WO2015058018A1 - Chimeric receptor that triggers antibody-dependent cell cytotoxicity against multiple tumors - Google Patents

Chimeric receptor that triggers antibody-dependent cell cytotoxicity against multiple tumors Download PDF

Info

Publication number
WO2015058018A1
WO2015058018A1 PCT/US2014/060999 US2014060999W WO2015058018A1 WO 2015058018 A1 WO2015058018 A1 WO 2015058018A1 US 2014060999 W US2014060999 W US 2014060999W WO 2015058018 A1 WO2015058018 A1 WO 2015058018A1
Authority
WO
WIPO (PCT)
Prior art keywords
cells
cell
lymphocytes
cancer
antibody
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2014/060999
Other languages
English (en)
French (fr)
Inventor
Dario Campana
Ko KUDO
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
National University of Singapore
St Jude Childrens Research Hospital
Original Assignee
National University of Singapore
St Jude Childrens Research Hospital
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to CA2926267A priority Critical patent/CA2926267C/en
Priority to SG11201602979RA priority patent/SG11201602979RA/en
Priority to AU2014337195A priority patent/AU2014337195B2/en
Priority to KR1020167012468A priority patent/KR102308597B1/ko
Priority to JP2016524494A priority patent/JP6417413B2/ja
Priority to BR112016007695A priority patent/BR112016007695A2/pt
Application filed by National University of Singapore, St Jude Childrens Research Hospital filed Critical National University of Singapore
Priority to CN201480057323.2A priority patent/CN105683214B/zh
Priority to EP14854582.5A priority patent/EP3057986B1/en
Publication of WO2015058018A1 publication Critical patent/WO2015058018A1/en
Priority to IL245088A priority patent/IL245088A0/en
Anticipated expiration legal-status Critical
Priority to ZA2016/02798A priority patent/ZA201602798B/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/14Blood; Artificial blood
    • A61K35/17Lymphocytes; B-cells; T-cells; Natural killer cells; Interferon-activated or cytokine-activated lymphocytes
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/16Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/1703Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • A61K38/1709Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/16Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/177Receptors; Cell surface antigens; Cell surface determinants
    • A61K38/1774Immunoglobulin superfamily (e.g. CD2, CD4, CD8, ICAM molecules, B7 molecules, Fc-receptors, MHC-molecules)
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00Cellular immunotherapy
    • A61K40/10Cellular immunotherapy characterised by the cell type used
    • A61K40/11T-cells, e.g. tumour infiltrating lymphocytes [TIL] or regulatory T [Treg] cells; Lymphokine-activated killer [LAK] cells
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • A61P35/02Antineoplastic agents specific for leukemia
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70503Immunoglobulin superfamily
    • C07K14/70517CD8
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70503Immunoglobulin superfamily
    • C07K14/70535Fc-receptors, e.g. CD16, CD32, CD64 (CD2314/705F)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/62DNA sequences coding for fusion proteins
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06Animal cells or tissues; Human cells or tissues
    • C12N5/0602Vertebrate cells
    • C12N5/0634Cells from the blood or the immune system
    • C12N5/0636T lymphocytes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06Animal cells or tissues; Human cells or tissues
    • C12N5/0602Vertebrate cells
    • C12N5/0634Cells from the blood or the immune system
    • C12N5/0646Natural killers cells [NK], NKT cells
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/505Medicinal preparations containing antigens or antibodies comprising antibodies
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide

Definitions

  • the present disclosure is directed to a chimeric receptor that binds the Fc portion of human immunoglobulin and delivers activation signals.
  • the chimeric receptor of the present disclosure comprises the high-affinity V158 FCGR3A variant, the hinge and transmembrane domains of CD8cc, and the signaling domains of CD3 ⁇ and 4-lBB.
  • the chimeric receptor of the present disclosure has a high affinity for Rituximab, Trastuzumab, hul4.18K322A, and other therapeutic antibodies, making it useful for augmenting the efficacy of antibody therapy against various cancers.
  • T-lymphocytes can exert major anti-tumor effects as demonstrated by results of allogeneic hematopoietic stem cell transplantation (HSCT) for hematologic malignancies, where T-cell-mediated graft- versus-host disease (GvHD) is inversely associated with disease recurrence, and immunosuppression withdrawal or infusion of donor lymphocytes can contain relapse Weiden et al., N. Engl. J. Med. 1979; 300(19): 1068-1073; Porter et al., N. Engl. J. Med.
  • HSCT allogeneic hematopoietic stem cell transplantation
  • T lymphocytes can be skewed towards cancer cells by the expression of chimeric signaling receptors with antibody recognition properties: ligation of the cognate target results in T-cell activation and triggers cytotoxicity Eshhar et al., Proc. Natl. Acad. Sci. USA. 1993; 90(2):720-724; Geiger et al., /. Immunol.
  • Another approach to cancer immunotherapy is the administration of monoclonal antibodies which can exert cytotoxicity through a variety of mechanisms including induction of pro-apoptotic signals, complement fixation and antibody-dependent cell cytotoxicity (ADCC) Yu et al., N. Engl. J. Med. 2010; 363(14):1324-1334; Ferris et al., J. Clin. Oncol. 2010;
  • FcyRIIIa FcyRIIIa
  • V valine
  • the present disclosure is based, at least in part, on the development of novel chimeric receptors for use in, e.g., cancer therapy. Accordingly, provided herein are chimeric receptors, nucleic acids encoding such, vectors comprising the encoding nucleic acids, host cells expressing the chimeric receptors, and uses of such host cells for enhancing antibody- based cancer therapy and/or ADCC effects in a subject, e.g. , a cancer patient.
  • the present disclosure provides a chimeric receptor comprising: (a) an extracellular ligand-binding domain of a CD 16 molecule; (b) the hinge and transmembrane domains of CD8cc; and (c) a cytoplasmic domain comprising a 4- IBB signaling domain and a CD3 ⁇ signaling domain.
  • the CD16 molecule is F158 FCGR3A and its extracellular ligand-binding domain may comprise (e.g. , consists of) the amino acid sequence of SEQ ID NO: 16.
  • the CD16 molecule is the V158 FCGR3A variant and its extracellular ligand-binding domain may comprise (e.g. , consists of) the amino acid sequence of SEQ ID NO: 2.
  • the hinge and transmembrane domains of CD8cc may comprise (e.g. , consists of) the amino acid sequence of SEQ ID NO: 3;
  • the 4-1BB signaling domain may comprise (e.g. , consists of) the amino acid sequence of SEQ ID NO: 4;
  • the CD3 ⁇ signaling domain may comprise (e.g. , consists of) the amino acid sequence of SEQ ID NO: 5.
  • any of the chimeric receptors disclosed herein may further comprise a signal peptide of CD8cc, which is located at the N-terminus of the chimeric receptor.
  • signal peptide of CD8cc may comprise (e.g. , consists of) the amino acid sequence of SEQ ID NO: 6.
  • the chimeric receptor may comprise the amino acid sequence of residues 22-436 of SEQ ID NO: 1 or residues 22-436 of SEQ ID NO: 15. In one example, the the chimeric receptor comprise (e.g. , consists of) the amino acid sequence or SEQ ID NO: 1 or SEQ ID NO: 15.
  • the present disclosure provides an isolated polynucleotide comprising a nucleotide sequence that encodes any of the chimeric receptors disclosed herein.
  • the polynucleotide encoding the chimeric receptor may comprise the nucleotide sequence of SEQ ID NO: 10 or SEQ ID NO: 18, the nucleotide sequence of SEQ ID NO: 11, the nucleotide sequence of SEQ ID NO: 12, the nucleotide sequence of SEQ ID NO: 14, or a combination thereof.
  • the polynucleotide encoding the chimeric receptor comprises the nucleotide sequence of SEQ ID NO: 9 or SEQ ID NO: 17.
  • the present disclosure provides a vector comprising a
  • the vector is a viral vector (e.g. , a retroviral vector or a lenti viral vector).
  • the present disclosure provides an isolated host cell comprising any of the chimeric receptors disclosed herein.
  • the host cell is a T lymphocyte or an NK cell.
  • the host cell is a T lymphocyte or an NK cell which is activated and/or expanded ex vivo (e.g. , T lymphocyte can be activated in the presence of one or more agents selected from the group consisting of anti-CD3/CD28, IL- 2, and phytohemoagglutinin; e.g.
  • NK cell can be activated in the presence of one or more agents selected from the group consisting of CD 137 ligand protein, CD 137 antibody, IL- 15 protein, IL- 15 receptor antibody, IL-2 protein, IL- 12 protein, IL-21 protein, and K562 cell line).
  • the host cell is an autologous T lymphocyte or an autologous NK cell isolated from a patient having a cancer.
  • the host cell is an allogeneic T lymphocyte or an allogeneic NK cell.
  • the host cell is an allogeneic T lymphocyte in which the expression of the endogenous T cell receptor has been inhibited or eliminated.
  • the present disclosure provides a pharmaceutical composition
  • a pharmaceutical composition comprising (i) a polynucleotide encoding any of the chimeric receptors disclosed herein or a vector comprising such a polynucleotide, or a host cell expressing the chimeric receptor; and (ii) a pharmaceutically acceptable carrier or excipient.
  • the pharmaceutical composition may further comprise an antibody, which exerts cytotoxicity to cancer cells (e.g. , an antibody which binds to cancer cells and has a human or humanized Fc portion which binds to human CD16, or Rituximab, or Trastuzumab, or hul4.18K322A, or Epratuzumab, or Cetuximab, or Labetuzumab).
  • the present disclosure provides a method for enhancing efficacy of an antibody-based immunotherapy of a cancer in a subject in need thereof.
  • the subject may be treated with an antibody which binds to cancer cells.
  • Such a method may comprise introducing into the subject a therapeutically effective amount of T lymphocytes or NK cells, which express any of the chimeric receptors as described herein.
  • the present disclosure provides a method of enhancing a T lymphocyte or an NK cell antibody-dependent cell cytotoxicity (ADCC) in a subject, the method comprising introducing into the subject a therapeutically effective amount of T lymphocytes or NK cells, which express the chimeric receptor as disclosed herein.
  • the subject is being treated with an antibody which can bind to cancer cells.
  • the subject may be treated with an antibody which may have a human or humanized Fc portion which can bind to human CD 16.
  • the subject is being treated with an antibody selected from the group consisting of Rituximab, Trastuzumab, hul4.18K322A, Epratuzumab, Cetuximab, and Labetuzumab.
  • the cancer is selected from the group consisting of carcinomas, lymphomas, sarcomas, blastomas, and leukemias. In one specific
  • the cancer is selected from the group consisting of a cancer of B-cell origin (e.g., B-lineage acute lymphoblastic leukemia, B-cell chronic lymphocytic leukemia, B-cell non-Hodgkin' s lymphoma), breast cancer, gastric cancer, neuroblastoma, osteosarcoma, lung cancer, melanoma, prostate cancer, colon cancer, renal cell carcinoma, ovarian cancer, rhabdomyosarcoma, leukemia, and Hodgkin's lymphoma.
  • the T lymphocytes or NK cells are autologous T lymphocytes or autologous NK cells isolated from the subject.
  • the autologous T lymphocytes or autologous NK cells are activated and/or expanded ex vivo.
  • the T lymphocytes or NK cells are allogeneic T lymphocytes or allogeneic NK cells.
  • the allogeneic T lymphocytes are T lymphocytes in which the expression of the endogenous T cell receptor has been inhibited or eliminated.
  • the allogeneic T lymphocytes or allogeneic NK cells are activated and/or expanded ex vivo.
  • the chimeric receptor is introduced into the T lymphocytes or the NK cells by a method selected from the group consisting of retroviral transduction, lentiviral transduction, DNA electroporation, and RNA electroporation.
  • the T lymphocytes can be activated in the presence of one or more agents selected from the group consisting of anti-CD3/CD28, IL-2, and phytohemoagglutinin.
  • NK cells can be activated in the presence of one or more agents selected from the group consisting of CD 137 ligand protein, CD 137 antibody, IL-15 protein, IL-15 receptor antibody, IL-2 protein, IL-12 protein, IL-21 protein, and K562 cell line.
  • any of the methods disclosed herein may further comprise administering to the subject a therapeutically effective amount of IL-2.
  • pharmaceutical compositions for use for enhancing ADCC effect in cancer patients or for treating cancer are also within the scope of the present disclosure.
  • composition comprises any of the polynucleotides disclosed herein that encode a chimeric receptor also disclosed herein, a vector comprising such a polynucleotide, or host cells expressing the chimeric receptor, and a pharmaceutically acceptable carrier or excipient; and (ii) uses of such pharmaceutical compositions for the manufacture of a medicament for the treatment of disease cancer.
  • the pharmaceutical compositions may further comprise an anti-cancer antibody, such as those known in the art or disclosed herein.
  • Figures 1 demonstrates expression of CD16V-BB ⁇ receptors in T cells.
  • A Schematic representation of the CD16V-BB ⁇ receptor construct.
  • B Expression of CD16V-BB ⁇ receptors in peripheral blood T lymphocytes. Flow cytometric dot plots illustrate expression of CD 16 (B73.1 antibody) in combination with GFP or CD3 ⁇ in activated T lymphocytes transduced with a vector containing GFP alone (Mock) or GFP and CD16V-BB ⁇ . Percentage of positive cells in each quadrant is shown.
  • C Western blotting of cell lysates from T lymphocytes transduced with GFP alone or CD16V-BB ⁇ . The membranes were probed with an anti-CD3 ⁇ antibody.
  • Figures 2 shows expression of CD16V-BB ⁇ receptor in T-cell subsets.
  • A Activated CD3+ T lymphocytes were transduced with a vector containing GFP alone (Mock) and with a vector containing the CD16V-BB ⁇ construct. Expression of CD 16 was tested in CD4+ and CD8+ cells by flow cytometry. Dot plots show results of one representative experiment.
  • Figures 3 demonstrates antibody-binding capacity of CD16V-BB ⁇ receptors.
  • A T lymphocytes transduced with a vector containing GFP (Mock) or GFP and CD16V-BB ⁇ were incubated with Rituximab for 30 minutes; the amount of antibody bound to the cell surface was visualized with a goat-anti human IgG antibody conjugated to phycoerythrin (GAH IgG) and flow cytometry.
  • GFP human IgG antibody conjugated to phycoerythrin
  • B Jurkat cells transduced with CD16V-BB (V158) or CD16F-BB ⁇ (F158) were incubated with Rituximab for 30 minutes. The plot compares the relation between mean fluorescence intensity (MFI) of GFP and MFI of GAH IgG obtained with cells expressing the two receptors.
  • MFI mean fluorescence intensity
  • C Jurkat cells mock-transduced or transduced with CD16V-BB ⁇ were co- cultured with Daudi cells labeled with calcein AM orange-red in the presence of Rituximab. Cell aggregates are quantified in the upper right quadrants of each dot plot.
  • D Summary of the aggregation assays illustrated in C. Bars show mean + SD of 3 experiments. Aggregation measured with Jurkat cells transduced with CD16V-BB ⁇ in the presence of Rituximab ("Ab") was significantly higher than that measured in the 3 other culture conditions (P ⁇ 0.001 by t test).
  • Figure 4 shows the relative capacity of CD16V-BB ⁇ and CD16F-BB ⁇ receptors to bind Trastuzumab and human IgG.
  • Jurkat cells transduced with CD16V-BB ⁇ (V158; black symbols) or CD16F-BB ⁇ (F158; white symbols) were incubated with Trastuzumab or human IgG for 30 minutes.
  • the plots compare the relation between mean fluorescence intensity (MFI) of GFP and MFI of goat-anti human (GAH) IgG conjugated to PE obtained with cells expressing either receptor (P ⁇ 0.0001 for both Trastuzumab and IgG).
  • MFI mean fluorescence intensity
  • Figures 5 demonstrates that immunoglobulin binding to CD16V-BB ⁇ receptors induces T cell activation, exocytosis of lytic granules, and cell proliferation.
  • A. T lymphocytes transduced with a vector containing GFP (Mock) or GFP and CD16V-BB ⁇ were cultured in microtiter plates coated with Rituximab for 48 hours without IL-2; expression of CD25 was measured by flow cytometry.
  • GFP GFP
  • CD16V-BB ⁇ a vector containing GFP (Mock) or GFP and CD16V-BB ⁇ were cultured in microtiter plates coated with Rituximab for 48 hours without IL-2; expression of CD25 was measured by flow cytometry.
  • cytotoxicity against cancer cell lines mediated by mock- or CD16V-BB ⁇ -transduced T lymphocytes in the presence of the corresponding antibody Each symbol indicates the mean of triplicate cultures (P ⁇ 0.01 by paired t test for all 3 comparisons). The full set of data is shown in Fig. 7.
  • Figure 7 shows the collective results of 4-hour in vitro cytotoxicity assays.
  • Mock- or CD16V-BB ⁇ T lymphocytes were cocultured with the cell lines shown and either non-reactive human immunoglobulin ("No Ab") or the corresponding antibody ("Ab”).
  • Results correspond to mean (+ SD) cytotoxicity of triplicate experiments performed with T lymphocytes of 3 donors for NB1691 and SK-BR-3, and of 1 donor for the remaining cell lines; results of Daudi are mean (+ SD) cytotoxicity of triplicate measurements from 2 donors and single measurements with T lymphocytes from 4 additional donors.
  • Figures 8 demonstrates that cytotoxicity of CD16V-BB ⁇ T lymphocytes is powerful, specific and is not affected by unbound IgG.
  • B cytotoxicity of CD16V-BB ⁇ T lymphocytes was powerful, specific and is not affected by unbound IgG.
  • Mock- or CD16V-BB ⁇ -transduced T lymphocytes were cocultured with the B-cell lymphoma cell line Daudi for 4 hours at 2: 1 E:T in the presence of Rituximab or the non-reactive antibodies Trastuzumab or hul4.18K322A. Results correspond to mean (+ SD) cytotoxicity of triplicate experiments ("Mock” results are the aggregate of triplicate experiments with each antibody). Cytotoxicity with Rituximab was significantly higher than those in all other experimental conditions (P ⁇ 0.0001 for all comparisons). C.
  • Cytotoxicity of T lymphocytes expressing CD16V-BB ⁇ against tumor cell lines at 8 : 1 E T in the presence of various concentrations of immunotherapeutic antibodies and competing unbound IgG (added simultaneously to the antibody). Symbols correspond to mean (+ SD) of at least triplicate measurement for each antibody concentration. For each cell line, cytotoxicities were not statistically different, regardless of the amount of unbound IgG present.
  • Figures 9 demonstrates that T lymphocytes expressing CD16V-BB ⁇ receptors exert anti-tumor activity in vivo.
  • NOD-SCID-IL2RGnull mice were injected i.p. with 3 x 10 5 Daudi cells labeled with luciferase.
  • mice were euthanized when bioluminescence reached 5 x 10 10 photons/second.
  • C Overall survival comparisons of mice in the different treatment groups.
  • Figures 10 confirms that T lymphocytes expressing CD16V-BB ⁇ receptors exert antitumor activity in vivo.
  • NOD-SCID-IL2RGnull mice were injected i.p. with 3 x 10 5 NB1691 cells labeled with luciferase.
  • Hul4.18K322A antibody 25 ⁇ g was injected i.p. once weekly for 4 weeks starting on day 5.
  • mice were euthanized when bioluminescence reached 1 x 10 10 photons/second.
  • C Overall survival comparisons of mice in the different treatment groups.
  • Figures 11 demonstrates functional differences between T lymphocytes expressing CD16V-BB ⁇ and CD16F-BB ⁇ receptors.
  • Figure 12 shows a schematic representation of CD 16 chimeric receptors used in this study.
  • Figure 13 shows expression of CD 16V receptors with different signaling domains.
  • Flow cytometric dot plots illustrate expression of CD 16 (detected with the 3G8 antibody) in combination with GFP in activated T lymphocytes transduced with a vector containing green fluorescent protein (GFP) alone (Mock) or different CD 16V constructs. Percentage of positive cells in each quadrant is shown.
  • GFP green fluorescent protein
  • Figures 14 demonstrates that CD16V-BB ⁇ induces higher T cell activation, proliferation and cytotoxicity than CD 16V receptors with different signaling properties.
  • A. CD25 mean fluorescence intensity (MFI) by flow cytometry plotted against green fluorescent protein (GFP) MFI in T lymphocytes expressing different chimeric receptors after 48-hour co- culture with Daudi cells and Rituximab (0.1 ⁇ g/mL).
  • CD25 expression with CD16V-BB ⁇ was significantly higher than that triggered by CD16V ⁇ , CD16V-FceRIy or CD 16V with no signaling capacity (“CD16V-trunc”) (P ⁇ 0.0001 by linear regression analysis).
  • T lymphocytes transduced with various CD 16V receptors were cultured with Daudi, SK-BR-3 or NB1691 cells in the presence of Rituximab, Trastuzumab and hul4.18K322A, respectively. All antibodies were used at 0.1 ⁇ g/mL. Symbols indicate percentage of cell recovery as compared to number of input cells (mean + SD of 3 experiments); cell counts for weeks 1-3 of culture were significantly higher with CD16V-BB ⁇ receptors that with all other receptors by paired t test for all 3 cultures (P ⁇ 0.0001). C.
  • Figures 15 demonstrates expression of CD16V-BB ⁇ receptors by mRNA
  • B. Cytotoxicity of mock or CD16V-BB ⁇ electroporated T cells was tested against the Ramos cell line in the presence of Rituximab. Symbols show mean + SD percent cytotoxicity (n 3; P ⁇ 0.01 for comparisons at all E:T ratios).
  • T lymphocytes expressing ⁇ T- cell receptors lack activating FcyR and do not mediate antibody- dependent cell cytotoxicity (ADCC). Nimmerjahn et al., Nat Rev Immunol. 2008;8(l):34-47.
  • a chimeric receptor composed of a FcyR and T-cell signaling molecules should confer ADCC capability to these cells and, therefore, should significantly augment the anti-tumor potential of monoclonal antibodies (as well as other anti-tumor molecules comprising the Fc portion, such as, e.g., a composite molecule constituted by a ligand ⁇ e.g., cytokine, immune cell receptor) binding a tumor surface receptor combined with the Fc -portion of an immunoglobulin or Fc-containing DNA or RNA), regardless of the targeted tumor- antigen.
  • a composite molecule constituted by a ligand ⁇ e.g., cytokine, immune cell receptor binding a tumor surface receptor combined with the Fc -portion of an immunoglobulin or Fc-containing DNA or RNA
  • the present disclosure provides a chimeric receptor which comprises (i) an extracellular ligand-binding domain of a CD 16 molecule, which can be F158 FCGR3A or the high-affinity V158 FCGR3A variant, (ii) a hinge and transmembrane domains of CD8cc, and (ii) the signaling domains of CD3 ⁇ and 4-1BB.
  • the chimeric receptor of the present disclosure is a universal chimeric receptor with potential for augmenting significantly the efficacy of antibody therapy against multiple tumors.
  • the receptor of the present disclosure when expressed in human T cells by retroviral transduction, the receptor of the present disclosure has a significantly higher affinity for human IgG including humanized antibodies such as the anti-CD20 antibody Rituximab as compared to another receptor containing the common F158 variant. Engagement of the chimeric receptor provokes T-cell activation, exocytosis of lytic granules and proliferation.
  • CD16V-BB ⁇ expressing T cells specifically kill lymphoma cell lines and primary chronic lymphocytic leukemia (CLL) cells in the presence of Rituximab at low effector: target ratio, even when CLL cultures are performed on bone marrow-derived mesenchymal cells.
  • CLL chronic lymphocytic leukemia
  • the anti-HER2 antibody Trastuzumab trigger chimeric receptor-mediated antibody-dependent cell cytotoxicity (ADCC) against breast and gastric cancer cells, and the anti-GD2 antibody hul4.18K322A against neuroblastoma and osteosarcoma cells.
  • ADCC antibody-dependent cell cytotoxicity
  • T cells expressing the chimeric receptor and Rituximab in combination eradicated human lymphoma cells in immunodeficient mice, while T cells or antibody alone did not.
  • a method based on electroporation of the chimeric receptor mRNA was developed as disclosed herein, leading to efficient and transient receptor expression without the use of viral vectors.
  • chimeric receptor as used herein is defined as a cell-surface receptor comprising an extracellular ligand binding domain, a transmembrane domain and a cytoplasmic signaling domain in a combination that is not naturally found together on a single protein.
  • the chimeric receptor of the present disclosure is intended primarily for use with T cells but could also be used for natural killer (NK) cells.
  • the term “about” or “approximately” means within an acceptable error range for the particular value as determined by one of ordinary skill in the art, which will depend in part on how the value is measured or determined, i.e., the limitations of the measurement system. For example, “about” can mean within an acceptable standard deviation, per the practice in the art. Alternatively, “about” can mean a range of up to +20%, preferably up to +10%, more preferably up to +5%, and more preferably still up to +1% of a given value. Alternatively, particularly with respect to biological systems or processes, the term can mean within an order of magnitude, preferably within 2-fold, of a value. Where particular values are described in the application and claims, unless otherwise stated, the term “about” is implicit and in this context means within an acceptable error range for the particular value.
