WO2015056980A1 - 테뷰코나졸, 메페나셋 및 이나벤파이드에 특이적으로 결합할 수 있는 핵산 압타머 및 그 용도 - Google Patents

테뷰코나졸, 메페나셋 및 이나벤파이드에 특이적으로 결합할 수 있는 핵산 압타머 및 그 용도 Download PDF

Info

Publication number
WO2015056980A1
WO2015056980A1 PCT/KR2014/009696 KR2014009696W WO2015056980A1 WO 2015056980 A1 WO2015056980 A1 WO 2015056980A1 KR 2014009696 W KR2014009696 W KR 2014009696W WO 2015056980 A1 WO2015056980 A1 WO 2015056980A1
Authority
WO
WIPO (PCT)
Prior art keywords
tebuconazole
mefenacet
nucleic acid
inabenfide
aptamer
Prior art date
Application number
PCT/KR2014/009696
Other languages
English (en)
French (fr)
Inventor
구만복
투안 뉴엔반
권영섭
Original Assignee
고려대학교산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 고려대학교산학협력단 filed Critical 고려대학교산학협력단
Priority to JP2016548990A priority Critical patent/JP6262868B2/ja
Priority to US15/028,931 priority patent/US20160251660A1/en
Publication of WO2015056980A1 publication Critical patent/WO2015056980A1/ko

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/115Aptamers, i.e. nucleic acids binding a target molecule specifically and with high affinity without hybridising therewith ; Nucleic acids binding to non-nucleic acids, e.g. aptamers
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/5308Immunoassay; Biospecific binding assay; Materials therefor for analytes not provided for elsewhere, e.g. nucleic acids, uric acid, worms, mites
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/16Aptamers

