoresis, fluorescence binding assay, aptahistochemistry, aptacytochemistry, fluorescence microscopy or flow cytometry.
  • the present invention relates to an in vitro method for the detection of TLR-4 in a sample, hereinafter "the second in vitro method for the detection of TLR-4 of the invention", comprising
  • the third step of the second in vitro method for detection of the invention comprises detecting the presence of the complex of the invention bound to the TLR-4 present in the sample.
  • the detection of the complex according to the invention can be carried out with virtually any known antibody or reagent that binds with high affinity to the aptamer of the invention or to the functional group.
  • the detection of the aptamer of the invention has been described in detail in the context of the first in vitro method for detection of the invention.
  • the detection can also be carried out with virtually any known antibody or reagent that binds with high affinity to said functional group. For this reason, it is particularly appropriate for the second in vitro method for detection of the invention that the functional group is a detectable reagent.
  • the functional group is a detectable reagent selected from the group formed by radionuclides, fluorophores, proteins and haptenes.
  • the detectable reagents contemplated by the present invention can be divided between the reagents which are directly detectable by themselves, such as radionuclides or fluorophores, and the reagents which are indirectly detectable, such as proteins or haptenes.
  • the detectable reagent is a radionuclide and the detection is performed by detection of the radiation emitted by the radionuclide.
  • Said radiation will depend on the type of radionuclide, being able to be an a particle emission, ⁇ particle emission or ⁇ type emission.
  • detection techniques suitable for different radionuclides are well-known.
  • the emission emitted by 123 l can be detected by a gamma camera.
  • the detectable reagent is a fluorophore and the detection is performed by detection of the fluorescence emitted by the fluorophore.
  • the use of a fluorophore requires the prior excitation thereof with a wavelength within its excitation spectrum, which causes emission at a different wavelength.
  • the excitation and emission wavelengths of the fluorophores contemplated in the present invention are part of the state of the art.
  • the fluorescence emitted can be detected, for example, through fluorimetry techniques by using a fluorescence spectrophotometer or a fluorescence microscope.
  • the detectable reagent is a protein.
  • Said protein could be detected depending on the type of protein used. For example:
  • an enzyme requires the addition of its specific substrate which will be detectable by colorimetry, chemiluminescence or fluorimetry;
  • a fluorescent protein like a fluorophore, requires excitation at a wavelength suitable for being detectable by fluorimetry (for example, the wavelengths included in Table 1 );
  • an antigen or an haptene requires an antibody or another molecule that specifically recognizes it.
  • said antibody or molecule specific for the antigen/haptene must be labeled, for example, with an enzyme, and the detection will depend on the type of labeling.
  • the second in vitro method of the invention can be carried out as part of detection techniques such as ELONA, ELASA, precipitation and qPCR, gel mobility shift assay, Western Blotting, surface plasmon resonance, kinetic capillary electrophoresis, fluorescence binding assay, aptahistochemistry, aptacytochemistry, fluorescence microscopy or flow cytometry.
  • detection techniques such as ELONA, ELASA, precipitation and qPCR, gel mobility shift assay, Western Blotting, surface plasmon resonance, kinetic capillary electrophoresis, fluorescence binding assay, aptahistochemistry, aptacytochemistry, fluorescence microscopy or flow cytometry.
  • the detection of TLR-4 is performed by means of fluorescence.
  • the present invention relates to an in vitro method for inhibiting TLR-4 in a sample, hereinafter "the first in vitro method for the inhibition of TLR-4 of the invention", which comprises contacting a sample comprising TLR-4 with a nucleic acid aptamer with the capability of binding specifically to and inhibiting TLR-4 and comprising a sequence selected from the group consisting of SEQ ID NO: 1 and SEQ ID NO: 2 or a functionally equivalent variant thereof, in conditions suitable for inhibiting TLR-4.
  • the terms "aptamer”, “TLR-4", “functionally equivalent variant”, “inhibition of TLR-4" and “sample” have been described in detail above and their definitions and particularities are herein included by reference.
  • the TLR-4 of the sample is comprised in living cells.
  • the first in vitro method for the inhibition of TLR-4 of the invention comprises contacting a sample comprising TLR-4 with an aptamer according to the invention in conditions suitable for inhibiting TLR-4. To that end, the aptamer of the invention is applied on the sample and it must bind to TLR-4.
  • condition suitable for inhibiting TLR-4 refers to the incubation conditions that allow the binding of the aptamer of invention to TLR-4 and the subsequent inhibition thereof. These conditions include the composition of the buffer in which the aptamer of the invention is applied on the sample, the amount of aptamer, the incubation time and the incubation temperature.
  • buffers suitable for allowing the binding of the aptamer of the invention to TLR-4 and the inhibition thereof include PBS, TBS, phosphate buffer and citrate buffer.
  • these buffers contain 1 mM MgCI 2 .
  • the amount of aptamer required for detecting the TLR-4 molecules present in the sample will depend both on the size of the sample and on the amount of TLR-4 present therein, and it could be readily determined by optimization methods commonly used in the art.
  • the aptamer concentration is at least 1 fM, at least 10 fM, at least 100 fM, at least 1 pM, at least 10 pM, at least 100 pM, at least 1 nM, at least 10 nM, at least 100 nM, at least 1 ⁇ , at least 10 ⁇ , at least 100 ⁇ or more.
  • the aptamer concentration is between 100 fM and 1 ⁇ , more preferably between 1 pM and 100 nM, even more preferably between 100 pM and 1 nM.
  • the aptamer is incubated with the sample at a suitable temperature and for a time sufficient for allowing the binding of the aptamer to the TLR-4 molecules that may be present in the sample.
  • the temperature is preferably between 20°C and 37°C, more preferably 37°C.
  • the aptamer will be incubated with the sample for at least 5 min, at least 10 min, at least 15 min, at least 20 min, at least 30 min, at least 60 min, at least 120 min or more.
  • the present invention relates to an in vitro method for inhibiting TLR-4 in a sample, hereinafter "the second in vitro method for the inhibition of TLR-4 of the invention", which comprises contacting a sample comprising TLR-4 with a complex comprising a nucleic acid aptamer with the capability of binding specifically to and inhibiting TLR-4 and comprising a sequence selected from the group consisting of SEQ ID NO: 1 and SEQ ID NO: 2 or a functionally equivalent variant thereof and a functional group in conditions suitable for inhibiting TLR-4.
  • the aptamer of the invention is able to block or inhibit the volume of infarction produced in a model of stroke induced in animals used in experiments, as described in Example 4. Therefore, the capability of the aptamer of the invention of binding specifically to and inhibiting TLR-4 renders it useful from a therapeutic viewpoint. It is apparent that the therapeutic effect obtained with the aptamer of the invention can be complemented with a functional group with therapeutic activity, as described in the context of the complex of the invention. Accordingly, the present invention contemplates the medical uses of the aptamer of the invention and of the complex of the invention. A. Medical uses of the aptamer of the invention
  • the present invention relates to a nucleic acid aptamer with the capability of binding specifically to and inhibiting TLR-4 and comprising a sequence selected from the group consisting of SEQ ID NO: 1 and SEQ ID NO: 2 or a functionally equivalent variant thereof for use in medicine.
  • the present invention relates to a nucleic acid aptamer with the capability of binding specifically to and inhibiting TLR-4 and comprising a sequence selected from the group consisting of SEQ ID NO: 1 and SEQ ID NO: 2 or a functionally equivalent variant thereof for use in manufacturing a drug for the treatment of a pathology characterized by an increase in expression of TLR-4 and/or an increase in activation of TLR-4.
  • nucleic acid aptamer with the capability of binding specifically to and inhibiting TLR-4 and comprising a sequence selected from the group consisting of SEQ ID NO: 1 and SEQ ID NO: 2 or a functionally equivalent variant thereof for use in the treatment of a pathology characterized by an increase in expression of TLR-4 and/or an increase in activation of TLR-4.
  • it can be expressed as an in vivo method for the treatment of a pathology characterized by an increase in expression of TLR-4 and/or an increase in activation of TLR-4 in a subject, comprising the administration to said subject of a therapeutically effective amount of a nucleic acid aptamer with the capability of binding specifically to and inhibiting TLR-4 and comprising a sequence selected from the group consisting of SEQ ID NO: 1 and SEQ ID NO: 2 or a functionally equivalent variant thereof to said subject.
