WO2015138357A2 - Compositions useful in treatment of otc deficency - Google Patents

Compositions useful in treatment of otc deficency Download PDF

Info

Publication number
WO2015138357A2
WO2015138357A2 PCT/US2015/019536 US2015019536W WO2015138357A2 WO 2015138357 A2 WO2015138357 A2 WO 2015138357A2 US 2015019536 W US2015019536 W US 2015019536W WO 2015138357 A2 WO2015138357 A2 WO 2015138357A2
Authority
WO
WIPO (PCT)
Prior art keywords
nucleic acid
seq
hotc
sequence
acid sequence
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2015/019536
Other languages
English (en)
French (fr)
Other versions
WO2015138357A3 (en
Inventor
Lili Wang
James M. Wilson
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of Pennsylvania Penn
Original Assignee
University of Pennsylvania Penn
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University of Pennsylvania Penn filed Critical University of Pennsylvania Penn
Priority to US15/124,620 priority Critical patent/US9890365B2/en
Publication of WO2015138357A2 publication Critical patent/WO2015138357A2/en
Publication of WO2015138357A3 publication Critical patent/WO2015138357A3/en
Anticipated expiration legal-status Critical
Priority to US15/861,427 priority patent/US10626382B2/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10Transferases (2.)
    • C12N9/1003Transferases (2.) transferring one-carbon groups (2.1)
    • C12N9/1018Carboxy- and carbamoyl transferases (2.1.3)
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/005Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
    • A61K48/0058Nucleic acids adapted for tissue specific expression, e.g. having tissue specific promoters as part of a contruct
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/16Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00Drugs for disorders of the metabolism
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86Viral vectors
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y201/00Transferases transferring one-carbon groups (2.1)
    • C12Y201/03Carboxy- and carbamoyltransferases (2.1.3)
    • C12Y201/03003Ornithine carbamoyltransferase (2.1.3.3)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011Details
    • C12N2710/10011Adenoviridae
    • C12N2710/10311Mastadenovirus, e.g. human or simian adenoviruses
    • C12N2710/10341Use of virus, viral particle or viral elements as a vector
    • C12N2710/10343Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00Reverse transcribing RNA viruses
    • C12N2740/00011Details
    • C12N2740/10011Retroviridae
    • C12N2740/15011Lentivirus, not HIV, e.g. FIV, SIV
    • C12N2740/15041Use of virus, viral particle or viral elements as a vector
    • C12N2740/15043Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011Details
    • C12N2750/14011Parvoviridae
    • C12N2750/14032Use of virus as therapeutic agent, other than vaccine, e.g. as cytolytic agent
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011Details
    • C12N2750/14011Parvoviridae
    • C12N2750/14033Use of viral protein as therapeutic agent other than vaccine, e.g. apoptosis inducing or anti-inflammatory
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011Details
    • C12N2750/14011Parvoviridae
    • C12N2750/14041Use of virus, viral particle or viral elements as a vector
    • C12N2750/14043Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011Details
    • C12N2750/14011Parvoviridae
    • C12N2750/14071Demonstrated in vivo effect
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011Details
    • C12N2750/14011Parvoviridae
    • C12N2750/14111Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14141Use of virus, viral particle or viral elements as a vector
    • C12N2750/14143Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00Nucleic acids vectors
    • C12N2800/22Vectors comprising a coding region that has been codon optimised for expression in a respective host

