WO2014151736A1 - Activation of bioluminescence by structural complementation - Google Patents
Activation of bioluminescence by structural complementation Download PDFInfo
- Publication number
- WO2014151736A1 WO2014151736A1 PCT/US2014/026354 US2014026354W WO2014151736A1 WO 2014151736 A1 WO2014151736 A1 WO 2014151736A1 US 2014026354 W US2014026354 W US 2014026354W WO 2014151736 A1 WO2014151736 A1 WO 2014151736A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- amino acid
- polypeptide
- acid sequence
- met
- peptide
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/531—Production of immunochemical test materials
- G01N33/532—Production of labelled immunochemicals
- G01N33/533—Production of labelled immunochemicals with fluorescent label
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K51/00—Preparations containing radioactive substances for use in therapy or testing in vivo
- A61K51/02—Preparations containing radioactive substances for use in therapy or testing in vivo characterised by the carrier, i.e. characterised by the agent or material covalently linked or complexing the radioactive nucleus
- A61K51/04—Organic compounds
- A61K51/08—Peptides, e.g. proteins, carriers being peptides, polyamino acids, proteins
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/43504—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates
- C07K14/43509—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates from crustaceans
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K19/00—Hybrid peptides, i.e. peptides covalently bound to nucleic acids, or non-covalently bound protein-protein complexes
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K7/00—Peptides having 5 to 20 amino acids in a fully defined sequence; Derivatives thereof
- C07K7/02—Linear peptides containing at least one abnormal peptide link
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K7/00—Peptides having 5 to 20 amino acids in a fully defined sequence; Derivatives thereof
- C07K7/04—Linear peptides containing only normal peptide links
- C07K7/08—Linear peptides containing only normal peptide links having 12 to 20 amino acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/0069—Oxidoreductases (1.) acting on single donors with incorporation of molecular oxygen, i.e. oxygenases (1.13)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/66—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving luciferase
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/536—Immunoassay; Biospecific binding assay; Materials therefor with immune complex formed in liquid phase
- G01N33/542—Immunoassay; Biospecific binding assay; Materials therefor with immune complex formed in liquid phase with steric inhibition or signal modification, e.g. fluorescent quenching
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/58—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving labelled substances
- G01N33/581—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving labelled substances with enzyme label (including co-enzymes, co-factors, enzyme inhibitors or substrates)
-
- G—PHYSICS
- G06—COMPUTING OR CALCULATING; COUNTING
- G06Q—INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR ADMINISTRATIVE, COMMERCIAL, FINANCIAL, MANAGERIAL OR SUPERVISORY PURPOSES; SYSTEMS OR METHODS SPECIALLY ADAPTED FOR ADMINISTRATIVE, COMMERCIAL, FINANCIAL, MANAGERIAL OR SUPERVISORY PURPOSES, NOT OTHERWISE PROVIDED FOR
- G06Q30/00—Commerce
- G06Q30/02—Marketing; Price estimation or determination; Fundraising
- G06Q30/0283—Price estimation or determination
-
- G—PHYSICS
- G06—COMPUTING OR CALCULATING; COUNTING
- G06Q—INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR ADMINISTRATIVE, COMMERCIAL, FINANCIAL, MANAGERIAL OR SUPERVISORY PURPOSES; SYSTEMS OR METHODS SPECIALLY ADAPTED FOR ADMINISTRATIVE, COMMERCIAL, FINANCIAL, MANAGERIAL OR SUPERVISORY PURPOSES, NOT OTHERWISE PROVIDED FOR
- G06Q30/00—Commerce
- G06Q30/06—Buying, selling or leasing transactions
- G06Q30/0601—Electronic shopping [e-shopping]
- G06Q30/0631—Recommending goods or services
-
- H—ELECTRICITY
- H04—ELECTRIC COMMUNICATION TECHNIQUE
- H04W—WIRELESS COMMUNICATION NETWORKS
- H04W4/00—Services specially adapted for wireless communication networks; Facilities therefor
- H04W4/02—Services making use of location information
-
- H—ELECTRICITY
- H04—ELECTRIC COMMUNICATION TECHNIQUE
- H04W—WIRELESS COMMUNICATION NETWORKS
- H04W4/00—Services specially adapted for wireless communication networks; Facilities therefor
- H04W4/30—Services specially adapted for particular environments, situations or purposes
- H04W4/35—Services specially adapted for particular environments, situations or purposes for the management of goods or merchandise
-
- H—ELECTRICITY
- H04—ELECTRIC COMMUNICATION TECHNIQUE
- H04W—WIRELESS COMMUNICATION NETWORKS
- H04W4/00—Services specially adapted for wireless communication networks; Facilities therefor
- H04W4/30—Services specially adapted for particular environments, situations or purposes
- H04W4/38—Services specially adapted for particular environments, situations or purposes for collecting sensor information
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/60—Fusion polypeptide containing spectroscopic/fluorescent detection, e.g. green fluorescent protein [GFP]
Definitions
- compositions and methods for the assembly of a bioluminescent complex from two or more non-luminescent (e.g., substantially non-luminescent) peptide and/or polypeptide units are provided herein.