  • the terms “treat”, “treatment”, and the like mean to relieve or alleviate at least one symptom associated with such condition, or to slow or reverse the progression of such condition.
  • the term “treat” also denotes to arrest, delay the onset ⁇ i.e., the period prior to clinical manifestation of a disease) and/or reduce the risk of developing or worsening a disease.
  • the term “treat” may mean eliminate or reduce a patient's tumor burden, or prevent, delay or inhibit metastasis, etc.
  • the term "therapeutically effective" applied to dose or amount refers to that quantity of a compound or pharmaceutical composition ⁇ e.g., a composition comprising T lymphocytes (and/or NK cells) comprising the chimeric receptor of the present disclosure, and optionally further comprising a tumor- specific cytotoxic monoclonal antibody or another anti-tumor molecule comprising the Fc portion ⁇ e.g., a composite molecule constituted by a ligand ⁇ e.g., cytokine, immune cell receptor) binding a tumor surface receptor combined with the Fc-portion of an immunoglobulin or Fc-containing DNA or RNA)) that is sufficient to result in a desired activity upon administration to a subject in need thereof.
  • a compound or pharmaceutical composition ⁇ e.g., a composition comprising T lymphocytes (and/or NK cells) comprising the chimeric receptor of the present disclosure, and optionally further comprising a tumor- specific cytotoxic monoclonal antibody or another anti-tumor molecule comprising
  • the term "therapeutically effective” refers to that quantity of a compound or pharmaceutical composition that is sufficient to delay the manifestation, arrest the progression, relieve or alleviate at least one symptom of a disorder treated by the methods of the present disclosure. Note that when a combination of active ingredients is administered the effective amount of the combination may or may not include amounts of each ingredient that would have been effective if administered individually.
  • compositions of the present disclosure refers to molecular entities and other ingredients of such compositions that are physiologically tolerable and do not typically produce untoward reactions when administered to a mammal (e.g., a human).
  • pharmaceutically acceptable means approved by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in mammals, and more particularly in humans.
  • the term "subject" refers to any mammal. In a preferred embodiment, the subject is human.
  • the present disclosure provides a chimeric receptor comprising: (a) an extracellular ligand-binding domain of F158 FCGR3A or V158 FCGR3A variant (e.g., SEQ ID NO: 16 or SEQ ID NO:2, respectively); (b) a hinge and transmembrane domains of CD8cc (e.g., SEQ ID NO: 3); and (c) a cytoplasmic domain comprising a 4- IBB signaling domain (e.g., SEQ ID NO:4) and a CD3 ⁇ signaling domain (e.g., SEQ ID NO:5).
  • the chimeric receptor may further comprise a signal peptide of CD8cc, e.g., SEQ ID NO:6.
  • the chimeric receptor comprises the amino acid sequence SEQ ID NO: 1 or SEQ ID NO: 15.
  • the chimeric receptor is CD16V-BB ⁇ that consists of the amino acid sequence of SEQ ID NO: 1.
  • the chimeric receptor is CD16F-BB ⁇ that consists of the amino acid sequence of SEQ ID NO: 15.
  • the chimeric receptor of the present disclosure contains one or more signaling domains in addition to the two signaling domains described herein, i.e., CD3 ⁇ and 4-1BB/CD137.
  • several signaling domains are fused together for additive or synergistic effect.
  • Non-limiting examples of useful additional signaling domains include part or all of one or more of TCR Zeta chain, CD28,
  • OX40/CD134 4-1BB/CD137, FceRIy, ICOS/CD278, ILRB/CD122, IL-2RG/CD132, and CD40.
  • the present disclosure also provides polynucleotides encoding the chimeric receptors disclosed above.
  • the polynucleotide encoding an extracellular ligand-binding domain of V158 FCGR3A variant comprises the nucleotide sequence of SEQ ID NO: 10.
  • the polynucleotide encoding the F158 FCGR3A extracellular domain comprises the nucleotide sequence of SEQ ID NO: 18.
  • the polynucleotide encoding the hinge and transmembrane domains of CD 8 a comprises the nucleotide sequence of SEQ ID NO: 11.
  • the polynucleotide encoding the 4-lBB signaling domain comprises the nucleotide sequence of SEQ ID NO: 12. In one specific embodiment, the polynucleotide encoding the CD3 ⁇ signaling domain comprises the nucleotide sequence of SEQ ID NO: 13. In one specific embodiment, the polynucleotide encoding the signal peptide of CD8cc comprises the nucleotide sequence of SEQ ID NO: 14.
  • the polynucleotide encoding the chimeric receptor of CD16V-BB ⁇ and comprises the nucleotide sequence of SEQ ID NO: 9.
  • the polynucleotide encoding the chimeric receptor of CD16V-BB ⁇ and comprises the nucleotide sequence of SEQ ID NO: 9.
  • polynucleotide encoding the chimeric receptor of CD16F-BB ⁇ and comprises the nucleotide sequence of SEQ ID NO: 17.
  • the present disclosure also provides vectors comprising such polynucleotides (including vectors in which such polynucleotides are operatively linked to at least one regulatory element for expression of the chimeric receptor).
  • useful vectors of the present disclosure include viral vectors such as, e.g., retroviral vectors and lenti viral vectors.
  • such vectors also include a suicide gene.
  • suicide gene refers to a gene that causes the cell expressing the suicide gene to die.
  • the suicide gene can be a gene that confers sensitivity to an agent, e.g., a drug, upon the cell in which the gene is expressed, and causes the cell to die when the cell is contacted with or exposed to the agent.
  • agent e.g., a drug
  • HSV Herpes Simplex Virus
  • TK thymidine kinase gene
  • cytosine daminase purine nucleoside phosphorylase
  • nitroreductase caspase 8.
  • the present disclosure also provides host cells comprising the chimeric receptors disclosed above.
  • useful host cells include T lymphocytes and NK cells, which can be either autologous or allogeneic (with endogenous T-cell receptor either removed or retained).
  • the host cell is an autologous T lymphocyte isolated from a patient having cancer.
  • such autologous T lymphocyte is activated and expanded ex vivo.
  • the chimeric receptor of the present disclosure can be introduced into the host cell by any method known in the art.
  • particularly useful methods include retroviral transduction, lentiviral transduction, and DNA and mRNA electroporation.
  • mRNA electroporation results in effective expression of the chimeric receptor of the present disclosure in T lymphocytes.
  • references describing retroviral transduction include Anderson et al., U.S. Pat. No. 5,399,346; Mann et al., Cell 33: 153 (1983); Temin et al., U.S. Pat. No. 4,650,764; Temin et al., U.S. Pat. No.
  • 95/07358 describes high efficiency transduction of primary B lymphocytes. See also the Examples section, below, for examples of specific techniques for retroviral transduction and mRNA electroporation which can be used.
  • Host cell activation and expansion is usually used to allow integration of a viral vector into the genome and expression of the gene encoding the chimeric receptor of the present disclosure.
  • mRNA electroporation no activation and expansion is required (although electroporation is more effective when performed on activated cells).
  • host cells T lymphocytes or NKT cells
  • expression is useful if there is a potential toxicity and should be helpful in the initial phases of clinical testing for possible side effects.
  • a further aspect of the present disclosure provides pharmaceutical compositions.
  • the present disclosure provides a pharmaceutical composition comprising (i) a polynucleotide encoding the chimeric receptor of the present disclosure or a vector comprising such polynucleotide and (ii) a pharmaceutically acceptable carrier or excipient.
  • the present disclosure provides a pharmaceutical composition
  • a pharmaceutical composition comprising (i) a host cell comprising the chimeric receptor of the present disclosure and (ii) a pharmaceutically acceptable carrier or excipient.
  • such pharmaceutical composition further comprises a monoclonal antibody which can exert cytotoxicity to cancer cells (e.g. , Rituximab, Trastuzumab, hul4.18K322A, etc.) or another anti-tumor molecule comprising the Fc portion (e.g., a composite molecule constituted by a ligand (e.g. , cytokine, immune cell receptor) binding a tumor surface receptor combined with the Fc-portion of an immunoglobulin or Fc-containing DNA or RNA).
  • a monoclonal antibody which can exert cytotoxicity to cancer cells
  • a monoclonal antibody which can exert cytotoxicity to cancer cells
  • another anti-tumor molecule comprising the Fc portion
  • Suitable excipients for use in the pharmaceutical compositions of the present disclosure will be well known to those of skill in the art and may, for example, comprise tissue culture medium (e.g. , for cells to survive ex vivo) or a saline solution (e.g. , when cells are being injected in patients).
  • tissue culture medium e.g. , for cells to survive ex vivo
  • a saline solution e.g. , when cells are being injected in patients.
  • compositions of the present disclosure may also contain one or more additional active compounds as necessary for the particular indication being treated, preferably those with complementary activities that do not adversely affect each other.
  • additional active compounds include, e.g. , IL2 as well as various agents listed in the discussion of combination treatments, below.
  • the chimeric receptor of the present disclosure confers antibody-dependent cell cytotoxicity (ADCC) capacity to T lymphocytes and enhances ADCC in NK cells.
  • ADCC antibody-dependent cell cytotoxicity
  • the receptor When the receptor is engaged by an antibody (or another anti-tumor molecule comprising the Fc portion) bound to tumor cells, it triggers T-cell activation, sustained proliferation and specific cytotoxicity against cancer cells targeted by the antibody (or such other anti-tumor molecule comprising the Fc portion).
  • T lymphocytes comprising the receptor of the present disclosure were highly cytotoxic against a wide range of tumor cell types, including B-cell lymphoma, breast and gastric cancer, neuroblastoma and osteosarcoma, as well as primary chronic lymphocytic leukemia (CLL).
  • Cytotoxicity was entirely dependent on the presence of a specific antibody bound to target cells: soluble antibodies did not induce exocytosis of cytolytic granules and did not provoke non-specific cytotoxicity.
  • the degree of affinity of CD 16 for the Fc portion of Ig is a critical determinant of ADCC and thus to clinical responses to antibody immunotherapy.
  • the CD 16 with the 158V polymorphism was selected as an example; this variant has a high binding affinity for Ig and mediates superior ADCC.
  • the chimeric receptor of the present disclosure facilitates T-cell therapy by allowing one single receptor to be used for multiple cancer cell types. It also allows the targeting of multiple antigens simultaneously, a strategy that may ultimately be advantageous given immunoescape mechanism exploited by tumors (Grupp et al., N. Engl. J. Med. 2013;
  • Antibody-directed cytotoxicity could be stopped whenever required by simple withdrawal of antibody administration. Because the T cells expressing the chimeric receptor of the present disclosure are only activated by antibody bound to target cells, unbound immunoglobulin should not exert any stimulation on the infused T cells. Clinical safety can be further enhanced by using mRNA electroporation to express the chimeric receptor transiently, to limit any potential autoimmune reactivity.
  • the present disclosure provides a method for enhancing efficacy of an antibody-based immunotherapy of a cancer in a subject in need thereof, which subject is being treated with an antibody which can bind to cancer cells and has a humanized Fc portion which can bind to human CD 16, said method comprising introducing into the subject a therapeutically effective amount of T lymphocytes or NK cells, which T
  • lymphocytes or NK cells comprise the chimeric receptor of the present disclosure.
  • the present disclosure provides a method of enhancing T lymphocyte or NK cell ADCC activity in a subject comprising administering to the subject a T lymphocyte or NK cell, which T lymphocyte or NK cell comprises the chimeric receptor of the present disclosure.
  • the subject has cancer.
  • such subject is being treated with an antibody which can bind to cancer cells.
  • the T lymphocytes or NK cells are autologous T lymphocytes or NK cells isolated from the subject. In one specific
  • the autologous T lymphocytes or NK cells are activated and/or expanded ex vivo.
  • the T lymphocytes or NK cells are allogeneic T lymphocytes or NK cells.
  • the T lymphocytes are allogeneic T lymphocytes in which the expression of the endogenous T cell receptor has been inhibited or eliminated.
  • the allogeneic T lymphocytes prior to introduction into the subject, are activated and/or expanded ex vivo.
  • T lymphocytes can be activated by any method known in the art, e.g., in the presence of anti- CD3/CD28, IL-2, and/or phytohemoagglutinin.
  • NK cells can be activated by any method known in the art, e.g., in the presence of one or more agents selected from the group consisting of CD 137 ligand protein, CD 137 antibody, IL-15 protein, IL-15 receptor antibody, IL-2 protein, IL-12 protein, IL-21 protein, and K562 cell line. See, e.g., U.S. Patents Nos. 7,435,596 and 8,026,097 for the description of useful methods for expanding NK cells.
  • the chimeric receptor is introduced into the T lymphocytes or the NK cells ⁇ e.g., after ex vivo activation and/or expansion) by retroviral transduction, lentiviral transduction, or DNA or RNA electroporation.
  • introduction or re-introduction of T lymphocytes or NK cells to the subject is followed by administering to the subject a therapeutically effective amount of IL-2.
  • the chimeric receptor of the present disclosure may be used for treatment of any cancer, including, without limitation, carcinomas, lymphomas, sarcomas, blastomas, and leukemias, for which a specific antibody with an Fc portion that binds to CD 16 exists or is capable of being generated.
  • cancers which can be treated by the chimeric receptor of the present disclosure include, e.g., cancers of B-cell origin (e.g., B-lineage acute lymphoblastic leukemia, B-cell chronic lymphocytic leukemia and B-cell non-Hodgkin's lymphoma), breast cancer, gastric cancer, neuroblastoma, and osteosarcoma.
  • Non-limiting examples of anti-cancer antibodies containing an Fc portion that can bind to human CD 16, whose efficacy can be enhanced by the method of the present disclosure include, for example, Rituximab, Trastuzumab, hul4.18K322A, Epratuzumab, Cetuximab, and Labetuzumab.
  • the appropriate dosage of the antibody used will depend on the type of cancer to be treated, the severity and course of the disease, previous therapy, the patient's clinical history and response to the antibody, and the discretion of the attending physician.
  • the antibody can be administered to the patient at one time or over a series of treatments.
  • the progress of the therapy of the present disclosure can be easily monitored by conventional techniques and assays.
  • the administration of antibodies can be performed by any suitable route, including systemic administration as well as administration directly to the site of the disease (e.g., to primary tumor).
  • the T lymphocytes used in the methods of the present disclosure are most preferably patient's own cells (i.e., autologous cells) that were earlier isolated from a blood sample and preferably activated and expanded ex vivo (e.g., for 3-5 days) with standard methods, such as, e.g., anti-CD3/CD28 beads, IL-2, or phytohemoagglutinin.
  • allogeneic T lymphocytes can be used (preferably allogeneic T lymphocytes in which the expression of the endogenous T cell receptor has been inhibited or eliminated). See Torikai et al., Blood, 2012 119: 5697-5705.
  • T lymphocytes and NK cells from a patient are transduced (or electroporated) with the polynucleotide encoding the chimeric receptor of the present disclosure (or a vector comprising such polynucleotide) so that the chimeric receptor is expressed on the cell surface of the T cell or NK cell.
  • the modified cells can then be administered into the patient (e.g., 1 day after infusion of a therapeutic antibody).
  • patients can be treated by infusing therapeutically effective doses of T lymphocytes or NK cells comprising the chimeric receptor of the present disclosure in the range of about 10 5 to 10 10 or more cells per kilogram of body weight (cells/Kg).
  • the infusion can be repeated as often and as many times as the patient can tolerate until the desired response is achieved.
  • the appropriate infusion dose and schedule will vary from patient to patient, but can be determined by the treating physician for a particular patient.
  • initial doses of approximately 10 6 cells/Kg will be infused, escalating to 10 or more cells/Kg.
  • IL-2 can be co-administered to expand infused cells post- infusion.
  • the amount of IL-2 can about 1-5 x 10 6 international units per square meter of body surface.
  • NK cells used in the methods of the present disclosure may be preferentially expanded by exposure to cells that lack or poorly express major histocompatibility complex I and/or II molecules and which have been genetically modified to express membrane bound IL-15 and 4- IBB ligand (CDI37L).
  • cell lines include, but are not necessarily limited to, K562 [ATCC, CCL 243; Lozzio et al., Blood 45(3): 321-334 (1975); Klein et al., Int. J. Cancer 18: 421-431 (1976)], and the Wilms tumor cell line HFWT. [Fehniger T A, Caligiuri M A.
  • the cell line used lacks or poorly expresses both MHC I and II molecules, such as the K562 and HFWT cell lines.
  • a solid support may be used instead of a cell line.
  • Such support should preferably have attached on its surface at least one molecule capable of binding to NK cells and inducing a primary activation event and/or a proliferative response or capable of binding a molecule having such an affect thereby acting as a scaffold.
  • the support may have attached to its surface the CD 137 ligand protein, a CD 137 antibody, the IL-15 protein or an IL-15 receptor antibody.
  • the support will have IL-15 receptor antibody and CD 137 antibody bound on its surface.
  • compositions and methods described in the present disclosure may be utilized in conjunction with other types of therapy for cancer, such as chemotherapy, surgery, radiation, gene therapy, and so forth.
  • therapies can be administered simultaneously or
  • suitable therapeutically effective dosages for each agent may be lowered due to the additive action or synergy.
  • immunomodulatory treatments such as, e.g., therapeutic vaccines (including but not limited to GVAX, DC-based vaccines, etc.), checkpoint inhibitors (including but not limited to agents that block CTLA4, PD1, LAG3, TIM3, etc.) or activators (including but not limited to agents that enhance 41BB, OX40, etc.).
  • therapeutic vaccines including but not limited to GVAX, DC-based vaccines, etc.
  • checkpoint inhibitors including but not limited to agents that block CTLA4, PD1, LAG3, TIM3, etc.
  • activators including but not limited to agents that enhance 41BB, OX40, etc.
  • Non-limiting examples of other therapeutic agents useful for combination with the immunotherapy of the present disclosure include:
  • anti-angiogenic agents e.g., TNP-470, platelet factor 4, thrombospondin-1, tissue inhibitors of metalloproteases (TIMP1 and TIMP2), prolactin (16-Kd fragment), angiostatin (38-Kd fragment of plasminogen), endostatin, bFGF soluble receptor, transforming growth factor beta, interferon alpha, soluble KDR and FLT-1 receptors, placental proliferin-related protein, as well as those listed by Carmeliet and Jain (2000));
  • anti-angiogenic agents e.g., TNP-470, platelet factor 4, thrombospondin-1, tissue inhibitors of metalloproteases (TIMP1 and TIMP2), prolactin (16-Kd fragment), angiostatin (38-Kd fragment of plasminogen), endostatin, bFGF soluble receptor, transforming growth factor beta, interferon alpha, soluble KDR and FLT-1 receptors, placental proliferin
  • a VEGF antagonist or a VEGF receptor antagonist such as anti-VEGF antibodies, VEGF variants, soluble VEGF receptor fragments, aptamers capable of blocking VEGF or VEGFR, neutralizing anti-VEGFR antibodies, inhibitors of VEGFR tyrosine kinases and any combinations thereof;
  • chemotherapeutic compounds such as, e.g., pyrimidine analogs (5- fluorouracil, floxuridine, capecitabine, gemcitabine and cytarabine), purine analogs, folate antagonists and related inhibitors (mercaptopurine, thioguanine, pentostatin and 2- chlorodeoxyadenosine (cladribine)); antiproliferative/antimitotic agents including natural products such as vinca alkaloids (vinblastine, vincristine, and vinorelbine), microtubule disruptors such as taxane (paclitaxel, docetaxel), vincristin, vinblastin, nocodazole, epothilones and navelbine, epidipodophyllotoxins (etoposide, teniposide), DNA damaging agents (actinomycin, amsacrine, anthracyclines, bleomycin, busulfan, camptothecin, carboplatin, chlor
  • antibiotics such as dactinomycin (actinomycin D), daunorubicin, doxorubicin (adriamycin), idarubicin, anthracyclines, mitoxantrone, bleomycins,
  • antiproliferative/antimitotic alkylating agents such as nitrogen mustards (mechlorethamine, cyclophosphamide and analogs, melphalan, chlorambucil), ethylenimines and methylmelamines (hexamethylmelamine and thiotepa), alkyl sulfonates-busulfan, nitrosoureas (carmustine (BCNU) and analogs, streptozocin), trazenes-dacarbazinine (DTIC); antiproliferative/antimitotic antimetabolites such as folic acid analogs (methotrexate); platinum coordination complexes (cisplatin, carboplatin), procarbazine, hydroxyurea, mitot