Definitions

  • OTC Ornithine transcarbamylase
  • immunosuppressive drugs are necessary for the duration of the subject's life.
  • Gene therapy of a metabolic disease such as OTCD presents a more challenging model for gene replacement therapy than other conditions. Because the gene acts in a cell-autonomous manner (i.e., it can only influence the cell in which it is expressed), therapeutic effects should be directly correlated with the number of target cells that are transduced, rather than with the net level of expression in liver such as with a secreted protein where high expression per cell can overcome low transduction. Furthermore, there has been at least one published report that hOTCwt mRNA is unstable. [Wang, L., et al, Molecular Genetics and Metabolism, 105 (2012) 203-211].
  • a composition comprising a non-viral carrier and an engineered hOTC is provided which is less than 80% identical to the wild-type hOTC sequence over the full-length hOTC of the wild-type sequence (e.g., SEQ ID NO: 1), or a fragment thereof which comprises the mature hOTC but lacking at least the native leader sequence, or another intermediate which comprises at least the mature hOTC) and expresses a functional hOTCase.
  • the engineered sequence has been preferably codon optimized and further improved such that it enhances at least one of transduction, transcription and/or translation of the enzyme.
  • the composition comprises a nucleic acid molecule comprising an engineered sequence encoding human ornithine transcarbamylase (hOTCase) and expression control sequences which direct expression of hOTCase in a liver cell, wherein the hOTC nucleic acid sequence is less than 80% identical to the wild-type hOTC sequence over at least the mature hOTC sequence of SEQ ID NO: 1, wherein said hOTC nucleic acid sequence is selected from the nucleic acid sequence comprising SEQ ID NO: 5 or a nucleic acid sequence at least about 96 to about 99 % identical thereto, a nucleic acid sequence selected from SEQ ID NO: 9, or a nucleic acid sequence at least about 96 to about 99 % identical thereto, a nucleic acid sequence comprising SEQ ID NO: 11 or a nucleic acid sequence at least about 96 to about 99 % identical thereto, or a nucleic acid sequence comprising SEQ ID NO: 13 or a nucleic acid
  • the composition comprises a plasmid.
  • the plasmid has the sequence of SEQ ID NO: 6.
  • the engineered hOTC nucleic acid molecule is formulated in a moiety selected from the group consisting of micelles, liposomes, cationic lipid - nucleic acid compositions, poly-glycan compositions, block copolymers and other polymers, lipid and/or cholesterol-based - nucleic acid conjugates.
  • a pharmaceutical composition comprises an excipient and an effective amount of the engineered hOTC nucleic acid molecule.
  • a composition which comprises the engineered hOTC nucleic acid molecule for use in a method of treatment of a disease or medical condition associated with ornithine transcarbamylase deficiency in a human patient.
  • a composition comprises a nucleic acid molecule encoding functional human ornithine transcarbamylase for use in a method in preventing and/or treating fibrosis or cirrhosis in a subject heterozygous for ornithine transcarbamylase deficiency in a human patient.
  • a composition comprises a nucleic acid molecule comprising a nucleic acid sequence encoding functional human ornithine transcarbamylase for use in a method for preventing and/or treating hepatocellular carcinoma in a subject heterozygous for ornithine transcarbamylase deficiency.
  • transcarbamylase deficiency in a subject comprising delivering to a subject in need thereof the composition containing an engineered hOTC as described herein.
  • a composition comprises an mRNA according to any one of SEQ ID NO: 10, 1 1, or 12 in a method for delivering ornithine transcarbamylase to a human patient in acute crisis.
  • a composition as defined herein may also be used in a method for delivering ornithine transcarbamylase to a human patient following treatment of said patient with RNA.
  • a method for preventing and/or treating fibrosis or cirrhosis in a subject heterozygous for ornithine transcarbamylase deficiency comprises delivering to a subject a composition comprising a nucleic acid sequence encoding functional human ornithine transcarbamylase.
  • a method for preventing and/or treating hepatocellular carcinoma in a subject heterozygous for ornithine transcarbamylase deficiency comprises delivering a composition comprising a nucleic acid sequence encoding functional human ornithine transcarbamylase.
  • FIG. 1A provides a wild-type hOTC cDNA, which has 324 A, 223 C,
  • FIG. IB - 1C provides the human ornithine transcarbamylase sequence encoded by the sequence of FIG. 1A [SEQ ID NO:2].
  • FIG.2 provides an engineered hOTC cDNA, with an altered GC ratio.
  • the base count in the sequence is 283 A, 285 C, 284 G, and 216 T [SEQ ID NO: 3].
  • FIG. 3 provides an engineered hOTC cDNA termed LW3 [SEQ ID NO:4].
  • the base count in this sequence is 279 A, 303 C, 288 G, and 220 T.
  • the start codon for the hOTC open reading frame (ORF) is preceded by a Kozak sequence in this figure.
  • the coding sequence for the leader begins at nucleotide 15 (first 96 nucleotides), followed by the coding sequence for the 322 amino acid hOTCase.
  • the stop codon is followed by a Notl restriction site (GCGGCCGC) which is a remnant of the vector.
  • GCGGCCGC Notl restriction site
  • FIG. 4 provides an engineered hOTC cDNA termed LW4 [SEQ ID NO: 1]
  • the base count in this sequence is 278 A, 303 C, 289 G, and 220 T.
  • the coding sequence for the leader begins at nucleotide 15 (first 96 nucleotides), followed by the coding sequence for the 322 amino acid hOTCase. In this figure the stop codon is followed by a Notl restriction site (GCGGCCGC) which is a remnant of the vector.
  • FIGs. 5A - 5C provides an alignment of the cDNA sequences of the wild- type hOTC, and five engineered sequences, GS [SEQ ID NO: 3], LW3 [SEQ ID NO:4], LW4 [SEQ ID NO: 5], LW5 [SEQ ID NO: 8] and LW6 [SEQ ID NO:9].
  • the aligned sequences contain a Kozak sequence (first 14 nucleotides of LW3 and LW4) and a restriction enzyme site (following termination codon for LW3 and LW4), which are not part of the open reading frame.
  • An engineered human (h) ornithine transcarbamylase (OTC) cDNA is provided herein, which was designed to maximize translation and improve mRNA stability as compared to the wild-type hOTC DNA and/or mRNA.
  • engineered hOTC mRNA sequences are also provided herein. These compositions may be used in therapeutic and/or prophylactic methods as described herein. Optionally, these compositions are used in combination other therapies consistent with the standard of care for the conditions for which the subject (e.g., a human subject) has been diagnosed.
  • FIG. 1A For comparison purposes, a wild-type human OTC cDNA sequence is illustrated in FIG. 1A. This sequence encodes the human ornithine transcarbamylase of the amino acid sequence of FIGS. 1A - 1C. This same amino acid sequence is encoded by the engineered hOTC genes of FIGS. 2A - FIG. 5.
  • the hOTC enzyme which may be referred to as hOTCase to distinguish from the gene, is expressed from this sequence in the form of a pre-protein having a 32 amino acid leader peptide at its N-terminus (encoded by nt 1 -96 of FIG.1 , about amino acids 1 to about 32 of SEQ ID NO: 2) which is cleaved after directing the enzyme to the cellular mitochondria, leaving the 322 amino acid residue "mature” protein (about amino acid 33 to about amino acid 354 of SEQ ID NO: 2.
  • This "so-called mature" hOTCase is a homotrimeric protein with a 322 amino acid residue sequence in each polypeptide chain.
  • all of the engineered cDNA sequences are about 77% to about
  • a modified hOTC coding sequence which sequence has less than about 80% identity, preferably about 77% identity or less to the full-length wild-type hOTC coding sequence (FIG. 1A, SEQ ID NO:l), which encodes functional hOTCase.
  • the modified hOTC coding sequence is characterized by improved stability as compared to wt hOTC following AAV-mediated delivery ⁇ e.g., rAAV).
  • a modified hOTC coding sequence is provided which lacks alternative reading frames for proteins of at least about 9 amino acids in length.
  • a modified hOTC coding sequence is 96% to 99.9% identical to the sequence encoding the mature enzyme (about nt 99 to about 1068) or full- length of FIG. 4 (hOTCco-LW4, SEQ ID NO: 5), or 96.5% to 99% identical, or about 97% , or about 98% identical to SEQ ID NO:5 (FIG. 4).
  • a modified hOTC coding sequence is 96% to 99.9% identical to the sequence encoding the mature enzyme (about nt 99 to about 1068) of FIG. 3 (hOTCco-LW3, SEQ ID NO:4), or 96.5% to 99% identical, or about 97% , or about 98% identical to SEQ ID NO: 4 (FIG. 3).
  • a modified hOTC coding sequence is 96% to
  • a modified hOTC coding sequence has the sequence encoding the mature protein (about nt 99 to about 1068) or the full-length of hOTCco-LW5 [SEQ ID NO: 8] or hOTCco-LW6 [SEQ ID NO:9], or a sequence 96% to 99.9% identical thereto.
  • hOTCco-LW5 and hOTCco-LW6 are about 97% identical to each other, and each is about 78% identical to the wild-type sequence [SEQ ID NO: 1].
  • the sequences of FIGs. 2-5 are provided as the sense strand of the cDNA sequences.
  • the present invention also encompasses the anti-sense strands corresponding to these cDNA sequences and corresponding RNA, e.g., m NA, sequences.
  • the engineered mRNA of SEQ ID NO: 10 corresponds to the DNA of SEQ ID NO:4
  • the engineered RNA of SEQ ID NO: 11 corresponds to the DNA of SEQ ID NO: 5
  • the engineered RNA of SEQ ID NO: 12 corresponds to the DNA of SEQ ID NO: 8
  • the RNA of SEQ ID NO: 13 corresponds to the DNA of SEQ ID NO:9.
  • RNA sequences and sequences which are 95% to 99%, or about 97%, or about 98% identical to one or more of these sequences are encompassed within the scope of this invention.
  • Methods for aligning and determining RNA identity are known the art and include published and publically available web-based or commercially available databases and services. See, e.g., LocARNA, CARNA, as well as other programs identified elsewhere therein.
  • the mRNA sequence may be delivered using a selected RNA delivery system, examples of which are supplied herein.
  • fragments e.g., the sequences encoding the transit peptide (amino acids 1 to about 32), about amino acids 332 to about 354, an intermediate hOTC enzyme, or the mature enzyme, or other fragments as may be desired.
  • SEQ ID NO:2 See, e.g., Ye et al. 2001, Hum Gene Ther 12: 1035-1046.
  • a chimeric OTC in which the N- terminal presequence of wild-type OTC is replaced with a transit sequence from another source which is compatable with the subject's system such that it effectively transports the mature hOTCase encoded by the chimeric OTC gene to the desired organelle.
  • a transit sequence from another source which is compatable with the subject's system such that it effectively transports the mature hOTCase encoded by the chimeric OTC gene to the desired organelle.
  • Such transit sequences encode a transit peptide (also termed a signal peptide, targeting signal, or localization signal) which is fused to the coding sequence for the mature hOTC of SEQ ID NO: 1, 3, 4, 5, 8 and/or 9.
  • the wild-type hOTC transit sequence corresponds to about the first 98 nucleotides of SEQ ID NO: 1.
  • these wild-type N-terminal sequences may be removed (about nucleic acids 1 to about nt 96 - nt 98) and replaced with a heterologous transit sequence.
  • Suitable transit peptides are preferably, although not necessarily of human origin. Suitable transit peptides may be chosen from
  • sequence identity refers to the residues in the two sequences which are the same when aligned for correspondence.
  • the length of sequence identity comparison may be over the full-length of the genome, the full-length of a gene coding sequence, or a fragment of at least about 500 to 5000 nucleotides, is desired. However, identity among smaller fragments, e.g. of at least about nine nucleotides, usually at least about 20 to 24 nucleotides, at least about 28 to 32 nucleotides, at least about 36 or more nucleotides, may also be desired.
  • Percent identity may be readily determined for amino acid sequences over the full-length of a protein, polypeptide, about 32 amino acids, about 330 amino acids, or a peptide fragment thereof or the corresponding nucleic acid sequence coding sequences.
  • a suitable amino acid fragment may be at least about 8 amino acids in length, and may be up to about 700 amino acids.
  • identity is determined in reference to “aligned” sequences.
  • alignd sequences or alignments refer to multiple nucleic acid sequences or protein (amino acids) sequences, often containing corrections for missing or additional bases or amino acids as compared to a reference sequence.
  • Alignments are performed using any of a variety of publicly or commercially available Multiple Sequence Alignment Programs. Sequence alignment programs are available for amino acid sequences, e.g., the "Clustal X”, “MAP”, “PIMA”, “MSA”, “BLOCKMAKER”, “MEME”, and “Match-Box” programs. Generally, any of these programs are used at default settings, although one of skill in the art can alter these settings as needed. Alternatively, one of skill in the art can utilize another algorithm or computer program which provides at least the level of identity or alignment as that provided by the referenced algorithms and programs. See, e.g., J. D. Thomson et al, Nucl. Acids. Res., "A comprehensive comparison of multiple sequence alignments", 27(13):2682-2690 (1999).
  • nucleotide sequence identity can be measured using FastaTM, a program in GCG Version 6.1.
  • FastaTM provides alignments and percent sequence identity of the regions of the best overlap between the query and search sequences. For instance, percent sequence identity between nucleic acid sequences can be determined using FastaTM with its default parameters (a word size of 6 and the NOP AM factor for the scoring matrix) as provided in GCG Version 6.1 , herein incorporated by reference.
  • the modified hOTC genes described herein are engineered into a suitable genetic element (vector) useful for generating viral vectors and/or for delivery to a host cell, e.g., naked DNA, phage, transposon, cosmid, episome, etc., which transfers the hOTC sequences carried thereon.
  • a host cell e.g., naked DNA, phage, transposon, cosmid, episome, etc.
  • the selected vector may be delivered by any suitable method, including transfection, electroporation, liposome delivery, membrane fusion techniques, high velocity DNA-coated pellets, viral infection and protoplast fusion.
  • the methods used to make such constructs are known to those with skill in nucleic acid manipulation and include genetic engineering, recombinant engineering, and synthetic techniques. See, e.g., Sambrook et al, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, NY.
  • an "expression cassette” refers to a nucleic acid molecule which comprises the hOTC sequences, promoter, and may include other regulatory sequences therefor, which cassette may be packaged into the capsid of a viral vector (e.g., a viral particle).
  • a viral vector e.g., a viral particle.
  • such an expression cassette for generating a viral vector contains the hOTC sequences described herein flanked by packaging signals of the viral genome and other expression control sequences such as those described herein.
  • the packaging signals are the 5 ' inverted terminal repeat (ITR) and the 3' ITR.
  • the ITR sequences from AAV2, or the deleted version thereof (AITR) are used for convenience and to accelerate regulatory approval.
  • ITRs from other AAV sources may be selected.
  • the source of the ITRs is from AAV2 and the AAV capsid is from another AAV source, the resulting vector may be termed pseudotyped.
  • an expression cassette for an AAV vector comprises an AAV
  • 5' ITR the hOTC coding sequences and any regulatory sequences