  • a nucleic acid aptamer with the capability of binding specifically to and inhibiting TLR-4 and comprising a sequence selected from the group consisting of SEQ ID NO: 1 and SEQ ID NO: 2 or a functionally equivalent variant thereof binds specifically to TLR-4 on the surface of a target cell.
  • the aptamer of the invention When the aptamer of the invention is contacted with TLR-4, it inhibits its activity, resulting in a reduction or interruption in the release of pro-inflammatory cytokines such as IL-1 , IL-8, TNF-alpha and lL-12.
  • treatment refers to the clinical intervention in an attempt to prevent, cure, delay, reduce the seriousness of, or improve one or more symptoms of the pathology characterized by an increase in expression of TLR-4 and/or an increase in activation of TLR-4, or for the purpose of prolonging survival of a patient beyond what is expected in the absence of such treatment.
  • target cell refers to the particular cell that expresses TLR-4, including, inter alia, myeloid lineage cells such as monocytes, macrophages, microglia cells, granulocytes and immature dendritic cells, as well as cells of other lineages such as neurons, etc.
  • the target cell is a monocyte or a macrophage.
  • the target cell is a microglia cell.
  • the target cell is a granulocyte.
  • the target cell is an immature dendritic cell.
  • the target cell is a neuron.
  • the target cell is a mammal cell.
  • the mammal cell is a human cell.
  • subject refers to a member of a mammal species, and includes, but is not limited to, domestic animals and primates, including humans; the subject is preferably a male or female human of any age or race.
  • a therapeutically effective amount in the context of the present invention, refers to the amount of the aptamer of the invention required for achieving a prevention, cure, delay, reduction of the seriousness of, or improvement of one or more observable symptoms of the pathology characterized by an increase in expression of TLR-4 and/or an increase in activation of TLR-4.
  • pathology characterized by an increase in expression of TLR-4 and/or an increase in activation of TLR-4 refers to a pathology in which the cells that express TLR-4 show an increase in expression of TLR-4 and/or an increase in activation of TLR-4, and/or a pathology in which there is an increase in the amount of cells that express TLR-4, with respect to normal or reference physiological conditions or reference values, and in which said cells are directly or indirectly involved regardless of whether or not TLR-4 is responsible for the disease.
  • the pathology characterized by an increase in expression of TLR-4 and/or an increase in activation of TLR-4 can furthermore be characterized by having an inflammatory component.
  • said pathology characterized by an increase in expression of TLR-4 and/or an increase in activation of TLR-4 is selected from the group consisting of, inter alia, stroke, acute myocardial infarction, sepsis, atherosclerosis, multiple sclerosis, rheumatoid arthritis, a retinal degenerative disease, and drug addiction.
  • said pathology characterized by an increase in expression of TLR-4 and/or an increase in activation of TLR-4 is a stroke.
  • stroke or "cerebrovascular disease” or “cerebral infarction” or “apoplexy”, in the context of the present invention, refers to a pathology characterized by a neurological deficit caused by an important decrease in cerebral blood flow, in an abnormally abrupt manner (ischemic stroke), or due to hemorrhaging caused by the rupture of a vessel of the brain (hemorrhagic stroke).
  • ischemic stroke blood irrigation is lost due to the sudden and immediate interruption of blood flow due to occlusion of any of the arteries irrigating the brain mass, which generates the appearance of an infarcted area.
  • Artery occlusion is generally due to atherosclerosis or an embolus (cerebral embolism) that comes from another location, fundamentally the heart or other arteries.
  • embolus Cerebral embolism
  • the rupture of a blood vessel in the brain occurs, depriving the area of the brain that depends on that artery of blood.
  • blood that flows out compresses brain structures, including other blood vessels, which increases the affected area by ischemia secondary to the intracerebral hemorrhage.
  • said pathology characterized by an increase in expression of TLR-4 and/or an increase in activation of TLR-4 is acute myocardial infarction.
  • acute myocardial infarction or “infarction” or “heart attack”, in the context of the present invention, refers to a pathology characterized by insufficient blood supply, with tissue damage, in an area of the heart, caused by an obstruction in one of the coronary arteries. Ischemia or deficient oxygen supply resulting from such obstruction causes angina pectoris, which if recannulated soon enough, does not cause death of heart tissue, whereas if this anoxia is maintained, the myocardium becomes injured and necrosis, i.e., infarction, ultimately occurs.
  • said pathology characterized by an increase in expression of TLR-4 and/or an increase in activation of TLR-4 is sepsis.
  • said pathology characterized by an increase in expression of TLR-4 and/or an increase in activation of TLR-4 is atherosclerosis.
  • the term "atherosclerosis”, in the context of the present invention, refers to a syndrome or pathology characterized by the deposition and infiltration of lipid substances in the walls of medium- and thick-sized arteries.
  • the cells of the arterial wall interpret this deposition as an invasion and activate circulating monocytes of the immune system, which penetrate the arterial wall, are converted into macrophages and start to phagocyte LDL particles, generating an inflammatory process. Inflammation in turn causes the multiplication and migration of the smooth muscle cells of the wall, which gradually cause narrowing of the arterial diameter.
  • the specific thickening is referred to as an atheromatous plaque. It is the most common form of arteriosclerosis.
  • the diseases forming atherosclerosis syndrome and characterized by involvement of the arteries through atheromatous plaques, and accordingly obstruction of blood flow or ischemia, depending on the artery of the organ involved, are:
  • Ischemic heart disease the maximum representative thereof being acute myocardial infarction, in the heart.
  • Cerebrovascular disease in the form of stroke or cerebral thrombosis or cerebral hemorrhage, in the central nervous system. Intermittent claudication, the maximum seriousness thereof being acute arterial ischemia of the lower limbs.
  • Erectile dysfunction this is the principal cause of impotency in people over 40 years of age.
  • Ischemic colitis which is an area of inflammation (irritation and swelling) caused by interference with the blood flow to the colon (large intestine), in the arteries of the intestines.
  • said pathology characterized by an increase in expression of TLR-4 and/or an increase in activation of TLR-4 is multiple sclerosis.
  • multiple sclerosis in the context of the present invention, refers to a pathology characterized by the onset of demyelinating, neurodegenerative and chronic lesions of the central nervous system. Its causes are currently unknown, although the involvement of various autoimmune mechanisms has been demonstrated. In multiple sclerosis patients, lymphocytes cross the blood-brain barrier to affect the myelin, while an inflammatory process aided by macrophages and neuroglia cells occurs.
  • said pathology characterized by an increase in expression of TLR-4 and/or an increase in activation of TLR-4 is rheumatoid arthritis.
  • rheumatoid arthritis in the context of the present invention, refers to a systemic autoimmune inflammatory pathology, characterized by causing persistent synovitis of the joints, causing their progressive destruction, generating different degrees of deformity and functional disability. The process starts with the intervention of humoral and cell factors, particularly CD4 T-cells, which generate inflammation mediating molecules, attract and activate peripheral blood cells, causing proliferation and activation of the synoviocytes, invading and destroying joint cartilage, subchondral bone, tendons and ligaments.
  • said pathology characterized by an increase in expression of TLR-4 and/or an increase in activation of TLR-4 is a retinal degenerative disease.
  • retinal degenerative disease in the context of the present invention, refers to a disease or disorder characterized by a degeneration of the retina, which may be the result of retinal inflammation. TLR-4-mediated microglial activation has been shown to make a contribution to the process of retinal inflammation.
  • Major retinal degenerative diseases include:
  • ASD Age-related macular degeneration
  • dry and wet forms in the dry (nonexudative) form, cellular debris called drusen accumulates between the retina and the choroid, causing atrophy and scarring to the retina; in the wet (exudative) form, which is more severe, blood vessels grow up from the choroid behind the retina which can leak exudate and fluid and also cause hemorrhaging.
  • - Stargardt disease or fundus flavimaculatus
  • fundus flavimaculatus is an inherited form of juvenile macular degeneration that causes progressive vision loss usually to the point of legal blindness.
  • the onset of symptoms usually appears between the ages of 6 and 13 years old (average of about 16-18 years).
  • Symptoms typically develop by 20 years of age, and include wavy vision, blind spots, blurriness, impaired color vision, and difficulty adapting to dim lighting.