- bioluminescent activity is conferred upon a non- luminescent polypeptide via structural complementation with another, complementary non-luminescent peptide.
- the present invention relates to compositions comprising complementary non- luminescent amino acid chains (e.g., substantially non-luminescent peptides and/or polypeptides that are not fragments of a preexisting protein), complexes thereof, and methods of generating an optically detectable bioluminescent signal upon association of the non-luminescent amino acid chains (e.g., peptides and/or polypeptides).
- the present invention provides two or more non-luminescent, or substantially non-luminescent peptides and/or polypeptides, that, when brought together, assemble into a bioluminescent complex.
- a pair of substantially non-luminescent peptide and/or polypeptide units assembles into a bioluminescent complex.
- three or more substantially non-luminescent peptide and/or polypeptide units assemble into a bioluminescent complex (e.g., ternary complex, tertiary complex, etc.).
- a bioluminescent complex e.g., ternary complex, tertiary complex, etc.
- the assembled pair catalyzes a chemical reaction of an appropriate substrate into a high energy state, and light is emitted.
- a bioluminescent complex exhibits luminescence in the presence of substrate (e.g., coelenterazine, furimazine, etc.).
- the embodiments described herein relating to luminescence should be viewed as applying to complementary, substantially non-enzymatically active amino acid chains (e.g., peptides and/or polypeptides that are not fragments of a preexisting protein) that separately lack a specified detectable activity (e.g., enzymatic activity) or substantially non-enzymatically active subunits of a polypeptide, complexes thereof, and methods of generating the detectable activity (e.g., an enzymatic activity) upon association of the complementary, substantially non-enzymatically active amino acid chains (e.g., peptides and/or polypeptides).
- embodiments described herein that refer to non-luminescent peptides and/or polypeptides are applied, in some embodiments, to substantially non-luminescent peptides and/or polypeptides.
- the invention is further directed to assays for the detection of molecular interactions between molecules of interest by linking the interaction of a pair of non-luminescent
- a pair of a non-luminescent elements are tethered (e.g., fused) to molecules of interest and assembly of the bioluminescent complex is operated by the molecular interaction of the molecules of interest. If the molecules of interest engage in a sufficiently stable interaction, the bioluminescent complex forms, and a bioluminescent signal is generated. If the molecules of interest fail to engage in a sufficiently stable interaction, the bioluminescent complex will not form or only form weakly, and a bioluminescent signal is not detectable or is substantially reduced (e.g., substantially
- the magnitude of the detectable bioluminescent signal is proportional (e.g., directly proportional) to the amount, strength, favorability, and/or stability of the molecular interactions between the molecules of interest.
- the present invention provides peptides comprising an amino acid sequence having less than 100% (e.g., 20%... 30%... 40%... 50%... 60%... 70%... 80%, or more) sequence identity with SEQ ID NO: 2, wherein a detectable bio luminescent signal is produced when the peptide contacts a polypeptide consisting of SEQ ID NO: 440.
- the present invention provides peptides comprising an amino acid sequence having less than 100% and greater than 40% (e.g., >40%, >45%, >50%, >55%, >60%, >65%, >70%, >75%, >80%, >85%, >90%, >95%, >98%, >99%) sequence identity with SEQ ID NO: 2, wherein a detectable bioluminescent signal is produced when the peptide contacts a polypeptide consisting of SEQ ID NO: 440.
- 40% e.g., >40%, >45%, >50%, >55%, >60%, >65%, >70%, >75%, >80%, >85%, >90%, >95%, >98%, >99%
- a detectable bioluminescent signal is produced when the peptide contacts a polypeptide having less than 100% and greater than 40%> (e.g., >40%>, >45%, >50%, >55%, >60%, >65%, >70%, >75%, >80%, >85%, >90%, >95%, >98%, >99%) sequence identity with SEQ ID NO: 440.
- the detectable bioluminescent signal is produced, or is substantially increased, when the peptide associates with the polypeptide comprising or consisting of SEQ ID NO: 440, or a portion thereof.
- the peptide exhibits alteration (e.g., enhancement) of one or more traits compared to a peptide of SEQ ID NO: 2, wherein the traits are selected from: affinity for the polypeptide consisting of SEQ ID NO: 440, expression, intracellular solubility, intracellular stability and bioluminescent activity when combined with the polypeptide consisting of SEQ ID NO: 440.
- the peptide amino acid sequence may be selected from amino acid sequences of SEQ ID NOS: 3-438 and 2162-2365.
- fusion polypeptides comprise: (a) an above described peptide, and (b) a first interaction polypeptide that forms a complex with a second interaction polypeptide upon contact of the first interaction polypeptide and the second interaction polypeptide.