  • AAV 3' ITR A shortened version of the 5 ' ITR termed AITR, has been described in which the D-sequence and terminal resolution site (trs) are deleted. In other embodiments, the full-length AAV 5 ' and 3 ' ITRs are used.
  • This illustrative plasmid contains an expression cassette comprising: scITR (nt 5 - 109 of SEQ ID NO: 6), a TATA signal (nt 851-854 of SEQ ID NO:6), a synthetic hOTC coding sequence (nt 976-2037 of SEQ ID NO: 6), a poly A (nt 2182-2046 on the complement of SEQ ID NO: 6), a scITR (nt 2378- 221 Ion the complement of SEQ ID NO: 6), and a liver specific (TBG) promoter (nt 4172- 4760) of SEQ ID NO: 6).
  • Other expression cassettes may be generated using the other synthetic hOTC coding sequences, and other expression control elements, described herein.
  • sc in this context refers to self-complementary.
  • Self- complementary AAV refers a construct in which a coding region carried by a recombinant AAV nucleic acid sequence has been designed to form an intra-molecular double-stranded DNA template.
  • dsDNA double stranded DNA
  • the expression cassette typically contains a promoter sequence as part of the expression control sequences, e.g., located between the selected 5' ITR sequence and the hOTC coding sequence.
  • the illustrative plasmid and vector described herein uses the liver-specific promoter thyroxin binding globulin (TBG).
  • TBG liver-specific promoter thyroxin binding globulin
  • other liver- specific promoters may be used [see, e.g., The Liver Specific Gene Promoter Database, Cold Spring Harbor, http://rulai.schl.edu/LSPD/, such as, e.g., alpha 1 anti-trypsin (A1AT); human albumin Miyatake et al., J.
  • TTR minimal enhancer/promoter alpha-antitrypsin promoter, LSP (845 nt)25 (requires intron- less scAAV); or LSP1.
  • promoters such as constitutive promoters, regulatable promoters [see, e.g., WO 2011/126808 and WO 2013/04943], or a promoter responsive to physiologic cues may be used may be utilized in the vectors described herein.
  • an expression cassette and/or a vector may contain one or more other appropriate transcription initiation, termination, enhancer sequences, efficient RNA processing signals such as splicing and polyadenylation (poly A) signals; sequences that stabilize cytoplasmic mRNA; sequences that enhance translation efficiency (i.e., Kozak consensus sequence); sequences that enhance protein stability; and when desired, sequences that enhance secretion of the encoded product.
  • suitable polyA sequences include, e.g., SV40, SV50, bovine growth hormone (bGH), human growth hormone, and synthetic poly As.
  • suitable enhancers include, e.g., the alpha fetoprotein enhancer, the TTR minimal
  • the expression cassette comprises one or more expression enhancers.
  • the expression cassette contains two or more expression enhancers. These enhancers may be the same or may differ from one another.
  • an enhancer may include an Alpha mic/bik enhancer. This enhancer may be present in two copies which are located adjacent to one another.
  • the dual copies of the enhancer may be separated by one or more sequences.
  • the expression cassette further contains an intron, e.g, the Promega intron.
  • suitable introns include those known in the art, e.g., such as are described in WO 2011/126808.
  • one or more sequences may be selected to stabilize mR A.
  • An example of such a sequence is a modified WPRE sequence, which may be engineered upstream of the polyA sequence and downstream of the coding sequence [see, e.g., MA Zanta-Boussif, et al, Gene Therapy (2009) 16: 605- 619.
  • control sequences are "operably linked" to the hOTC gene sequences.
  • operably linked refers to both expression control sequences that are contiguous with the gene of interest and expression control sequences that act in trans or at a distance to control the gene of interest.
  • AAV viral vectors are well suited for delivery of the hOTC expression sequences described herein.
  • Such AAV vectors may contain ITRs which are from the same AAV source as the capsid.
  • the AAV ITRs may be from a different AAV source than that which supplies the capsid.
  • the ITRs in the expression are selected from a source which differs from the AAV source of the capsid.
  • AAV2 ITRs may be selected for use with an AAV capsid having a particular efficiency for targeting liver (e.g., hepatocytes).
  • AAV capsids may be selected from AAV8 [US Patent 7790449; US Patent 7282199] and rhlO [WO 2003/042397] for the compositions described herein.
  • AAV AAV9
  • AAVl AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV9
  • others such as, e.g., those described in WO 2003/042397; WO 2005/033321, WO 2006/110689; US 7588772 B2, which are incorporated by reference herein] may be used in human subjects.
  • a self-complementary AAV is provided.
  • This viral vector may contain a ⁇ 5' ITR and an AAV 3' ITR.
  • the viral vector is scAAV2/8.TBG.hOTCco.
  • the viral vector is
  • scAAV2/rhlO.TBG.hOTCco both contain the 5' AITR from AAV2, the liver-specific TBG promoter, an engineered hOTCco coding sequence of the invention, an SV40 polyA, and the 3' AAV2 ITR in an AAV8 capsid [see, e.g., US Patent No. 8,318480B2] or AAV rhl 0 capsid.
  • the sequence may be selected from engineered hOTC one of SEQ ID NO: 3, 4, 5, 8 or 9.
  • the transit sequence of the engineered hOTC may be substituted with a heterologous transit sequence to provide a chimeric hOTC, which retains the mature hOTCase.
  • a single-stranded AAV viral vector is provided.
  • Such a vector may contain a 5' AAV ITR and a 3' ITR.
  • a 5' AAV ITR may contain a 5' AAV ITR and a 3' ITR.
  • AAV2/8.TBG.hOTCco which contains the full-length AAV2 - 5' ITR, the liver-specific TBG promoter, the hOTC coding sequence, a bovine growth hormone poly A, and AAV2 - 3' ITR.
  • AAV2/8.TBG.hOTCco-.WPRE.bGH which contains the same vector elements, and additionally contains the woodchuck hepatitis virus post- transcriptional regulatory element (WPRE).
  • WPRE woodchuck hepatitis virus post- transcriptional regulatory element
  • WPRE woodchuck hepatitis virus post- transcriptional regulatory element
  • WPRE is absent from constructs to be used in vivo.
  • the engineered hOTC sequence (abbreviated herein hOTCco) may be selected from engineered hOTC of one of SEQ ID NO: 3, 4, 5, 8 or 9.
  • the transit peptide sequence of the engineered hOTC may be substituted with a heterologous transit sequence to provide a
  • Still other promoters may be selected, including tissue specific promoters.
  • a producer cell line is transiently transfected with a construct that encodes the transgene flanked by ITRs and a construct(s) that encodes rep and cap.
  • a packaging cell line that stably supplies rep and cap is transiently transfected with a construct encoding the transgene flanked by ITRs.
  • AAV virions are produced in response to infection with helper adenovirus or herpesvirus, requiring the separation of the rAAVs from contaminating virus.
  • helper functions can be supplied by transient transfection of the cells with constructs that encode the required helper functions, or the cells can be engineered to stably contain genes encoding the helper functions, the expression of which can be controlled at the transcriptional or
  • transgene flanked by IT s and rep/cap genes are introduced into insect cells by infection with baculovirus-based vectors.
  • baculovirus-based vectors For reviews on these production systems, see generally, e.g., Zhang et al., 2009, "Adenovirus-adeno-associated virus hybrid for large-scale recombinant adeno-associated virus production," Human Gene Therapy 20:922-929, the contents of each of which is incorporated herein by reference in its entirety. Methods of making and using these and other AAV production systems are also described in the following U.S.
  • a single promoter may direct expression of a single R A that encodes two or three or more genes, and translation of the downstream genes are driven by IRES sequences.
  • a single promoter may direct expression of an RNA that contains, in a single open reading frame (ORF), two or three or more genes separated from one another by sequences encoding a self-cleavage peptide (e.g., T2A) or a protease recognition site (e.g., furin).
  • ORF open reading frame
  • the ORF thus encodes a single polyprotein, which, either during (in the case of T2A) or after translation, is cleaved into the individual proteins (such as, e.g., transgene and dimerizable transcription factor).
  • individual proteins such as, e.g., transgene and dimerizable transcription factor.
  • these IRES and polyprotein systems can be used to save AAV packaging space, they can only be used for expression of components that can be driven by the same promoter.
  • the transgene capacity of AAV can be increased by providing AAV ITRs of two genomes that can anneal to form head to tail concatamers.
  • the hOTC genes described herein may be used to generate viral vectors other than rAAV.
  • Such other viral vectors may include any virus suitable for gene therapy may be used, including but not limited to adenovirus; herpes virus; lentivirus; retroviri/s/ etc.
  • adenovirus including but not limited to adenovirus; herpes virus; lentivirus; retroviri/s/ etc.
  • one of these other vectors is generated, it is produced as a replication-defective viral vector.
  • a "replication-defective virus” or “viral vector” refers to a synthetic or artificial viral particle in which an expression cassette containing a gene of interest is packaged in a viral capsid or envelope, where any viral genomic sequences also packaged within the viral capsid or envelope are replication-deficient; i.e., they cannot generate progeny virions but retain the ability to infect target cells.
  • the genome of the viral vector does not include genes encoding the enzymes required to replicate (the genome can be engineered to be "gutless" - containing only the transgene of interest flanked by the signals required for amplification and packaging of the artificial genome), but these genes may be supplied during production.
  • replication- defective viruses may be adeno-associated viruses (AAV), adenoviruses, lentiviruses (integrating or non-integrating), or another suitable virus source.
  • AAV adeno-associated viruses
  • adenoviruses adenoviruses
  • lentiviruses integrating or non-integrating
  • another suitable virus source adeno-associated viruses
  • compositions described herein are designed for delivery to subjects in need thereof by any suitable route or a combination of different routes.
  • Direct or intrahepatic delivery to the liver is desired and may optionally be performed via intravascular delivery, e.g., via the portal vein, hepatic vein, bile duct, or by transplant.
  • other routes of administration may be selected (e.g., oral, inhalation, intranasal, intratracheal, intraarterial, intraocular, intravenous, intramuscular, and other parental routes).
  • the hOTC delivery constructs described herein may be delivered in a single composition or multiple compositions.
  • two or more different AAV may be delivered [see, e.g., WO 2011/126808 and WO 2013/049493].
  • multiple viruses may contain different replication-defective viruses ⁇ e.g., AAV, adenovirus, and/or lentivirus).
  • delivery may be mediated by non-viral constructs, e.g., "naked DNA”, “naked plasmid DNA”, R A, and mR A; coupled with various delivery compositions and nano particles, including, e.g., micelles, liposomes, cationic lipid - nucleic acid compositions, poly-glycan compositions and other polymers, lipid and/or cholesterol-based - nucleic acid conjugates, and other constructs such as are described herein. See, e.g., X. Su et al, Mol. Pharmaceutics, 2011, 8 (3), pp 774-787; web publication: March 21, 2011; WO2013/182683, WO
  • Such non-viral hOTC delivery constructs may be administered by the routes described previously.
  • the viral vectors can be formulated with a physiologically acceptable carrier for use in gene transfer and gene therapy applications.
  • quantification of the genome copies may be used as the measure of the dose contained in the formulation.
  • Any method known in the art can be used to determine the genome copy (GC) number of the replication-defective virus compositions of the invention.
  • One method for performing AAV GC number titration is as follows: Purified AAV vector samples are first treated with DNase to eliminate un-encapsidated AAV genome DNA or contaminating plasmid DNA from the production process. The DNase resistant particles are then subjected to heat treatment to release the genome from the capsid.
  • the dose of replication-defective virus in the formulation is 1.0 x 10 9 GC, 5.0 X 10 9 GC, 1.0 X 10 10 GC, 5.0 X 10 10 GC, 1.0 X 10 11 GC, 5.0 X 10 11 GC, 1.0 X 10 12 GC, 5.0 X 10 12 GC, or 1.0 x 10 13 GC, 5.0 X 10 13 GC, 1.0 X 10 14 GC, 5.0 X 10 14 GC, or 1.0 x 10 15 GC.
  • DNA and RNA is generally measured in the nanogram (ng) to microgram
  • ⁇ g amounts of the nucleic acids.
  • dosages of the RNA is the range of 1 ng to 700 ⁇ g, 1 ng to 500 ⁇ g, 1 ng to 300 ⁇ g, 1 ng to 200 ⁇ g, or 1 ng to 100 ⁇ g are formulated and administered.
  • Similar dosage amounts of a DNA molecule containing an expression cassette and not delivered to a subject via a viral vector may be utilized for non-viral hOTC DNA delivery constructs.
  • IU per volume e.g., mL
  • IU infectious unit, or alternatively transduction units (TU); IU and TU can be used interchangeably as a quantitative measure of the titer of a viral vector particle preparation.
  • the lentiviral vector is typically non-integrating.
  • the amount of viral particles is at least about 3xl0 6 IU, and can be at least about lxl O 7 IU, at least about 3xl 0 7 IU, at least about 1x10 s IU, at least about 3x10 s IU, at least about lxl O 9 IU, or at least about 3x10 9 IU.
  • the above-described recombinant vectors may be delivered to host cells according to published methods.
  • the rAAV preferably suspended in a physiologically compatible carrier, may be administered to a human or non-human mammalian patient.
  • Suitable carriers may be readily selected by one of skill in the art in view of the indication for which the transfer virus is directed.
  • one suitable carrier includes saline, which may be formulated with a variety of buffering solutions (e.g., phosphate buffered saline).
  • Other exemplary carriers include sterile saline, lactose, sucrose, calcium phosphate, gelatin, dextran, agar, pectin, peanut oil, sesame oil, and water. The selection of the carrier is not a limitation of the present invention.
  • compositions of the invention may contain, in addition to the rAAV and carrier(s), other conventional pharmaceutical ingredients, such as preservatives, or chemical stabilizers.
  • suitable exemplary preservatives include chlorobutanol, potassium sorbate, sorbic acid, sulfur dioxide, propyl gallate, the parabens, ethyl vanillin, glycerin, phenol, and parachlorophenol.
  • Suitable chemical stabilizers include gelatin and albumin.
  • the viral vectors described herein may be used in preparing a medicament for delivering ornithine transcarbamylase to a subject (e.g., a human patient) in need thereof, supplying functional hOTCase to a subject, and/or for treating ornithine transcarbamylase deficiency.
  • a course of treatment may optionally involve repeat administration of the same viral vector (e.g., an AAV8 vector) or a different viral vector (e.g., an AAV8 and an AAVrhlO). Still other combinations may be selected using the viral vectors and non-viral delivery systems described herein.
  • nucleic acid sequences described herein may be delivered via a non- viral route.
  • a hOTC sequence may be via a carrier system for expression or delivery in R A form (e.g., m NA) using one of a number of carrier systems which are known in the art.
  • carrier systems include those provided by commercial entities, such as Phase x' so-called "SMARTT" technology. These systems utilize block copolymers for delivery to a target host cell. See, e.g., US