  • Retinitis pigmentosa which is an inherited, degenerative eye disease that causes severe vision impairment due to the progressive degeneration of the rod photoreceptor cells in the retina.
  • Patients in the early stages of RP first notice compromised peripheral and dim light vision due to the decline of the rod photoreceptors.
  • the progressive rod degeneration is later followed by abnormalities in the adjacent retinal pigment epithelium and the deterioration of cone photoreceptor cells.
  • peripheral vision becomes increasingly compromised patients experience progressive "tunnel vision" and eventual blindness.
  • the retinal degenerative disease is selected from the group consisting of AMD, Stargardt disease, RP, choroideremia, Leber congenital amaurosis, retinoschisis juvenile, Usher disease, and Bardet Biedl.
  • the retinal degenerative disease is AMD.
  • the retinal degenerative disease is Stargardt disease.
  • the retinal degenerative disease is RP.
  • the retinal degenerative disease is choroideremia.
  • the retinal degenerative disease is Leber congenital amaurosis.
  • the retinal degenerative disease is Usher disease.
  • the retinal degenerative disease is Bardet Biedl.
  • said pathology characterized by an increase in expression of TLR-4 and/or an increase in activation of TLR-4 is a drug addiction.
  • drug addiction or “drug dependence”, in the context of the present invention, refers to a disorder or pathology caused by the frequent use of addictive substances called drugs. According to ICD-10 (World Health Organization, 2005), in order to be diagnosed as such, the drug dependence must present three or more of the following criteria, which refer both to aspects related to physical dependence and to psychological dependence, in a 12-month period:
  • a nucleic acid aptamer for the administration to a subject of a nucleic acid aptamer with the capability of binding specifically to and inhibiting TLR-4 and comprising a sequence selected from the group consisting of SEQ ID NO: 1 and SEQ ID NO: 2 or a functionally equivalent variant thereof, said aptamer will be formulated in a suitable pharmaceutical composition.
  • a suitable pharmaceutical composition for the administration to a subject of a nucleic acid aptamer with the capability of binding specifically to and inhibiting TLR-4 and comprising a sequence selected from the group consisting of SEQ ID NO: 1 and SEQ ID NO: 2 or a functionally equivalent variant thereof.
  • the complexes according to the present invention comprising a nucleic acid aptamer with the capability of binding specifically to and inhibiting TLR-4 and comprising a sequence selected from the group consisting of SEQ ID NO: 1 and SEQ ID NO: 2 or a functionally equivalent variant thereof and a functional group according to the invention can comprise, as a functional group, a drug suitable for the treatment of a pathology characterized by an increase in expression of TLR-4 and/or an increase in activation of TLR-4.
  • the dual objective of (i) inhibiting the activity of TLR-4 and (ii) directing the drug in a specific manner to its site of action, is therefore achieved.
  • the present invention refers to a complex comprising a nucleic acid aptamer with the capability of binding specifically to and inhibiting TLR-4 and comprising a sequence selected from the group consisting of SEQ ID NO: 1 and SEQ ID NO: 2 or a functionally equivalent variant thereof and a functional group for use in medicine.
  • the present invention relates to a complex comprising a nucleic acid aptamer with the capability of binding specifically to and inhibiting TLR-4 and comprising a sequence selected from the group consisting of SEQ ID NO: 1 and SEQ ID NO: 2 or a functionally equivalent variant thereof and a functional group for use in manufacturing a drug for the treatment of a pathology characterized by an increase in expression of TLR-4 and/or an increase in activation of TLR-4.
  • a complex comprising a nucleic acid aptamer with the capability of binding specifically to and inhibiting TLR-4 and comprising a sequence selected from the group consisting of SEQ ID NO: 1 and SEQ ID NO: 2 or a functionally equivalent variant thereof and a functional group for use in the treatment of a pathology characterized by an increase in expression of TLR-4 and/or an increase in activation of TLR-4.
  • TLR-4 can be expressed as method of treatment of a pathology characterized by an increase in expression of TLR-4 and/or an increase in activation of TLR-4 in a subject, comprising the administration to said subject of a therapeutically effective amount of a complex comprising a nucleic acid aptamer with the capability of binding specifically to and inhibiting TLR-4 and comprising a sequence selected from the group consisting of SEQ ID NO: 1 and SEQ ID NO: 2 or a functionally equivalent variant thereof and a functional group to said subject.
  • a complex comprising a nucleic acid aptamer with the capability of binding specifically to and inhibiting TLR-4 and comprising a sequence selected from the group consisting of SEQ ID NO: 1 and SEQ ID NO: 2 or a functionally equivalent variant thereof and a drug binds specifically to TLR-4 in the surface of a target cell.
  • the aptamer of the invention When the aptamer of the invention is contacted with TLR-4, it inhibits its activity, resulting in a reduction or interruption in the release of proinflammatory cytokines such as IL-1 , IL-8, TNF-alpha and IL-12, and the drug exerts its function on the cell or on the environment where said cell is located.
  • Suitable drugs that can be used as functional groups in the complexes formed with a nucleic acid aptamer with the capability of binding specifically to and inhibiting TLR-4 include, without limitation, antagonists of TLR-4, such as naloxone, naltrexone, LPS, ibudilast, propentofylline, amitriptyline, ketotifen, cyclobenzaprine, mianserin and imipramine; anti-platelet drugs, such as aspirin and clopidogrel; anti-coagulants, such as heparin, acenocumarol, warfarin, dabigatran and rivaroxaban; and antioxidants, such as edaravone; the tissue plasminogen activator and the recombinant variants thereof; nucleic acids which have the capability of silencing the expression of genes involved in a pathology characterized by an increase in expression of TLR-4 and/or an increase in activation of TLR-4, such as antisense RNA, antis
  • nucleic acid aptamer with the capability of binding specifically to and inhibiting TLR-4 and comprising a sequence selected from the group consisting of SEQ ID NO: 1 and SEQ ID NO: 2 or a functionally equivalent variant thereof, or a complex comprising a nucleic acid aptamer with the capability of binding specifically to and inhibiting TLR-4 and comprising a sequence selected from the group consisting of SEQ ID NO: 1 and SEQ ID NO: 2 or a functionally equivalent variant thereof and a functional group
  • said aptamers and complexes can be formulated in suitable pharmaceutical compositions.
  • the present invention relates to a pharmaceutical composition, hereinafter "the first pharmaceutical composition of the invention", comprising at least one nucleic acid aptamer with the capability of binding specifically to and inhibiting TLR-4 and comprising a sequence selected from the group consisting of SEQ ID NO: 1 and SEQ ID NO: 2 or a functionally equivalent variant thereof.
  • the first pharmaceutical composition of the invention further comprises one or more pharmaceutically acceptable carriers, excipients, or solvents.
  • the present invention relates to a pharmaceutical composition, hereinafter "the second pharmaceutical composition of the invention", comprising at least one complex comprising a nucleic acid aptamer with the capability of binding specifically to and inhibiting TLR-4 and comprising a sequence selected from the group consisting of SEQ ID NO: 1 and SEQ ID NO: 2 or a functionally equivalent variant thereof and a functional group.
  • the second pharmaceutical composition of the invention further comprises one or more pharmaceutically acceptable carriers, excipients, or solvents.
  • the pharmaceutical compositions provided by the present invention can be administered to a subject for the treatment of a pathology characterized by an increase in expression of TLR-4 and/or an increase in activation of TLR-4.
  • pharmaceutically acceptable carrier or “pharmaceutically acceptable excipient” or “pharmaceutically acceptable solvent”, in the context of the present invention, seeks to include any and all of the solvents, dispersion media, coatings, antibacterial and antifungal agents, absorption delaying and isotonic agents, and the like, compatible with the pharmaceutical administration.
  • pharmaceutically acceptable carrier or “pharmaceutically acceptable excipient” or “pharmaceutically acceptable solvent”
  • pharmaceutically acceptable solvent seeks to include any and all of the solvents, dispersion media, coatings, antibacterial and antifungal agents, absorption delaying and isotonic agents, and the like, compatible with the pharmaceutical administration.
  • the use of such carriers and vehicles in pharmaceutically active substances is well-known in the art. Unless any conventional carrier is incompatible with the active compound, use thereof in the compositions of the invention is contemplated.
  • the acceptable vehicles, excipients, or acceptable stabilizers are not toxic for the subject at the doses and concentrations used, and include buffers such as phosphate, citrate, and other organic acids; antioxidants including ascorbic acid and methionine; preservatives (such as octadecyldimethylbenzyl ammonium chloride, hexamethonium chloride, benzalkonium chloride, benzethonium chloride; phenol, butyl or benzyl alcohol; alkyl parabens such as methyl or propyl paraben; catechol; resorcinol; cyclohexanol; 3-pentanol, and m- cresol); low molecular weight polypeptides (less than about 10 amino acids); proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, histidine,