  • anticoagulants heparin, synthetic heparin salts and other inhibitors of thrombin
  • fibrinolytic agents such as tissue plasminogen activator, streptokinase and urokinase), aspirin, dipyridamole, ticlopidine, clopidogrel, abciximab
  • antimigratory agents antisecretory agents (breveldin); immunosuppressives (cyclosporine, tacrolimus (FK-506), sirolimus (rapamycin), azathioprine, mycophenolate mofetil); anti-angiogenic compounds (e.g.
  • TNP-470 TNP-470, genistein, bevacizumab
  • growth factor inhibitors e.g., fibroblast growth factor (FGF) inhibitors
  • FGF fibroblast growth factor
  • angiotensin receptor blocker nitric oxide donors; anti-sense oligonucleotides; antibodies (trastuzumab); cell cycle inhibitors and differentiation inducers (tretinoin); mTOR inhibitors, topoisomerase inhibitors (doxorubicin (adriamycin), amsacrine, camptothecin, daunorubicin, dactinomycin, eniposide, epirubicin, etoposide, idarubicin and mitoxantrone, topotecan, irinotecan), corticosteroids (cortisone, dexamethasone,
  • corticosteroids cortisone, dexamethasone
  • hydrocortisone hydrocortisone, methylpednisolone, prednisone, and prenisolone
  • growth factor signal transduction kinase inhibitors growth factor signal transduction kinase inhibitors
  • mitochondrial dysfunction inducers and caspase activators mitochondrial dysfunction inducers and caspase activators
  • chromatin disruptors hydrocortisone, methylpednisolone, prednisone, and prenisolone
  • the human B-lineage lymphoma cell lines Daudi and Ramos, the T-cell acute lymphoblastic leukemia cell line Jurkat, and the neuroblastoma cell lines CHLA-255, NB1691 and SK-N-SH were available at St. Jude Children's Research Hospital.
  • the breast carcinoma cell lines MCF-7 (ATCC HTB-22) and SK-BR-3 (ATCC HTB-30), and the osteosarcoma cell line U-2 OS (ATCC HTB-96) were obtained from the American Type Culture Collection (ATCC; Rockville, MD); the gastric carcinoma cell line MKN7 was from National Institute of Biomedical Innovation (Osaka, Japan).
  • Daudi CHLA-255, NB1691, SK-N-SH, SK-BR-3, MCF-7, U-2 OS and MKN7 were also transduced with a murine stem cell virus (MSCV)-internal ribosome entry site (IRES)-green fluorescent protein (GFP) retroviral vector containing the firefly luciferase gene (Fujisaki et al., Cancer Res. 2009; 69(9):4010-4017). Transduced cells were selected for their expression of GFP with a FACSAria cell sorter (BD Biosciences, San Jose, CA). Peripheral blood or bone marrow samples from newly diagnosed and untreated patients with B-chronic lymphocytic leukemia (CLL) were obtained following informed consent and approval from the Domain Specific Ethics Board governing Singapore's National University Hospital.
  • CLL B-chronic lymphocytic leukemia
  • Peripheral blood samples were obtained from de-identified by-products of platelet donations from healthy adult donors. Mononuclear cells were enriched by centrifugation on Accu-Prep Human Lymphocytes Cell Separation Media (Accurate Chemical & Scientific Corp., Westbury, N.Y.), and cultured with anti-CD3/CD28 beads (Invitrogen, Carlsbad, CA) in RPMI-1640 with 10% fetal bovine serum (FBS), antibiotics, 100 IU interleukin (IL)-2 (Roche, Mannheim, Germany) for 3days.
  • FBS fetal bovine serum
  • IL interleukin
  • T cells were purified by negative selection with a mixture of CD14, CD16, CD19, CD36, CD56, CD123 and CD235a antibodies and magnetic beads (Pan T Cell Isolation Kit II; Miltenyi Biotec, Bergisch Gladbach, Germany) (purity, >98%). Purified T cells were maintained in the above medium, with the addition of 100 IU IL-2 every other day. Plasmids, virus production and gene transduction
  • the pMSCV-IRES-GFP, pEQ-PAM3(-E), and pRDF were obtained from the St. Jude Children's Research Hospital Vector Development and Production Shared Resource
  • FCRG3A cDNA was obtained from Origene (Rockville, MD) and its V158F variant was generated using site-directed mutagenesis by PCR using primers "F” CTTCTGCAGGGGGCTTGTTGGGAGTAAAAATGTGTC (SEQ ID NO: 7) and "R” GACACATTTTTACTCCCAACAAGCCCCCTGCAGAAG (SEQ ID NO: 8).
  • CD8cc hinge and transmembrane domain SEQ ID NO: 11
  • CD3 ⁇ SEQ ID NO: 13
  • fuGENE 6 or X-tremeGENE 9 (Roche, Indianapolis, IN) was used to transfect 3 x 10 6 293T cells with 3.5 ⁇ g of cDNA encoding CD16V-BB ⁇ , 3.5 ⁇ g of pEQ-PAM3(-E), and 3 ⁇ g of pRDF (Imai et al., Leukemia 2004; 18:676-684).
  • RetroNectin TakaRa, Otsu, Japan
  • T cells 1 x 10 5
  • Cells were then maintained in RPMI-1640 with FBS, antibiotics and 100 IU/mL IL-2 until the time of the experiments, 7-21 days after transduction.
  • CD 16 Surface expression of CD 16 was analyzed by flow cytometry using R-Phycoerythrin conjugated anti-human CD16 (clone B73.1, BD Biosciences Pharmingen, San Diego, CA).
  • R-Phycoerythrin conjugated anti-human CD16 clone B73.1, BD Biosciences Pharmingen, San Diego, CA.
  • 2 x 10 T cells were lysed in Cellytic M lysis Buffer (Sigma, St Louis, MO) containing 1% protease inhibitor cocktail (Sigma) and 1% phosphatase inhibitor cocktail 2 (Sigma). After centrifugation, lysate supernatants were boiled with an equal volume of LDS buffer (Invitrogen, Carlsbad, CA) with or without reducing buffer
  • the pVAXl vector (Invitrogen, Carlsbad, CA) was used as a template for in vitro mRNA transcription.
  • the CD16V-BB ⁇ cDNA was subcloned into EcoRI and Xbal sites of pVAXl.
  • the corresponding mRNA was transcribed in vitro with T7 mScript mRNA production system (CellScript, Madison, WI). See, e.g., Shimasaki et al., Cytotherapy. 2012;14(7):830-40.
  • the Amaxa Nucleofector (Lonza, Walkersville, MD) was used; 1 x 10 of purified T cells activated with 200 IU/mL IL-2 overnight were mixed with 200 ⁇ g/mL mRNA in Cell Line Nucleofector Kit V (Lonza), transferred into the processing chamber, and transfected using the program X-001. Immediately after electroporation, cells were transferred from the processing chamber into a 24-well plate and then cultured in RPMI-1640 with FBS, antibiotics and 100 IU/mL IL-2 (Roche, Mannheim, Germany). See also Shimasaki et al., Cytotherapy, 2012, 1-11.
  • T lymphocytes (5 x 10 5 ) transduced with chimeric receptors or a vector containing GFP only were incubated with Rituximab (Rituxan, Roche; 0.1- ⁇ g/mL), Trastuzumab (Herceptin; Roche; 0.1-1 ⁇ g/mL) and/or purified human IgG (R&D Systems, Minneapolis, MN ; 0.1-1 ⁇ g/mL) for 30 minutes at 4°C.
  • Rituximab Rituxan, Roche; 0.1- ⁇ g/mL
  • Trastuzumab Herceptin; Roche; 0.1-1 ⁇ g/mL
  • purified human IgG R&D Systems, Minneapolis, MN ; 0.1-1 ⁇ g/mL
  • CD20-positive Daudi cells were labeled with CellTrace calcein red-orange AM (Invitrogen) and then incubated with Rituximab (0.1 ⁇ g/mL) for 30 minutes at 4°C. After washing twice in PBS, cells with Jurkat cells transduced with the chimeric receptor or mock-transduced at 1: 1 E:T ratio in 96 round bottom plates (Costar, Corning, NY) for 60 min at 37°C. The proportion of cells forming heterologous cell aggregates (calcein AM-GFP double positive) was determined by flow cytometry.
  • T cells transduced with the chimeric receptor or mock-transduced were placed in the wells of a 24- well plate (Costar, Corning, NY) in RPMI-1640 with FBS, antibiotics and 50 IU/mL IL-2. Daudi cells were treated with Streck cell preservative (Streck Laboratories, Omaha, NE) to stop proliferation and labeled with Rituximab (O. ⁇ g/mL) for 30 min at 4°C. They were added to the wells, at 1: 1 ratio with T cells, on days 0, 7, 14 and 21. The n number of viable T cells after culture was measured by flow cytometry.
  • chimeric receptor- and mock transduced T cells (1 x 10 5 ) were placed into each well of a Rituximab-coated 96-well flat bottom plate and cultured for 4 hours at 37°C.
  • T cells were co-cultured with Daudi cells pre-incubated with Rituximab.
  • An anti-human CD 107a antibody conjugated to phycoerythrin (BD Biosciences) was added at the beginning of the cultures and one hour later GolgiStop (0.15 ⁇ ; BD Biosciences) was added.
  • CD 107a positive T cells were analyzed by flow cytometry.
  • target cells were suspended in RPMI-1640 with 10% FBS, labeled with calcein AM (Invitrogen) and plated into 96-well round bottom plates (Costar). T cells were added at various E: T ratio as indicated in Results, and co-cultured with target cells for 4 hours, with or without the antibodies Rituximab (Rituxan, Roche), Trastuzumab (Herceptin, Roche), or hul4.18K322A (obtained from Dr. James Allay, St Jude Children's GMP, Memphis, TN; at 1 ⁇ g/mL). At the end of the cultures, cells were collected, resuspended in an identical volume of PBS, propidium iodide was added.
  • the number of viable target cells was counted using the Accuri C6 flow cytometer (Fujisaki et al., Cancer Res. 2009; 69(9):4010-4017). For adherent cell lines, cytotoxicity was tested using luciferase-labeled target cells. To measure
  • Daudi cells expressing luciferase were injected intraperitoneally (i.p.; 0.3 x 10 6 cells per mouse) in NOD.Cg-Prkdc scid IL2rg tmlWjl /SzJ (NOD/scid IL2RGnull) mice (Jackson Laboratory, Bar Harbor). Some mice received Rituximab (100 ⁇ g) i.p. 4 days after Daudi inoculation, with or without i.p. injection of human primary T cells on days 5 and 6.
  • T cells had been activated with anti-CD3/CD28 beads for 3 days, transduced with the CD16V-BB ⁇ receptor, resuspended in RPMI-1640 plus 10% FBS and then injected at lx 10 cells per mouse.
  • Rituximab injection was repeated weekly for 4 weeks, with no further T lymphocyte injection. All mice received i.p. injections of 1000-2000 IU of IL-2 twice a week for 4 weeks. A group of mice received tissue culture medium instead of Rituximab or T cells.
  • Tumor engraftment and growth was measured using a Xenogen IVIS-200 system (Caliper Life Sciences, Hopkinton, MA). Imaging commenced 5 minutes after i.p. injection of an aqueous solution of D-luciferin potassium salt (3 mg/mouse) and photons emitted from luciferase-expressing cells were quantified using the Living Image 3.0 software.
  • FCRG3A The V158 polymorphism of FCRG3A (CD16), expressed in about one-fourth of individuals, encodes a high-affinity immunoglobulin Fc receptor and is associated with favorable responses to antibody therapy (25, 26, 29-31).
  • a V158 variant of the FCGR3A gene was generated. It was combined with the hinge and transmembrane domain of CD 8 a, the T-cell stimulatory molecule CD3 ⁇ , and the co-stimulatory molecule 4- IBB (Fig. 1A). Imai et al., Leukemia 2004; 18:676-684 .
  • An MCSV retroviral vector containing the CD16V-BB ⁇ construct and GFP was used to transduce peripheral blood T lymphocytes from 12 donors: median GFP expression in CD3+ cells was 89.9% (range, 75.3%-97.1%); in the same cells, median chimeric receptor surface expression as assessed by anti-CD 16 staining was 83.0% (67.5%-91.8%) (Fig. IB).
  • T lymphocytes from the same donors transduced with a vector containing only GFP had a median GFP expression of 90.3% (67.8%-98.7%) but only 1.0% (0.1%-2.7%) expressed CD 16 (Fig. IB).
  • CD4+ and CD8+ T cells 69.8% + 10.8% CD4+ cells were CD 16+ after transduction with CD16V-BB , as compared to 77.6% + 9.2% CD8+ cells (Fig. 2).
  • the presence of the chimeric protein was also determined by western blotting probed with the anti-CD3 ⁇ antibody. As shown in Fig.
  • CD16V-BB ⁇ -transduced T lymphocytes expressed a chimeric protein of approximately 25 kDa under reducing conditions, in addition to the endogenous CD3 ⁇ of 16 kDa. Under non-reducing conditions, the CD16V-BB ⁇ protein was shown to be expressed as either a monomer or a dimer of 50 kDa.
  • peripheral blood T lymphocytes from 3 donors were transduced. As shown in Fig. 3 A, CD 16V- ⁇ - ⁇ -expressing T lymphocytes were coated with the antibody after incubation with Rituximab. Similar results were obtained with Trastuzumab and human IgG.
  • CD16V-BB ⁇ receptor which contained the high-affinity V158 polymorphism of FCRG3A (CD16)
  • CD16F-BB ⁇ an identical receptor containing the F158 variant instead
  • Fig. 3B shows that at any given level of GFP, cells transduced with the CD16V-BB ⁇ receptor had a higher PE fluorescence intensity than that of cells transduced with the CD16F-BB ⁇ receptor, indicating that the former had a significantly higher antibody-binding affinity.
  • Trastuzumab and human IgG were also bound by CD16V-BB ⁇ receptors with a higher affinity (Fig. 4).
  • Binding of Ig to ⁇ - ⁇ - ⁇ induces T cell activation, degranulation and cell
  • T lymphocytes transduced with CD16V-BB ⁇ markedly increased IL-2 receptor expression (CD25) when cultured on plates coated with Rituximab whereas no changes were detected in the absence of antibody, or in mock-transduced cells regardless of whether the antibody was present (Fig. 5A and B).
  • CD16V-BB ⁇ receptor cross-linking triggered exocytosis of lytic granules in T lymphocytes, as detected by CD 107a staining.
  • T lymphocytes expressing CD16V-BB ⁇ expanded in the presence of Rituximab and Daudi cells (at a 1 : 1 ratio with T lymphocytes): in 3 experiments, mean T cell recovery after 7 days of culture was 632% (+ 97%) of input cells; after 4 weeks of culture, it was 6877% (+ 1399%).
  • unbound Rituximab even at a very high concentration (1-10 ⁇ g/mL), had no significant effect on cell proliferation in the absence of target cells, and no cell growth occurred without Rituximab, or in mock-transduced T cells regardless of the presence of the antibody and/or target cells (Fig. 5D).
  • CD16V-BB ⁇ receptor cross-linking induces signals that result in sustained proliferation.
  • T lymphocytes expressing ⁇ - ⁇ - ⁇ mediate ADCC in vitro and in vivo T lymphocytes expressing ⁇ - ⁇ - ⁇ mediate ADCC in vitro and in vivo
  • CD16V-BB ⁇ T lymphocytes should be capable of killing target cells in the presence of specific antibodies. Indeed, in 4-hour in vitro cytotoxicity assays, CD16V-BB ⁇ T lymphocytes were highly cytotoxic against the B-cell lymphoma cell lines Daudi and Ramos in the presence of Rituximab: more than 50% target cells were typically lysed after 4 hours of co- culture at a 2 : 1 E : T ratio (Fig. 6 and Fig. 7). By contrast, target cell killing was low in the absence of the antibody or with mock-transduced T cells (Fig. 6 and Fig. 7).
  • CD3+ T lymphocytes >98%) and contained no detectable CD3— CD56+ NK cells.
  • CD16V-BB- ⁇ T lymphocytes were co-cultured with CLL cells in the presence of bone marrow-derived mesenchymal stromal cells for 24 hours at a 1:2 E:T. As shown in Fig. 6C, mesenchymal cells did not diminish the killing capacity of the ADCC-mediating lymphocytes.
  • CD16V-BB ⁇ T lymphocytes was tested against solid tumor cells expressing HER2 (the breast cancer cell lines MCF-7 and SK-BR-3 and the gastric cancer cell line MKN7) or GD2 (the neuroblastoma cell lines CHLA-255, NB1691 and SK-N-SH, and the
  • osteosarcoma cell line U2-OS The antibodies Trastuzumab were used to target HER2 and hul4.18K322A were used to target GD2.
  • cytotoxicity exceeded 50% at 1:8 ratio in the presence of hul4.18K322A.
  • CD16V- ⁇ - ⁇ -mediated cell killing the CD20+ Daudi cells were cultured with CD16V-BB T lymphocytes and antibodies of different specificity: only Rituximab mediated cytotoxicity, while there was no increase in cytotoxicity in the presence of Trastuzumab or hul4.18K322A (Fig. 8).
  • CD16V-BB ⁇ -mediated cell killing in the presence of immunotherapeutic antibodies could be inhibited by unbound monomelic IgG. As shown in Fig. 8, T cell cytotoxicity was not affected even if IgG was present at up to 1000 times higher concentration than the cell-bound immunotherapeutic antibody.
  • CD16V-BB ⁇ receptors The function of T cells bearing either CD16V-BB ⁇ or CD16F-BB ⁇ receptors was compared. In line with their higher affinity for Ig, CD16V-BB ⁇ receptors induced significantly higher T cell proliferation and ADCC than that triggered by the lower affinity CD16F-BB ⁇ receptors (Fig. 11).
  • T cells bearing CD16V-BB ⁇ were compared to that of T cells expressing other receptors with different signaling properties. These included a receptor with no signaling capacity ("CD16V-truncated”), one with CD3 ⁇ but no 4-1BB ("CD16V "), and a previously described receptor that combined CD 16V with the transmembrane and cytoplasmic domains of FceRlY("CD16V-FceRiy) (Jefferis, Nat. Rev. Drug Discov. 2009; 8(3):226-234; Clemenceau et al., Blood 2006; 107(12):4669-4677) (Fig. 12). After retroviral transduction in activated T cells, all receptors were highly expressed (Fig. 13). As shown in Fig. 14, CD 16V- ⁇ - ⁇ induced significantly higher activation, proliferation and specific cytotoxicity than all other constructs.
  • CD16V-BB ⁇ expression was enforced by retroviral transduction. It was tested whether an alternative method, electroporation of mRNA, could also confer ADCC capacity to T lymphocytes. Activated T lymphocytes from 2 donors were electroporated and high expression efficiencies were obtained: 55% and 82% of T lymphocytes became CD16+ 24 hours after electroporation (Fig. 15A). In the second donor, receptor expression was also tested on day 3, when it was 43%, a result similar to those of previous experiments with another receptor where expression persisted for 72 to 96 hours (Fujisaki et al., Cancer Res. 2009; 69(9):4010-4017).
  • ADCC was activated in T lymphocytes electroporated with CD16V-BB ⁇ mRNA: in the presence of Rituximab, 80% Ramos cells were killed after 4 hours at a 2 : 1 E : T ratio, while cells electroporated without mRNAs were ineffective (Fig. 15B).
  • CD16V-BB ⁇ T lymphocytes were highly cytotoxic against a wide range of tumor cell types, including B-cell lymphoma, breast and gastric cancer, neuroblastoma and osteosarcoma, as well as primary CLL cells. Cytotoxicity was entirely dependent on the presence of a specific antibody bound to target cells; unbound antibodies did not provoke non-specific cytotoxicity nor affected cytotoxicity with cell-bound antibodies.
  • CD16V-BB ⁇ T cells also killed CLL cells when these were cultured on mesenchymal cell layers, regardless of the known immunosuppressive effects of this microenvironment (Jefferis, Nat. Rev. Drug Discov. 2009; 8(3):226-234; Clemenceau et al., Blood 2006; 107(12):4669-4677).
  • CD16V-BB ⁇ T lymphocytes infused after Rituximab eradicated B-cell lymphoma cells engrafted in immunodeficient mice, and had considerable anti-tumor activity in mice engrafted with neuroblastoma cells in the presence of an anti-GD2 antibody.
  • T cells expressing CD16V-BB ⁇ effected strong ADCC in vitro and in vivo.
  • CD 16 The affinity of CD 16 for the Fc portion of Ig is a critical determinant of ADCC and, thus, influences clinical responses to antibody immunotherapy. Hence, considerable efforts are being made to further enhance the affinity of Fc fragments for FcyR, for example by glycoengineering (Nimmerjahn et al., Nat. Rev. Immunol. 2008; 8(l):34-47, Kohrt et al., Immunotherapy 2012; 4(5):511-527).
  • FCRG3A CDI6 gene with the 158V polymorphism (SEQ ID NO: 10) was used as an example.
  • This variant encodes a receptor with higher binding affinity for Ig and has been shown to mediate superior ADCC (Ferris et al., J. Clin. Oncol. 2010; 28(28):4390-4399; Koene et al., Blood 1997; 90(3): 1109- 1114; Cartron et al., Blood 2002; 99(3):754-758; Weng et al., J. Clin. Oncol. 2003; 21(21):3940-3947; Dall'Ozzo et al., Cancer Res. 2004;
  • CD16V-BB ⁇ had a significantly higher capacity to bind human Ig Fc, and induced more vigorous proliferation and cytotoxicity, evoking results of recent studies addressing the role of affinity in chimeric antigen receptor function (Kono et al., Cancer Res. 2002; 62(20):5813-5817; Delgado et al., Cancer Res. 2010; 70(23):9554-956).
  • Current "second generation" chimeric receptors combine a stimulatory molecule with a co- stimulatory one to augment signaling and prevent activation-induced apoptosis. Therefore, CD16 V158 was combined with a stimulatory molecular tandem constituted by CD3 ⁇ and 4-1BB (CD137). Indeed, the CD16V-BB ⁇ receptor induced a markedly superior T cell activation,
  • Antibody therapy has become standard-of-care for many cancer subtypes; its clinical efficacy is mostly determined by its capacity to trigger ADCC through the engagement of Fc receptors (Ferris et al., J. Clin. Oncol. 2010; 28(28):4390-4399).
  • the main effectors of ADCC are NK cells but their function can be impaired in patients with cancer.
  • Trastuzumab-mediated ADCC of gastric cancer cells overexpressing HER2 was significantly lower with peripheral blood mononuclear cells from gastric cancer patients and advanced disease as compared to that obtained with samples from patients with early disease or healthy donors.
  • responses are likely to be influenced by other factors, including the genotype of NK-cell inhibitory receptors and their ligands.
  • CD16V-BB ⁇ receptors can be expressed by mRNA electroporation not only in activated T lymphocytes but also in resting peripheral blood mononuclear cells, a procedure that would take only a few hours from blood collection to infusion of CD16V-BB ⁇ -expressing cells and is therefore well suited for clinical application.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Immunology (AREA)
  • General Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Cell Biology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biotechnology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Biophysics (AREA)
  • Public Health (AREA)
  • Wood Science & Technology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Toxicology (AREA)
  • Hematology (AREA)
  • General Engineering & Computer Science (AREA)
  • Epidemiology (AREA)
  • Microbiology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Oncology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Marine Sciences & Fisheries (AREA)
  • Developmental Biology & Embryology (AREA)
  • Virology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Peptides Or Proteins (AREA)
PCT/US2014/060999 2013-10-17 2014-10-17 Chimeric receptor that triggers antibody-dependent cell cytotoxicity against multiple tumors Ceased WO2015058018A1 (en)