  • RNA delivery technologies are also available, e.g., from Veritas Bio [see, e.g., US 2013/0323001, Dec 23, 2010, "In vivo delivery of double stranded RNA to a target cell" (cytosolic content including RNAs, e.g., mRNA, expressed siRNA/shRNA/miRNA, as well as injected/introduced siRNA/shRNA/miRNA, or possibly even transfected DNA present in the cytosol packaged within exovesicles and be transported to distal sites such as the liver)].
  • RNAs e.g., mRNA, expressed siRNA/shRNA/miRNA, as well as injected/introduced siRNA/shRNA/miRNA, or possibly even transfected DNA present in the cytosol packaged within exovesicles and be transported to distal sites such as the liver
  • Still other systems for in vivo delivery of RNA sequences have been described. See, e.g.,
  • the invention provides an engineered hOTC mRNA of the mature sequence (at least about nt 99 - 1098) or the full-length of SEQ ID NO: 10, 11, 12, 13, or a sequence having at least 97% to 99% identity thereto, in a composition for delivery of double-stranded or single stranded RNA which results in expression of the mature hOTCase in a target host cell, e.g., a liver cell.
  • a target host cell e.g., a liver cell.
  • RNA live directly, as compared to transcribed from a DNA delivery molecule
  • hOTCase live directly, as compared to transcribed from a DNA delivery molecule
  • a cap or a modified base in order to avoid rapid clearance of the RNA, it is modified as described herein (e.g., using a cap or a modified base), such that its effects may be retained for over 24 hours, over 48 hours, or up to about 3 days (about 72 hours). It may be desirable to co-administer an mRNA directly as described herein and co-administer at the same or substantially the same time, a DNA or viral vector-based hOTC composition as defined herein.
  • compositions according to the present invention may comprise a pharmaceutically acceptable carrier, such as defined above.
  • the composition comprises a block copolymer associated with a hOTC polynucleotide as described herein.
  • the block copolymers may form a micelle, such that the micelle comprises a plurality of block copolymer.
  • such a composition contains a nucleic acid molecule comprising the ni NA sequence corresponding to the hOTC sequence encoding the mature hOTCase (at least about nt 99 to 1098) or the full-length of any of SEQ ID NO: 10, 11, 12, 13.
  • this nucleic acid molecule may include the 5' untranslated region (UT ), also known as the leader sequence or leader RNA, and one or more of an optional intron(s), an optional exon(s), an optional a Kozak sequence, an optional WPRE. and a polyA, and the 3' UTR flanking the coding sequences.
  • UT 5' untranslated region
  • Suitable leader sequences include those discussed above in connection with the hOTC DNA sequences, which discussion is incorporated by reference herein. Examples of sources of suitable leader sequences, other than the native hOTC leader sequences, or those corresponding to FIG 2, FIG3 or FIG4, or FIG 5 are discussed above. Similarly, sources of suitable introns, polyA, and Kozak sequences are discussed above and are applicable to the delivery of the corresponding RNA sequences discussed in the present paragraph. Further, various modifications to the RNA may be generated, e.g., a modified 5' cap structure may be engineered into the construct in order to avoid rapid clearance of the mRNA in vivo, or for another desired reason. Methods of generating such 5' cap structures is known to those of skill in the art.
  • modified nucleotides can be used to make mRNA in vitro, like pseudouridine.
  • RNA may be dosed repetitively, or subject can be dosed first with mRNA to manage neonatal crises followed up by viral vector-mediated delivery ⁇ e.g., AAV) for long term therapy and to prevent fibrosis/cirrhosis and/or hepatocellular carcinoma.
  • viral vector-mediated delivery e.g., AAV
  • mRNA can be synthesized from the hOTC DNA sequences described herein, using techniques that are well known in the art. For example, Cazenave C, Uhlenbeck OC, RNA template-directed RNA synthesis by T7 RNA polymerase. Proc Natl Acad Sci U S A. 1994 Jul 19;91(15):6972-6, describe the use of the T7 RNA polymerase for generating RNA from cDNA or RNA templates. See also, Wichlacz Al, Legiewicz M, Ciesiolka J., Generating in vitro transcripts with homogenous 3' ends using trans-acting antigenomic delta ribozyme., Nucleic Acids Res.
  • RNAs are produced by SP6 in vitro transcription of cloned cDNAs, Nucleic Acids Res. 1984 Sep 25;12(18):7057-70; and Rio, D. C, et al. RNA: A Laboratory Manual. Cold Spring Harbor: Cold Spring Harbor Laboratory Press, 2011, 205-220. Each of these references is incorporated herein by reference. In addition, kits and protocols for generating mRNA are available
  • RNA Synthesis Kit TriLink Biotechnologies; bioSYNTHESIS; GE Dharmacon; and IBA Lifesciences.
  • the hOTC DNA sequences described herein can be generated in vitro and synthetically, using techniques well known in the art.
  • the PCR-based accurate synthesis (PAS) of long DNA sequence method may be utilized, as described by Xiong et al, PCR-based accurate synthesis of long DNA sequences, Nature Protocols 1 , 791 - 797 (2006).
  • a method combining the dual asymmetrical PCR and overlap extension PCR methods is described by Young and Dong, Two-step total gene synthesis method, Nucleic Acids Res. 2004; 32(7): e59. See also, Gordeeva et al, J Microbiol Methods. Improved PCR-based gene synthesis method and its application to the
  • DNA may also be generated from NA molecules through amplification via the use of Reverse Transcriptases (RT), which are RNA-dependent DNA Polymerases. RTs polymerize a strand of DNA that is complimentary to the original RNA template and is referred to as cDNA. This cDNA can then be further amplified through PCR or isothermal methods as outlined above. Custom DNA can also be generated commercially from companies including, without limitation, GenScript; GENEWIZ®; GeneArt® (Life Technologies); and Integrated DNA Technologies.
  • RT Reverse Transcriptases
  • Custom DNA can also be generated commercially from companies including, without limitation, GenScript; GENEWIZ®; GeneArt® (Life Technologies); and Integrated DNA Technologies.
  • RNA Ribonucleic acid
  • expression is used herein in its broadest meaning and comprises the production of RNA or of RNA and protein.
  • expression or “translation” relates in particular to the production of peptides or proteins. Expression may be transient or may be stable.
  • translation in the context of the present invention relates to a process at the ribosome, wherein an mRNA strand controls the assembly of an amino acid sequence to generate a protein or a peptide.
  • a "therapeutically effective amount" of the hOTC is delivered as described herein to achieve a desired result, i.e., treatment of OTC deficiency or one or more symptoms thereof.
  • a desired result includes reducing orotic acid levels, reducing hyperammonemia and/or minimizing or eliminating one or more of the neurophysical complications including developmental delay, learning disabilities, intellectual disability, attention deficit hyperactivity disorder, and executive function deficits.
  • Treatment may include treatment of subjects having severe neonatal-onset disease (males or, more rarely, females), and late-onset (partial) disease in males and females, which may present from infancy to later childhood, adolescence, or adulthood.
  • the invention provides a method of treating and/or preventing fibrosis and/or cirrhosis in subjects, particularly those late- onset heterozygous subjects by administering hOTC as described herein.
  • therapeutic goals for OTC deficiency are to maintain plasma ammonia at less than ⁇ 80 ⁇ /L, plasma glutamine ⁇ 1,000 ⁇ /L, argininemia 80-150 ⁇ /L and branched chain amino acids within the normal range.
  • other therapeutic endpoints may be selected by the treating physician.
  • the invention provides a method of rescuing and/or treating a neonatal subject OTCD comprising the step of delivering a hOTC gene to the liver of a newborn subject (e.g., a human patient).
  • This method may utilize any nucleic acid sequence encoding a functional hOTCase, whether a synthetic hOTC as described herein or a wild-type hOTC, or a hOTC from another source, or a combination thereof.
  • neonatal treatment is defined as being administered a hOTC as described herein within 8 hours, the first 12 hours, the first 24 hours, or the first 48 hours of delivery.
  • neonatal delivery is within the period of about 12 hours to about 1 week, 2 weeks, 3 weeks, or about 1 month, or after about 24 hours to about 48 hours.
  • neonatal therapy is desirably followed by readministration at about 3 months of age, about 6 months, about 9 months, or about 12 months.
  • readministration may be with the same type of vector, a different viral vector, or via non-viral delivery.
  • an RNA based delivery system for functional hOTC is used to stabilize a subject (e.g., a human patient) in crisis, followed by delivery of a viral vector mediated delivery of a functional hOTC.
  • initial therapy involves co-administration of viral and non-viral - mediated hOTC delivery systems.
  • the hOTC DNA and RNA constructs may be used alone, or in combination with the standard of care for the patient's diagnosis and condition.
  • the inventors have found that heterozygous OTCD subjects, including those with late onset OTCD, have increased fibrosis and/or microvesicular steatosis throughout the liver. Such liver fibrosis and/or microvesicular steatosis can lead to OTCD-related cirrhosis.
  • the invention provides methods of preventing liver fibrosis and/or the associated medical condition OTCD-related cirrhosis by delivering to the subject (e.g., a human patient) a hOTC.
  • This aspect of the invention may utilize a viral or non-viral delivery system.
  • the nucleic acid expression cassette may contain a synthetic hOTC DNA or RNA as provided herein, or another suitable sequence which expresses functional hOTCase.
  • a method of treating and/or preventing liver fibrosis, microvesicular steatosis, and/or OTCD-related cirrhosis which involves delivering OTCase to a subject having OTCD.
  • the subject may be a human patient.
  • the patient is heterozygous and has late onset OTCD.
  • the patient may have been previously untreated for OTCD, or may have received other conventional treatments.
  • the method of the invention provides for treating and/or reversing liver fibrosis and/or OTCD-related cirrhosis by delivering to the subject a functional OTCase which is encoded by an engineered DNA of SEQ ID NO: 1, 3, 4, 5, 8 or 9, or a chimeric DNA as defined herein.
  • Delivery of the DNA may be mediated by a viral vector containing the engineered in an expression cassette, or by a non-viral delivery system, either of which mediates expression of functional OTCase in the liver cells of the subject.
  • the subject is administered an engineered RNA of SEQ ID NO: 10, 11, 12 or 13, or a chimeric RNA as defined herein. Delivery of the RNA may be mediated by a viral vector containing the engineered RNA in an expression cassette, or by a non-viral delivery system, either of which mediates expression of functional OTCase in the liver cells of the subject.
  • the invention provides methods of preventing treating and/or preventing HCC by delivering to the subject (e.g., a human patient) a hOTC.
  • This aspect of the invention may utilize a viral or non-viral delivery system.
  • the nucleic acid expression cassette may contain a synthetic hOTC DNA or RNA as provided herein, or another suitable sequence which and expresses functional hOTCase.
  • treatment of the patient e.g., a first injection
  • treatment of the patient is initiated prior diagnosis with HCC.
  • treatment of the patient is initiated following HCC diagnosis.
  • treatment is involves co-administration with sorafenib (commercially available as Nexavar®), or being used in conjuction with chemoembolization, radiation, thermal ablation, precutanous ethanol injection, targeted therapy (e.g., anti-angiogenesis drugs), hepatic arterial infusion of anti-cancer drugs, immunotherapy, or with surgical options including, e.g., resection, cryosurgery, and liver transplant.
  • non-integrating delivery system e.g., direct RNA delivery, or non-integrating viruses such as adenoviruses or non- integrating lentiviruses
  • a non-integrating delivery system e.g., direct RNA delivery, or non-integrating viruses such as adenoviruses or non- integrating lentiviruses
  • OTCase such as characterized by SEQ ID NO: 2 or another OTCase which provides at least about 50%, at least about 75%, at least about 80%, at least about 90%, or about the same, or greater than 100% of the biological activity level of the wild-type human ornithine transcarbamylase enzyme, which may be characterized by the sequence of SEQ ID NO:2 or a natural variant or polymorph thereof which is not associated with disease. More particularly, as heterozygous patients may have as low an OTCase functional level as about 50% or lower, effective treatment may not require replacement of OTCase activity to levels within the range of "normal" or non-OTCD patients.
  • patients having no detectable amounts of OTCase may be rescued by delivering OTCase function to less than 100% activity levels, and may optionally be subject to further treatment subsequently.
  • the gene therapy described herein whether viral or non-viral, may be used in conjunction with other treatments, i.e., the standard of care for the subject's (patient's) diagnosis.
  • such a functional OTCase has a sequence which has about 95% or greater identity to the mature protein (i.e., about the last 322 amino acids) or full-length sequence of SEQ ID NO: 2, or about 97% identity or greater, or about 99% or greater to SEQ ID NO: 2 at the amino acid level.
  • a functional OTCase may have also encompass natural polymorphs which are not associated with any disease (e.g., FlOl, LI 11, and/or WI193-194 of SEQ ID NO:2).
  • Identity may be determined by preparing an alignment of the sequences and through the use of a variety of algorithms and/or computer programs known in the art or commercially available [e.g., BLAST, ExPASy; ClustalO; FASTA; using, e.g., Needleman-Wunsch algorithm, Smith- Waterman algorithm].
  • OTC enzyme activity can be measured using a liquid chromatography mass spectrometry stable isotope dilution method to detect the formation of citrulline normalized to [1,2,3,4,5-13C5] citrulline (98% 13C).
  • the method is adapted from a previously developed assay for detection of N-acetylglutamate synthase activity [Morizono H, et al, Mammalian N-acetylglutamate synthase. Mol Genet Metab. 2004;81(Suppl 1):S4— 11.].
  • Slivers of fresh frozen liver are weighed and briefly homogenized in buffer containing 10 mM HEPES, 0.5 % Triton X-100, 2.0 mM EDTA and 0.5 mM DTT. Volume of homogenization buffer is adjusted to obtain 50 mg/ml tissue. Enzyme activity is measured using 250 ⁇ g liver tissue in 50 mM Tris-acetate, 4 mM ornithine, 5 mM carbamyl phosphate, pH 8.3.
  • Enzyme activity is initiated with the addition of freshly prepared 50 mM carbamyl phosphate dissolved in 50 mM Tris-acetate pH 8.3, allowed to proceed for 5 minutes at 25 °C and quenched by addition of an equal volume of 5 mMl 3 C5 -citrulline in 30%TCA. Debris is separated by 5 minutes of microcentrifugation, and the supernatants are transferred to vials for mass spectroscopy.
  • liver biopsy may also be used.
  • One such assay is a plasma amino acid assays in which the ratio of glutamine and citrulline is assessed and if glutamine is high (>800 microliters/liter) and citrilluine low (e.g., single digits), a urea cycle defect is suspected.
  • Plasma ammonia levels can be measured and a concentration of about 100 micromoles per liter is indicative of OTCD.
  • Blood gases can be assessed if a patient is hyperventilating; respiratory alkalosis is frequent in OTCD.
  • Orotic acid in urine e.g., greater than about 20 micromoles per millimole creatine is indicative of OTCD, as is elevated urinary orotate after allopurinol challenge test.