  • Supplementary active compounds can also be incorporated in the pharmaceutical composition provided by the present invention. Therefore, in a particular embodiment, the pharmaceutical composition provided by the present invention can also contain more than one active compound as required for the particular indication in question, preferably those with complementary activities that do not adversely affect one another. For example, it may desirable to furthermore provide a chemotherapeutic agent, a cytokine, an analgesic agent, an anti-inflammatory agent or an immunosuppressive agent.
  • the effective amount of said other active agents depends, among other things, on the therapeutic amount of the aptamers or of the complexes which are present in the pharmaceutical composition, the nature and the seriousness of the pathology to be treated, the subject, etc.
  • the nucleic acid aptamer with the capability of binding specifically to and inhibiting TLR-4 and comprising a sequence selected from the group consisting of SEQ ID NO: 1 and SEQ ID NO: 2 or a functionally equivalent variant thereof, or the complex of the invention are formulated with vehicles that will protect said products from rapid elimination from the body, such as a controlled release formulation, including implants and microencapsulated delivery system.
  • vehicles that will protect said products from rapid elimination from the body, such as a controlled release formulation, including implants and microencapsulated delivery system.
  • Biodegradable and biocompatible polymers such as ethylene-vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid can be used. The methods for the preparation of such formulations will be evident for persons skilled in the art. These can be prepared according to methods known by persons skilled in the art, for example, as described in US patent 4,522,81 1.
  • compositions provided by the present invention can be administered to a subject by means of any suitable administration route, such as, for example, by parenteral route.
  • parenteral in the context of the present invention, includes the intravenous, intraperitoneal, intramuscular, or subcutaneous administration.
  • the intravenous form of parenteral administration is generally preferred.
  • compositions provided by the present invention can be suitably administered by pulse infusion, for example, with decreasing does of the aptamer or of the complex of the invention.
  • the dosage is provided by means of injections, more preferably intravenous or subcutaneous injections, depending in part on whether the administration is brief or chronic.
  • the pharmaceutical compositions provided by the present invention can be adapted for parenteral administration with the addition of sterile solutions, suspensions or lyophilized products in the suitable dosage form.
  • the pharmaceutical compositions suitable for injectable use include sterile aqueous solutions or dispersions or sterile powders for the preparation of sterile injectable solutions or dispersions.
  • suitable vehicles include physiological saline solution, bacteriostatic water CremophorEM (BASF, Parsippany, NJ) or phosphate buffer saline (PBS).
  • the composition must be sterile and fluid to facilitate injectability. It must be stable in the manufacturing and storage conditions and must be preserved against the contaminating action of microorganisms such as bacteria and fungi.
  • the vehicle can be a solvent or dispersion medium which contains, for example, water, ethanol, a pharmaceutically acceptable polyol such as glycerol, propylene glycol, liquid polyethylene glycol, and suitable mixtures thereof.
  • Suitable fluidity can be maintained, for example, by means of the use of a coating such as lecithine, by means of maintaining the particle size required in the case of dispersion and by the use of surfactants.
  • the prevention of the action of microorganisms can be achieved by means of various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like.
  • compositions for example, sugars, polyalcohols such as mannitol, sorbitol, and sodium chloride.
  • the prolonged absorption of the injectable compositions can be provoked, including in the composition an absorption-delaying agent, for example, aluminum monostearate and/or gelatin.
  • the injectable sterile solutions can be prepared by incorporating the required amount of the active compound (for example, an aptamer or complex of the invention) in a suitable solvent with one or a combination of the previously listed ingredients, as required, followed by filtration sterilization.
  • the dispersions are prepared by incorporating the active compound in a sterile vehicle which contains a basic dispersion medium and the other required ingredients from those previously listed.
  • the preferred methods of preparation are vacuum-drying and freeze-drying, which produces a powder of the active ingredient plus any additional desired ingredient from previously filtered sterile solution thereof.
  • said pharmaceutical composition is administered through intravenous route.
  • Suitable excipients such as bulking agents, buffering agents or surfactants, can be used.
  • the mentioned formulations will be prepared using standard methods such as those described or contemplated in the Spanish and United States pharmacopoeias and similar reference texts.
  • Dosage unit form refers to physically discrete units suitable as unit dosages for the subject to be treated, each unit containing a predetermined amount of active compound (an aptamer or complex of the invention) calculated to produce the desired therapeutic effect in association with the required pharmaceutical vehicle.
  • active compound an aptamer or complex of the invention
  • the active compounds will typically be administered one or more times a day, for example 1 , 2, 3 or 4 times a day, with typical total daily doses in the interval of 0.0001 to 1 .000 mg/kg of body weight/day, preferably from about 0.001 to about 100 mg/kg of body weight/day, more preferably from about 0.01 to 10 mg/kg of body weight/day.
  • the pharmaceutical compositions can be formulated for the purpose of containing the desired amount, such as a therapeutically effective amount of the aptamer or complex of the invention.
  • compositions provided by the present invention can be included in a container, packaging, or dispenser together with instructions for administration.
  • the invention relates to the use of a complex according to the invention for in vivo imaging of a cell, tissue or organ which express TLR4, wherein said complex comprises one or more aptamers according to the invention and a functional group, said functional group being a detectable moiety.
  • Suitable detectable moieties for use in the in vivo imaging methods according to the invention have been described above in the context of the complex of the invention and include, without limitation, a radionuclide, a fluorophore, a contrast media, a protein and an haptene.
  • the inventors used the RND40 aptamer library to carry out the screening of aptamers specific for TLR-4, supplied by IBA GmbH (Goettingen, Germany).
  • the initial RND40 library is theoretically made up of 10 24 single-stranded DNA (ssDNA) oligonucleotides with fixed sequence at the ends, consisting of 18 nucleotides where each hybridize the respective primers for PCR amplification thereof, and a central region consisting of 40 bases having random sequence.
  • ssDNA single-stranded DNA
  • HEK293T and HEK293T/TLR-4 cells were obtained from Invivogen (San Diego,
  • the culture medium with the non-bound aptamers was removed, the cells were washed twice with PBS and recovered in 500 ⁇ of PBS by means of centrifugation at 1500 rpm. The cells were centrifuged to remove the supernatant and the aptamers adhered to the cells were amplified by PCR to prepare a sufficient amount for the following screening round.
  • the counter-screening on HEK-293T cells from the RND40 aptamer library was done during the prior preparation of the initial RND40 population and every 3 screening rounds, with the population isolated from the preceding screening round. To that end, 8-10 x 10 5 HEK-293T cells were seeded in triplicate in P6 plate wells, 24 h before the screening assay and were incubated at 37°C, 5% C0 2 .
  • aptamers of the RND40 library (or of the population isolated in the preceding screening round) in 100 ⁇ PBS, which aptamers were previously denatured at 95°C for 10 min followed by incubation at 4°C for 10 min, was added; 300 ⁇ of DMEM medium (Dulbecco's modified Eagle's medium) supplemented with 10% fetal bovine serum, 100 U/ml penicillin, 100 ⁇ g/ml streptomycin and 25 ⁇ g/ml amphotericin were added and applied on the cells. After 1 h of incubation at 37°C, 5% C0 2 , the culture medium with the non- bound aptamers for being used in screening rounds on TLR-4 was removed.
  • DMEM medium Dulbecco's modified Eagle's medium
  • the RND40 library enriched in a preceding screening round is used.
  • 1 nmol of aptamers was incubated with 7 ⁇ g of 6xHIS-hTLR-4 (at a ratio of 10 aptamer molecules to 1 hTLR-4 molecule), in an aptamer buffer (20 mM Tris-HCI, pH 7.4, 1 mM MgCI 2 , 150 mM NaCI, 5 mM KCI), at 37°C for 1 h with stirring.
  • NTA-Ni resin QIAGEN, Germany
  • the bound sequences were amplified by PCR to prepare a sufficient amount for the following screening round.