Definitions

  • the present invention relates to nucleic acid aptamers that can bind tebuconazole, mefenacet and inabenphide, and to their use, and more particularly specifically to bind to tebuconazole, mefenacet and inabenphide.
  • Tebuconazole is a triazole derivative that is widely used to prevent anthrax in peppers.
  • the US FDA considers this fungicide to be safe for humans, but the US Environmental Protection Agency (EPA) defines tebuconazole as a Class C (probably carcinogenic) carcinogen, and the Swedish Chemicals Association is a potential endocrine disrupting chemical. Tebuconazole is still dangerous. Recently, tebuconazole was detected in the red pepper powder of a large food company in excess of the standard amount, and a ban on distribution and sales was imposed.
  • EPA US Environmental Protection Agency
  • Mefenacet is a herbicide that has not been reported as a carcinogen, but is known to cause allergic reactions when exposed to the skin for prolonged periods of time. In addition, long stays in the environment can be very lethal to bees and cause ecosystem disturbances.
  • Inabenfide is a plant growth inhibitor that is forbidden for long periods of time and is recommended to avoid skin, eyes or inhalation.
  • tebuconazole residual substances
  • mefenacet mefenacet
  • inabenphide causes intestinal dysfunction, DNA damage, nervous system and development, and cancer, birth defects, and miscarriage. Can be. Therefore, it is necessary to develop a method for detecting pesticides remaining in soil, water quality, and agricultural and aquatic products, as well as preventing misuse of tebuconazole, mefenacet, and inabenphide.
  • aptamer refers to a single-stranded DNA or RNA molecular structure having high specificity and affinity for a specific target obtained from a random nucleic acid library having a variety of about 10 to 12 to 14 .
  • aptamers are nucleic acid structures unlike antibodies, which are used in the field of sensors, and have excellent thermal stability, and because they are synthesized in vitro, they do not require animals or cells. It is economical and there is no restriction in the target substance, so it is possible to synthesize aptamers for various targets such as biomolecules such as proteins and amino acids, low molecular organic chemicals such as environmental hormones, antibiotics and residual medicines, bacteria and viruses.
  • aptamers for various target materials are being produced, and due to the properties of aptamers that bind with specificity and strong affinity with target materials, many researches have recently applied aptamers to drug development, drug delivery systems, and biosensors. It is done. Therefore, aptamer is a very suitable material to be introduced into a method for detecting a trace amount of residual pesticides, and can be applied to detection of specific residual pesticide substances through nano biotechnology using the same.
  • the most important factor in the aptamer development method is to distinguish between DNA (or RNA) bound to a target and DNA that does not bind to a target.
  • DNA or RNA
  • research has been conducted to distinguish DNA by fixing a target or a DNA random library.
  • the biggest difficulty of the immobilization method is that the immobilization yield may be low, and it is costly and time-consuming to analyze the immobilization yield itself.
  • the possibility of DNA binding directly to the separation material (magnetic beads, column, etc.) used for immobilization cannot be completely ruled out, and it may appear in the process of re-isolating DNA bound to the target fixed to the separation material.
  • DNA pool loss remains a limitation and problem with immobilization.
  • the low DNA fixation problem that can arise from immobilizing the DNA library is a major limitation in direct connection with the loss of the DNA pool, the most important loss to avoid in the aptamer development process.
  • heavy metal ions such as difficult to immobilize itself is difficult to develop aptamer by the immobilization method, there is a problem that there is a limitation in the target selection in the immobilization method.
  • the use of the non-immobilized aptamer development technology can overcome all of the above limitations and has the advantage of reducing the number of iterations of the screening process required for aptamer development because the binding sites of the target are not limited.
  • nucleic acid aptamer which is a nucleic acid construct showing a particularly high affinity for tebuconazole, mefenacet, and inabenphide.
  • a nucleic acid aptamer a nucleic acid construct showing a particularly high affinity for tebuconazole, mefenacet, and inabenphide.
  • graphene SELEX a nucleic acid aptamer specifically binding to tebuconazole, mefenacet, inabenpyide.
  • the present invention was completed by confirming that tebuconazole, mefenacet, and inabenphide can be effectively detected or removed.
  • the present invention provides a nucleic acid aptamer that can specifically bind to tebuconazole, mefenacet or inabenphide having a nucleotide sequence selected from the group consisting of SEQ ID NOs: 3-15. do.
  • the present invention also provides a method for detecting tebuconazole, mefenacet or inabenphide, comprising contacting the nucleic acid aptamer with a sample.
  • the present invention also provides a composition for detecting tebuconazole, mefenacet or inabenphide containing the nucleic acid aptamer.
  • the present invention also provides a sensor for detecting tebuconazole, mefenacet or inabenphide containing the nucleic acid aptamer.
  • the present invention also provides a kit for detecting tebuconazole, mefenacet or inabenphide containing the nucleic acid aptamer.
  • the present invention also provides a method for separating tebuconazole, mefenacet or inabenphide using the nucleic acid aptamer.
  • the present invention also provides a composition for separating tebuconazole, mefenacet or inabenphide containing the nucleic acid aptamer.
  • the present invention also provides a kit for separating tebuconazole, mefenacet or inabenphide containing the nucleic acid aptamer.
  • FIG. 1 is a schematic diagram of a process for preparing a target-specific aptamer using the S-SELEX MT method developed on the basis of a non-immobilized graphene-based SELEX.
  • 2 is a graph showing that the amount of ssDNA binding to tebuconazole, mefenacet, and inabenphide obtained from each selection round is increased.
  • Figure 3 is a schematic diagram illustrating the principle of detecting the target material using the aptamer and gold nanoparticle aggregation phenomenon.
  • 4 to 16 are two of aptamers specifically binding to tebuconazole (T), mefenacet (MBA), and inabenphide (I) represented by SEQ ID NO: 3 to SEQ ID NO: 15 according to the present invention.
  • T tebuconazole
  • MAA mefenacet
  • I inabenphide
  • FIG. 17 illustrates the results of observing gold nanoparticle-based color changes for various samples using nucleic acid aptamer T1.
  • FIG. 18 shows the results of observing gold nanoparticle-based color changes for various samples using the aptamer MBA.
  • FIG. 19 shows the results of observing gold nanoparticle-based color changes for various samples using the aptamer i13.
  • FIG. 20 shows the results of observing gold nanoparticle-based color change for various detection samples using aptamer T2.
  • 21 shows the results of observing gold nanoparticle-based color changes for various concentrations of tebuconazole using aptamer T1.
  • nucleic acid aptamer refers to a small single-stranded oligonucleotide capable of specifically recognizing a target substance with high affinity.
  • sample in the present invention is a composition containing or estimated to contain Tebuconazole, Mefenacet, Inabenfide, liquid, soil, air, food It may be characterized in that it is detected from a sample collected from any one or more of waste, flora and fauna and flora and fauna, but is not limited thereto.
  • the liquid may be characterized in that the water, blood, urine, tears, sweat, saliva, lymph and cerebrospinal fluid, and the water, such as precipitation ( ⁇ ), sea water ( ⁇ ), lakes ( ⁇ ⁇ ) and rain (Sunsu) Including, waste includes sewage, wastewater, and the like, the flora and fauna includes the human body.
  • animal and plant tissues include tissues such as mucous membranes, skin, skin, hair, scales, eyes, tongue, cheeks, hoofs, beaks, snouts, feet, hands, mouths, nipples, ears, and nose.
  • the "GO SELEX process” referred to herein refers to a method of identifying DNA sequences specific to each molecule by selecting and amplifying DNA or RNA having a high binding capacity to a specific molecule in a collection of randomly synthesized DNA or RNA ( JW Park, R. Tatavarty, DWKim, HTJung and MBGu (2012), Immobilization-free screening of aptamers assisted by graphene oxide, Chemical Communications, 48,15,2071-2073.
  • the present invention can bind specifically to Tebuconazole, Mefenacet, or Inabenfide, which has a nucleotide sequence selected from the group consisting of SEQ ID NOs: 3-15. Nucleic acid aptamers.
  • Aptamer T3 5'-CGTACGGAATTCGCTAGCACGTTGACGCTGGTGCCCGGTTGTGGTGCG
  • Tn1 5'-CGTACGGAATTCGCTAGCACGTTGACGCTGGTGCCCGGTTGTGGGCGA
  • Tn3 5'-CGTACGGAATTCGCTAGCGTGTCAATAATGGTCCTCTGGGATCCGAGC
  • Tc2 5'-CACGTGGAGCTCGGATCCACGCGCAGTGGGACCAACCCAAGCCGTGGC
  • Tc3 5'-CACGTGGAGCTCGGATCCACACAACACTCGCACCACAACCGGGCACCA
  • Aptamer MBA 5'-CGTACGGAATTCGCTAGCCCCCCGGCAGGCCACGGCTTGGGTTGGTC
  • Aptamer T2 5'-CGTACGGAATTCGCTAGCCCCCCGGCAGGCCACGGCTTGGGTTGGTCCCTCTGCGCGTGGATCCGAGCTCCACGTG-3 '(SEQ ID NO: 15)
  • Nucleic acid aptamers are provided as single-stranded DNA or RNA, and in the present invention, when the nucleic acid is RNA, T is represented by U in the nucleic acid sequence, and such a sequence is included in the scope of the present invention. It is obvious to those who have ordinary knowledge in Esau.
  • the nucleic acid aptamer of the present invention is any binding that specifically binds to Tebuconazole, Mefenacet or Inabenfide selected by GO SELEX (Systematic Evolution of Ligands by Exponential enrichment) process. It may be a nucleic acid aptamer of the nucleotide sequence.
  • nucleic acid aptamer capable of specifically binding Tebuconazole, Mefenacet, or Inabenfide of the present invention may be prepared by a method comprising the following steps: Can:
  • step d) of the DNA aptamer manufacturing method PCR is performed using a primer to which fluorescein is attached to one of the primer pairs, followed by separation of the denatured single-stranded DNA through electrophoresis. It is characterized by including more.
  • GO SELEX Systematic Evolution of Ligands by Exponential enrichment
  • Nucleic acid aptamers that bind to Tebuconazole, Mefenacet, and Inabenfide using a) process and then, using the gold nanoparticle-based chromatographic method, SEQ ID NO. It was confirmed that the aptamer having the nucleotide sequence represented by SEQ ID NO: 15 specifically binds to each of Tebuconazole, Mefenacet, and Inabenfide.
  • the present invention relates to a method for detecting tebuconazole, mefenacet, or inabenfide.
  • the sample may be a sample taken from any one or more of water, soil, waste, food, plants and plants and animal and plant tissues, but is not limited thereto.
  • the water includes precipitation, sea water, lake, rainwater, and the like
  • waste includes sewage, wastewater, and the like.
  • the nucleic acid aptamer according to the present invention specifically binds to tebuconazole, mefenacet, and inabenphide by color analysis based on gold nanoparticles.
  • Gold nanoparticle-based chromatic diagnostics have recently emerged as a new alternative to on-site detection in terms of ease of preparation, simple operation and visual observation of color changes [Zhao, W., Brook, MA, Li, Y., 2008a. Chem Bio Chem 9, 2363-2371.
  • the aptamer is physically adsorbed on the surface of the unmodified gold nanoparticles.
  • the aptamer adsorbed by the binding of the target due to the phenomenon that the color changes by the phenomenon of falling off the surface of the gold nanoparticles.
  • the solution color of pure gold nanoparticles is red, and when the aptamer is physically adsorbed on the gold nanoparticles and the target is inserted, the aptamer is more affinity between the aptamer and the target than the affinity between the gold nanoparticles.
  • Mer combines with the target [Y. S.
  • the gold nanoparticle-based chromatographic analysis confirmed that the aptamer selected in the present invention specifically binds to tebuconazole, mefenacet, and inabenphide.
  • the aptamer is fixed to the surface of the gold nanoparticles by covalent bonds, etc., so that when the target material is present, aggregation occurs due to the distance between two or more gold nanoparticles.
  • the color of the gold nanoparticle solution changes from red to blue, or the aptamer is physically adsorbed on the surface of the unmodified gold nanoparticle
  • the aptamer adsorbed when the target material is present Due to the phenomenon that the color changes due to the phenomenon falling off the surface of the gold nanoparticles can detect tebuconazole, mefenacet, inabenphide.
  • gold nanoparticles for the aptamer T1, il3, MBA which is the nucleic acid sequence represented by SEQ ID NO: 3, 9, 14 showing the highest affinity among the nucleic acid aptamer represented by SEQ ID NO: 3 to 14 Particle-based chromaticity analysis confirmed that the aptamer specifically binds to tebuconazole, mefenacet, and inabenphide.
  • the present invention Tebuconazole, mefenacet or Tebuconazole containing aptamer specifically binding to Tebuconazole, Mefenacet or Inabenfide
  • the present invention relates to a composition for detecting benphide.
  • the aptamers of the present invention may also be chemically synthesized by methods already known in the art.
  • a modified sugar residue eg, ribose or deoxyribose
  • examples of the moiety modified in the sugar moiety include those in which the oxygen atom at the 2 ', 3' and / or 4 'sites of the sugar moiety is replaced with another atom.
  • Such a sugar residue can be modified by a method known per se (for example, Sproate et al., (1991) Nucle . Acid . Res . 19, 733-738; Cotton et al., (1991) Nucl.Acid . Res. 19, 2629-2635; see Hobbs et al. , (1973) Biochemistry 12, 5138-5145).
  • the aptamer of the present invention may use a modified (eg, chemically substituted) nucleic acid base (eg, purine, pyrimidine) in order to increase the binding to tebuconazole, mefenacet, inabenphide, and the like.
  • modifications include, for example, 5-site pyrimidine modifications, 6- and / or 8-site purine modifications, modifications in extrafoam amines, substitution with 4-thiouridines, 5-bromo or 5-iodine-urisyl Substitution is mentioned.
  • the phosphate group contained in the aptamer of this invention may be modified so that it may become resistant to nuclease and hydrolysis.
  • P (0) 0 group is P (0) S (thioate), P (S) S (dithioate), P (O) NR 2 (amidate), P (O) R, R (O) Or may be substituted with OR ', CO or CH 2 (formacetal) or 3'-amine (-NH-CH 2 -CH 2- ), wherein each R or R' is independently H or substituted Or unsubstituted alkyl (eg, methyl, ethyl).
  • a linking group -O-, -N-, or -S- is illustrated, and can couple
  • Modifications in the present invention may also include 3 'and 5' modifications, such as capping. Modifications also include polyethylene glycols, amino acids, peptides, inverted dT, nucleic acids, nucleosides, Myristoyl, Lithocolic-oleyl, Docosanyl, Lauroyl , Stearoyl, Palmitoyl, Oleoyl, Linoleoyl, Other Lipids, Steroids, Cholesterol, Caffeine, Vitamins, Pigments, Fluorescents, Anticancer Agents, Toxins, Enzymes, It can be done by adding radioactive material, biotin and the like to the ends. For such modifications, see, eg, US Pat. No. 5,660,985 and US Pat. No. 5,756,703. However, the nucleic acid aptamer is preferably characterized in that any one aptamer of the nucleotide sequence represented by SEQ ID NO: 3 to 15.
  • the composition for detecting tebuconazole, mefenacet or inabenphide of the present invention is Tebuconazole, Mefenacet and Inaben, which are the most detected herbicides among pesticides and herbicides exceeding the residual limit. It can be used to detect Inabenfide, which is a livestock product, since residual pesticides may be present in foods or the environment in very small amounts and may affect human end-users through various environmental pathways such as bioconcentration. There is a need for techniques for detecting and removing residual pesticides that are widely used in the field.
  • the nucleic acid aptamer of the present invention may be used in any form for the detection of tebuconazole, mefenacet, inabenphide.
  • the DNA aptamer-tebuconazole, mefenacet, inabenphide complex prepared by immobilizing the nucleic acid aptamer of the present invention on magnetic beads to bind tebuconazole, mefenacet, and inabenphide.
  • the nucleic acid aptamer-magnetic beads of the present invention can be used to detect tebuconazole, mefenacet, and inabenphide in a sample using a sensor connected with the nucleic acid aptamer of the present invention as a linker.
  • the detection method etc. can be used.
  • the present invention provides a detection sensor of tebuconazole, mefenacet and / or inabenphide containing an aptamer specifically binding to tebuconazole, mefenacet or inabenphide.
  • Aptamers that specifically bind to tebuconazole, mefenacet, or inabenphide may be provided in the form of a sensor for detecting tebuconazole, mefenacet, or inabenide by being fixed to a substrate such as a chip.
  • the detection sensor containing an aptamer specifically binding to the tebuconazole, mefenacet or inabenphide may be provided in the form of a kit.
  • Kits for tebuconazole, mefenacet and inabenphide can take the form of bottles, tubs, small sachets, envelopes, tubes, ampoules, etc., which may be partially or It may be formed entirely from plastic, glass, paper, foil, wax, and the like.
  • the container may be equipped with a fully or partially separable stopper, which may initially be part of the container or attached to the container by mechanical, adhesive, or other means.
  • the container may also be equipped with a stopper, which may be accessible to the contents by an injection needle.
  • the kit may include an external package, which may include instructions for use of the components.
  • nucleic acid aptamer specifically binding to tebuconazole, mefenacet or inabenphide also specifically detects only tebuconazole, mefenacet, or inabenphide, including tebucona It will be apparent to those skilled in the art that the present invention can provide a sol, mefenacet, inabenphide composition for separation.
  • the present invention relates to a method for removing or separating tebuconazole, mefenacet, inabenphide using an aptamer that specifically binds to tebuconazole, mefenacet or inabenphide.
  • the magnetic beads to which the nucleic acid aptamer is immobilized are filled in a column, and then terbuconazole, mefenacet, Samples containing inabenphide can be passed through to selectively remove or separate only tebuconazole, mefenacet, and inabenphide.
  • DNA pools used in the present invention is Genotech Inc. Chemically commissioned to Korea.
  • Random DNA pools were counter-targeted with [pencycuron, butachlor] and buffer solutions (20 mM Tris-Cl buffer, pH 7.6 contained 100 mM NaCl, 2 mM MgCl 2 , 5 mM KCl, 1 mM CaCl 2, 0.02% Tween 20, 10% MeOH), mixed and reacted at room temperature for 30 minutes, and then reacted with the above mixture solution and graphene oxide solution at room temperature for 30 minutes to secure DNA that is not bound to the counter target. At this time, single-stranded DNA that does not bind to the counter target is strongly adsorbed through ⁇ -stacking on the surface of graphene. Centrifugation removes DNA bound to the counter target.
  • buffer solutions (20 mM Tris-Cl buffer, pH 7.6 contained 100 mM NaCl, 2 mM MgCl 2 , 5 mM KCl, 1 mM CaCl 2, 0.02% Tween 20, 10% MeOH
  • the DNA pool obtained in Example 2 was contained in a counter target (pencycuron, butachlor, mefenacet, inabenfide) and a buffer solution (20 mM Tris-Cl buffer, pH 7.6). 100mM NaCl, 2mM MgCl 2 , 5mM KCl, 1mM CaCl 2 , 0.02% Tween 20, 10% MeOH), mix and react for 30 minutes at room temperature, and then mix with the above mixture to obtain DNA that does not bind to the counter target. The pin oxide solution is allowed to react at room temperature for 30 minutes. At this time, single-stranded DNA that does not bind to the counter target is strongly adsorbed through ⁇ -stacking on the surface of graphene.
  • a counter target pH 7.6
  • 100mM NaCl, 2mM MgCl 2 , 5mM KCl, 1mM CaCl 2 , 0.02% Tween 20, 10% MeOH mix and react for 30 minutes at room temperature, and then mix with
  • Centrifugation removes DNA bound to the counter target.
  • tebuconazole By adding tebuconazole to a graphene-only gastric tube in order to obtain DNA that specifically binds to tebuconazole, and reacting at room temperature for 30 minutes. Conformational change was induced to isolate target specific aptamers from graphene, and then target specific DNA was obtained by ethanol precipitation. The amount of DNA specifically binding to tebuconazole thus obtained was measured. 2 shows that the amount of DNA binding to tebuconazole obtained in each selection round is increasing.
  • the random DNA pool synthesized in Example 2 was subjected to counter targets (pencycuron, butachlor, tebuconazole, inabenfide) and a buffer solution (20 mM Tris-Cl buffer, pH). 7.6 contained 100mM NaCl, 2mM MgCl 2 , 5mM KCl, 1mM CaCl 2 , 0.02% Tween 20, 10% MeOH), mix and react at room temperature for 30 minutes, and then mix the above mixture to obtain DNA that does not bind to the counter target. And the graphene oxide solution is allowed to react at room temperature for 30 minutes.
  • the random DNA pool synthesized in Example 2 was subjected to counter targets (pencycuron, butachlor, tebuconazole, mefenacet) and a buffer solution (20 mM Tris-Cl buffer, pH). 7.6 contained 100mM NaCl, 2mM MgCl 2 , 5mM KCl, 1mM CaCl 2 , 0.02% Tween 20, 10% MeOH), mix and react at room temperature for 30 minutes, and then mix the above mixture to obtain DNA that does not bind to the counter target. And the graphene oxide solution is allowed to react at room temperature for 30 minutes.
  • PCR was performed using known primer regions to increase the amount of tebuconazole, mefenacet, and inabenphide binding specific DNA.
  • fluorescein was immobilized on one primer as follows.
  • polyacrylamide gel electrophoresis was performed to make double-stranded DNA into a single strand.
  • the 10% polyacrylamide gel contains 6M of urea and 20% formamide, resulting in two bands after electrophoresis, which results in two strands of DNA being denatured during electrophoresis.
  • Resins are attached to the top of the DNA strands, while the unattached DNA strands are located below. DNA bands with fluorescein were cut out and gel extracted, followed by ethanol precipitation to obtain the separated DNA.
  • the obtained DNA pool was mixed with the first solution of tebuconazole, mefenacet, and inabenphide, and the magnetic bead solution was reacted with tebuconazole, mefenacet, and inabenphide.
  • a schematic diagram of this process is shown in FIG. 3, and if a FluMag-SELEX process is one selection, a total of six selection processes are performed. In the end, more than 60% of terbuconazole, mefenacet, DNA pools that bind to inabenphide were obtained.
  • count selection was performed with AMPA, tebuconazole, mefenacet, and inabenphide, respectively, to block non-specifically bound DNA and have high affinity only for tebuconazole, mefenacet, and inabenphide. DNA pools that specifically bind were obtained. Finally, the DNA pool was cloned using a Quiagen cloning kit, and DNA was extracted from the colonies. The results were then analyzed based on 13 different types of tebuconazole, mefenacet, and inabenphide. A nucleic acid construct to bind was secured.
  • Table 1 shows the results of analyzing the base sequences of 13 different DNA species that specifically bind with high affinity to tebuconazole, mefenacet, and inabenphide.
  • the results of predicting the secondary structure of the aptamer specific to these 13 kinds of tebuconazole, mefenacet, and inabenphide using the m-fold program are shown in FIGS. 4 to 16.
  • aptamers for each target having high specificity for tebuconazole, mefenacet, and inabenphide were selected as follows.
  • T1 one of the most specific aptamers that specifically bind to tebuconazole, was analyzed for binding strength with various concentrations of tebuconazole.
  • Nucleic acid aptamers specifically binding to tebuconazole, mefenacet or inabenphide according to the present invention are trace amounts of Tebuconazole, Mefenacet, and Inaben present in soil, water or food. Since detection and separation of Inabenfide is possible, it is possible to detect trace amounts of residual pesticides present in foods or the environment, and thus can be used to protect humans from bioconcentration.
  • the method of detecting tebuconazole, mefenacet, inabenphide using the nucleic acid aptamer according to the present invention a kit for detection and a separation kit have an advantage of being economical since it uses aptamer which can be produced at low cost. It's very useful.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Biotechnology (AREA)
  • Immunology (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Hematology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Urology & Nephrology (AREA)
  • Food Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Biophysics (AREA)
  • Cell Biology (AREA)
  • Plant Pathology (AREA)
  • Medicinal Chemistry (AREA)
  • Pathology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • General Physics & Mathematics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