Priority Applications (10)

Application Number Priority Date Filing Date Title
CN201480057323.2A CN105683214B (zh) 2013-10-17 2014-10-17 触发针对多种肿瘤的抗体依赖细胞毒性的嵌合受体
SG11201602979RA SG11201602979RA (en) 2013-10-17 2014-10-17 Chimeric receptor that triggers antibody-dependent cell cytotoxicity against multiple tumors
AU2014337195A AU2014337195B2 (en) 2013-10-17 2014-10-17 Chimeric receptor that triggers antibody-dependent cell cytotoxicity against multiple tumors
KR1020167012468A KR102308597B1 (ko) 2013-10-17 2014-10-17 다중 종양에 대항하여 항체-의존성 세포 세포독성을 촉발시키는 키메라 수용체
JP2016524494A JP6417413B2 (ja) 2013-10-17 2014-10-17 多様な腫瘍に対する抗体依存性細胞毒性を誘発するキメラ受容体
CA2926267A CA2926267C (en) 2013-10-17 2014-10-17 Chimeric receptor that triggers antibody-dependent cell cytotoxicity against multiple tumors
EP14854582.5A EP3057986B1 (en) 2013-10-17 2014-10-17 Chimeric receptor that triggers antibody-dependent cell cytotoxicity against multiple tumors
BR112016007695A BR112016007695A2 (pt) 2013-10-17 2014-10-17 receptor quimérico que desencadeia a citotoxicidade celular mediada por anticorpo contra múltiplos tumores
IL245088A IL245088A0 (en) 2013-10-17 2016-04-13 A chimeric receptor that causes antibody-dependent cytotoxicity for multiple tumors
ZA2016/02798A ZA201602798B (en) 2013-10-17 2016-04-22 Chimeric receptor that triggers antibody-dependent cell cytotoxicity against multiple tumors