  • regulation refers to the ability of a compound of formula (I) to inhibit one or more components of a biological pathway.
  • a "subject” is a mammal, e.g., a human, mouse, rat, guinea pig, dog, cat, horse, cow, pig, or non-human primate, such as a monkey, chimpanzee, baboon or gorilla.
  • disease As used herein, "disease”, “disorder” and “condition” are used interchangeably, to indicate an abnormal state in a subject.
  • pAAVsc.TBG.hOTCwt and pAAVsc.TBG.hOTCco-LW4 were constructed by replacing the mOTC coding sequencing with wild-type (WT) hOTC (hOTCwt) or hOTCcoLW cDNA, respectively, in a plasmid derived from the previously described pAAVsc.TBG.mOTC 1.3 with the intron disrupted [Moscioni D, et al, "Long- term correction of ammonia metabolism and prolonged survival in ornithine
  • the scAAV2/8.TBG.hOTCco-LW4 contains an AAV2 3' IT and a 5'
  • PEI polyethylenimine
  • Genome titers [genome copies (GC)/ml] of AAV vectors were determined by real-time PCR using primer and probe sets targeting the TBG promoter (forward primer 5'-AAACTGCCAATTCCACTGCTG-3' [SEQ ID NO: 14], reverse primer 5 '-CCATAGGCAAAAGCACCAAGA-3 ' [SEQ ID NO:15 ], probe 6FAM- TTGGCCCAATAGTGAGAACTTTTTCCTGC [SEQ ID NO: 16] -TAMRA), and using a linearized plasmid as the standard.
  • the forward primer is located 400bp downstream of the 5' closed hairpin.
  • OTC protein expression levels and OTC activity were evaluated in the liver of spf ⁇ mice 14 days after i.v. injection of l x l O 11 GC of AAV2/8sc.TBG.hOTCwt or AAV2/8sc.TBG.hOTCco-LW4 vectors.
  • the sp 811 mice are a model for late onset OTC disease in humans. All animal procedures were performed in accordance with protocols approved by the Institutional Animal Care and Use Committee (IACUC) of the IACUC.
  • OTC enzyme activity was measured using a liquid chromatography mass spectrometry stable isotope dilution method to detect the formation of citrulline normalized to [1 ,2,3,4,5-13C5] citrulline (98% 13C).
  • the method is adapted from a previously developed assay for detection of N-acetylglutamate synthase activity
  • Slivers of fresh frozen liver were weighed and briefly homogenized in buffer containing 10 mM HEPES, 0.5 % Triton X-100, 2.0 mM EDTA and 0.5 mM DTT. Volume of homogenization buffer was adjusted to obtain 50 mg/ml tissue. Enzyme activity was measured using 250 ⁇ g liver tissue in 50 mM Tris-acetate, 4 mM ornithine, 5 mM carbamyl phosphate, pH 8.3.
  • Enzyme activity was initiated with the addition of freshly prepared 50 mM carbamyl phosphate dissolved in 50 mM Tris-acetate pH 8.3, allowed to proceed for 5 minutes at 25 °C and quenched by addition of an equal volume of 5 mM13C5-citrulline in 30%TCA. Debris was separated by 5 minutes of microcentrifugation, and the supernatants were transferred to vials for mass spectroscopy. Ten of sample was injected into an Agilent 1100 series LC-MS under isocratic conditions with a mobile phase of 93% solvent A (1 ml trifluoroacetic acid in 1 L water):7% solvent B (1ml trifluoroacetic acid in 1L of 1 :9 water/acetonitrile).
  • LW4 The vector carrying engineered hOTC cDNA termed herein LW4 (FIG. 4) was found to improve expressed hOTC protein levels by 100-fold.
  • An assessment of OTC enzyme activity generally correlated with the OTC Western blot experiments although OTC protein was more elevated than OTC enzyme activity when compared to endogenous OTC.
  • the hOTCco-LW4 resulted in over 33 -fold higher activity than the hOTCwt.
  • Sustained and dose-correlated hOTC expression and activity levels were observed in the treated spf ⁇ mice.
  • the vector carrying the hOTCco-LW4 vector was about 10-fold more potent.
  • the illustrative vector carrying the modified hOTCco-LW4 provided high level of transduction, as measured by OTC histological assays, throughout a broad range of doses. Between doses l x l O 11 GC and 3x 10 9 GC, transduction efficiency, as measured by histochemical staining, varied between 50-70%. At the lowest dose of 1 x 10 9 GC, 40% of the liver areas were positive by OTC histochemical staining. The lack of a clear dose effect by histochemistry and immunostaining could be due to the fact that codon optimization significantly improved hOTC expression in the transduced hepatocytes. This leads to improved sensitivity to detect transduced cells with low vector genome copies.
  • Transduction could be saturated with high vector doses (1 ⁇ 10 11 - 1 ⁇ 10 10 GC), and therefore transduction efficiency measured by in situ detection methods would not discriminate between low and high dose groups in contrast to OTC enzyme activity on liver lysates measured by mass spectrometry.
  • pAAVsc.TBG.hOTCco is cloned into an AAV8 capsid [Gao et al, PNAS USA, 2002, 99:11854-11859] using conventional techniques.
  • pAAVsc.TBG.hOTCco are cloned into a AAVrhlO capsid [Gao et al, PNAS USA, 2002, 99:11854-11859] using conventional techniques.
  • Plasmids containing the codon optimized hOTCco sequences are cloned as described by replacing the mOTC coding sequencing of the pLSPlmOTC plasmid [Cunningham et al, Mol Ther, 2009, 17: 1340-1346] with the corresponding cDNA sequence of SEQ ID NO:3, 4, 5, 9 or 10.
  • the resulting plasmids pAAVsc.LSPl .hOTCco are cloned into AAV8 capsids to form the corresponding ssAAV2/8.LSPl .hOTC-co vectors using techniques described in Example 1.
  • Plasmids containing the codon optimized hOTCco sequences are cloned as described by replacing the mOTC coding sequencing of the pLSPlmOTC plasmid [Cunningham et al, Mol Ther, 2009, 17: 1340-1346] with the corresponding cDNA sequence of SEQ ID NO:3, 4, 5, 9 or 10.
  • the resulting plasmids pAAVsc.LSPl .hOTCco are cloned into AAV8 capsids to form the corresponding ssAAV2/8.LSPl .hOTC-co vectors using techniques described in Example 1.
  • the vectors generated according to Part A or B may be purified by two rounds of cesium chloride gradient centrifugation, buffered-exchanged with PBS, and concentrated using Amicon Ultra 15 centrifugal filter devices- 100K (Millipore, Bedford, MA). Genome titer (GC/ml) of AAV vectors can be determined by real-time PCR using a primer/probe set corresponding to the TBG promoter and linearized plasmid standards.
  • Vectors can be subject to additional quality control tests including sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) analysis for vector purity and Limulus amebocyte lysate (LAL) for endotoxin detection (Cambrex Bio Science, Walkersville, MD, USA).
  • SDS-PAGE sodium dodecyl sulfate-polyacrylamide gel electrophoresis
  • LAL Limulus amebocyte lysate
  • An AAV8 vector was generated using the methods described herein.
  • the vector has packaged therein a 5' AAV2 ITR, a TBG promoter, an intron, a hOTCco, a WPRE element, a bovine growth hormone poly A, and a 3' AAV2 ITR.
  • the expression and kinetics of this vector was compared to a self-complementary AAV8 vector with or without the WPRE element.
  • the results show that the single-stranded constructs with the WPRE element outperformed those vectors lacking the WPRE element; at comparable doses both single-stranded vectors (with and without WPRE) were less robust than the self-complementary vector lacking WPRE in the time points measured.
  • the single-stranded vectors may have other desirable properties, e.g., in terms of kinetics, depending upon the age and condition of the patient.
  • hOTCco cDNA [SEQ ID NO: 3, 4, 5, 9 and 10] with Notl linkers is cloned downstream of a rat PEPCK promoter to generate pPEPCK-hOTC as described in A. Mian et al, Molecular Therapy, 2004, 10: 492-499 (2004).
  • This plasmid is digested with Ascl, and the resultant PEPCK-hOTCco fragment is inserted into the adenoviral backbone plasmid pC4HSU31 to generate the parental plasmids pC4HSU-PEPCK- hOTCco.
  • Plasmid pWPRE is digested with Clal to release the WPRE, which is then inserted into the Mlul site of pPEPCK-hOTC, to generate pPEPCK-hOTCco-WPRE plasmid with their respective hOTCco sequences.
  • the remaining steps to generate the adenoviral plasmid pC4HSU-PEPCK-hOTCco-WPRE are as previously described. All cloning sites are confirmed by DNA sequence analysis. The identity of recombinant adenoviral plasmids can be confirmed by restriction enzyme digestion with Hindlll and BamHI. The adenoviral plasmids are linearized with Pmel before transfection into 293Cre4 cells.
  • Adenoviral vectors are rescued and amplified with 293Cre4 cells and helper virus AdLC8cluc. Suspension 293N3Scre8 cells may be used in the final step of vector production. Purification, quantification by OD260 and viral DNA extraction are performed as described in detail elsewhere [Brunetti-Pierri, N., et al. (2004). Acute toxicity after high-dose systemic injection of helper-dependent adenoviral vectors into nonhuman primates. Hum. Gene Ther. 15: 35 ⁇ 16; Ng, P., Parks, R. J. and Graham, F. L. (2002). Preparation of helper-dependent adenoviral vectors. Methods Mol. Med. 69: 371— 388].
  • Replication-defective lentiviral vectors containing the hOTCco sequences provided herein can be produced by replacing the rat OTC gene sequence insert of the plasmid pLenti-GIII-CMV-GFP-2A-Puro [commercially available from Applied Biological Materials (ABM) Inc.; Canada] with the desired hOTCco sequence [SEQ ID NO: 3, 4, 5, 9 and 10].
  • the viruses are generated according to manufacturer instructions.
  • the ABM system includes an enhancer deletion in the U3 region of 3'ALTR to ensure self-inactivation of the lentiviral vector following transduction and integration into the target cell's genomic DNA; contains minimal lentiviral genes necessary for packaging, replication and transduction (Gag/Pol/Rev), derived from different plasmids all lacking packaging signals; further, none of the Gag, Pol, or Rev genes are incorporated into in the packaged viral genome, thus making the mature virus replication-incompetent.
  • a DNA construct containing a liver specific promoter and the hOTCco DNA of SEQ ID NO: 3, 4, 5, 9 and 10 are engineered into lentivirus vectors which are pseudotyped into Sindbis virus E2 enveloped produced as described in US2011/0064763, which is incorporated by reference herein, All vectors contain splice donor, packaging signal (psi), a Rev-responsive element (RRE), splice donor, splice acceptor, central poly-purine tract (cPPT).
  • RRE Rev-responsive element
  • cPPT central poly-purine tract
  • hOTCco DNA of SEQ ID NO: 3, 4, 5 9 and 10 is cloned into a lentivirus pseudotyped with a vesicular stomatitis virus (VSV) envelope gene, purchased from InvivoGen (SanDiego, CA) using manufacturer's instructions.
  • VSV vesicular stomatitis virus
  • RNA may be prepared by in vitro transcription from a DNA template or synthesized.
  • the RNA expression cassette is prepared which includes a 5 ' UTR, an optional intron with splice donor and acceptor sites, an optional Kozak sequence, the hOTC coding sequence provided herein, a polyA, and a 3' UTR using known techniques.
  • a suitable amount of mRNA are incorporated into a lipid- enveloped pH-responsive polymer nanoparticles generated using published techniques. [X. Su et al, Mol. Pharmaceutics, 2011, 8 (3), pp 774-787; web publication: March 21, 2011].
  • PEI polyethyleneimine
  • the required amount of mRNA is diluted just before application in water for injection (Braun, Melsungen) to a total volume of 4 ml and added quickly to 4 ml of an aqueous solution of branched PEI 25 kDa using a pipette at an N/ ' P ratio of 10. The solution is mixed by pipetting tip and down.
  • a lipid formulation is created using expression cassette containing the hOTCco RNA in a formulation of cK - E12:DOPE:Chol:P£G-DMG2.K (relative amounts 50:25:20:5 (mg:mg:mg:mg)) to provide a solution for delivery.
  • the cationic lipid cK -E12 is used (see, e.g., WO 2013/063468), and is combined with dioieoylphosphatidyl-ethanolamine or "DOPE", cholesterol (chol), and polyethylene glycol (PEG) or a PEGylated lipid (PEG-DMG2K) using e fonnuiation methods described i internationai patent publications WO 20 0/053572 and WO 2012/170930, both of which are incoiporated herein by reference.
  • DOPE dioieoylphosphatidyl-ethanolamine
  • chol cholesterol
  • PEG polyethylene glycol
  • PEG-DMG2K PEGylated lipid
  • 4, or 5 are engineered as naked plasmid DNA constructs which are delivered to a target liver cell (e.g., via intravascular administration) and express the human OTC protein in the target cell.
  • Cationic lipid-DNA complexes - Cationic lipid - DNA complexes are prepared using a suitable amount of an expression cassette containing at least a promoter, an optional intron, an optional Kozak sequences, an hOTCco of SEQ ID NO: 3, 4 or 5, a poly A, and other optional expression control sequences.
  • the promoter may be a liver specific promoter. Alternatively, another non-tissue specific promoter may be selected.
  • a suitable amount of DNA is formulated with a cationic lipid of cK - E12:DOPE:Chol:PEG-DMG2K (relative amounts 50:25:20:5 (mg:mg:mg:mg)) to form a cationic lipid - DNA complex suitable for delivery to a subject.
  • the cationic lipid cK -E12 is used (see, e.g., WO 2013/063468), and is combined with
  • DOPE dioleoylphosphatidyl-ethanolamine
  • cholesterol cholesterol
  • PEG polyethylene glycol
  • PEG-DMG2K PEGylated lipid
  • the scAAV8.TBG.hOTCcoLW4 prepared as described in Example 1 was used to rescue animals in a mouse model of neonatal (early) onset OTCD.
  • OTC KO mice were generated through the deletion of exons 2-3, and the properties of this mouse characterized in terms of similarity to human patients with null mutations of OTC.
  • the OTC knockout (KO) model generated in our laboratory through the deletion of exons 2-3 closely mimics the severe neonatal onset form of OTCD in humans.
  • Neonatal male OTC KO pups have elevated plasma ammonia levels due to the absence of OTC expression in the liver, and they inevitably die within 24 hours after birth.
  • a single injection of scAAV8-hOTCco vector prepared as described in Example 1 at a dose of l-3xl0el0 GC/pup immediately after birth is able to rescue the OTC KO pups and extend the life to 6 weeks.
  • mice show close to normal levels of plasma ammonia, although urine orotic acid levels in a subset of these mice were significantly elevated.
  • Sirius red staining on liver samples from heterozygous mice of different ages (6, 12, and 18 months old) showed liver fibrosis in aged (18-month old) OTC-KO heterozygous female mice, similar to a liver sample from a 11 -year-old OTCD patient.
  • a single injection of AAV8sc-hOTCco vector can prevent liver fibrosis in OTC-KO heterozygous and has great potential for correction of liver fibrosis in OTCD patients.
  • Gene therapy vectors described herein are capable of rapid, robust and prolonged gene expression even in mice with a complete lack of OTC.
  • Heterozygous females are able to reproduce and deliver hemizygous male offspring, but these pups die within a day of birth if untreated.
  • Untreated old heterozygous female mice show evidence of increased fibrosis and microvesicular steatosis, a finding that appears similar to observations in human heterozygous patients.
  • a regimen of gene transfer that is able to rescue affected males has been developed and treated males have survived over 72 weeks.
  • liver-specific gene therapy with hOTC can prevent liver fibrosis.
  • These data correlate with in treatment of heterozygous OTC deficient humans, e.g., subjects having late onset of OTCD.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Microbiology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Epidemiology (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Virology (AREA)
  • Hematology (AREA)
  • Diabetes (AREA)
  • Obesity (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)
PCT/US2015/019536 2014-03-09 2015-03-09 Compositions useful in treatment of otc deficency Ceased WO2015138357A2 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
US15/124,620 US9890365B2 (en) 2014-03-09 2015-03-09 Compositions useful in treatment of ornithine transcarbamylase (OTC) deficiency
US15/861,427 US10626382B2 (en) 2014-03-09 2018-01-03 Compositions useful in treatment of ornithine transcarbamylase (OTC) deficiency