  • the counter-screening is performed in the same conditions as screening but in the absence of TLR-4 protein bound to the resin.
  • the selected aptamers were resuspended in a volume of 20 ⁇ of distilled water and amplified by means of PCR using the primers, which will correspond with sequences SEQ ID NO: 5 (GCGGATGAAGACTGGTGT) and SEQ ID NO: 6 (GTTGCTCGTATTTAGGGC) in the conditions of 0.8 ⁇ /primer SEQ ID NO: 5, 0.8 ⁇ /primer SEQ ID NO: 6, 200 mM dNTPs, 2 mM MgCI 2 , 10 U Taq polymerase (Biotools, Spain) in a final volume of 200 ⁇ according to the following amplification program: 2 min at 95°C; 15 cycles of 30 s at 95°C, 30 s at 56°C and 30 s at 72°C; and finally 5 min at 72°C.
  • TLR-4 protein 100 ng/well of 6xHIS-recombinant TLR-4 were added to a 96-well microtiter plate and were incubated at 4°C for 16 h. Subsequently, individual aptamers labeled with digoxigenin in the 5 ' end were diluted at a concentration of 5 ⁇ g/mL and then denatured for 10 min at 95°C and cooled for 10 min on ice. Then, 20 pmol of each of the aptamers in 100 ⁇ (200 nM) of aptamer buffer were added to each well and the plate was incubated for 1 h at 37°C.
  • aptamers were recovered with 150 mM imidazol dissolved in PBS with 1 mM MgCI 2 .
  • the values of aptamer bound to hTLR-4 were determined by means of quantitative PCR (qPCR) using the primers with sequences SEQ ID NO: 5 and SEQ ID NO: 6 in an IQ5 thermal cycler (BioRad).
  • TLRApt#1 R SEQ ID NO: 3
  • TLRApt#2F TLRApt#3R
  • TLRApt#4F SEQ ID NO: 4
  • HEK-Blue hTLR4 cells (Invivogen, ref. hkb-htlr4), expressing human receptor TLR-4, together with the MD2 and CD14 proteins, which are activated by the binding of their agonist, lipopolysaccharide from Escherichia coii K12 (LPS-EK), were used.
  • this cell line contains a SEAP (secreted embryonic alkaline phosphatase) reporter gene, which is controlled by the NF-kB promoter, such that it is expressed in response to this NF-kB signaling route, induced by TLR-4.
  • SEAP secreted embryonic alkaline phosphatase
  • the SEAP enzyme is secreted into the culture medium, and by adding and metabolizing its commercial substrate QUANTI-BlueTM (Invivogen, San Diego, California, USA) it causes a change in color of the medium from red to blue.
  • the control agonist molecule LPS-EK UP lipopolysaccharide from E. coii K12, Ultra Pure
  • LPS-RS UP lipopolysaccharide from R. sphaeroides, Ultra Pure
  • 1 mM MgCI 2 in sterile PBS at concentrations of 0.02 ng/ ⁇ and 2 ng/ ⁇ , respectively.
  • the aptamers are prepared at concentrations of 0.1 , 1 , 10 and 100 ng/ ⁇ in 1 mM CI 2 Mg in sterile PBS, are denatured at 95°C for 10 min and were structured at 4°C for 10 min.
  • HEK Blue-hTLR4 cells were seeded onto 96-well culture plates at 2x10 4 cells/well in 200 ⁇ _ complete medium DMEM supplemented with (1 x) HEK- BlueTM Selection. After 24 h or 48 h incubation, when the cells get 70-80% confluence, the medium is recovered and added 170 ⁇ _ fresh medium. In control wells 30 ⁇ _ SELEX buffer is added.
  • Peritoneal macrophages were seeded in 12-well plates at a density of 1 x10 6 cells/ml. Macrophages were stimulated in the presence of 500 ng/ml LPS and 1 h after the aptamer was added to a final concentration of 20 nM and 200 nM. Nitrites release was measured by the Griess reaction after 24 h. Samples were assayed in duplicate. Animal model of stroke
  • C57BL/10ScCr mice (formerly called C57BL/10ScCr) and C57BL/10ScSn mice were acquired from The Jackson Laboratory (Bar Harbor, Me, USA).
  • the murine strain C57BL/10ScNJ does not express functional TLR4 by deletion of the TLR4 gene, and the C57BL/10ScSn strain does not express any mutation in the TLR4 gene and is used as a control group.
  • 4 TLR4-deficient mice were used per group (C57BL/10ScNJ) and 4 control mice were used per group (C57BL/10ScSn).
  • MCAO median cerebral arterial occlusion
  • CCA common carotid artery
  • MCA median cerebral artery
  • a ventral-cervical incision is made to isolate said artery and occlude it permanently via ligature.
  • an incision is made at 1 cm of the perpendicular line joining the lateral cantus of the left eye and the outer ear canal and the temporal muscle is removed.
  • a drill hole is made to expose the MCA that is occluded by ligature.
  • T2WI T2WI
  • Binding of aptamers to cell surface TLR4 was analyzed by seeding HEK293 or HEK Blue-hTLR4 cells onto 24-well culture plates at 2x10 5 cells/well in 200 ⁇ _ complete medium DMEM supplemented with HEK-BlueTM Selection buffer.
  • cells are treated or not with the TLR-4 activator LPS-EK-UP (0.4 ng/well) for 30 min and then with the Alexa Fluor 488- labelled aptamers (20 nM) in 50 ⁇ _ volume of PBS buffer containing 1 mM MgCI 2 and 1 mg/ml BSA for 30 min at room temperature in the dark. Cells were then washed with 2 mL of the same buffer, suspended in 0.5 mL of the buffer and subjected to flow cytometry analysis.
  • aptamers Three hundred ng of aptamers were folded in SELEX buffer by heating to 95°C and cooling on ice. Refolded aptamer were incubated with 2 U of ⁇ Exonuclease or DNAse I (Fermentas) in a 10 ⁇ _ reaction for 10 min, 30 min, 1 h, 2 h and 4 h at 37°C. Afterward, samples were solved on a 3% agarose gel. Bands were visualized by GelRed (Biotium) and quantified using Image Studio Digits V3.1 software.
  • the inventors used the RND40 aptamer library to carry out the screening of aptamers specific for TLR-4 supplied by IBA GmbH (Goettingen, Germany).
  • the initial RND40 library is made up of oligonucleotides (ssDNA) with fixed sequence at the ends, consisting of 18 nucleotides each, where they hybridize the respective primers for PCR amplification thereof, and a central region consisting of 40 bases having a random sequence.
  • the initial RND40 library of 10 13 aptamers was enriched in aptamers specific for hTLR-4.
  • a "counter-screening" process was performed on the library for the surface or matrix where the target molecule (magnetic resin, cells of the same line as that which expresses the target protein, etc.) is presented.
  • the selected aptamers were identified after 6 screening rounds according to the following strategies:
  • Figure 2 shows the most likely sequences and secondary structures of the selected aptamers TLRApt#1 R (SEQ ID NO: 3) and TLRApt#4F (SEQ ID NO: 4), obtained using mFold software (Zuker M., 2003, Nucleic Acids Res 31 :3406-15).
  • the capability of binding of the aptamers to hTLR-4 was determined by means of incubation of the aptamers with a Ni-NTA resin with bound hTLR-4, recovery and subsequent qPCR amplification of the bound aptamers.
  • the obtained results show that all the selected aptamers are able to bind to the recombinant hTLR-4 protein ( Figure 3A).
  • a lower Ct value indicates a larger amount of aptamer bound to hTLR-4.
  • Dose-response curves were made for the purpose of determining the concentration of each aptamer at which the maximum antagonist effect is obtained using as agonist LPS-EK-UP ( Figure 4A) or lysates from HEK293 cells (Damage- associated molecular pattern; DAMP) ( Figure 4B). Based on the results obtained, it can be concluded that the concentrations at which the best effect is observed are20 nM for agonist LPS-EK-UP and 200 nM for DAMPs.
  • TLRApt#4F SEQ ID NO: 4
  • TLRApt#4F-T SEQ ID NO: 2
  • TLRApt#4F-T SEQ ID NO: 2
  • EXAMPLE 3 Optimization of the aptamer antagonists of TLR-4 for increasing its activity and stability in animal models
  • the aptamers that showed the capability of inhibiting receptor TLR-4 have been modified by means of removing specific regions from the sequence thereof for the purpose of increasing the stability and/or resistance with respect to nucleases.
  • a study of the secondary structure of the different aptamers was conducted using the mFold program (Zuker M., 2003, mentioned at supra) and the capability of the aptamers of forming G-quadruplex structures has been analyzed by means of the QGRS Mapper program (Kikin et al., 2006, Nucleic Acids Res 34:W676-W682).
  • aptamers TLRApt#1 R-T SEQ ID NO: 1
  • TLRApt#4F-T SEQ ID NO: 2
  • EXAMPLE 4 Effect of the aptamer antagonists of TLR-4 in an animal model of stroke
  • mice normal male TLR-4-deficient mice (C57BL/10ScNJ) and control mice expressing TLR-4 (C57BL/10ScSn) were used, in which focal cerebral ischemia was induced by means of median cerebral arterial occlusion (MCAO).
  • MCAO median cerebral arterial occlusion
  • mice normally expressing TLR4 demonstrate that the aptamers cause a reduction in size of the infarcted area which, in the case of aptamer TLRApt#4F-T (SEQ ID NO: 2), is statistically significant.
  • HEK293 cell line transfected with human TLR4, 293-hTLR4A The parental human HEK293 cell line, lacking human TLR4, was used as a control.
  • aptamers were labeled with Alexa Fluor 488.
  • Figure 9A shows that Alexa Fluor 488-labelled aptamers bind strongly to 293-hTLR4A cells (right panel), but not to HK293 cells lacking human TLR4 (left panel).
  • ApTLR#4F-T SEQ ID NO: 2
  • ApTLR#1 R-T SEQ ID NO: 1
  • aptamer ApTLR#1 R-T (SEQ ID NO: 1 ) is the most sensible and is completely degraded after 5 min incubation in presence of DNAse I.
  • TLRApt#1 R SEQ ID NO: 3
  • TLRApt#4F SEQ ID NO: 4
  • TLRApt#1 R SEQ ID NO: 3
  • TLRApt#4F SEQ ID NO: 4
  • TLRApt#1 R-T (SEQ ID NO: 1 ) and TLRApt#4F-T (SEQ ID NO: 2) have been obtained in truncated form maintaining the antagonist activity of the original aptamers TLRApt#1 R (SEQ ID NO: 3) and TLRApt#4F (SEQ ID NO: 4), respectively.
  • TLRApt#4F-T (SEQ ID NO: 2) is able to reduce the infarcted area in an animal model of stroke.
  • TLRApt#1 R SEQ ID NO: 3
  • y TLRApt#4F SEQ ID NO: 4