본 발명은 테뷰코나졸, 메페나셋, 이나벤파이드에 특이적으로 결합할 수 있는 핵산 앱타머 및 그 용도에 관한 것으로, 보다 상세하게는 극미량의 테뷰코나졸, 메페나셋, 이나벤파이드에도 특이적으로 결합할 수 있는 핵산 앱타머 및 이를 이용한 테뷰코나졸, 메페나셋, 이나벤파이드의 검출 및 분리방법에 관한 것이다. 본 발명에 따른 테뷰코나졸, 메페나셋, 이나벤파이드에 특이적으로 결합할 수 있는 핵산 압타머는 식품 등 시료 중 극히 미량으로 존재하는 테뷰코나졸, 메페나셋, 이나벤파이드의 검출 및 분리를 가능하게 하는 장점이 있어, 종래 검출이 어려웠던 테뷰코나졸, 메페나셋, 이나벤파이드의 검출 및 제거에 효과적이다. 아울러, 본 발명에 따른 압타머를 이용한 테뷰코나졸, 메페나셋, 이나벤파이드의 검출방법 및 검출용 키트는 낮은 비용으로 생산이 가능한 압타머를 이용함으로써 경제성을 높이는 장점이 있으며 여러 가지 타겟에 대한 각각의 앱타머를 개발할 필요가 없어 매우 유용하다.