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201461950157P 2014-03-09 2014-03-09
US61/950,157 2014-03-09

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US15/124,620 A-371-Of-International US9890365B2 (en) 2014-03-09 2015-03-09 Compositions useful in treatment of ornithine transcarbamylase (OTC) deficiency
US15/861,427 Division US10626382B2 (en) 2014-03-09 2018-01-03 Compositions useful in treatment of ornithine transcarbamylase (OTC) deficiency

Publications (2)

Publication Number Publication Date
WO2015138357A2 true WO2015138357A2 (en) 2015-09-17
WO2015138357A3 WO2015138357A3 (en) 2015-12-10

Family

ID=52737408

Family Applications (2)

Application Number Title Priority Date Filing Date
PCT/US2015/019536 Ceased WO2015138357A2 (en) 2014-03-09 2015-03-09 Compositions useful in treatment of otc deficency
PCT/US2015/019513 Ceased WO2015138348A1 (en) 2014-03-09 2015-03-09 Compositions useful in treatment of ornithine transcarbamylase (otc) deficiency

Family Applications After (1)

Application Number Title Priority Date Filing Date
PCT/US2015/019513 Ceased WO2015138348A1 (en) 2014-03-09 2015-03-09 Compositions useful in treatment of ornithine transcarbamylase (otc) deficiency

Country Status (22)

Country Link
US (6) US10167454B2 (cg-RX-API-DMAC7.html)
EP (2) EP3116900B1 (cg-RX-API-DMAC7.html)
JP (2) JP6822841B2 (cg-RX-API-DMAC7.html)
KR (1) KR102390075B1 (cg-RX-API-DMAC7.html)
AU (2) AU2015229750A1 (cg-RX-API-DMAC7.html)
BR (2) BR112016020688B1 (cg-RX-API-DMAC7.html)
CA (1) CA2939950C (cg-RX-API-DMAC7.html)
CL (2) CL2016002235A1 (cg-RX-API-DMAC7.html)
CY (1) CY1123378T1 (cg-RX-API-DMAC7.html)
DK (1) DK3116900T3 (cg-RX-API-DMAC7.html)
ES (1) ES2821938T3 (cg-RX-API-DMAC7.html)
HR (1) HRP20201544T1 (cg-RX-API-DMAC7.html)
HU (1) HUE051311T2 (cg-RX-API-DMAC7.html)
IL (2) IL247329B (cg-RX-API-DMAC7.html)
LT (1) LT3116900T (cg-RX-API-DMAC7.html)
MX (1) MX377804B (cg-RX-API-DMAC7.html)
PL (1) PL3116900T3 (cg-RX-API-DMAC7.html)
PT (1) PT3116900T (cg-RX-API-DMAC7.html)
RS (1) RS60902B1 (cg-RX-API-DMAC7.html)
SI (1) SI3116900T1 (cg-RX-API-DMAC7.html)
SM (1) SMT202000531T1 (cg-RX-API-DMAC7.html)
WO (2) WO2015138357A2 (cg-RX-API-DMAC7.html)

Cited By (18)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9890365B2 (en) 2014-03-09 2018-02-13 The Trustees Of The University Of Pennsylvania Compositions useful in treatment of ornithine transcarbamylase (OTC) deficiency
WO2018127382A1 (en) * 2017-01-03 2018-07-12 Ethris Gmbh Ornithine transcarbamylase coding polyribonucleotides and formulations thereof
WO2019104152A1 (en) * 2017-11-22 2019-05-31 Modernatx, Inc. Polynucleotides encoding ornithine transcarbamylase for the treatment of urea cycle disorders
WO2020018583A1 (en) 2018-07-16 2020-01-23 Selecta Biosciences, Inc. Methods and compositions of otc constructs and vectors
US10646582B2 (en) 2013-07-30 2020-05-12 Genevant Sciences Gmbh Block copolymers
US11219634B2 (en) 2015-01-21 2022-01-11 Genevant Sciences Gmbh Methods, compositions, and systems for delivering therapeutic and diagnostic agents into cells
US11235057B2 (en) 2011-04-29 2022-02-01 Selecta Biosciences, Inc. Methods for providing polymeric synthetic nanocarriers for generating antigen-specific tolerance immune responses
US11298342B2 (en) 2013-05-03 2022-04-12 Selecta Biosciences, Inc. Methods providing a therapeutic macromolecule and synthetic nanocarriers comprising immunosuppressant locally and concomitantly to reduce both type I and type IV hypersensitivity
WO2022165313A1 (en) 2021-02-01 2022-08-04 Regenxbio Inc. Gene therapy for neuronal ceroid lipofuscinoses
US11426451B2 (en) 2017-03-11 2022-08-30 Selecta Biosciences, Inc. Methods and compositions related to combined treatment with antiinflammatories and synthetic nanocarriers comprising an immunosuppressant
US11584780B2 (en) 2016-07-26 2023-02-21 Biomarin Pharmaceutical Inc. Adeno-associated virus capsid proteins
US11633422B2 (en) 2014-09-07 2023-04-25 Selecta Biosciences, Inc. Methods and compositions for attenuating anti-viral transfer vector immune responses
US11684584B2 (en) 2016-12-30 2023-06-27 Genevant Sciences Gmbh Branched peg molecules and related compositions and methods
US11685906B2 (en) 2018-12-06 2023-06-27 Arcturus Therapeutics, Inc. Compositions and methods for treating ornithine transcarbamylase deficiency
US11739345B2 (en) 2018-05-09 2023-08-29 Biomarin Pharmaceutical Inc. Methods of treating phenylketonuria
US11821008B2 (en) 2018-05-14 2023-11-21 Biomarin Pharmaceutical Inc. Liver targeting adeno-associated viral vectors
EP4114470A4 (en) * 2020-03-03 2024-04-17 Arcturus Therapeutics, Inc. Compositions and methods for the treatment of ornithine transcarbamylase deficiency
US12508249B2 (en) 2020-04-24 2025-12-30 Cartesian Therapeutics Inc. Methods related to administering immunosuppressants and non-allergenic antigens to reduce or prevent anaphylaxis

Families Citing this family (24)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
RU2020109343A (ru) 2014-11-05 2020-03-17 Вояджер Терапьютикс, Инк. Полинуклеотиды aadc для лечения болезни паркинсона
WO2017059902A1 (en) * 2015-10-07 2017-04-13 Biontech Rna Pharmaceuticals Gmbh 3' utr sequences for stabilization of rna
EP3452101A2 (en) 2016-05-04 2019-03-13 CureVac AG Rna encoding a therapeutic protein
IL315358A (en) 2016-08-18 2024-11-01 Univ California CRISPR-CAS genome engineering using a modular AAV delivery system
EP3538136A1 (en) * 2016-11-10 2019-09-18 Translate Bio, Inc. Subcutaneous delivery of messenger rna
WO2018126112A1 (en) * 2016-12-30 2018-07-05 The Trustees Of The University Of Pennsylvania Gene therapy for treating phenylketonuria
DK3568483T3 (da) * 2017-01-10 2025-11-10 Childrens Medical Res Institute Polynukleotider og vektorer til ekspression af transgener
US11530402B2 (en) 2017-05-31 2022-12-20 The University Of North Carolina At Chapel Hill Optimized human clotting factor IX gene expression cassettes and their use
JOP20190269A1 (ar) 2017-06-15 2019-11-20 Voyager Therapeutics Inc بولي نوكليوتيدات aadc لعلاج مرض باركنسون
KR20250040746A (ko) 2017-08-09 2025-03-24 바이오버라티브 테라퓨틱스 인크. 핵산 분자 및 이의 용도
WO2019222277A1 (en) * 2018-05-15 2019-11-21 Translate Bio, Inc. Subcutaneous delivery of messenger rna
CA3099306A1 (en) 2018-05-15 2019-11-21 Voyager Therapeutics, Inc. Compositions and methods for the treatment of parkinson's disease
SG11202100139VA (en) 2018-07-17 2021-02-25 Neuromyon Inc Treatment of neuropathy with dna constructs expressing igf-1 isoforms
JP7602454B2 (ja) 2018-08-09 2024-12-18 バイオベラティブ セラピューティクス インコーポレイテッド 核酸分子及び非ウイルス遺伝子治療のためのそれらの使用
EP3856762A1 (en) 2018-09-28 2021-08-04 Voyager Therapeutics, Inc. Frataxin expression constructs having engineered promoters and methods of use thereof
AU2020216480A1 (en) 2019-01-31 2021-09-09 Oregon Health & Science University Methods for using transcription-dependent directed evolution of AAV capsids
CA3169529A1 (en) * 2020-03-04 2021-09-10 Jingjing Jiang Compositions and methods for the treatment of metabolic liver disorders
EP4121544A1 (en) * 2020-03-19 2023-01-25 Ultragenyx Pharmaceutical Inc. Compositions and methods for reducing reverse packaging of cap and rep sequences in recombinant aav
BR112022022212A2 (pt) 2020-05-12 2022-12-13 Univ Pennsylvania Composições para redução específica de drg de expressão de transgene
WO2022224372A1 (ja) * 2021-04-21 2022-10-27 学校法人自治医科大学 オルニチントランスカルバミラーゼ欠損症の治療用アデノ随伴ウイルスビリオン
WO2023028455A1 (en) * 2021-08-23 2023-03-02 Bioverativ Therapeutics Inc. Closed-end dna production with inverted terminal repeat sequences
US20250295807A1 (en) 2021-11-15 2025-09-25 The Trustees Of The University Of Pennsylvania Compositions for drg-specific reduction of transgene expression
US20250161493A1 (en) * 2022-01-21 2025-05-22 The Trustees Of The University Of Pennsylvania Compositions and methods for in vivo nuclease-mediated treatment of ornithine transcarbamylase (otc) deficiency
CA3268024A1 (en) * 2022-10-11 2024-04-18 Pacific Northwest Research Institute CONSTRUCTIONS RELATED TO GENETIC DISORDERS