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US201361892218P 2013-10-17 2013-10-17
US61/892,218 2013-10-17
US201462026243P 2014-07-18 2014-07-18
US62/026,243 2014-07-18

Publications (1)

Publication Number Publication Date
WO2015058018A1 true WO2015058018A1 (en) 2015-04-23

Family

ID=52828713

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2014/060999 Ceased WO2015058018A1 (en) 2013-10-17 2014-10-17 Chimeric receptor that triggers antibody-dependent cell cytotoxicity against multiple tumors

Country Status (11)

Country Link
EP (1) EP3057986B1 (https=)
JP (1) JP6417413B2 (https=)
KR (1) KR102308597B1 (https=)
CN (1) CN105683214B (https=)
AU (1) AU2014337195B2 (https=)
BR (1) BR112016007695A2 (https=)
CA (1) CA2926267C (https=)
IL (1) IL245088A0 (https=)
SG (1) SG11201602979RA (https=)
WO (1) WO2015058018A1 (https=)
ZA (1) ZA201602798B (https=)

Cited By (33)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2016040441A1 (en) * 2014-09-09 2016-03-17 Unum Therapeutics Chimeric receptors and uses thereof in immune therapy
WO2017061615A1 (ja) * 2015-10-08 2017-04-13 国立大学法人名古屋大学 キメラ抗原受容体を発現する遺伝子改変t細胞の調製方法
WO2017140632A1 (en) * 2016-02-19 2017-08-24 Novoscope Ip Limited Engineered cells & methods
WO2018017649A1 (en) * 2016-07-19 2018-01-25 Unum Therapeutics Inc. Use of antibody-coupled t cell receptor (actr) with multiple anti-cancer antibodies in cancer treatment
EP3315511A1 (en) 2016-10-29 2018-05-02 Miltenyi Biotec GmbH Adapter chimeric antigen receptor expressing cells for targeting of multiple antigens
US10144770B2 (en) 2013-10-17 2018-12-04 National University Of Singapore Chimeric receptors and uses thereof in immune therapy
US10195273B2 (en) 2016-06-05 2019-02-05 Snipr Technologies Limited Selectively altering microbiota for immune modulation
US10428305B2 (en) 2014-05-15 2019-10-01 National University Of Singapore Modified natural killer cells that express IL15 and uses thereof
US10463049B2 (en) 2015-05-06 2019-11-05 Snipr Technologies Limited Altering microbial populations and modifying microbiota
WO2019222642A1 (en) * 2018-05-18 2019-11-21 Senti Biosciences, Inc. Engineered immune cells and methods of use
WO2020010110A1 (en) 2018-07-03 2020-01-09 Unum Therapeutics Inc. Chimeric receptors in combination with trans metabolism molecules enhancing glucose import and therapeutic uses thereof
US10538739B2 (en) 2013-01-28 2020-01-21 St. Jude Children's Research Hospital, Inc. Chimeric receptor with NKG2D specificity for use in cell therapy against cancer and infectious disease
EP3620464A1 (en) 2018-09-10 2020-03-11 Miltenyi Biotec GmbH Car cell having crosslinked disulfide bridge on antigen recognizing moiety
WO2020201527A1 (en) 2019-04-04 2020-10-08 Umc Utrecht Holding B.V. Modified immune receptor constructs
US10920222B2 (en) 2018-04-30 2021-02-16 Snipr Biome Aps Treating and preventing microbial infections
WO2021047804A1 (en) 2019-09-11 2021-03-18 Miltenyi Biotec B.V. & Co. KG In vitro method for transduction of t cells in the presence of malignant cells
EP3878464A1 (en) 2020-03-09 2021-09-15 Miltenyi Biotec B.V. & Co. KG Use of a car cell having crosslinked disulfide bridge on antigen recognizing moiety for targeting cancer cells
US11141436B2 (en) 2019-03-05 2021-10-12 Nkarta, Inc. Immune cells engineered to express CD19-directed chimeric antigen receptors and uses thereof in immunotherapy
US11365236B2 (en) 2017-03-27 2022-06-21 Nkarta, Inc. Truncated NKG2D chimeric receptors and uses thereof in natural killer cell immunotherapy
US11446398B2 (en) 2016-04-11 2022-09-20 Obsidian Therapeutics, Inc. Regulated biocircuit systems
US11578333B2 (en) 2018-10-14 2023-02-14 Snipr Biome Aps Single-vector type I vectors
WO2023049933A1 (en) 2021-09-27 2023-03-30 Sotio Biotech Inc. Chimeric receptor polypeptides in combination with trans metabolism molecules that re-direct glucose metabolites out of the glycolysis pathway and therapeutic uses thereof
JP2023171766A (ja) * 2015-10-15 2023-12-05 セルラリティ インク. ナチュラルキラー細胞およびilc3細胞ならびにそれらの使用
US11896616B2 (en) 2017-03-27 2024-02-13 National University Of Singapore Stimulatory cell lines for ex vivo expansion and activation of natural killer cells
WO2024040207A1 (en) 2022-08-19 2024-02-22 Sotio Biotech Inc. Genetically engineered natural killer (nk) cells with chimeric receptor polypeptides in combination with trans metabolism molecules and therapeutic uses thereof
WO2024040208A1 (en) 2022-08-19 2024-02-22 Sotio Biotech Inc. Genetically engineered immune cells with chimeric receptor polypeptides in combination with multiple trans metabolism molecules and therapeutic uses thereof
US12076375B2 (en) 2022-06-29 2024-09-03 Snipr Biome Aps Treating and preventing E coli infections
US12077785B2 (en) 2018-08-14 2024-09-03 Sotio Biotech Inc. Chimeric antigen receptor polypeptides in combination with trans metabolism molecules modulating Krebs cycle and therapeutic uses thereof
US12104178B2 (en) 2017-03-03 2024-10-01 Obsidian Therapeutics, Inc. DHFR tunable protein regulation
US12258381B2 (en) 2018-02-09 2025-03-25 National University Of Singapore Activating chimeric receptors and uses thereof in natural killer cell immunotherapy
US12441787B2 (en) 2018-04-02 2025-10-14 National University Of Singapore Neutralization of human cytokines with membrane-bound anti-cytokine non-signaling binders expressed in immune cells
US12486514B2 (en) 2018-08-29 2025-12-02 National University Of Singapore Method to specifically stimulate survival and expansion of genetically-modified immune cells
US12590148B2 (en) 2018-11-26 2026-03-31 Nkarta, Inc. Methods for the simultaneous expansion of multiple immune cell types, related compositions and uses of same in cancer immunotherapy

Families Citing this family (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
NZ752984A (en) 2016-11-22 2026-03-27 Nat Univ Singapore Blockade of cd7 expression and chimeric antigen receptors for immunotherapy of t-cell malignancies
WO2019056174A1 (zh) * 2017-09-19 2019-03-28 中山大学 一种过表达cxcr5的间质干细胞及其制备方法和用途
IL276365B2 (en) 2018-02-01 2023-10-01 Nkmax Co Ltd A method for the production of natural killer cells and a preparation for cancer treatment
US12269863B2 (en) * 2018-05-23 2025-04-08 Manysmart Therapeutics, Inc. Bispecific T cell engager and uses thereof
EP3875478A1 (en) 2020-03-05 2021-09-08 Canvax Biotech, S.L. Novel non-immunogenic chimeric antigen receptors and uses thereof
CN113583139A (zh) * 2020-07-06 2021-11-02 上海鑫湾生物科技有限公司 一种嵌合受体及其应用
EP4313087A4 (en) * 2021-03-30 2025-03-19 The Regents of the University of California PROTECTION OF TRANSPLANTED CELLS VIA MODIFIED FC RECEPTORS

Citations (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4650764A (en) 1983-04-12 1987-03-17 Wisconsin Alumni Research Foundation Helper cell
US4980289A (en) 1987-04-27 1990-12-25 Wisconsin Alumni Research Foundation Promoter deficient retroviral vector
US5124263A (en) 1989-01-12 1992-06-23 Wisconsin Alumni Research Foundation Recombination resistant retroviral helper cell and products produced thereby
WO1995007358A1 (en) 1993-07-30 1995-03-16 University Of Medicine & Dentistry Of New Jersey Efficient gene transfer into primary lymphocytes
US5399346A (en) 1989-06-14 1995-03-21 The United States Of America As Represented By The Department Of Health And Human Services Gene therapy
US7435596B2 (en) 2004-11-04 2008-10-14 St. Jude Children's Research Hospital, Inc. Modified cell line and method for expansion of NK cell
US20110123440A1 (en) 2005-03-29 2011-05-26 Genevieve Hansen Altered Antibody FC Regions and Uses Thereof
US20120213783A1 (en) * 2009-10-01 2012-08-23 Rosenberg Steven A Anti-vascular endothelial growth factor receptor-2 chimeric antigen receptors and use of same for the treatment of cancer
US20130266551A1 (en) 2003-11-05 2013-10-10 St. Jude Children's Research Hospital, Inc. Chimeric receptors with 4-1bb stimulatory signaling domain