Description

테뷰코나졸, 메페나셋 및 이나벤파이드에 특이적으로 결합할 수 있는 핵산 압타머 및 그 용도
본 발명은 테뷰코나졸, 메페나셋 및 이나벤파이드에 결합할 수 있는 핵산 압타머 및 그의 용도에 관한 것으로, 보다 상세하게는 특이적으로 테뷰코나졸, 메페나셋 및 이나벤파이드에 결합할 수 있는 핵산 압타머 및 이를 이용한 테뷰코나졸, 메페나셋 및 이나벤파이드의 검출 및 제거 방법에 관한 것이다.
테뷰코나졸(Tebuconazole)은 고추의 탄저병을 예방하기 위해 광범위하게 사용되는 트라이아졸(triazole) 유도체이다. 미국 FDA에서는 이 살균제가 사람에게는 안전하다고 여기고 있지만 미국 환경보호국(EPA)에서는 테뷰코나졸을 C등급(발암물질일 가능성이 있는)의 발암물질로 규정하고 있고 스웨덴 화학 협회에서는 잠재적인 내분비 교란 화학물질로 규정하는 등 테뷰코나졸은 여전히 위험성을 가지고 있다. 최근에는 대형 식품회사의 고춧가루에서 테뷰코나졸이 기준량 이상 초과 검출 되어 유통 및 판매 금지 조치가 내려진 바 있다.
메페나셋(Mefenacet)은 제초제로서 발암물질로 보고되지는 않았지만 피부에 장기간 노출될 경우 알레르기 반응을 일으킬 수 있으며 눈에 들어갔을 경우에 염증을 유발할 수 있다고 알려져 있다. 또한 환경에 오래 잔류할 경우 벌에게 매우 치명적으로 작용하여 생태계 교란을 일으킬 수 있다.
이나벤파이드(Inabenfide)는 식물생장억제제로서 장기간의 섭취가 금지되고 있으며 피부나 눈, 또는 흡입을 피하라고 권장하고 있다. 그러나 매우 광범위하게 사용되고 있으며 그로 인해 환경오염이 야기될 수 있다는 문제가 있다. 상기 테뷰코나졸, 메페나셋, 이나벤파이드 등의 물질이 잔류되어 있는 농축수산물을 장기간 섭취할 경우에는 내장기능 이상, DNA 손상, 신경계와 발달에 해독을 끼치며 암, 기형아 출산, 유산 등이 일어날 수 있다. 따라서 테뷰코나졸, 메페나셋, 이나벤파이드의 오남용을 방지하는 것은 물론이고 식품의 안전성을 확보하기 위하여 토양, 수질, 농수산물에 잔류되어 있는 농약을 검출해 내는 방법을 개발하는 것이 필요한 실정이다.
기존의 잔류 농약 검출방법은 잔류 농약이 녹아있는 성분에 따라 각기 다른 시험용액을 조제하여 잔류 농약을 추출, 정제 후 액체 크로마토그래피를 이용해 정량하는 방법이 주로 사용되었다. 그러나, 기존의 방법은 녹인 물질에 따른 시험법도 소수이며, 시험용액을 각기 조제하는 데에도 번거롭다. 또한, 추출, 정제 과정 중에 테뷰코나졸, 메페나셋, 이나벤파이드의 손실이 있을 수도 있으므로 정확한 정량이 어렵다. 특히 상수원 및 하천, 약수 등으로 이용되는 수질 자원에 존재하는 테뷰코나졸, 메페나셋, 이나벤파이드의 분석이 중요한데, 기존의 검출방법은 주로 기기분석에 기대고 있기 때문에, 현장 분석이 거의 불가능하며, 분석 비용이 비싸다는 단점이 있다.
한편, 앱타머(aptamer)는 1012~14 정도의 다양성을 가지는 랜덤 핵산 라이브러리로부터 얻어지는 특정 타겟에 대해 높은 특이성과 친화도를 가지는 단일가닥 DNA 또는 RNA 분자 구조체를 말한다. 또한, 앱타머는 센서 분야에서 이용되는 기존의 감지물질인 항체와는 달리 핵산구조체 이므로 열 안정성이 우수하며, 시험관내(in vitro)에서 합성되기 때문에, 동물이나 세포가 따로 필요하지 않아 생산 비용 면에서도 경제적이며, 타겟 물질에 제약이 없어 단백질, 아미노산 같은 생분자 물질부터 환경호르몬, 항생제, 잔류 의약품 등의 저분자 유기화학 물질, 박테리아, 바이러스 등의 다양한 타겟에 대한 앱타머를 합성할 수 있다. 따라서 다양한 타겟 물질에 대한 앱타머가 만들어지고 있으며, 표적 물질과 특이성과 강한 친화도를 가지고 결합하는 앱타머의 특성으로 인해 최근 들어 앱타머를 신약 개발, 약물 전달 시스템 그리고 바이오센서 등에 응용하는 많은 연구가 이루어지고 있다. 따라서, 앱타머는 극미량의 잔류 농약의 검출방법에 도입하기에 매우 적절한 물질이며, 이를 활용한 나노 바이오 기술을 통해 특정 잔류 농약 물질을 검출하는데도 응용할 수 있다.
앱타머 개발방법에 있어서 가장 중요한 요소는 타겟에 결합한 DNA(혹은 RNA)와 결합하지 않은 DNA를 구별하는 것인데 이를 위하여 일반적으로 타겟을 고정하거나 DNA 랜덤 라이브러리를 고정하여 DNA를 구별하는 연구가 진행되어 왔다. 그러나 이러한 고정화 방식의 가장 큰 어려움은 고정화 수율이 낮을 수 있다는 점이고 고정화 수율 자체를 분석하는데 많은 비용과 시간이 소모되고 있다는 점이다. 또한 고정화에 사용되는 분리용 물질(자성비드, 컬럼 등)에 DNA가 직접 결합할 가능성을 완전히 배제할 수 없다는 점과 분리용 물질에 고정된 타겟에 결합한 DNA를 다시 분리해내는 과정에서 나타날 수 있는 DNA 풀 손실의 가능성 등이 고정화 방식의 한계이자 문제점으로 남아있다. 특히 DNA 라이브러리를 고정하는 방식에서 발생할 수 있는 낮은 DNA 고정율 문제는 앱타머 개발 과정에서 피해야 하는 가장 중요한 손실인 DNA 풀의 손실과 직결되어 큰 한계점이 된다. 그 외에도 고정화 자체가 어려운 중금속 이온 등은 고정화 방식으로는 앱타머를 개발하기가 어려워 고정화 방식에는 타겟 선정에도 제약이 있을 수 있다는 문제점이 있다. 이에, 비고정화 방식의 앱타머 개발기술을 이용하면 위에서 열거한 모든 한계를 극복할 수 있으며 타겟의 결합 부위가 제한적이지 않기 때문에 앱타머 개발에 필요한 선별과정 반복횟수를 줄일 수 있다는 장점이 있다. 이러한 이유로 비고정화 방식으로 앱타머를 개발할 수 있는 기술을 발명하기 위하여 종래에는 미세전자기계시스템(MEMS), 모세관전기이동 시스템(Capillary Electrophoresis) 기술 등이 활용되었으나 고가의 장비, 장치 사용의 복잡성, 숙련된 인력의 필요성 등은 여전히 문제점으로 남아있다. 한편, 그래핀은 2차원 구조의 탄소 구조체로서 열 안정성, 전기적 특성 및 강도가 매우 우수하며 단일가닥 DNA의 염기 부분과 π-스태킹을 통해 결합하기 때문에 이러한 특성들을 응용한 광범위한 연구가 실시되고 있다.그러나 비고정화 방식의 그래핀 기반 SELEX를 이용하여 앱타머를 개발할 때에도 여러 가지 target물질에 대한 앱타머를 개발 할 때는 시간이 오래 걸리는 단점이 있다. 각각의 주요 목표 타겟에 대한 카운터 타겟을 설정하고, 목표 타겟과 카운터타겟의 분석, 그리고 각각의 목표타겟에 대한 SELEX 진행해야 하기 때문이다.
이에, 본 발명자들은 상기 종래기술들의 문제점들을 극복하기 위하여 예의 연구 노력한 결과, 테뷰코나졸, 메페나셋, 이나벤파이드에 대해 특이적으로 높은 친화도를 보이는 핵산 구조체인 핵산 앱타머를 비고정화방식 그래핀 SELEX를 이용하여 개발하였다. 또한, 상기 테뷰코나졸, 메페나셋, 이나벤파이드에 특이적으로 결합하는 핵산 앱타머를 포함하는 금 나노입자 기반 색도 분석기법에 관한 조성물을 제조하여 해당 조성물을 이용하면 식품 등에 잔류하는 미량의 테뷰코나졸, 메페나셋, 이나벤파이드를 효과적으로 검출 또는 제거할 수 있음을 확인하고, 본 발명을 완성하게 되었다.
본 배경기술 부분에 기재된 상기 정보는 오직 본 발명의 배경에 대한 이해를 향상시키기 위한 것이며, 이에 본 발명이 속하는 기술분야에서 통상의 지식을 가지는 자에게 있어 이미 알려진 선행기술을 형성하는 정보를 포함하지 않을 수 있다.
발명의 요약
본 발명의 목적은 미량의 테뷰코나졸, 메페나셋 및 이나벤파이드도 검출할 수 있는 핵산 앱타머 및 그 용도를 제공하는 것이다.
상기 목적을 달성하기 위하여, 본 발명은 서열번호 3~15로 구성된 군에서 선택되는 염기서열을 가지는, 테뷰코나졸, 메페나셋 또는 이나벤파이드에 특이적으로 결합할 수 있는 핵산 앱타머를 제공한다.
본 발명은 또한, 상기 핵산 앱타머를 시료와 접촉시키는 단계를 포함하는 테뷰코나졸, 메페나셋 또는 이나벤파이드의 검출방법을 제공한다.
본 발명은 또한, 상기 핵산 앱타머를 포함하는 테뷰코나졸, 메페나셋 또는 이나벤파이드의 검출용 조성물을 제공한다.
본 발명은 또한, 상기 핵산 앱타머를 포함하는 테뷰코나졸, 메페나셋 또는 이나벤파이드의 검출용 센서를 제공한다.
본 발명은 또한, 상기 핵산 앱타머를 포함하는 테뷰코나졸, 메페나셋 또는 이나벤파이드의 검출용 키트를 제공한다.
본 발명은 또한, 상기 핵산 앱타머를 이용하는 것을 특징으로 하는 테뷰코나졸, 메페나셋 또는 이나벤파이드의 분리방법을 제공한다.
본 발명은 또한, 상기 핵산 앱타머를 포함하는 테뷰코나졸, 메페나셋 또는 이나벤파이드의 분리용 조성물을 제공한다.
본 발명은 또한, 상기 핵산 앱타머를 포함하는 테뷰코나졸, 메페나셋 또는 이나벤파이드의 분리용 키트를 제공한다.
본 발명의 다른 특징 및 구현예는 다음의 상세한 설명 및 첨부된 특허청구범위로부터 더욱 명백해 질 것이다.
도 1은 비고정화 방식 그래핀 기반 SELEX를 기반으로 개발된 S-SELEX MT법을 이용하여 타겟 특이적인 앱타머를 제조하는 과정의 모식도이다.
도 2는 각 selection round 에서부터 얻어진 테뷰코나졸, 메페나셋, 이나벤파이드에 결합하는 ssDNA의 양이 증가함을 보여주는 그래프이다.
도 3은 앱타머 및 금 나노입자 응집현상을 이용하여 타겟물질을 검출하는 원리를 설명하는 개략도이다.
도 4 내지 도 16은 본 발명에 따른 서열번호 3 내지 서열번호 15로 표시되는 테뷰코나졸(T), 메페나셋(MBA), 이나벤파이드(I)에 특이적으로 결합 가능한 앱타머의 2차 구조를 나타낸 것이다.
도 17은 핵산 앱타머 T1을 이용하여 다양한 검출시료에 대한 금 나노입자 기반의 색 변화를 관찰한 결과를 나타낸 것이다.
도 18은 앱타머 MBA를 이용하여 다양한 검출시료에 대한 금 나노입자 기반의 색 변화를 관찰한 결과를 나타낸 것이다.
도 19는 앱타머 i13을 이용하여 다양한 검출시료에 대한 금 나노입자 기반의 색 변화를 관찰한 결과를 나타낸 것이다.
도 20은 앱타머 T2를 이용하여 다양한 검출시료에 대한 금나노입자 기반의 색 변하를 관찰한 결과를 나타낸 것이다.
도 21은 앱타머 T1을 이용하여 다양한 농도의 테뷰코나졸에 대한 금 나노입자 기반의 색 변화를 관찰한 결과를 나타낸 것이다.
발명의 상세한 설명 및 구체적인 구현예
다른 식으로 정의되지 않는 한, 본 명세서에서 사용된 모든 기술적 및 과학적 용어들은 본 발명이 속하는 기술분야에서 숙련된 전문가에 의해서 통상적으로 이해되는 것과 동일한 의미를 갖는다. 일반적으로, 본 명세서에서 사용된 명명법은 본 기술분야에서 잘 알려져 있고 통상적으로 사용되는 것이다.
본 발명의 상세한 설명 등에서 사용되는 주요 용어의 정의는 다음과 같다.
본 발명에서 “핵산 앱타머”란, 높은 친화성으로 타겟물질을 특이적으로 인지할 수 있는 작은 단일가닥 올리고핵산을 말한다.
본 발명에서 "시료"란, 테뷰코나졸(Tebuconazole), 메페나셋(Mefenacet), 이나벤파이드(Inabenfide)를 함유하거나 함유하고 있는 것으로 추정되어 분석이 행해질 조성물로, 액체, 토양, 공기, 식품, 폐기물, 동식물 장내 및 동식물 조직 중 어느 하나 이상에서 채취된 시료로부터 검출되는 것을 특징으로 할 수 있으나, 이에 한정되는 것은 아니다. 이때, 액체는 물, 혈액, 소변, 눈물, 땀, 타액, 림프 및 뇌척수액 등임을 특징으로 할 수 있으며, 상기 물은 강수(江水), 해수(海水), 호수(湖水) 및 우수(雨水) 등을 포함하고, 폐기물은 하수, 폐수 등을 포함하며, 상기 동식물은 인체를 포함한다. 또한, 상기 동식물 조직으로는 점막, 피부, 외피, 털, 비늘, 안구, 혀, 뺨, 발굽, 부리, 주둥이, 발, 손, 입, 유두, 귀, 코 등의 조직을 포함한다.
본 명세서에서 언급된 "GO SELEX 프로세스"란 임의적으로 합성된 DNA 또는 RNA의 집합에서 특정 분자에 대해 높은 결합력을 지니는 DNA 또는 RNA를 선별하여 증폭시킴으로써 각각의 분자에 특이적인 DNA 서열을 알아내는 방법 (J.W. Park, R.Tatavarty, D.W.Kim, H.T.Jung and M.B.Gu (2012),Immobilization-free screening of aptamers assisted by graphene oxide, Chemical Communications, 48,15,2071-2073)을 말한다.
본 발명은 일 관점에서, 서열번호 3~15로 구성된 군에서 선택되는 염기서열을 가지는, 테뷰코나졸(Tebuconazole), 메페나셋(Mefenacet) 또는 이나벤파이드(Inabenfide)에 특이적으로 결합할 수 있는 핵산 앱타머에 관한 것이다.
앱타머 T1: 5'-CGTACGGAATTCGCTAGCAGCGTCCACGAGTGTGGTGTGGATCCGAGC
TCCACGAT-3'(서열번호 3)
앱타머 T3: 5'-CGTACGGAATTCGCTAGCACGTTGACGCTGGTGCCCGGTTGTGGTGCG
AGTGTTGTGTGGATCCGAGCTCCACGTG-3'(서열번호 4)
앱타머 T4: 5'-CGTACGGAATTCGCTAGCACGTTGACGCTGGTGCCCGGTTGTGGTGGAG
TGTTGTGTGGATCCGAGCTCCACGTG-3'(서열번호 5)
앱타머 T10: 5'-CGTACGGAATTCGCTAGCGAGTCATGTACCGTCCCTGTGGATCCGAGC
TCCACGTG-3'(서열번호 6)
앱타머 Tn1: 5'-CGTACGGAATTCGCTAGCACGTTGACGCTGGTGCCCGGTTGTGGGCGA
GTGTTGTGTGGATCCGAGCTCCACGTG-3' (서열번호 7)
앱타머 Tn3: 5'-CGTACGGAATTCGCTAGCGTGTCAATAATGGTCCTCTGGGATCCGAGC
TCCACGTG-3'(서열번호 8)
앱타머 Tc2: 5'-CACGTGGAGCTCGGATCCACGCGCAGTGGGACCAACCCAAGCCGTGGC
CTGCCGGGGGGCTAGCGAATTCCGTACG-3'(서열번호 9)
앱타머 Tc3: 5'-CACGTGGAGCTCGGATCCACACAACACTCGCACCACAACCGGGCACCA
GCGTCAACGTGCTAGCGAATTCCGTACG-3'서열번호 10)
앱타머 i11: 5'-CGTACGGAATTCGCTAGCACGTTGACGCTGGTGCCCGGTTTGGTGCG
AGTGTTGTGTGGATCCGAGCTCCACGTG-3'(서열번호 11)
*앱타머 i13: 5'-CGTACGGAATTCGCTAGCACGTTGACGCTGGTGCCCGGTTGTGGGTG
CGAGTGTTGTGTGGATCCGAGCTCCACGTG-3'(서열번호 12)