Family Cites Families (81)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US1016745A (en) 1911-04-11 1912-02-06 Edwin C Henrikson Table-caster.
US5139941A (en) 1985-10-31 1992-08-18 University Of Florida Research Foundation, Inc. AAV transduction vectors
US5436146A (en) 1989-09-07 1995-07-25 The Trustees Of Princeton University Helper-free stocks of recombinant adeno-associated virus vectors
US6268213B1 (en) 1992-06-03 2001-07-31 Richard Jude Samulski Adeno-associated virus vector and cis-acting regulatory and promoter elements capable of expressing at least one gene and method of using same for gene therapy
US5869305A (en) 1992-12-04 1999-02-09 The University Of Pittsburgh Recombinant viral vector system
US6204059B1 (en) 1994-06-30 2001-03-20 University Of Pittsburgh AAV capsid vehicles for molecular transfer
US5856152A (en) 1994-10-28 1999-01-05 The Trustees Of The University Of Pennsylvania Hybrid adenovirus-AAV vector and methods of use therefor
US5652224A (en) 1995-02-24 1997-07-29 The Trustees Of The University Of Pennsylvania Methods and compositions for gene therapy for the treatment of defects in lipoprotein metabolism
US5741683A (en) 1995-06-07 1998-04-21 The Research Foundation Of State University Of New York In vitro packaging of adeno-associated virus DNA
US6093570A (en) 1995-06-07 2000-07-25 The University Of North Carolina At Chapel Hill Helper virus-free AAV production
AU722375B2 (en) 1996-09-06 2000-08-03 Trustees Of The University Of Pennsylvania, The Methods using cre-lox for production of recombinant adeno-associated viruses
US20020037867A1 (en) 1999-02-26 2002-03-28 James M. Wilson Method for recombinant adeno-associated virus-directed gene therapy
ES2344660T3 (es) 1996-09-06 2010-09-02 The Trustees Of The University Of Pennsylvania Uso de virus adeno-asociados recombinantes en la preparacion de un medicamento para la terapia genica mediante celulas musculares.
JP2001500015A (ja) 1996-09-06 2001-01-09 トラステイーズ・オブ・ザ・ユニバーシテイ・オブ・ペンシルベニア T7ポリメラーゼを利用する組換えアデノ随伴ウイルスの誘導可能な製造方法
US5866552A (en) 1996-09-06 1999-02-02 The Trustees Of The University Of Pennsylvania Method for expressing a gene in the absence of an immune response
WO1998011244A2 (en) 1996-09-11 1998-03-19 The Government Of The United States Of America, Represented By The Secretary, Department Of Health And Human Services Aav4 vector and uses thereof
WO1998024924A1 (en) 1996-12-05 1998-06-11 Introgene B.V. Genetic modification of primate hemopoietic repopulating stem cells
WO1998044151A1 (en) 1997-04-01 1998-10-08 Glaxo Group Limited Method of nucleic acid amplification
AU728220B2 (en) 1997-04-14 2001-01-04 Cell Genesys, Inc. Methods for increasing the efficiency of recombinant AAV product
US6156303A (en) 1997-06-11 2000-12-05 University Of Washington Adeno-associated virus (AAV) isolates and AAV vectors derived therefrom
US6251677B1 (en) 1997-08-25 2001-06-26 The Trustees Of The University Of Pennsylvania Hybrid adenovirus-AAV virus and methods of use thereof
CA2304168A1 (en) 1997-09-19 1999-04-01 The Trustees Of The University Of Pennsylvania Methods and cell line useful for production of recombinant adeno-associated viruses
CA2304131A1 (en) 1997-09-19 1999-04-01 James M. Wilson Method for gene transfer using bcl2 and compositions useful therein
AU9319198A (en) 1997-09-19 1999-04-05 Trustees Of The University Of Pennsylvania, The Methods and vector constructs useful for production of recombinant aav
AU3097399A (en) 1998-03-20 1999-10-11 Trustees Of The University Of Pennsylvania, The Compositions and methods for helper-free production of recombinant adeno-associated viruses
US6953690B1 (en) 1998-03-20 2005-10-11 The Trustees Of The University Of Pennsylvania Compositions and methods for helper-free production of recombinant adeno-associated viruses
EP1080218A1 (en) 1998-05-27 2001-03-07 University of Florida Method of preparing recombinant adeno-associated virus compositions by using an iodixanol gradient
ES2313784T3 (es) 1998-05-28 2009-03-01 The Government Of The Usa, As Represented By The Secretary, Department Of Health And Human Services Vector aav5 y usos del mismo.
EP1127150B1 (en) 1998-11-05 2007-05-16 The Trustees Of The University Of Pennsylvania Adeno-associated virus serotype 1 nucleic acid sequences, vectors and host cells containing same
US6759237B1 (en) 1998-11-05 2004-07-06 The Trustees Of The University Of Pennsylvania Adeno-associated virus serotype 1 nucleic acid sequences, vectors and host cells containing same
WO2000028004A1 (en) 1998-11-10 2000-05-18 The University Of North Carolina At Chapel Hill Virus vectors and methods of making and administering the same
US6387368B1 (en) 1999-02-08 2002-05-14 The Trustees Of The University Of Pennsylvania Hybrid adenovirus-AAV virus and methods of use thereof
US6258595B1 (en) 1999-03-18 2001-07-10 The Trustees Of The University Of Pennsylvania Compositions and methods for helper-free production of recombinant adeno-associated viruses
JP4693244B2 (ja) 1999-03-18 2011-06-01 ザ・トラステイーズ・オブ・ザ・ユニバーシテイ・オブ・ペンシルベニア 組換えアデノ随伴ウイルスのヘルパー無しの生産のための組成物および方法
JP2003501067A (ja) 1999-06-02 2003-01-14 トラステイーズ・オブ・ザ・ユニバーシテイ・オブ・ペンシルベニア ヘルパーウイルスを要求する組み換えウイルス産生のために有用な組成物及び方法
CA2379166C (en) 1999-08-09 2013-03-26 Targeted Genetics Corporation Enhancement of expression of a single-stranded, heterologous nucleotide sequence from recombinant viral vectors by designing the sequence such that it forms instrastrand base pairs
US6365394B1 (en) 1999-09-29 2002-04-02 The Trustees Of The University Of Pennsylvania Cell lines and constructs useful in production of E1-deleted adenoviruses in absence of replication competent adenovirus
CA2384814A1 (en) 1999-09-29 2001-04-05 The Trustees Of The University Of Pennsylvania Methods for rapid peg-modification of viral vectors, compositions for enhanced gene transduction, compositions with enhanced physical stability, and uses therefor
US7115391B1 (en) 1999-10-01 2006-10-03 Genovo, Inc. Production of recombinant AAV using adenovirus comprising AAV rep/cap genes
CA2385823A1 (en) 1999-10-01 2001-04-12 Haifeng Chen Production of recombinant aav using adenovirus comprising aav rep/cap genes
CA2392537A1 (en) 1999-12-03 2001-06-07 The Trustees Of The University Of Pennsylvania Compositions and methods for increasing packaging and yields of recombinant adenoviruses using multiple packaging signals
US6821512B1 (en) 1999-12-03 2004-11-23 The Trustees Of The University Of Pennsylvania Compositions and methods for increasing packaging and yield of recombinant adenoviruses using multiple packaging signals
US6855314B1 (en) 2000-03-22 2005-02-15 The United States Of America As Represented By The Department Of Health And Human Services AAV5 vector for transducing brain cells and lung cells
US6468524B1 (en) 2000-03-22 2002-10-22 The United States Of America, As Represented By The Secretary Of The Department Of Health And Human Services AAV4 vector and uses thereof
US7056502B2 (en) 2000-04-28 2006-06-06 The Trustees Of The University Of Pennsylvania Recombinant aav vectors with AAV5 capsids and AAV5 vectors pseudotyped in heterologous capsids
US20060057553A1 (en) * 2000-05-30 2006-03-16 Estuardo Aguilar-Cordova Chimeric viral vectors for gene therapy
US7201898B2 (en) 2000-06-01 2007-04-10 The University Of North Carolina At Chapel Hill Methods and compounds for controlled release of recombinant parvovirus vectors
JP2004520812A (ja) 2000-08-30 2004-07-15 ハプロゲン・エルエルシー 対立遺伝子を決定するための方法
ATE403013T1 (de) 2001-05-18 2008-08-15 Wisconsin Alumni Res Found Verfahren zur synthese von dna-sequenzen die photolabile linker verwenden
EP1478772A2 (en) * 2001-08-14 2004-11-24 The General Hospital Corporation Nucleic acid and amino acid sequences involved in pain
US20040086485A1 (en) * 2001-10-04 2004-05-06 Aguilar-Cordova Carlos Estuardo Chemeric viral vectors for gene therapy
MX346493B (es) 2001-11-13 2017-03-21 Univ Pennsylvania Un metodo para detectar y/o identificar secuencias del virus adeno-asociado y aislamiento de secuencias novedosas identificadas de ese modo.
JP4810062B2 (ja) 2001-12-17 2011-11-09 ザ・トラステイーズ・オブ・ザ・ユニバーシテイ・オブ・ペンシルベニア アデノ随伴ウイルス(aav)血清型8の配列
ES2526341T3 (es) 2001-12-17 2015-01-09 The Trustees Of The University Of Pennsylvania Secuencias de serotipo 9 de virus adeno-asociado (AAV), vectores que las contienen, y usos de las mismas
AU2002367943A1 (en) 2001-12-18 2003-12-22 University Of North Carolina At Chapel Hill Improved reagents and methods for producing parvoviruses
US20070015238A1 (en) 2002-06-05 2007-01-18 Snyder Richard O Production of pseudotyped recombinant AAV virions
CN102199626B (zh) 2003-09-30 2015-06-24 宾夕法尼亚大学托管会 腺伴随病毒(aav)进化支、序列、含有这些序列的载体及它们的应用
EP2383346B1 (en) 2005-04-07 2014-10-08 The Trustees of the University of Pennsylvania Modified AAVrh.64 capsids, compositions containing same and uses thereof
EP1777906A1 (en) 2005-06-09 2007-04-25 Matsushita Electric Industrial Co., Ltd. Amplitude error compensating apparatus and orthogonality error compensating apparatus
US7588772B2 (en) 2006-03-30 2009-09-15 Board Of Trustees Of The Leland Stamford Junior University AAV capsid library and AAV capsid proteins
WO2008118212A2 (en) 2006-11-08 2008-10-02 Veritas, Llc In vivo delivery of double stranded rna to a target cell
EP2058401A1 (en) 2007-10-05 2009-05-13 Genethon Widespread gene delivery to motor neurons using peripheral injection of AAV vectors
EP3586868B1 (en) 2008-04-22 2023-11-08 Vib Vzw Liver-specific nucleic acid regulatory elements and methods and use thereof
CA3065577C (en) 2008-05-13 2022-05-31 Phaserx, Inc. Diblock copolymers and polynucleotide complexes thereof for delivery into cells
JP2012507581A (ja) 2008-11-06 2012-03-29 ユニヴァーシティ オブ ワシントン 二重特異性細胞内送達媒体
BRPI0921357A2 (pt) 2008-11-06 2016-06-21 Phaserx Inc copolímeros em multibloco
CN104910025B (zh) 2008-11-07 2019-07-16 麻省理工学院 氨基醇类脂质和其用途
SG177744A1 (en) 2009-07-24 2012-02-28 Immune Design Corp Lentiviral vectors pseudotyped with a sindbis virus envelope glycoprotein
EP2281579A1 (en) 2009-08-05 2011-02-09 BioNTech AG Vaccine composition comprising 5'-Cap modified RNA
US9315825B2 (en) 2010-03-29 2016-04-19 The Trustees Of The University Of Pennsylvania Pharmacologically induced transgene ablation system
EP2553106A2 (en) 2010-03-29 2013-02-06 The Trustees Of The University Of Pennsylvania Pharmacologically induced transgene ablation system
KR101811771B1 (ko) 2011-05-12 2017-12-22 히다치 겡키 가부시키 가이샤 건설기계
EP2717893B1 (en) 2011-06-08 2019-05-08 Translate Bio, Inc. Lipid nanoparticle compositions and methods for mrna delivery
FR2977562B1 (fr) 2011-07-06 2016-12-23 Gaztransport Et Technigaz Cuve etanche et thermiquement isolante integree dans une structure porteuse
WO2013063468A1 (en) 2011-10-27 2013-05-02 Massachusetts Institute Of Technology Amino acid derivates functionalized on the n- terminal capable of forming drug incapsulating microspheres
WO2013143555A1 (en) 2012-03-26 2013-10-03 Biontech Ag Rna formulation for immunotherapy
AU2013243949A1 (en) * 2012-04-02 2014-10-30 Moderna Therapeutics, Inc. Modified polynucleotides for the production of biologics and proteins associated with human disease
WO2013151663A1 (en) * 2012-04-02 2013-10-10 modeRNA Therapeutics Modified polynucleotides for the production of membrane proteins
WO2013182683A1 (en) 2012-06-08 2013-12-12 Ethris Gmbh Pulmonary delivery of messenger rna
CA3160394C (en) * 2013-07-30 2023-11-07 Genevant Sciences Gmbh Block copolymers and their conjugates or complexes with oligonucleotides
MX377804B (es) * 2014-03-09 2025-03-11 Univ Pennsylvania Composiciones utiles en el tratamiento de deficiencia de la ornitina transcarbamilasa (otc).