Family Cites Families (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
ATE483472T1 (de) * 2002-05-30 2010-10-15 Macrogenics Inc Cd16a bindungsproteine und verwendung zur behandlung von immunkrankheiten
US20080003225A1 (en) * 2006-06-29 2008-01-03 Henri Vie Method for enhancing the antibody-dependent cellular cytotoxicity (ADCC) and uses of T cells expressing CD16 receptors
CA2694055A1 (en) * 2007-08-01 2009-02-05 Glaxo Group Limited Novel antibodies
US8067339B2 (en) * 2008-07-09 2011-11-29 Merck Sharp & Dohme Corp. Surface display of whole antibodies in eukaryotes
DE102009013748B4 (de) * 2009-03-17 2012-01-26 Paul-Ehrlich-Institut Bestimmung von Interaktionen konstanter Antikörperteile mit Fc-gamma Rezeptoren
AU2011289426A1 (en) * 2010-08-10 2013-02-28 Amgen Inc. Dual function in vitro target binding assay for the detection of neutralizing antibodies against target antibodies
PH12013501201A1 (en) * 2010-12-09 2013-07-29 Univ Pennsylvania Use of chimeric antigen receptor-modified t cells to treat cancer
CA2972714A1 (en) * 2014-09-09 2016-03-17 Unum Therapeutics Chimeric receptors and uses thereof in immune therapy

Patent Citations (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4650764A (en) 1983-04-12 1987-03-17 Wisconsin Alumni Research Foundation Helper cell
US4980289A (en) 1987-04-27 1990-12-25 Wisconsin Alumni Research Foundation Promoter deficient retroviral vector
US5124263A (en) 1989-01-12 1992-06-23 Wisconsin Alumni Research Foundation Recombination resistant retroviral helper cell and products produced thereby
US5399346A (en) 1989-06-14 1995-03-21 The United States Of America As Represented By The Department Of Health And Human Services Gene therapy
WO1995007358A1 (en) 1993-07-30 1995-03-16 University Of Medicine & Dentistry Of New Jersey Efficient gene transfer into primary lymphocytes
US20130266551A1 (en) 2003-11-05 2013-10-10 St. Jude Children's Research Hospital, Inc. Chimeric receptors with 4-1bb stimulatory signaling domain
US7435596B2 (en) 2004-11-04 2008-10-14 St. Jude Children's Research Hospital, Inc. Modified cell line and method for expansion of NK cell
US8026097B2 (en) 2004-11-04 2011-09-27 St. Jude Children's Research Hospital Expansion of NK cells and therapeutic uses thereof
US20110123440A1 (en) 2005-03-29 2011-05-26 Genevieve Hansen Altered Antibody FC Regions and Uses Thereof
US20120213783A1 (en) * 2009-10-01 2012-08-23 Rosenberg Steven A Anti-vascular endothelial growth factor receptor-2 chimeric antigen receptors and use of same for the treatment of cancer
US20130225668A1 (en) * 2009-10-01 2013-08-29 The United States Of America, As Represented By The Secretary, Department Of Health And Human Anti-vascular endothelial growth factor receptor-2 chimeric antigen receptors and use of same for the treatment of cancer

Non-Patent Citations (71)

* Cited by examiner, † Cited by third party
Title
"Animal Cell Culture", 1986
"Cancer Research UK Centre for Cancer Therapeutics at the Institute of Cancer Research, Sutton, Surrey, UK", 2004, HUMANA PRESS, article "Suicide Gene Therapy: Methods and Reviews, Springer, Caroline J."
"Current Protocols in Molecular Biology", 1994, JOHN WILEY & SONS, INC
"DNA Cloning: A practical Approach", vol. I, II, 1985
"Harrison's Principles of Internal Medicine", 2001, MCGRAW HILL, NY
"Immobilized Cells and Enzymes", 1986, 1RL PRESS
"Nucleic Acid Hybridization", 1985
"Oligonucleotide Synthesis", 1984
"Physician's Desk Reference", 2005, THOMSON P D R, MONTVALE N.J.
"Remington's Pharmaceutical Sciences", 1991, MACK PUB. CO., N.J.
"Remington's The Science and Practice of Pharmacy", 2000, LIPPINCOTT WILLIAMS AND WILKINS, BALTIMORE MD.
"The Merck Manual of Diagnosis and Therapy", 1992, MERCK RESEARCH LABORATORIES, RAHWAY N.J
"Transcription and Translation", 1984
AHLGRIMM ET AL., BLOOD, vol. 118, no. 17, 2011, pages 4657 - 4662
APPELBAUM, NATURE, vol. 411, no. 6835, 2001, pages 385 - 389
B. PERBAL: "A practical Guide To Molecular Cloning", 1984
BIBEAU ET AL., J. CLIN. ONCOL., vol. 27, no. 7, 2009, pages 1122 - 1129
BRENJENS ET AL., BLOOD, vol. 118, no. 18, 2011, pages 4817 - 4828
BRENTJENS ET AL., NAT. MED., vol. 9, no. 3, 2003, pages 279 - 286
BRENTJENS ET AL., SCI. TRANSL. MED., vol. 5, no. 177, 2013, pages 177RA138
CARTRON ET AL., BLOOD, vol. 99, no. 3, 2002, pages 754 - 758
CLEMENCEAU ET AL., BLOOD, vol. 107, no. 12, 2006, pages 4669 - 4677
COOPER ET AL., BLOOD, vol. 101, no. 4, 2003, pages 1637 - 1644
DALL'OZZO ET AL., CANCER RES., vol. 64, no. 13, 2004, pages 4664 - 4669
DATABASE UNIPROTKB [online] 18 September 2013 (2013-09-18), "FULL=LOW AFFINITY IMMUNOGLOBULIN GAMMA FC REGION RECEPTOR III-A;", XP055334803, retrieved from UNIPROT Database accession no. P08637 *
DATABASE UNIPROTKB [online] 29 May 2013 (2013-05-29), XP055334815, retrieved from UNIPROT Database accession no. M9MML0 *
DELGADO ET AL., CANCER RES., vol. 70, no. 23, 2010, pages 9554 - 956
ESHHAR ET AL., PROC. NATL. ACAD. SCI. USA., vol. 90, no. 2, 1993, pages 720 - 724
FEHNIGER T A; CALIGIURI M A, INT REV IMMUNOL, vol. 20, no. 3-4, 2001, pages 503 - 534
FERRIS ET AL., J. CLIN. ONCOL., vol. 28, no. 28, 2010, pages 4390 - 4399
FUJISAKI ET AL., CANCER RES., vol. 69, no. 9, 2009, pages 4010 - 4017
GALLUZZI ET AL., ONCOIMMUNOLOGY, vol. L, no. L, 2012, pages 28 - 37
GEIGER ET AL., J. IMMUNOL., vol. 162, no. 10, 1999, pages 5931 - 5939
GRUPP ET AL., N. ENGL. J. MED., vol. 368, no. 16, 2013, pages 1509 - 1518
HARADA H ET AL., EXP HEMATOL, vol. 32, no. 7, 2004, pages 614 - 621
HARADA H. ET AL., JPN. J. CANCER RES, vol. 93, 2002, pages 313 - 319
HATJIHARISSI ET AL., BLOOD, vol. 110, no. 7, 2007, pages 2561 - 2564
IMAI ET AL., LEUKEMIA, vol. 18, 2004, pages 676 - 684
JEFFERIS, NAT. REV. DRUG DISCOV., vol. 8, no. 3, 2009, pages 226 - 234
KLEIN ET AL., INT. J. CANCER, vol. 18, 1976, pages 421 - 431
KOCHENDERFER ET AL., BLOOD, vol. 119, no. 12, 2012, pages 2709 - 2720
KOENE ET AL., BLOOD, vol. 90, no. 3, 1997, pages 1109 - 1114
KOHRT ET AL., IMMUNOTHERAPY, vol. 4, no. 5, 2012, pages 511 - 527
KOLB ET AL., BLOOD, vol. 86, no. 5, 1995, pages 2041 - 2050
KONO ET AL., CANCER RES., vol. 62, no. 20, 2002, pages 5813 - 5817
KUO ET AL., BLOOD, vol. 82, 1993, pages 845
LOZZIO ET AL., BLOOD, vol. 45, no. 3, 1975, pages 321 - 334
MALONEY, N., ENGL. J. MED., vol. 366, no. 21, 2012, pages 2008 - 2016
MANN ET AL., CELL, vol. 33, 1983, pages 153
MARKOWITZ ET AL., J. VIROL., vol. 62, 1988, pages 1120
MUSOLINO ET AL., J. CLIN. ONCOL., vol. 26, no. 11, 2008, pages 1789 - 1796
NIMMERJAHN ET AL., NAT REV IMMUNOL., vol. 8, no. L, 2008, pages 34 - 47
NIMMERJAHN ET AL., NAT. REV. IMMUNOL., vol. 8, no. L, 2008, pages 34 - 47
ONCLIVE, vol. 365, no. 8, pages 725 - 733
PORTER ET AL., N. ENGL. J. MED., vol. 330, no. 2, 1994, pages 100 - 106
PORTER ET AL., ONCLIVE, 2011, pages 25
PORTER ET AL., ONCLIVE, vol. 365, no. 8, 25 December 2010 (2010-12-25), pages 725 - 733
PULE ET AL., NAT. MED., vol. 14, no. 11, 2008, pages 1264 - 1270
SAMBROOK; FRITSCH; MANIATIS: "Molecular Cloning: A Laboratory Manual", 1989, COLD SPRING HARBOR LABORATORY PRESS
SCOTT ET AL., NAT. REV. CANCER, vol. 12, no. 4, 2012, pages 278 - 287
See also references of EP3057986A4
SHIMASAKI ET AL., CYTOTHERAPY, 2012, pages 1 - 11
SHIMASAKI ET AL., CYTOTHERAPY, vol. 14, no. 7, 2012, pages 830 - 40
SLAVIN ET AL., BLOOD, vol. 87, no. 6, 1996, pages 2195 - 2204
TILL ET AL., BLOOD, vol. 119, no. 17, 2012, pages 3940 - 3950
TORIKAI ET AL., BLOOD, vol. 119, 2012, pages 5697 - 5705
VEERAMANI ET AL., BLOOD, vol. 118, no. 12, 2011, pages 3347 - 3349
WEIDEN ET AL., N. ENGL. J. MED., vol. 300, no. 19, 1979, pages 1068 - 1073
WEINER ET AL., CELL, vol. 148, no. 6, 2012, pages 1081 - 1084
WENG ET AL., J. CLIN. ONCOL., vol. 21, no. 21, 2003, pages 3940 - 3947
YU ET AL., N. ENGL. J. MED., vol. 363, no. 14, 2010, pages 1324 - 1334