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Biomedical Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Molecular Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Medicinal Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Biotechnology (AREA)
  • Zoology (AREA)
  • General Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Epidemiology (AREA)
  • Urology & Nephrology (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Hematology (AREA)
  • Food Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Cell Biology (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Neurosurgery (AREA)
  • Neurology (AREA)
  • Addiction (AREA)
  • Rheumatology (AREA)
PCT/EP2015/064277 2014-06-24 2015-06-24 Aptamers specific for tlr-4 and uses thereof Ceased WO2015197706A1 (en)

Priority Applications (18)

Application Number Priority Date Filing Date Title
BR112016030172-2A BR112016030172B1 (pt) 2014-06-24 2015-06-24 Aptâmeros específicos para tlr-4 e usos dos mesmos
JP2016575345A JP6959738B2 (ja) 2014-06-24 2015-06-24 Tlr−4特異的アプタマーおよびそれらの使用
RU2016152094A RU2709718C9 (ru) 2014-06-24 2015-06-24 Аптамеры, специфические в отношении tlr-4, и их применение
US15/322,021 US10196642B2 (en) 2014-06-24 2015-06-24 Aptamers specific for TLR-4 and uses thereof
PL15732619T PL3161139T3 (pl) 2014-06-24 2015-06-24 Aptamery swoiste wobec tlr-4 oraz ich zastosowania
MX2016016992A MX387405B (es) 2014-06-24 2015-06-24 Aptámeros específicos de tlr-4 y usos de los mismos.
ES15732619T ES2825106T3 (es) 2014-06-24 2015-06-24 Aptámeros específicos para TLR-4 y usos de los mismos
DK15732619.0T DK3161139T3 (da) 2014-06-24 2015-06-24 Tlr-4-specifikke aptamerer og anvendelser heraf
CA2953020A CA2953020C (en) 2014-06-24 2015-06-24 Aptamers specific for tlr-4 and uses thereof
CN201580034070.1A CN106459980B (zh) 2014-06-24 2015-06-24 Tlr-4特异性适配体及其应用
SI201531392T SI3161139T1 (sl) 2014-06-24 2015-06-24 Aptameri, specifični za TLR-4 in njihove uporabe
AU2015279248A AU2015279248B2 (en) 2014-06-24 2015-06-24 Aptamers specific for TLR-4 and uses thereof
EP15732619.0A EP3161139B1 (en) 2014-06-24 2015-06-24 Aptamers specific for tlr-4 and uses thereof
KR1020177001493A KR102454682B1 (ko) 2014-06-24 2015-06-24 Tlr-4에 특이적인 압타머 및 이의 용도
ZA2017/00363A ZA201700363B (en) 2014-06-24 2017-01-17 Aptamers specific for tlr-4 and uses thereof
US16/220,726 US10808252B2 (en) 2014-06-24 2018-12-14 Aptamers specific for TLR-4 and uses thereof
US17/022,984 US11591603B2 (en) 2014-06-24 2020-09-16 Aptamers specific for TLR-4 and uses thereof
US18/156,936 US20230279402A1 (en) 2014-06-24 2023-01-19 Aptamers Specific for TLR-4 and Uses Thereof