앱타머 i18: 5'-CGTACGGAATTCGCTAGCACGTTGACGCTGGTGCCCGGTTGTGGTGCG
GGTGTTGTGTGGATCCGAGCTCCACGTG-3'(서열번호 13)
앱타머 MBA: 5'-CGTACGGAATTCGCTAGCCCCCCGGCAGGCCACGGCTTGGGTTGGTC
CCACTGCGCGTGGATCCGAGCTCCACGTG-3'(서열번호 14)
앱타머 T2: 5'-CGTACGGAATTCGCTAGCCCCCCGGCAGGCCACGGCTTGGGTTGGTCCCTCTGCGCGTGGATCCGAGCTCCACGTG-3'(서열번호 15)
핵산 앱타머는 단일가닥 DNA 또는 RNA로서 제공되는 것으로서, 본 발명에서 상기 핵산이 RNA인 경우에는 상기 핵산서열에서 T는 U로 표시되며, 이러한 서열이 본 발명의 범위에 포함됨은 본 발명이 속하는 기술분야에서 통상의 지식을 가지는 자에게 자명한 사항이라 할 것이다.
본 발명의 핵산 앱타머는, GO SELEX (Systematic Evolution of Ligands by Exponential enrichment) 공정에 의해 선택된 테뷰코나졸 (Tebuconazole), 메페나셋 (Mefenacet) 또는 이나벤파이드 (Inabenfide)에 특이적으로 결합하는 임의의 염기서열의 핵산 앱타머일 수 있다.
더욱 구체적으로, 본 발명의 테뷰코나졸(Tebuconazole), 메페나셋(Mefenacet) 또는 이나벤파이드(Inabenfide)에 특이적으로 결합할 수 있는 상기 핵산 앱타머는 하기의 단계를 포함하는 방법에 의하여 제조될 수 있다:
a) 양끝에 PCR용 프라이머 영역을 포함하고 중앙에 30 내지 50개의 임의의 염기를 가지는 단일 가닥 핵산 풀(pool)과 타겟물질 또는 카운터 타겟물질을 완충용액에서 혼합하여 상온에서 결합을 유도하는 단계;
b) 상기 혼합액과 그래핀을 반응시켜 타겟물질과 결합한 또는 카운터 타겟물질에 결합하지 않는 단일가닥 핵산을 제거하는 단계;
c) 상기 단계에서 얻은 타겟물질에 특이적으로 결합하는 단일가닥 핵산에 대해 상기 PCR용 프라이머 영역을 이용하여 PCR을 수행하여 증폭시키는 단계;
d) 상기 타겟물질에 특이적으로 결합하는 단일 가닥 핵산에 대해 타겟물질과 카운터 타겟물질을 이용하여 그래핀 기반 선별(selection) 및 카운터 선별(counterselection) 하는 과정을 반복 수행하는 단계;
e) 상기 그래핀 기반 카운터 선별 단계에서 카운터 타겟물질에 결합하는 타겟 비특이적인 단일가닥 핵산을 제거하고, 그래핀에 결합된 타겟 특이적인 단일가닥 핵산에 대해 타겟에 의한 배좌 변위(Conformational change)를 유발시켜 그래핀으로부터 타겟 특이적인 앱타머를 분리하는 단계
상기 DNA 압타머 제조방법의 d) 단계에서, 프라이머 쌍 중 하나에 플루오레세인(fluorescein)이 붙여진 프라이머를 사용하여 PCR을 수행한 후, 전기영동을 통해 기 변성된 단일가닥 DNA를 분리하는 단계를 더 포함하는 것 특징으로 한다.
본 발명의 일 실시예에서는 테뷰코나졸(Tebuconazole), 메페나셋(Mefenacet) 또는 이나벤파이드(Inabenfide)에 특이적으로 결합하는 앱타머를 제작하기 위하여, GO SELEX (Systematic Evolution of Ligands by Exponential enrichment) 공정을 이용하여 테뷰코나졸(Tebuconazole), 메페나셋(Mefenacet), 이나벤파이드(Inabenfide)에 결합하는 핵산 앱타머를 선별해 낸 다음, 금 나노입자 기반의 색도 분석법을 통하여 상기 서열번호 3 내지 서열번호 15로 표시되는 염기서열을 갖는 앱타머가 테뷰코나졸(Tebuconazole), 메페나셋(Mefenacet), 이나벤파이드(Inabenfide)의 각각에 대하여 모두 특이적으로 결합함을 확인하였다.
본 발명은 다른 관점에서, 테뷰코나졸(Tebuconazole), 메페나셋(Mefenacet) 또는 이나벤파이드(Inabenfide)의 검출방법에 관한 것이다.
상기 상기 시료는 물, 토양, 폐기물, 식품, 동식물 장내 및 동식물 조직 중 어느 하나 이상에서 채취된 시료인 것을 특징으로 할 수 있으나, 이에 한정되는 것은 아니다. 이때, 상기 물은 강수(江水), 해수(海水), 호수(湖水) 및 우수(雨水)등을 포함하고, 폐기물은 하수, 폐수 등을 포함하며, 상기 동식물은 인체를 포함한다.
본 발명의 일 실시예에서는 금 나노입자 기반의 색도 분석법으로 본 발명에 따른 핵산 압타머가 특이적으로 테뷰코나졸, 메페나셋, 이나벤파이드에 결합함을 확인하였다.
금 나노입자 기반의 색도진단법은, 그 준비의 편리성과 간단한 작동법 그리고 육안으로 색 변화를 관찰할 수 있다는 점에서 최근 들어 온사이트(on-site) 탐지의 새로운 대안으로 떠오르고 있다[Zhao, W., Brook, M.A., Li, Y., 2008a. ChemBioChem 9, 2363-2371]. 이러한 금 나노입자 기반 앱타머 센서에는 두 가지 종류가 있는데, 하나는 금 나노입자 표면을 변형하여 앱타머를 금 나노입자 표면에 공유결합 등으로 고정하여 타겟 물질이 있을 때 두 개 이상의 금 나노입자 거리가 서로 가까워짐으로 인해 응집(aggregation)이 일어나서 금 나노입자 용액의 색이 붉은색에서 푸른색 계열로 변하는 특징을 이용한 것이고, 다른 하나는 변형되지 않은 금 나노입자 표면에 앱타머가 물리적으로 흡착되어 있다가 타겟 물질이 있을 때 흡착되어 있던 앱타머과 타겟과의 결합으로 인해 금 나노입자의 표면에서 떨어져 나오는 현상에 의해 색이 변하는 특성을 이용하는 것이다. 순수한 금 나노 입자의 용액 색은 붉은색이고, 앱타머가 물리적으로 금 나노입자에 흡착이 된 후 타겟을 넣어주면, 앱타머와 타겟 간의 친화도가 앱타머와 금 나노입자 간의 친화도보다 크기 때문에 앱타머는 타겟과 결합하게 된다[Y. S. Kim,et al., A novel colorimetric aptasensor using gold nanoparticle for a highly sensitive and specific detection of oxytetracycline, Biosensors and Bioelectronics, Volume 26, Issue 4, 15 2010]. 이때, NaCl을 첨가해주면 타겟을 첨가해준 튜브에서는 금 나노 입자가 뭉치게 되면서 색깔 변화를 관찰할 수 있다. 반면, 타겟이 없는 튜브에서는 앱타머가 NaCl로 인한 금 나노 입자의 응집(aggregation)을 방해하기 때문에, 색 변화를 관찰할 수 없다. 이러한 특성을 바탕으로 앱타머-금 나노입자를 이용하여 타겟 물질을 검출할 수 있는 것이다. 또한, 금 나노입자 용액을 UV 분광광도계(spectrophotometer)로 흡광도를 측정하면, 순수한 금 나노입자 용액은 520 nm 에서 가장 높은 흡광도를 보이는 반면에 색이 푸른 계열로 변한 후에는 650 nm 에서 가장 높은 흡광도를 보이게 된다. 따라서 650 nm 에서의 흡광도 값을 520 nm 에서의 흡광도 값으로 나눈 값은 타겟에 의해 응집(aggregation)이 일어난 정도와 비례해서 증가한다. 본 발명의 일 실시예에서도 이러한 금 나노입자 기반의 색도 분석법을 통하여 본 발명에서 선별한 앱타머가 테뷰코나졸, 메페나셋, 이나벤파이드에 대하여 특이적으로 결합하는지를 확인하였다.
구체적으로, 본 발명에서는 금 나노입자 표면을 변형하여 앱타머를 금 나노입자 표면에 공유결합 등으로 고정하여 타겟 물질이 있을 때 두 개 이상의 금 나노입자 거리가 서로 가까워짐으로 인해 응집(aggregation)이 일어나서 금 나노입자 용액의 색이 붉은색에서 푸른색 계열로 변하는 특징을 이용하거나, 변형되지 않은 금 나노입자 표면에 앱타머가 물리적으로 흡착되어 있다가 타겟 물질이 있을 때 흡착되어 있던 앱타머과 타겟과의 결합으로 인해 금 나노입자의 표면에서 떨어져 나오는 현상에 의해 색이 변하는 특성을 이용하여 테뷰코나졸, 메페나셋, 이나벤파이드를 검출할 수 있다.
본 발명의 일 실시예에서는 상기 서열번호 3 내지 14로 표시되는 핵산 앱타머 중 가장 높은 친화도를 보인 서열번호 3, 9, 14로 표시되는 핵산서열인 앱타머 T1, il3, MBA에 대하여 금 나노입자 기반 색도 분석을 수행한 결과, 테뷰코나졸, 메페나셋, 이나벤파이드에 해당 앱타머가 특이적으로 결합함을 확인하였다.
따라서, 본 발명은 다른 관점에서, 상기 테뷰코나졸(Tebuconazole), 메페나셋(Mefenacet) 또는 이나벤파이드(Inabenfide)에 특이적으로 결합하는 앱타머를 함유하는 테뷰코나졸, 메페나셋 또는 이나벤파이드 검출용 조성물에 관한 것이다.
본 발명의 앱타머는 이 기술분야에서 이미 공지된 방법에 의해 화학 합성할 수도 있다.
본 발명의 앱타머는, 테뷰코나졸, 메페나셋, 이나벤파이드에 대한 결합성, 안정성 등을 높이기 위하여 각 뉴클레오티드의 당 잔기(예, 리보오스나 디옥시리보스)가 수식된 것을 사용할 수 있다. 당 잔기에서 수식되는 부위는, 예컨대 당 잔기의 2'부위, 3'부위 및/또는 4'부위의 산소원자를 다른 원자로 치환한 것 등을 들 수 있다. 수식의 종류로서는, 예컨대 플루오로화, O-알킬화(예, O-메틸화, O-에틸화), O-알릴화, S-알킬화(예, S-메틸화, S-에틸화), S-알릴화, 아미노화(예, -NH)를 들 수 있다. 이러한 당잔기의 변형은, 자체 공지의 방법에 의해 행할 수 있다(예컨대 Sproatet al.,(1991) Nucle. Acid.Res. 19, 733-738; Cotton et al., (1991) Nucl.Acid.Res. 19, 2629-2635; Hobbs et al., (1973) Biochemistry 12, 5138-5145 참조).
본 발명의 앱타머는 테뷰코나졸, 메페나셋, 이나벤파이드에 대한 결합성 등을 높이기 위하여 핵산염기(예, 푸린, 피리미딘)가 변형(예, 화학적 치환)된 것을 사용할 수 있다. 이러한 변형으로서는, 예컨대 5부위 피리미딘 변형, 6 및/또는 8부위 푸린 변형, 환외(環外) 아민에서의 변형, 4-티오우리딘으로의 치환, 5-브로모 또는 5-요오드-우리실으로의 치환을 들 수 있다.
또한, 뉴클레아제 및 가수분해에 대하여 내성을 갖도록, 본 발명의 앱타머에 포함되는 인산기가 변형되어 있어도 좋다. 예컨대 P(0)0기가, P(0)S(티오에이트), P(S)S(디티오에이트), P(O)NR2(아미데이트), P(O)R, R(O)OR', CO 또는 CH2(포름아세탈) 또는 3'-아민(-NH-CH2-CH2-)으로 치환되어 있어도 좋다〔여기서 각각의 R 또는 R'은 독립적으로, H이거나, 또는 치환되어 있거나, 또는 치환되어 있지 않은 알킬(예, 메틸, 에틸)이다〕. 연결기로서는, -O-, -N- 또는 -S-가 예시되고, 이들의 연결기를 통하여 인접하는 뉴클레오티드에 결합할 수 있다.
본 발명에서의 변형은 또한, 캡핑과 같은 3' 및 5'의 변형을 포함하여도 좋다. 변형은 또한, 폴리에틸렌글리콜, 아미노산, 펩티드, inverted dT, 핵산, 뉴클레오시드, 미리스토일(Myristoyl), 리쏘콜릭-올레일(Lithocolic-oleyl), 도코사닐(Docosanyl), 라우로일(Lauroyl), 스테아로일(Stearoyl), 팔미토일(Palmitoyl), 올레오일(Oleoyl), 리놀레오일(Linoleoyl), 그 외 지질, 스테로이드, 콜레스테롤, 카페인, 비타민, 색소, 형광물질, 항암제, 독소, 효소, 방사성 물질, 비오틴 등을 말단에 부가함으로써 행해질 수 있다. 이러한 변형에 대해서는, 예컨대 미국특허 제5,660,985호, 미국특허 제5,756,703호를 참조할 수 있다. 그러나 상기 핵산 앱타머는, 바람직하게는 서열번호 3 내지 15로 표시되는 염기서열 중 어느 하나의 앱타머인 것을 특징으로 한다.
본 발명의 테뷰코나졸, 메페나셋 또는 이나벤파이드 검출용 조성물은 잔류 허용기준을 초과하는 농약?제초제 중에서 가장 많이 검출되는 제초제인 테뷰코나졸 (Tebuconazole), 메페나셋 (Mefenacet), 이나벤파이드 (Inabenfide)를 검출하기 위하여 사용 가능한 것으로, 잔류 농약은 매우 적은 양으로 식품이나 환경에 존재하더라도 생물농축 현상 등과 같은 여러 환경적인 경로에 의해서 최종 소비자인 사람에게 영향을 미칠 수 있기 때문에, 축수산물에서 광범위하게 사용되고 있는 잔류 농약을 검출 및 제거하는 기술이 필요하다. 따라서, 테뷰코나졸, 메페나셋, 이나벤파이드의 검출을 위해 본 발명의 핵산 앱타머는 어떠한 형태로도 사용될 수 있다. 예를 들어, 본 발명의 핵산 앱타머를 자성비드에 고정화시켜 테뷰코나졸, 메페나셋, 이나벤파이드를 결합시켜 제조된 DNA 앱타머-테뷰코나졸, 메페나셋, 이나벤파이드 복합체(complex)는 자석을 이용하여 분리할 수 있게 되고, 이 복합체로부터 다시 테뷰코나졸, 메페나셋, 이나벤파이드를 분리함으로써 테뷰코나졸, 메페나셋, 이나벤파이드만을 선택적으로 검출할 수 있게 된다. 또한, 본 발명의 핵산 앱타머-자성비드를 본 발명의 실시예에 기술된 방법 이외에도 본 발명의 핵산 앱타머와 연결자로 연결된 센서를 이용하여 시료 중의 테뷰코나졸, 메페나셋, 이나벤파이드를 검출하는 방법 등을 사용할 수 있다.
본 발명은 다른 관점에서, 테뷰코나졸, 메페나셋 또는 이나벤파이드에 특이적으로 결합하는 앱타머를 함유하는 테뷰코나졸, 메페나셋 및/또는 이나벤파이드의 검출센서를 제공한다. 상기 테뷰코나졸, 메페나셋, 이나벤파이드에 특이적으로 결합하는 앱타머는 칩 등 기판에 고정되어 테뷰코나졸, 메페나셋, 이나벤파이드 검출용 센서의 형태로 제공될 수 있다.
상기 테뷰코나졸, 메페나셋 또는 이나벤파이드에 특이적으로 결합하는 앱타머를 함유하는 검출용 센서는, 키트(kit)의 형태로 제공될 수 있다.
테뷰코나졸, 메페나셋, 이나벤파이드 검출용 키트는 병, 통(tub), 작은 봉지(sachet), 봉투(envelope), 튜브, 앰플(ampoule) 등과 같은 형태를 취할 수 있으며 이들은 부분적으로 또는 전체적으로 플라스틱, 유리, 종이, 호일, 왁스 등으로부터 형성될 수 있다. 용기는, 처음에는 용기의 일부이거나 또는 기계적, 접착성, 또는 기타 수단에 의해 용기에 부착될 수 있는, 완전히 또는 부분적으로 분리가 가능한 마개를 장착할 수 있다. 용기는 또한 주사 바늘에 의해 내용물에 접근할 수 있는, 스토퍼가 장착될 수 있다. 상기 키트는 외부패키지를 포함할 수 있으며, 외부 패키지는 구성요소들의 사용에 관한 사용설명서를 포함할 수 있다.