Cited By (87)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10801012B2 (en) 2013-01-28 2020-10-13 St. Jude Children's Research Hospital, Inc. Chimeric receptor with NKG2D specificity for use in cell therapy against cancer and infectious disease
US10829737B2 (en) 2013-01-28 2020-11-10 St. Jude Children's Research Hospital, Inc. Chimeric receptor with NKG2D specificity for use in cell therapy against cancer and infectious disease
US10538739B2 (en) 2013-01-28 2020-01-21 St. Jude Children's Research Hospital, Inc. Chimeric receptor with NKG2D specificity for use in cell therapy against cancer and infectious disease
US10774309B2 (en) 2013-01-28 2020-09-15 St. Jude Children's Research Hospital, Inc. Natural killer cell immunotherapy for treating cancer
US10836999B2 (en) 2013-01-28 2020-11-17 St. Jude Children's Research Hospital, Inc. Chimeric receptor with NKG2D specificity for use in cell therapy against cancer and infectious disease
US11873512B2 (en) 2013-01-28 2024-01-16 St. Jude Children's Research Hospital, Inc. Chimeric receptor with NKG2D specificity for use in cell therapy against cancer and infectious disease
US10144770B2 (en) 2013-10-17 2018-12-04 National University Of Singapore Chimeric receptors and uses thereof in immune therapy
US10428305B2 (en) 2014-05-15 2019-10-01 National University Of Singapore Modified natural killer cells that express IL15 and uses thereof
US12264335B2 (en) 2014-05-15 2025-04-01 National University Of Singapore Natural killer cells expressing membrane-bound interleukin 15 (mbIL15) and uses thereof
US10774311B2 (en) 2014-05-15 2020-09-15 National University Of Singapore Natural killer cells modified to express membrane-bound interleukin 15 and uses thereof
US11560548B2 (en) 2014-05-15 2023-01-24 National University Of Singapore Immune cells expressing membrane-bound interleukin 15 (mbIL15) and uses thereof
AU2015315199B2 (en) * 2014-09-09 2020-02-27 Unum Therapeutics Chimeric receptors and uses thereof in immune therapy
WO2016040441A1 (en) * 2014-09-09 2016-03-17 Unum Therapeutics Chimeric receptors and uses thereof in immune therapy
US12226430B2 (en) 2015-05-06 2025-02-18 Snipr Technologies Limited Altering microbial populations and modifying microbiota
US10582712B2 (en) 2015-05-06 2020-03-10 Snipr Technologies Limited Altering microbial populations and modifying microbiota
US11612617B2 (en) 2015-05-06 2023-03-28 Snipr Technologies Limited Altering microbial populations and modifying microbiota
US10506812B2 (en) 2015-05-06 2019-12-17 Snipr Technologies Limited Altering microbial populations and modifying microbiota
US10524477B2 (en) 2015-05-06 2020-01-07 Snipr Technologies Limited Altering microbial populations and modifying microbiota
US11547716B2 (en) 2015-05-06 2023-01-10 Snipr Technologies Limited Altering microbial populations and modifying microbiota
US11642363B2 (en) 2015-05-06 2023-05-09 Snipr Technologies Limited Altering microbial populations and modifying microbiota
US10561148B2 (en) 2015-05-06 2020-02-18 Snipr Technologies Limited Altering microbial populations and modifying microbiota
US11844760B2 (en) 2015-05-06 2023-12-19 Snipr Technologies Limited Altering microbial populations and modifying microbiota
US10463049B2 (en) 2015-05-06 2019-11-05 Snipr Technologies Limited Altering microbial populations and modifying microbiota
US11517582B2 (en) 2015-05-06 2022-12-06 Snipr Technologies Limited Altering microbial populations and modifying microbiota
US11400110B2 (en) 2015-05-06 2022-08-02 Snipr Technologies Limited Altering microbial populations and modifying microbiota
US11147830B2 (en) 2015-05-06 2021-10-19 Snipr Technologies Limited Altering microbial populations and modifying microbiota
US10624349B2 (en) 2015-05-06 2020-04-21 Snipr Technologies Limited Altering microbial populations and modifying microbiota
US12502401B2 (en) 2015-05-06 2025-12-23 Snipr Technologies Limited Altering microbial populations and modifying microbiota
US12514867B2 (en) 2015-05-06 2026-01-06 Snipr Technologies Limited Altering microbial populations and modifying microbiota
US12514869B2 (en) 2015-05-06 2026-01-06 Snipr Technologies Limited Altering microbial populations and modifying microbiota
WO2017061615A1 (ja) * 2015-10-08 2017-04-13 国立大学法人名古屋大学 キメラ抗原受容体を発現する遺伝子改変t細胞の調製方法
JP2023171766A (ja) * 2015-10-15 2023-12-05 セルラリティ インク. ナチュラルキラー細胞およびilc3細胞ならびにそれらの使用
JP7577430B2 (ja) 2016-02-19 2024-11-05 ノヴォスコープ アイピー リミテッド 改変細胞及び方法
JP2019512215A (ja) * 2016-02-19 2019-05-16 ノヴォスコープ アイピー リミテッド 改変細胞及び方法
WO2017140632A1 (en) * 2016-02-19 2017-08-24 Novoscope Ip Limited Engineered cells & methods
US11446398B2 (en) 2016-04-11 2022-09-20 Obsidian Therapeutics, Inc. Regulated biocircuit systems
DE112017002816T5 (de) 2016-06-05 2019-02-14 Snipr Technologies Limited Selektives verändern einer mikrobiota zur immunmodulation
US11471531B2 (en) 2016-06-05 2022-10-18 Snipr Technologies Limited Selectively altering microbiota for immune modulation
US12318445B2 (en) 2016-06-05 2025-06-03 Snipr Technologies Limited Selectively altering microbiota for immune modulation
US11141481B2 (en) 2016-06-05 2021-10-12 Snipr Technologies Limited Selectively altering microbiota for immune modulation
US10603379B2 (en) 2016-06-05 2020-03-31 Snipr Technologies Limited Selectively altering microbiota for immune modulation
US10300139B2 (en) 2016-06-05 2019-05-28 Snipr Technologies Limited Selectively altering microbiota for immune modulation
US10195273B2 (en) 2016-06-05 2019-02-05 Snipr Technologies Limited Selectively altering microbiota for immune modulation
US11291723B2 (en) 2016-06-05 2022-04-05 Snipr Technologies Limited Selectively altering microbiota for immune modulation
US11351252B2 (en) 2016-06-05 2022-06-07 Snipr Technologies Limited Selectively altering microbiota for immune modulation
US10953090B2 (en) 2016-06-05 2021-03-23 Snipr Technologies Limited Selectively altering microbiota for immune modulation
US10596255B2 (en) 2016-06-05 2020-03-24 Snipr Technologies Limited Selectively altering microbiota for immune modulation
US10363308B2 (en) 2016-06-05 2019-07-30 Snipr Technologies Limited Selectively altering microbiota for immune modulation
US10300138B2 (en) 2016-06-05 2019-05-28 Snipr Technologies Limited Selectively altering microbiota for immune modulation
US10765740B2 (en) 2016-06-05 2020-09-08 Snipr Technologies Limited Selectively altering microbiota for immune modulation
US11471530B2 (en) 2016-06-05 2022-10-18 Snipr Technologies Limited Selectively altering microbiota for immune modulation
WO2018017649A1 (en) * 2016-07-19 2018-01-25 Unum Therapeutics Inc. Use of antibody-coupled t cell receptor (actr) with multiple anti-cancer antibodies in cancer treatment
EP3315511A1 (en) 2016-10-29 2018-05-02 Miltenyi Biotec GmbH Adapter chimeric antigen receptor expressing cells for targeting of multiple antigens
WO2018078066A1 (en) 2016-10-29 2018-05-03 Miltenyi Biotec Gmbh Adapter chimeric antigen receptor expressing cells for targeting of multiple antigens
US12104178B2 (en) 2017-03-03 2024-10-01 Obsidian Therapeutics, Inc. DHFR tunable protein regulation
US11896616B2 (en) 2017-03-27 2024-02-13 National University Of Singapore Stimulatory cell lines for ex vivo expansion and activation of natural killer cells
US12351617B2 (en) 2017-03-27 2025-07-08 National University Of Singapore Immune cells comprising truncated NKG2D chimeric receptors
US11365236B2 (en) 2017-03-27 2022-06-21 Nkarta, Inc. Truncated NKG2D chimeric receptors and uses thereof in natural killer cell immunotherapy
US12258381B2 (en) 2018-02-09 2025-03-25 National University Of Singapore Activating chimeric receptors and uses thereof in natural killer cell immunotherapy
US12441787B2 (en) 2018-04-02 2025-10-14 National University Of Singapore Neutralization of human cytokines with membrane-bound anti-cytokine non-signaling binders expressed in immune cells
US11643653B2 (en) 2018-04-30 2023-05-09 Snipr Biome Aps Treating and preventing microbial infections
US11788085B2 (en) 2018-04-30 2023-10-17 Snipr Biome Aps Treating and preventing microbial infections
US11485973B2 (en) 2018-04-30 2022-11-01 Snipr Biome Aps Treating and preventing microbial infections
US12448619B2 (en) 2018-04-30 2025-10-21 Snipr Biome Aps Treating and preventing microbial infections
US11421227B2 (en) 2018-04-30 2022-08-23 Snipr Biome Aps Treating and preventing microbial infections
US10920222B2 (en) 2018-04-30 2021-02-16 Snipr Biome Aps Treating and preventing microbial infections
WO2019222642A1 (en) * 2018-05-18 2019-11-21 Senti Biosciences, Inc. Engineered immune cells and methods of use
WO2020010110A1 (en) 2018-07-03 2020-01-09 Unum Therapeutics Inc. Chimeric receptors in combination with trans metabolism molecules enhancing glucose import and therapeutic uses thereof
US12077785B2 (en) 2018-08-14 2024-09-03 Sotio Biotech Inc. Chimeric antigen receptor polypeptides in combination with trans metabolism molecules modulating Krebs cycle and therapeutic uses thereof
US12486514B2 (en) 2018-08-29 2025-12-02 National University Of Singapore Method to specifically stimulate survival and expansion of genetically-modified immune cells
EP3620464A1 (en) 2018-09-10 2020-03-11 Miltenyi Biotec GmbH Car cell having crosslinked disulfide bridge on antigen recognizing moiety
US12404513B2 (en) 2018-10-14 2025-09-02 Snipr Biome Aps Single-vector Type I vectors
US11578333B2 (en) 2018-10-14 2023-02-14 Snipr Biome Aps Single-vector type I vectors
US11629350B2 (en) 2018-10-14 2023-04-18 Snipr Biome Aps Single-vector type I vectors
US11851663B2 (en) 2018-10-14 2023-12-26 Snipr Biome Aps Single-vector type I vectors
US12590148B2 (en) 2018-11-26 2026-03-31 Nkarta, Inc. Methods for the simultaneous expansion of multiple immune cell types, related compositions and uses of same in cancer immunotherapy
US11154575B2 (en) 2019-03-05 2021-10-26 Nkarta, Inc. Cancer immunotherapy using CD19-directed chimeric antigen receptors
US12398187B2 (en) 2019-03-05 2025-08-26 Nkarta, Inc. CD19-directed chimeric antigen receptors and uses thereof in immunotherapy
US11141436B2 (en) 2019-03-05 2021-10-12 Nkarta, Inc. Immune cells engineered to express CD19-directed chimeric antigen receptors and uses thereof in immunotherapy
US11253547B2 (en) 2019-03-05 2022-02-22 Nkarta, Inc. CD19-directed chimeric antigen receptors and uses thereof in immunotherapy
WO2020201527A1 (en) 2019-04-04 2020-10-08 Umc Utrecht Holding B.V. Modified immune receptor constructs
WO2021047804A1 (en) 2019-09-11 2021-03-18 Miltenyi Biotec B.V. & Co. KG In vitro method for transduction of t cells in the presence of malignant cells
EP3878464A1 (en) 2020-03-09 2021-09-15 Miltenyi Biotec B.V. & Co. KG Use of a car cell having crosslinked disulfide bridge on antigen recognizing moiety for targeting cancer cells
WO2023049933A1 (en) 2021-09-27 2023-03-30 Sotio Biotech Inc. Chimeric receptor polypeptides in combination with trans metabolism molecules that re-direct glucose metabolites out of the glycolysis pathway and therapeutic uses thereof
US12076375B2 (en) 2022-06-29 2024-09-03 Snipr Biome Aps Treating and preventing E coli infections
WO2024040208A1 (en) 2022-08-19 2024-02-22 Sotio Biotech Inc. Genetically engineered immune cells with chimeric receptor polypeptides in combination with multiple trans metabolism molecules and therapeutic uses thereof
WO2024040207A1 (en) 2022-08-19 2024-02-22 Sotio Biotech Inc. Genetically engineered natural killer (nk) cells with chimeric receptor polypeptides in combination with trans metabolism molecules and therapeutic uses thereof

Also Published As

Publication number Publication date
IL245088A0 (en) 2016-06-30
CA2926267A1 (en) 2015-04-23
CN105683214A (zh) 2016-06-15
SG11201602979RA (en) 2016-05-30
EP3057986B1 (en) 2017-12-27
AU2014337195A1 (en) 2016-04-21
JP2016534717A (ja) 2016-11-10
EP3057986A4 (en) 2017-03-15
KR20160062762A (ko) 2016-06-02
BR112016007695A2 (pt) 2017-09-12
CN105683214B (zh) 2021-03-09
EP3057986A1 (en) 2016-08-24
ZA201602798B (en) 2018-12-19
JP6417413B2 (ja) 2018-11-07
KR102308597B1 (ko) 2021-10-01
AU2014337195B2 (en) 2018-11-08
CA2926267C (en) 2023-08-01

Similar Documents

Publication Publication Date Title
CA2926267C (en) Chimeric receptor that triggers antibody-dependent cell cytotoxicity against multiple tumors
AU2015315199B2 (en) Chimeric receptors and uses thereof in immune therapy
US10144770B2 (en) Chimeric receptors and uses thereof in immune therapy
AU2019299439B2 (en) Chimeric receptors in combination with trans metabolism molecules enhancing glucose import and therapeutic uses thereof
RU2732925C2 (ru) МАт-НАПРАВЛЯЕМЫЕ ХИМЕРНЫЕ АНТИГЕННЫЕ РЕЦЕПТОРНЫЕ СИСТЕМЫ ДЛЯ СОРТИРОВКИ/ИСТОЩЕНИЯ СКОНСТРУИРОВАННЫХ ИММУННЫХ КЛЕТОК
AU2019206573B2 (en) Immune cells expressing a chimeric antigen receptor
US20190284298A1 (en) Use of antibody-coupled t cell receptor (actr) with multiple anti-cancer antibodies in cancer treatment
US20200181226A1 (en) Antibody-coupled t cell receptor constructs and therapeutic uses thereof
JP2026500718A (ja) B7-h3を標的とする抗体または抗体断片、およびキメラ抗原受容体免疫細胞療法の分野におけるその使用
EP4408982A1 (en) Chimeric receptor polypeptides in combination with trans metabolism molecules that re-direct glucose metabolites out of the glycolysis pathway and therapeutic uses thereof
TW202432833A (zh) 新穎cd19結合體、包含彼之car—t構築體及其使用方法
WO2018027135A1 (en) Treatment of lymphoma using antibody-coupled t cell receptor
HK1228416B (en) Chimeric receptor that triggers antibody-dependent cell cytotoxicity against multiple tumors
HK1228416A1 (en) Chimeric receptor that triggers antibody-dependent cell cytotoxicity against multiple tumors
Achkova Development of Immunotherapy for Classical Hodgkin's Lymphoma and Anaplastic Large Cell Lymphoma Using Colony-stimulating Factor-1 Receptor Re-targeted T-lymphocytes

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 14854582

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2926267

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 245088

Country of ref document: IL

ENP Entry into the national phase

Ref document number: 2016524494

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112016007695

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 2014337195

Country of ref document: AU

Date of ref document: 20141017

Kind code of ref document: A

REEP Request for entry into the european phase

Ref document number: 2014854582

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2014854582

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 20167012468

Country of ref document: KR

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 112016007695

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20160407