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
ES201430955A ES2555160B1 (es) 2014-06-24 2014-06-24 Aptámeros específicos de TLR-4 y usos de los mismos
ESP201430955. 2014-06-24

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US15/322,021 A-371-Of-International US10196642B2 (en) 2014-06-24 2015-06-24 Aptamers specific for TLR-4 and uses thereof
US16/220,726 Continuation US10808252B2 (en) 2014-06-24 2018-12-14 Aptamers specific for TLR-4 and uses thereof

Publications (1)

Publication Number Publication Date
WO2015197706A1 true WO2015197706A1 (en) 2015-12-30

Family

ID=53496661

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2015/064277 Ceased WO2015197706A1 (en) 2014-06-24 2015-06-24 Aptamers specific for tlr-4 and uses thereof

Country Status (18)

Country Link
US (4) US10196642B2 (https=)
EP (1) EP3161139B1 (https=)
JP (2) JP6959738B2 (https=)
KR (1) KR102454682B1 (https=)
CN (2) CN112111495A (https=)
AU (1) AU2015279248B2 (https=)
BR (1) BR112016030172B1 (https=)
CA (1) CA2953020C (https=)
DK (1) DK3161139T3 (https=)
ES (2) ES2555160B1 (https=)
MA (1) MA40283A (https=)
MX (1) MX387405B (https=)
PL (1) PL3161139T3 (https=)
PT (1) PT3161139T (https=)
RU (1) RU2709718C9 (https=)
SI (1) SI3161139T1 (https=)
WO (1) WO2015197706A1 (https=)
ZA (1) ZA201700363B (https=)

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2020069565A1 (en) 2018-10-02 2020-04-09 WearOptimo Pty Ltd Measurement system
WO2020230108A1 (en) * 2019-05-16 2020-11-19 Aptatargets, S.L. Treatment of ischemic stroke with aptamers targeting tlr-4
WO2024146930A1 (en) 2023-01-05 2024-07-11 Aptatargets, S.L. Aptoll molecules for the treatment of ischemic stroke and intracranial hemorrhages
WO2024240750A1 (en) 2023-05-22 2024-11-28 Aptatargets, S.L. New tlr-4 antagonist aptamers
US12484814B2 (en) 2018-10-02 2025-12-02 WearOptimo Pty Ltd Actuator system
US12569679B2 (en) 2018-10-02 2026-03-10 WearOptimo Pty Ltd Treatment delivery system

Families Citing this family (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2015155178A1 (en) * 2014-04-07 2015-10-15 INSERM (Institut National de la Santé et de la Recherche Médicale) New method for producing outer membrane vesicles
ES2555160B1 (es) * 2014-06-24 2016-10-25 Aptus Biotech, S.L. Aptámeros específicos de TLR-4 y usos de los mismos
EP3484441A4 (en) 2016-07-15 2020-03-18 President and Fellows of Harvard College GLYCOLIPID COMPOSITIONS AND METHOD FOR USE
EP3494994A1 (en) * 2017-12-07 2019-06-12 Universität zu Köln Combinations of ripk1- and ikk-inhibitors for the prevention or treatment of immune diseases
MY204234A (en) 2018-08-27 2024-08-16 Regeneron Pharma Use of raman spectroscopy in downstream purification
CN112789031B (zh) 2018-09-28 2023-03-24 胡桃钳医疗公司 用于核酸递送的包含脂化的阳离子肽化合物的脂质纳米颗粒制剂
EP3856904A2 (en) * 2018-09-28 2021-08-04 Augmanity Nano Ltd Methods and compositions for selection of functional aptamers
CN111474336B (zh) * 2020-03-21 2023-07-28 南昌大学 一种铁氰化镍纳米粒化学发光适体传感器的制备方法及基于其检测8-OhdG的方法
WO2021257494A1 (en) * 2020-06-15 2021-12-23 President And Fellows Of Harvard College Methods for modulating tlr4 signaling
CN114152599B (zh) * 2021-12-01 2023-10-13 中国农业大学 一种基于双劈裂功能核酸变构的孔雀石绿生物传感器
CN114836425A (zh) * 2022-02-25 2022-08-02 温州医科大学附属眼视光医院 检测小胶质细胞的核酸适体及应用

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2006138681A2 (en) * 2005-06-17 2006-12-28 University Of Rochester Methods and compositions for enhancing immune memory by blocking intrahepatic activated t cell deletion
WO2008076804A2 (en) * 2006-12-13 2008-06-26 Case Western Reserve University Method of treating intrauterine inflammation
WO2010053975A1 (en) * 2008-11-04 2010-05-14 Idera Pharmaceuticals, Inc. Modulation of toll-like receptor 4 expression by antisense oligonucleotides
WO2010060030A1 (en) * 2008-11-24 2010-05-27 Arizona Board Of Regents, A Body Corporate Of The State Of Arizona Tlr ligand-nucleic acid nanostructure as a novel immune modulatory agent and method of using the same

Family Cites Families (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4522811A (en) 1982-07-08 1985-06-11 Syntex (U.S.A.) Inc. Serial injection of muramyldipeptides and liposomes enhances the anti-infective activity of muramyldipeptides
US5194599A (en) 1988-09-23 1993-03-16 Gilead Sciences, Inc. Hydrogen phosphonodithioate compositions
US5264562A (en) 1989-10-24 1993-11-23 Gilead Sciences, Inc. Oligonucleotide analogs with novel linkages
CA2092002A1 (en) 1990-09-20 1992-03-21 Mark Matteucci Modified internucleoside linkages
US20010046674A1 (en) * 2000-02-03 2001-11-29 Andrew Ellington Signaling aptamers that transduce molecular recognition to a differential signal
US20060257411A1 (en) * 2005-05-06 2006-11-16 Bruce Beutler Compositions and methods for modulating cells via CD14 and toll-like receptor 4 signaling pathway
CN101227922A (zh) * 2005-05-06 2008-07-23 斯克里普斯研究学院 经由CD14和Toll样受体4信号传导途径调节细胞的组合物和方法
FR2892730A1 (fr) * 2005-10-28 2007-05-04 Biomerieux Sa Methode pour detecter la presence ou le risque de developper un cancer
WO2007067733A2 (en) * 2005-12-09 2007-06-14 Massachusetts Institute Of Technology Compositions and methods to monitor rna delivery to cells
CN103562387A (zh) * 2011-03-03 2014-02-05 夸克医药公司 Toll样受体途径的寡核苷酸调剂
CN103492572A (zh) * 2011-03-03 2014-01-01 夸克医药公司 用于治疗肺疾病和损伤的组合物和方法
ES2555160B1 (es) * 2014-06-24 2016-10-25 Aptus Biotech, S.L. Aptámeros específicos de TLR-4 y usos de los mismos