본 발명에 따른 테뷰코나졸, 메페나셋 또는 이나벤파이드에 특이적으로 결합하는 핵산 앱타머는 또한, 테뷰코나졸, 메페나셋, 이나벤파이드만을 특이적으로 검출하는바, 이를 포함하여 테뷰코나졸, 메페나셋, 이나벤파이드 분리용 조성물을 제공할 수 있음은 본 발명이 속하는 기술분야에서 당업자에게 자명한 것이다.
본 발명은 다른 관점에서, 테뷰코나졸, 메페나셋 또는 이나벤파이드에 특이적으로 결합하는 앱타머를 이용한 테뷰코나졸, 메페나셋, 이나벤파이드의 제거 또는 분리 방법에 관한 것이다.
본 발명의 조성물을 이용하는 테뷰코나졸, 메페나셋, 이나벤파이드의 제거방법의 한 예를 들면, 상기 핵산 앱타머가 고정화된 자성비드를 컬럼(column)에 채운 후 테뷰코나졸, 메페나셋, 이나벤파이드를 포함하는 시료를 통과시켜 테뷰코나졸, 메페나셋, 이나벤파이드만을 선택적으로 제거 또는 분리할 수 있다.
실시예
이하 첨부된 실시예를 들어 본 발명을 보다 상세히 설명한다. 그러나 이러한 실시예는 본 발명의 기술적 사상의 내용과 범위를 쉽게 설명하기 위한 예시일 뿐, 이에 의해 본 발명의 기술적 범위가 한정되거나 변경되는 것은 아니다. 또한, 이러한 예시에 기초하여 본 발명의 기술적 사상의 범위 안에서 다양한 변형과 변경이 가능함은 당업자에게는 당연할 것이다.
실시예 1: 임의의 염기서열을 가지는 DNA pool 합성
56mer DNA pool로서 양 끝에 PCR을 위한 프라이머 영역(primer region)이 있고 중앙에 임의의 염기를 가진 DNA pool을 아래와 같은 방법으로 합성하였다. 본 발명에 사용된 DNA pool은 Genotech Inc. Korea에 화학적으로 합성을 의뢰하였다.
CGTACGGAATTCGCTAGC-random region-GGATCCGAGCTCCACGTG
서열번호 1: CGTACGGAATTCGCTAGC
서열번호 2: GGATCCGAGCTCCACGTG
실시예 2: 테뷰코나졸, 메페나셋, 이나벤파이드 모두와 결합하는 DNA 앱타머의 선별
랜덤 DNA pool을 카운터 타겟 [펜시큐론(pencycuron), 부타클로(Butachlor)]와 버퍼용액(20mM Tris-Cl buffer, pH 7.6 contained 100mM NaCl, 2mM MgCl2, 5mM KCl, 1mM CaCl2, 0.02% Tween 20, 10% MeOH)에 넣고 혼합하여 30분간 상온에서 반응시킨 후 카운터 타겟과 결합하지 않은 DNA를 확보하기 위해 위의 혼합액과 그래핀 옥사이드 용액을 30분간 상온에서 반응시킨다. 이때 카운터 타겟과 결합하지 않은 단일가닥 DNA는 그래핀의 표면에 π-스태킹을 통해 강력하게 흡착하게 된다. 원심분리를 통해 카운터 타겟과 결합한 DNA를 제거한다. 테뷰코나졸, 메페나셋, 이나벤파이드에 특이적으로 결합하는 DNA를 확보하기 위해 그래핀만 있는 위 튜브에 테뷰코나졸, 메페나셋, 이나벤파이드를 첨가한후 30분간 상온에서 반응시킴으로서. 배좌 변위(Conformational change)를 유발시켜 그래핀으로부터 타겟 특이적인 앱타머를 분리한 후 에탄올 침전법으로 타겟 특이적DNA를 확보하였다. 이렇게 얻어진 테뷰코나졸, 메페나셋, 이나벤파이드에 특이적으로 결합하는 DNA의 양을 측정하였다.
도 2에서는 1~3 선별단계 (selection round)에서 얻어진 테뷰코나졸, 메페나셋, 이나벤파이드에 결합하는 DNA의 양이 증가하고 있음을 보여주었다.
실시예 3: 테뷰코나졸에 특이적으로 결합 가능한 DNA 앱타머의 선별
실시예 2에서 얻어진 DNA pool을 카운터 타겟 [펜시큐론(pencycuron), 부타클로(Butachlor),메페나셋(mefenacet), 이나벤파이드(inabenfide)]와 버퍼용액(20mM Tris-Cl buffer, pH 7.6 contained 100mM NaCl, 2mM MgCl2, 5mM KCl, 1mM CaCl2, 0.02% Tween 20, 10% MeOH)에 넣고 혼합하여 30분간 상온에서 반응시킨 후 카운터 타겟과 결합하지 않은 DNA를 확보하기 위해 위의 혼합액과 그래핀 옥사이드 용액을 30분간 상온에서 반응시킨다. 이때 카운터 타겟과 결합하지 않은 단일가닥 DNA는 그래핀의 표면에 π-스태킹을 통해 강력하게 흡착하게 된다. 원심분리를 통해 카운터 타겟과 결합한 DNA를 제거한다. 테뷰코나졸에 특이적으로 결합하는 DNA를 확보하기 위해 그래핀만 있는 위 튜브에 테뷰코나졸을 첨가한후 30분간 상온에서 반응시킴으로서. 배좌 변위(Conformational change)를 유발시켜 그래핀으로부터 타겟 특이적인 앱타머를 분리한 후 에탄올 침전법으로 타겟 특이적DNA를 확보하였다. 이렇게 얻어진 테뷰코나졸에 특이적으로 결합하는 DNA의 양을 측정하였다. 도 2에서는 각 선별단계 (selection round)에서 얻어진 테뷰코나졸에 결합하는 DNA의 양이 증가하고 있음을 보여주었다.
실시예 4: 메페나셋에 특이적으로 결합 가능한 DNA 앱타머의 선별
실시예 2에서 합성된 랜덤 DNA pool을 카운터 타겟 [펜시큐론(pencycuron), 부타클로(Butachlor), 테뷰코나졸(tebuconazole), 이나벤파이드(inabenfide)]와 버퍼용액(20mM Tris-Cl buffer, pH 7.6 contained 100mM NaCl, 2mM MgCl2, 5mM KCl, 1mM CaCl2, 0.02% Tween 20, 10% MeOH)에 넣고 혼합하여 30분간 상온에서 반응시킨 후 카운터 타겟과 결합하지 않은 DNA를 확보하기 위해 위의 혼합액과 그래핀 옥사이드 용액을 30분간 상온에서 반응시킨다. 이때 카운터 타겟과 결합하지 않은 단일가닥 DNA는 그래핀의 표면에 π-스태킹을 통해 강력하게 흡착하게 된다. 원심분리를 통해 카운터 타겟과 결합한 DNA를 제거한다. 메페나셋에 특이적으로 결합하는 DNA를 확보하기 위해 그래핀만 있는 위 튜브에 메페나셋을 첨가한후 30분간 상온에서 반응시킴으로서. 배좌 변위(Conformational change)를 유발시켜 그래핀으로부터 타겟 특이적인 앱타머를 분리한 후 에탄올 침전법으로 타겟 특이적DNA를 확보하였다. 이렇게 얻어진 메페나셋에 특이적으로 결합하는 DNA의 양을 측정하였다. 도 2에서는 각 선별단계 (selection round)에서 얻어진 메페나셋에 결합하는 DNA의 양이 증가하고 있음을 보여주었다.
실시예 5: 이나벤파이드에 특이적으로 결합 가능한 DNA 앱타머의 선별
실시예 2에서 합성된 랜덤 DNA pool을 카운터 타겟 [펜시큐론(pencycuron), 부타클로(Butachlor),테뷰코나졸(tebuconazole), 메페나셋(mefenacet)]와 버퍼용액(20mM Tris-Cl buffer, pH 7.6 contained 100mM NaCl, 2mM MgCl2, 5mM KCl, 1mM CaCl2, 0.02% Tween 20, 10% MeOH)에 넣고 혼합하여 30분간 상온에서 반응시킨 후 카운터 타겟과 결합하지 않은 DNA를 확보하기 위해 위의 혼합액과 그래핀 옥사이드 용액을 30분간 상온에서 반응시킨다. 이때 카운터 타겟과 결합하지 않은 단일가닥 DNA는 그래핀의 표면에 π-스태킹을 통해 강력하게 흡착하게 된다. 원심분리를 통해 카운터 타겟과 결합한 DNA를 제거한다. 이나벤파이드에 특이적으로 결합하는 DNA를 확보하기 위해 그래핀만 있는 위 튜브에 이나벤파이드를 첨가한후 30분간 상온에서 반응시킴으로서. 배좌 변위(Conformational change)를 유발시켜 그래핀으로부터 타겟 특이적인 앱타머를 분리한 후 에탄올 침전법으로 타겟 특이적DNA를 확보하였다. 이렇게 얻어진 이나벤파이드에 특이적으로 결합하는 DNA의 양을 측정하였다. 도 2에서는 각 선별단계 (selection round)에서 얻어진 이나벤파이드에 결합하는 DNA의 양이 증가하고 있음을 보여주었다.
실시예 6: 테뷰코나졸, 메페나셋, 이나벤파이드에 결합 가능한 DNA 앱타머 pool의 제조
테뷰코나졸, 메페나셋, 이나벤파이드 결합 특이적인 DNA의 양을 늘리기 위해 이미 알고 있는 프라이머 영역을 이용하여 PCR을 수행하였다.
PCR 생산물은 두 가닥의 DNA이므로 이를 단일가닥으로 분리하기 위한 과정을 위하여, 아래와 같이 하나의 프라이머에는 플루오레세인(fluorescein)을 고정하였다.
forward (APTFf) 5'-fluorescein-CGTACGGAATTCGCTAGC: 서열번호 16
reverse (APTR) 5'-CACGTGGAGCTCGGATCC-3':서열번호 17
PCR 반응물을 정제키트(purification kit)를 이용하여 정제한 후 이중가닥의 DNA를 단일가닥으로 만들기 위해 폴리아크릴아마이드젤 전기영동을 실시하였다. 10%의 폴리아크릴아마이드 젤에는 6M의 요소(urea), 20%의 포름아마이드(formamaid)가 포함되어 있어 전기영동 후에는 두 개의 밴드가 생기는데, 이는 전기영동 과정에서 두 가닥의 DNA가 변성되어 플루오레세인이 붙어있는 DNA 가닥은 위에, 붙어있지 않은 DNA 가닥은 아래에 각각 위치하게 된다. 플루오레세인이 붙어 있는 DNA 밴드를 잘라내어 젤 추출(gel extraction)을 실시한 후 다시 에탄올 침전법으로 분리된 DNA를 확보하였다. 이 때 확보된 DNA pool은 다시 처음의 테뷰코나졸, 메페나셋, 이나벤파이드가 고정되어 있는 자성비드 용액과 혼합하여 테뷰코나졸, 메페나셋, 이나벤파이드와 반응시켰다. 이러한 과정의 모식도를 도 3에 나타내었고, 일련의 과정(FluMag-SELEX process)을 한 번의 선별 (selection)이라 하면 총 6번의 선별과정을 거쳐 최종적으로 60% 이상이 테뷰코나졸, 메페나셋, 이나벤파이드에 결합하는 DNA pool을 얻었다. 3번째 선별 후에는 각각 AMPA와 테뷰코나졸, 메페나셋, 이나벤파이드로 count selection을 실시함으로써 비특이적으로 결합하는 DNA를 차단하고 테뷰코나졸, 메페나셋, 이나벤파이드에만 높은 친화도를 가지고 특이적으로 결합하는 DNA pool을 확보하였다. 최종적으로 얻어진 DNA pool을 Quiagen cloning kit를 이용하여 클로닝(cloning)하고 얻어진 콜로니에서부터 DNA를 추출하여 염기분석을 시행할 결과, 서로 다른 13종의 테뷰코나졸, 메페나셋, 이나벤파이드에 특이적으로 결합하는 핵산 구조체를 확보하였다.
실시예 7: 13종의 DNA 앱타머의 염기서열 분석 및 특이성 분석
테뷰코나졸, 메페나셋, 이나벤파이드에 높은 친화도를 가지고 특이적으로 결합하는 서로 다른 13 종의 DNA의 염기서열을 분석한 결과를 하기 표 1에 제시하였다. 또한, 이 13 종의 테뷰코나졸, 메페나셋, 이나벤파이드에 특이적인 앱타머의 2차 구조를 m-fold 프로그램을 이용하여 예측한 결과를 도 4 내지 도 16에 나타내었다.
표 1
Figure PCTKR2014009696-appb-T000001
상기 13종의 DNA 앱타머 중에서 테뷰코나졸, 메페나셋, 이나벤파이드에 대한 특이성이 높은 각 타겟에 대한 앱타머를 다음과 같이 선별하였다.
2nM의 금나노입자와 200nM의 각각의 테뷰코나졸, 메페나셋, 이나벤파이드 결합 앱타머를 3차 증류수에 넣고 상온에서 30분간 흡착 반응시킨 후 250uM의 테뷰코나졸[화학식1], 메페나셋[화학식2], 이나벤파이드[화학식 3], 카프로파미드[화학식 4], 펜시큐론[화학식 5], 부타클로[화학식6]를 첨가하여 30분간 반응시켰다. 상기 용액에 0.6M NaCl을 첨가하여 salt induced gold aggregation을 유도한 후 금나노입자 용액의 UV 흡광도를 측정 각각의 앱타머에서 목표 타겟과의 결합력이 가장 높은 앱타머 T1을 선정하였다. UV 흡광도 그래프와 반응 후의 샘플의 사진을 도 17 ~ 20에 개시하였다.
화학식 1
Figure PCTKR2014009696-appb-C000001
화학식 2
Figure PCTKR2014009696-appb-C000002
화학식 3
Figure PCTKR2014009696-appb-C000003
화학식 4
Figure PCTKR2014009696-appb-C000004
화학식 5
Figure PCTKR2014009696-appb-C000005
화학식 6
Figure PCTKR2014009696-appb-C000006
실시예 8: DNA 앱타머의 테뷰코나졸과의 결합력 분석
테뷰코나졸에 특이적으로 결합하는 서로 다른 13종의 앱타머 중에서 가장 특이도가 높은 1개의 앱타머인 T1과 다양한 농도의 테뷰코나졸과의 결합력을 분석하였다.
2nM의 금 나노입자와 200nM의 각각의 테뷰코나졸, 메페나셋, 이나벤파이드 앱타머를 3차 증류수에 넣고 상온에서 30분간 반응시킨 후 0에서 25 uM의 테뷰코나졸을 첨가하여 30분간 반응시킨다. 상기 용액에 0.6M NaCl을 첨가하여 salt induced gold aggregation을 유도하여 금 나노 입자의 UV 흡광도를 측정하였다. UV 흡광도 그래프와 반응 후의 샘플의 사진을 도 21에 개시하였다. 이로부터 테뷰코나졸 결합 특이적인 앱타머와 금 나노입자를 이용하여 테뷰코나졸을 검출할 수 있음을 알 수 있다.
본 발명에 따른 테뷰코나졸, 메페나셋 또는 이나벤파이드에 특이적으로 결합하는 핵산 압타머는 토양, 물 또는 식품 등에 존재하는 극미량의 테뷰코나졸 (Tebuconazole), 메페나셋 (Mefenacet), 이나벤파이드 (Inabenfide)의 검출 및 분리를 가능하게 하므로 식품 또는 환경에 존재하는 극소량의 잔류 농약 등의 검출이 가능하여 생물농축현상 등으로부터 인간을 보호하는 데 이용될 수 있다. 아울러, 본 발명에 따른 핵산 앱타머를 이용한 테뷰코나졸, 메페나셋, 이나벤파이드의 검출방법, 검출용 키트 및 분리용 키트는 낮은 비용으로 생산이 가능한 압타머를 이용하므로 경제성도 있다는 장점이 있어 매우 유용하다.
이상으로 본 발명이 속하는 기술분야의 당업자는 본 발명이 그 기술적 사상이나 필수적 특징을 변경하지 않고서 다른 구체적인 형태로 실시될 수 있다는 것을 이해할 수 있을 것이다. 이와 관련하여, 이상에서 기술한 실시 예들은 모든 면에서 예시적인 것이며 한정적인 것이 아닌 것으로서 이해해야만 한다. 본 발명의 범위는 상기 상세한 설명보다는 후술하는 특허 청구범위의 의미 및 범위 그리고 그 등가 개념으로부터 도출되는 모든 변경 또는 변형된 형태가 본 발명의 범위에 포함되는 것으로 해석되어야 한다.
전자파일 첨부하였음.