Cited By (32)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11717569B2 (en) 2011-04-29 2023-08-08 Selecta Biosciences, Inc. Tolerogenic synthetic nanocarriers
US11235057B2 (en) 2011-04-29 2022-02-01 Selecta Biosciences, Inc. Methods for providing polymeric synthetic nanocarriers for generating antigen-specific tolerance immune responses
US11779641B2 (en) 2011-04-29 2023-10-10 Selecta Biosciences, Inc. Tolerogenic synthetic nanocarriers for allergy therapy
US12472167B2 (en) 2013-05-03 2025-11-18 Cartesian Therapeutics, Inc. Methods providing a therapeutic macromolecule and synthetic nanocarriers comprising immunosuppressant locally and concomitantly to reduce both Type 1 and Type IV hypersensitivity
US11298342B2 (en) 2013-05-03 2022-04-12 Selecta Biosciences, Inc. Methods providing a therapeutic macromolecule and synthetic nanocarriers comprising immunosuppressant locally and concomitantly to reduce both type I and type IV hypersensitivity
US10646582B2 (en) 2013-07-30 2020-05-12 Genevant Sciences Gmbh Block copolymers
US10660970B2 (en) 2013-07-30 2020-05-26 Genevant Sciences Gmbh Nucleic acid constructs and methods of using the same
US11938191B2 (en) 2013-07-30 2024-03-26 Genevant Sciences Gmbh Block copolymers
US9890365B2 (en) 2014-03-09 2018-02-13 The Trustees Of The University Of Pennsylvania Compositions useful in treatment of ornithine transcarbamylase (OTC) deficiency
US10781430B2 (en) 2014-03-09 2020-09-22 The Trustees Of The University Of Pennsylvania Compositions useful in treatment of ornithine transcarbamylase (OTC) deficiency
US11732246B2 (en) 2014-03-09 2023-08-22 The Trustees Of The University Of Pennsylvania Compositions useful in treatment of ornithine transcarbamylase (OTC) deficiency
US10626382B2 (en) 2014-03-09 2020-04-21 The Trustees Of The University Of Pennsylvania Compositions useful in treatment of ornithine transcarbamylase (OTC) deficiency
US10167454B2 (en) 2014-03-09 2019-01-01 The Trustees Of The University Of Pennsylvania Compositions useful in treatment of ornithine transcarbamylase (OTC) deficiency
US11633422B2 (en) 2014-09-07 2023-04-25 Selecta Biosciences, Inc. Methods and compositions for attenuating anti-viral transfer vector immune responses
US11219634B2 (en) 2015-01-21 2022-01-11 Genevant Sciences Gmbh Methods, compositions, and systems for delivering therapeutic and diagnostic agents into cells
US11584780B2 (en) 2016-07-26 2023-02-21 Biomarin Pharmaceutical Inc. Adeno-associated virus capsid proteins
US11684584B2 (en) 2016-12-30 2023-06-27 Genevant Sciences Gmbh Branched peg molecules and related compositions and methods
WO2018127382A1 (en) * 2017-01-03 2018-07-12 Ethris Gmbh Ornithine transcarbamylase coding polyribonucleotides and formulations thereof
US11104887B2 (en) 2017-01-03 2021-08-31 Ethris Gmbh Ornithine transcarbamylase coding polyribonucleotides and formulations thereof
US12194078B2 (en) 2017-03-11 2025-01-14 Cartesian Therapeutics, Inc. Methods and compositions related to combined treatment with anti-inflammatories and synthetic nanocarriers comprising an immunosuppressant
US11426451B2 (en) 2017-03-11 2022-08-30 Selecta Biosciences, Inc. Methods and compositions related to combined treatment with antiinflammatories and synthetic nanocarriers comprising an immunosuppressant
US11859215B2 (en) 2017-11-22 2024-01-02 Modernatx, Inc. Polynucleotides encoding ornithine transcarbamylase for the treatment of urea cycle disorders
WO2019104152A1 (en) * 2017-11-22 2019-05-31 Modernatx, Inc. Polynucleotides encoding ornithine transcarbamylase for the treatment of urea cycle disorders
US11739345B2 (en) 2018-05-09 2023-08-29 Biomarin Pharmaceutical Inc. Methods of treating phenylketonuria
US11821008B2 (en) 2018-05-14 2023-11-21 Biomarin Pharmaceutical Inc. Liver targeting adeno-associated viral vectors
WO2020018583A1 (en) 2018-07-16 2020-01-23 Selecta Biosciences, Inc. Methods and compositions of otc constructs and vectors
US11685906B2 (en) 2018-12-06 2023-06-27 Arcturus Therapeutics, Inc. Compositions and methods for treating ornithine transcarbamylase deficiency
US12398379B2 (en) 2018-12-06 2025-08-26 Arcturus Therapeutics, Inc. Compositions and methods for treating ornithine transcarbamylase deficiency
EP4114470A4 (en) * 2020-03-03 2024-04-17 Arcturus Therapeutics, Inc. Compositions and methods for the treatment of ornithine transcarbamylase deficiency
US12351834B2 (en) 2020-03-03 2025-07-08 Arcturus Therapeutics, Inc. Compositions and methods for the treatment of ornithine transcarbamylase deficiency
US12508249B2 (en) 2020-04-24 2025-12-30 Cartesian Therapeutics Inc. Methods related to administering immunosuppressants and non-allergenic antigens to reduce or prevent anaphylaxis
WO2022165313A1 (en) 2021-02-01 2022-08-04 Regenxbio Inc. Gene therapy for neuronal ceroid lipofuscinoses

Also Published As

Publication number Publication date
JP6822841B2 (ja) 2021-01-27
WO2015138357A3 (en) 2015-12-10
US9890365B2 (en) 2018-02-13
US11732246B2 (en) 2023-08-22
US10167454B2 (en) 2019-01-01
IL247329B (en) 2020-07-30
HRP20201544T1 (hr) 2021-02-19
EP3778627A1 (en) 2021-02-17
US20170051259A1 (en) 2017-02-23
EP3116900B1 (en) 2020-07-08
US20180135030A1 (en) 2018-05-17
KR102390075B1 (ko) 2022-04-26
PL3116900T3 (pl) 2021-03-08
KR20160124229A (ko) 2016-10-26
LT3116900T (lt) 2020-12-10
BR122023023004A2 (pt) 2023-12-26
BR112016020688A2 (pt) 2017-10-03
IL275799B2 (en) 2023-02-01
RS60902B1 (sr) 2020-11-30
ES2821938T3 (es) 2021-04-28
CL2016002235A1 (es) 2017-06-23
JP2017512466A (ja) 2017-05-25
NZ761706A (en) 2024-04-26
NZ724165A (en) 2024-04-26
MX377804B (es) 2025-03-11
AU2020201190A1 (en) 2020-03-05
WO2015138348A1 (en) 2015-09-17
EP3116900A1 (en) 2017-01-18
MX2016011686A (es) 2016-11-07
SI3116900T1 (sl) 2021-02-26
AU2020201190B2 (en) 2022-04-07
US20170021037A1 (en) 2017-01-26
IL275799B (en) 2022-10-01
CA2939950A1 (en) 2015-09-17
CA2939950C (en) 2023-08-22
US20230416700A1 (en) 2023-12-28
JP6920500B2 (ja) 2021-08-18
US10781430B2 (en) 2020-09-22
DK3116900T3 (da) 2020-09-28
BR112016020688B1 (pt) 2024-01-30
US10626382B2 (en) 2020-04-21
CL2019002280A1 (es) 2019-11-29
HUE051311T2 (hu) 2021-03-01
CY1123378T1 (el) 2021-12-31
IL247329A0 (en) 2016-09-29
SMT202000531T1 (it) 2020-11-10
JP2020114235A (ja) 2020-07-30
US20200377866A1 (en) 2020-12-03
IL275799A (en) 2020-08-31
PT3116900T (pt) 2020-10-08
AU2015229750A1 (en) 2016-09-15
US20190071651A1 (en) 2019-03-07

Similar Documents

Publication Publication Date Title
US20230416700A1 (en) Compositions useful in treatment of ornithine transcarbamylase (otc) deficiency
US20220265861A1 (en) Adeno-associated viral vectors useful in treatment of spinal muscular atropy
WO2020257731A1 (en) Compositions and methods for treatment of maple syrup urine disease
EP4555087A2 (en) Compositions and methods for in vivo nuclease-mediated gene targeting for the treatment of genetic disorders in adult patients
EP4255500A1 (en) Compositions and uses thereof for treatment of angelman syndrome
WO2025217186A1 (en) Compositions and methods for in vivo nuclease-mediated treatment of citrullinemia type 1 (ctln1)
EP4469584A1 (en) Aav capsids for improved heart transduction and detargeting of liver
AU2022290521A1 (en) Recombinant adeno-associated viruses for lesch-nyhan disorders and uses thereof

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 15761461

Country of ref document: EP

Kind code of ref document: A2

WWE Wipo information: entry into national phase

Ref document number: 15124620

Country of ref document: US

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 15761461

Country of ref document: EP

Kind code of ref document: A2