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2006138681A2 (en) * 2005-06-17 2006-12-28 University Of Rochester Methods and compositions for enhancing immune memory by blocking intrahepatic activated t cell deletion
WO2008076804A2 (en) * 2006-12-13 2008-06-26 Case Western Reserve University Method of treating intrauterine inflammation
WO2010053975A1 (en) * 2008-11-04 2010-05-14 Idera Pharmaceuticals, Inc. Modulation of toll-like receptor 4 expression by antisense oligonucleotides
WO2010060030A1 (en) * 2008-11-24 2010-05-27 Arizona Board Of Regents, A Body Corporate Of The State Of Arizona Tlr ligand-nucleic acid nanostructure as a novel immune modulatory agent and method of using the same

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
MONA HEDAYAT ET AL: "Prophylactic and therapeutic implications of toll-like receptor ligands", MEDICINAL RESEARCH REVIEWS, vol. 32, no. 2, 25 October 2010 (2010-10-25), pages 294 - 325, XP055039310, ISSN: 0198-6325, DOI: 10.1002/med.20214 *
X. WITTEBOLE ET AL: "Toll-like Receptor 4 Modulation as a Strategy to Treat Sepsis", MEDIATORS OF INFLAMMATION, vol. 2010, 14 April 2010 (2010-04-14), pages 1 - 9, XP055039312, ISSN: 0962-9351, DOI: 10.1155/2010/568396 *

Cited By (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2020069565A1 (en) 2018-10-02 2020-04-09 WearOptimo Pty Ltd Measurement system
US12048558B2 (en) 2018-10-02 2024-07-30 WearOptimo Pty Ltd System for determining fluid level in a biological subject
US12484814B2 (en) 2018-10-02 2025-12-02 WearOptimo Pty Ltd Actuator system
US12569679B2 (en) 2018-10-02 2026-03-10 WearOptimo Pty Ltd Treatment delivery system
WO2020230108A1 (en) * 2019-05-16 2020-11-19 Aptatargets, S.L. Treatment of ischemic stroke with aptamers targeting tlr-4
WO2020230109A1 (en) * 2019-05-16 2020-11-19 Aptatargets, S.L. Treatment of tlr-4 mediated diseases and conditions with aptamers targeting tlr-4
WO2024146930A1 (en) 2023-01-05 2024-07-11 Aptatargets, S.L. Aptoll molecules for the treatment of ischemic stroke and intracranial hemorrhages
WO2024240750A1 (en) 2023-05-22 2024-11-28 Aptatargets, S.L. New tlr-4 antagonist aptamers
KR20260016947A (ko) 2023-05-22 2026-02-04 메르크 파텐트 게엠베하 새로운 tlr-4 길항제 앱타머

Also Published As

Publication number Publication date
ES2555160B1 (es) 2016-10-25
EP3161139B1 (en) 2020-07-22
JP6959738B2 (ja) 2021-11-05
US10808252B2 (en) 2020-10-20
US10196642B2 (en) 2019-02-05
JP2020127422A (ja) 2020-08-27
PL3161139T3 (pl) 2021-01-11
DK3161139T3 (da) 2020-10-19
CN112111495A (zh) 2020-12-22
CN106459980A (zh) 2017-02-22
AU2015279248B2 (en) 2021-03-11
BR112016030172B1 (pt) 2022-11-01
CN106459980B (zh) 2020-11-03
RU2709718C9 (ru) 2020-02-06
US20210130830A1 (en) 2021-05-06
US11591603B2 (en) 2023-02-28
US20170130227A1 (en) 2017-05-11
RU2016152094A3 (https=) 2019-01-29
SI3161139T1 (sl) 2020-12-31
ZA201700363B (en) 2018-11-28
US20190211334A1 (en) 2019-07-11
US20230279402A1 (en) 2023-09-07
KR102454682B1 (ko) 2022-10-13
CA2953020A1 (en) 2015-12-30
RU2709718C2 (ru) 2019-12-19
AU2015279248A1 (en) 2017-01-12
MX2016016992A (es) 2017-05-03
CA2953020C (en) 2023-01-10
BR112016030172A2 (pt) 2017-11-14
RU2016152094A (ru) 2018-07-26
EP3161139A1 (en) 2017-05-03
ES2825106T3 (es) 2021-05-14
PT3161139T (pt) 2020-10-23
KR20170021298A (ko) 2017-02-27
JP2017527260A (ja) 2017-09-21
MA40283A (fr) 2017-05-03
ES2555160A1 (es) 2015-12-29
MX387405B (es) 2025-03-18

Similar Documents

Publication Publication Date Title
US20230279402A1 (en) Aptamers Specific for TLR-4 and Uses Thereof
Wang et al. A targeted exosome therapeutic confers both CfDNA scavenging and macrophage polarization for ameliorating rheumatoid arthritis
JP7600208B2 (ja) 拘束された脂質を含むナノ材料およびその使用
Fernández et al. TLR4-binding DNA aptamers show a protective effect against acute stroke in animal models
Nogueira et al. Folate-targeted nanoparticles for rheumatoid arthritis therapy
Han et al. Biomimetic and bioinspired intervention strategies for the treatment of rheumatoid arthritis
Yan et al. A redox‐responsive nanovaccine combined with a2a receptor antagonist for cancer immunotherapy
US20150366996A1 (en) Aptamers for tumor initiating cells
Musumeci et al. G-quadruplex-forming oligonucleotide conjugated to magnetic nanoparticles: synthesis, characterization, and enzymatic stability assays
Gopinath et al. Cell-targeting aptamers act as intracellular delivery vehicles
KR20170132234A (ko) 혈관 내피 증식 인자 수용체에 결합하는 핵산 앱타머
HK1240610B (en) Aptamers specific for tlr-4 and uses thereof
HK1240610A1 (en) Aptamers specific for tlr-4 and uses thereof
KR20170109674A (ko) 비소세포 폐암 세포(h1975)에 결합하는 dna 앱타머
US20230357353A1 (en) MAdCAM-1 POLYPEPTIDES AND USES THEREOF
Bohrmann Bioorthogonal click chemistry–synthesis of aptamer-conjugated polymeric nanoparticles for cancer targeting and pretargeted imaging of ⁹⁹ᵐTc-labeled tetrazines
WO2024080931A1 (en) Anti-inflammatory red blood cell extracellular vesicles (rbcevs)
Bouzinab Apoferritin delivery of imidazotetrazine agents for targeted brain tumour therapy
ALSHAER L’UNIVERSITE PARIS-SACLAY
JP2021529810A (ja) 治療薬プレスクリーニングのための組成物
Liu Properties of Nucleic Acid Amphiphiles and Their Biomedical Applications
WO2009129619A1 (en) Aptamers for detection and imaging of apoptosis

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 15732619

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: MX/A/2016/016992

Country of ref document: MX

ENP Entry into the national phase

Ref document number: 2953020

Country of ref document: CA

ENP Entry into the national phase

Ref document number: 2016575345

Country of ref document: JP

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 15322021

Country of ref document: US

NENP Non-entry into the national phase

Ref country code: DE

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112016030172

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 2015279248

Country of ref document: AU

Date of ref document: 20150624

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 20177001493

Country of ref document: KR

Kind code of ref document: A

REEP Request for entry into the european phase

Ref document number: 2015732619

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2015732619

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 2016152094

Country of ref document: RU

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 112016030172

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20161221