Claims (11)

  1. 서열번호 3~15로 구성된 군에서 선택되는 염기서열을 가지는, 테뷰코나졸(Tebuconazole), 메페나셋(Mefenacet) 또는 이나벤파이드(Inabenfide)에 특이적으로 결합할 수 있는 핵산 앱타머:
    여기서, 상기 핵산이 RNA인 경우에는 상기 핵산서열에서 T는 U.
  2. 제1항의 핵산 앱타머를 시료와 접촉시키는 단계를 포함하는 테뷰코나졸 (Tebuconazole), 메페나셋 (Mefenacet) 또는 이나벤파이드 (Inabenfide)의 검출방법.
  3. 제2항에 있어서, 상기 시료는 물, 토양, 폐기물, 식품, 동식물 장내 및 동식물 조직 중 어느 하나 이상에서 채취된 시료인 것을 특징으로 하는 테뷰코나졸 (Tebuconazole), 메페나셋 (Mefenacet) 또는 이나벤파이드 (Inabenfide)의 검출방법.
  4. 제2항에 있어서, 상기 검출은 금 나노입자 기반의 색도 분석에 의한 것임을 특징으로 하는 테뷰코나졸 (Tebuconazole), 메페나셋 (Mefenacet) 또는 이나벤파이드 (Inabenfide)의 검출방법.
  5. 제1항의 핵산 앱타머를 포함하는 테뷰코나졸 (Tebuconazole), 메페나셋 (Mefenacet) 또는 이나벤파이드 (Inabenfide)의 검출용 조성물.
  6. 제1항의 핵산 앱타머를 포함하는 테뷰코나졸 (Tebuconazole), 메페나셋 (Mefenacet) 또는 이나벤파이드 (Inabenfide)의 검출용 센서.
  7. 제1항의 핵산 앱타머를 포함하는 테뷰코나졸 (Tebuconazole), 메페나셋 (Mefenacet) 또는 이나벤파이드 (Inabenfide)의 검출용 키트.
  8. 제1항의 핵산 앱타머를 이용하는 것을 특징으로 하는 시료로부터 테뷰코나졸 (Tebuconazole), 메페나셋 (Mefenacet) 또는 이나벤파이드 (Inabenfide)의 분리방법.
  9. 제8항에 있어서, 상기 핵산 앱타머가 고정된 비드가 충진된 컬럼에 시료를 통과시키는 단계를 포함하는 것을 특징으로 하는 방법.
  10. 제8항에 있어서, 상기 시료는 물, 토양, 폐기물, 식품, 동식물 장내 및 동식물 조직 중 어느 하나 이상에서 채취된 시료인 것을 특징으로 하는 방법.
  11. 제1항의 핵산 앱타머를 포함하는 테뷰코나졸 (Tebuconazole), 메페나셋 (Mefenacet) 또는 이나벤파이드 (Inabenfide)의 분리용 키트.
PCT/KR2014/009696 2013-10-16 2014-10-16 테뷰코나졸, 메페나셋 및 이나벤파이드에 특이적으로 결합할 수 있는 핵산 압타머 및 그 용도 WO2015056980A1 (ko)

Priority Applications (2)

Application Number Priority Date Filing Date Title
JP2016548990A JP6262868B2 (ja) 2013-10-16 2014-10-16 テブコナゾール、メフェナセット及びイナベンフィドに特異的に結合できる核酸アプタマー及びその用途
US15/028,931 US20160251660A1 (en) 2013-10-16 2014-10-16 Nucleic acid aptamer capable of specifically binding to tebuconazole, mefenacet and inabenfide, and use therof

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2013-0123471 2013-10-16
KR20130123471 2013-10-16

Publications (1)

Publication Number Publication Date
WO2015056980A1 true WO2015056980A1 (ko) 2015-04-23

Family

ID=52828357

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2014/009696 WO2015056980A1 (ko) 2013-10-16 2014-10-16 테뷰코나졸, 메페나셋 및 이나벤파이드에 특이적으로 결합할 수 있는 핵산 압타머 및 그 용도

Country Status (4)

Country Link
US (1) US20160251660A1 (ko)
JP (1) JP6262868B2 (ko)
KR (1) KR101617205B1 (ko)
WO (1) WO2015056980A1 (ko)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11325948B2 (en) 2016-03-19 2022-05-10 Exuma Biotech Corp. Methods and compositions for genetically modifying lymphocytes to express polypeptides comprising the intracellular domain of MPL

Families Citing this family (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3519571B1 (en) * 2016-09-29 2022-07-27 Aptitude Medical Systems, Inc. Compositions, methods and systems for identifying candidate nucleic acid agent
KR102067476B1 (ko) * 2018-02-08 2020-01-17 고려대학교 산학협력단 테부코나졸(Tebuconazole), 이나벤파이드(Inabenfide) 및 이프로벤포스(Iprobenfos))에 특이적으로 결합하는 DNA 앱타머 및 그의 용도
KR102445026B1 (ko) * 2020-07-23 2022-09-21 고려대학교 산학협력단 산화 그래핀을 이용한 타겟 특이적 앱타머 선별방법
KR20220031527A (ko) * 2020-09-04 2022-03-11 한국식품연구원 식품 유해 물질 검출 방법

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2009041776A2 (en) * 2007-09-27 2009-04-02 Korea University Industrial & Academic Collaboration Foundation Dna aptamer binding to oxytetracycline with specificity and production method thereof
WO2013032242A2 (ko) * 2011-08-31 2013-03-07 고려대학교 산학협력단 그래핀을 이용한 타겟 비고정화 방식의 앱타머 선별방법 및 이로부터 선별된 앱타머

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005036171A1 (en) 2003-10-09 2005-04-21 Koninklijke Philips Electronics N.V. Method and system for detection of a target analyte
KR100961532B1 (ko) * 2008-03-27 2010-06-07 고려대학교 산학협력단 테트라사이클린 및 그 유도체에 특이적으로 결합하는21종의 단일가닥 핵산 구조체 앱타머와 그 생산방법
KR101338520B1 (ko) 2011-10-25 2013-12-10 고려대학교 산학협력단 글라이포세이트에 특이적으로 결합하는 dna 앱타머
CN103149167A (zh) * 2013-02-26 2013-06-12 上海交通大学 检测牛奶及饮用水中四环素残留的方法

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2009041776A2 (en) * 2007-09-27 2009-04-02 Korea University Industrial & Academic Collaboration Foundation Dna aptamer binding to oxytetracycline with specificity and production method thereof
WO2013032242A2 (ko) * 2011-08-31 2013-03-07 고려대학교 산학협력단 그래핀을 이용한 타겟 비고정화 방식의 앱타머 선별방법 및 이로부터 선별된 앱타머

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
PARK, J. W. ET AL.: "Immobilization-free screening of aptamers assisted by graphene oxide", CHEMICAL COMMUNICATIONS, vol. 48, no. 15, 5 December 2011 (2011-12-05), pages 2071 - 2073 *
STOLTENBURG, R. ET AL.: "FluMag-SELEX as an advantageous method for DNA aptamer selection", ANAL. BIOANAL. CHEM., vol. 383, no. 1, 19 October 2005 (2005-10-19), pages 83 - 91 *
TOMBELLI, S. ET AL.: "Aptamers biosensors for pharmaceutical compounds", COMBINATORIAL CHEMISTRY & HIGH THROUGHPUT SCREENING, vol. 13, no. 7, August 2010 (2010-08-01), pages 641 - 649 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11325948B2 (en) 2016-03-19 2022-05-10 Exuma Biotech Corp. Methods and compositions for genetically modifying lymphocytes to express polypeptides comprising the intracellular domain of MPL

Also Published As

Publication number Publication date
KR20150044397A (ko) 2015-04-24
US20160251660A1 (en) 2016-09-01
JP2016533191A (ja) 2016-10-27
KR101617205B1 (ko) 2016-05-02
JP6262868B2 (ja) 2018-01-17

Similar Documents

Publication Publication Date Title
WO2015056980A1 (ko) 테뷰코나졸, 메페나셋 및 이나벤파이드에 특이적으로 결합할 수 있는 핵산 압타머 및 그 용도
AU2002214936B2 (en) A kit for detecting non-pathogenic or pathogenic influenza a subtype H5 virus
CN107090457A (zh) 检测样品的多元分析
WO2015034250A1 (ko) 카드뮴에 특이적으로 결합하는 dna 앱타머 및 이의 용도
WO2013032242A2 (ko) 그래핀을 이용한 타겟 비고정화 방식의 앱타머 선별방법 및 이로부터 선별된 앱타머
AU2002214936A1 (en) A kit for detecting non-pathogenic or pathogenic influenza a subtype H5 virus
KR101338520B1 (ko) 글라이포세이트에 특이적으로 결합하는 dna 앱타머
CN103614489B (zh) 一种登革热病毒的恒温扩增检测试剂盒及检测方法
EP3277834B1 (en) Methods of capturing sperm nucleic acids
ATE493508T1 (de) Verfahren, kits und vorrichtungen zur prozessierung von nukleinsäuren
CN105120986B (zh) 用于核酸纯化的一步程序
CA2811435C (en) Amine compounds for the selective preparation of biological samples
CN110387401A (zh) 一种miRNA-21的检测方法
KR102503021B1 (ko) 아플라톡신 g1에 특이적으로 결합하는 dna 앱타머 및 이의 용도
CN114457083A (zh) 一组特异识别孔雀石绿的单链dna核酸适配体及其应用
CN111363748B (zh) 一种核酸适配体及其构建方法和其在检测中华鳖彩虹病毒中的应用
KR101612882B1 (ko) 이프로벤포스(Iprobenfos)에 특이적으로 결합할 수 있는 핵산 앱타머 및 그 용도
KR102196281B1 (ko) 에디펜포스(edifenphos)에 특이적으로 결합하는 DNA 앱타머 및 그의 용도
KR101322882B1 (ko) 소바이러스성 설사 바이러스에 특이적으로 결합할 수 있는 핵산 앱타머 및 그 용도
KR101678946B1 (ko) 25-하이드록시 비타민 디3에 특이적으로 결합할 수 있는 핵산 앱타머 및 그 용도
KR102067476B1 (ko) 테부코나졸(Tebuconazole), 이나벤파이드(Inabenfide) 및 이프로벤포스(Iprobenfos))에 특이적으로 결합하는 DNA 앱타머 및 그의 용도
WO2012070788A2 (en) Method and kit for the quantification of nucleic acids
CN107058585A (zh) 一种核酸杂交检测方法
KR101912358B1 (ko) 펙테이트리에이즈 3(Pectate lyase 3)에 특이적으로 결합하는 핵산 앱타머 및 이의 용도
CN118086315A (zh) 一种识别原多甲藻酸-1的核酸适配体及其应用

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 14854813

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 15028931

Country of ref document: US

ENP Entry into the national phase

Ref document number: 2016548990

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 14854813

Country of ref document: EP

Kind code of ref document: A1