- bioluminescent complexes comprise: (a) a first fusion polypeptide described above and (b) a second fusion polypeptide comprising: (i) the second interaction polypeptide and (ii) a complement polypeptide that emits a detectable bioluminescent signal when associated with the peptide comprising an amino acid sequence having less than 100% and greater than 40% sequence identity with SEQ ID NO: 2; wherein the first fusion polypeptide and second fusion polypeptide are associated; and wherein the peptide comprising an amino acid sequence having less than 100% and greater than 40% sequence identity with SEQ ID NO: 2 and the complement polypeptide are associated.
- the present invention provides polypeptides comprising an amino acid sequence having less than 100% sequence identity with SEQ ID NO: 440, wherein a detectable bioluminescent signal is produced when the polypeptide contacts a peptide consisting of SEQ ID NO: 2.
- the present invention provides polypeptides comprising an amino acid sequence having less than 100%) and greater than 40%> (e.g., >40%>, >45%, >50%, >55%, >60%, >65%, >70%, >75%, >80%, >85%, >90%, >95%, >98%, >99%) sequence identity with SEQ ID NO: 440, wherein a detectable bio luminescent signal is produced when the polypeptide contacts a peptide consisting of SEQ ID NO: 2.
- a detectable bioluminescent signal is produced when the polypeptide contacts a peptide having less than 100% and greater than 40% (e.g., >40%, >45%, >50%, >55%, >60%, >65%, >70%, >75%, >80%, >85%, >90%, >95%, >98%, >99%) sequence identity with SEQ ID NO: 2.
- the polypeptide exhibits alteration (e.g., enhancement) of one or more traits compared to a peptide of SEQ ID NO: 440, wherein the traits are selected from: affinity for the peptide consisting of SEQ ID NO: 2, expression, intracellular solubility, intracellular stability, and bioluminescent activity when combined with the peptide consisting of SEQ ID NO: 2.
- the polypeptide amino acid sequence may be selected from one of the amino acid sequences of SEQ ID NOS: 441-2156.
- the detectable bioluminescent signal is produced when the polypeptide associates with the peptide consisting of SEQ ID NO: 2.
- a fusion polypeptide is provided that comprises: (a) a polypeptide described above and (b) a first interaction polypeptide that forms a complex with a second interaction polypeptide upon contact of the first interaction polypeptide and the second interaction polypeptide.
- a bioluminescent complex comprises: (a) a first fusion polypeptide described above; and (b) a second fusion polypeptide comprising: (i) the second interaction polypeptide and (ii) a complement peptide that causes the polypeptide comprising an amino acid sequence having less than 100% and greater than 40% (e.g., >40%, >45%, >50%, >55%, >60%, >65%, >70%, >75%, >80%, >85%, >90%, >95%, >98%, >99%) sequence identity with SEQ ID NO: 440 to emit a detectable
- the present invention provides nucleic acids (e.g., DNA, RNA, etc.), oligonucleotides, vectors, etc., that code for any of the peptides, polypeptides, fusion proteins, etc., described herein.
- a nucleic acid comprising or consisting of one of the nucleic acid sequences of SEQ ID NOS : 3-438 and 2162-2365 (coding for non- luminescent peptides) and/or SEQ ID NOS 441-2156 (coding for non-luminescent polypeptides) are provided.
- other nucleic acid sequences coding for amino acid sequences of SEQ ID NOS: 3-438 and 2162-2365 and/or SEQ ID NOS 441-2156 are provided.
- the present invention provides bioluminescent complexes comprising: (a) a peptide comprising a peptide amino acid sequence having less than 100% sequence identity (e.g., >99%, ⁇ 95%, ⁇ 90%, ⁇ 80%, ⁇ 70%, ⁇ 60%, ⁇ 50%, etc.) with SEQ ID NO: 2; and (b) a polypeptide comprising a polypeptide amino acid sequence having less than 100% and greater than 40% (e.g., >40%, >45%, >50%, >55%, >60%, >65%, >70%, >75%, >80%, >85%, >90%, >95%, >98%, >99%) sequence identity with SEQ ID NO: 440, wherein the bioluminescent complex exhibits detectable luminescence.
- a peptide comprising a peptide amino acid sequence having less than 100% sequence identity e.g., >99%, ⁇ 95%, ⁇ 90%, ⁇ 80%, ⁇ 70%, ⁇ 60%,
- the present invention provides bioluminescent complexes comprising: (a) a peptide comprising a peptide amino acid sequence having less than 100% and greater than 40%> (e.g., >40%>, >45%, >50%, >55%, >60%, >65%, >70%, >75%, >80%, >85%, >90%, >95%, >98%, >99%) sequence identity with SEQ ID NO: 2; and (b) a polypeptide comprising a polypeptide amino acid sequence having less than 100% and greater than 40% (e.g., >40%, >45%, >50%, >55%, >60%, >65%, >70%, >75%, >80%, >85%, >90%, >95%, >98%, >99%) sequence identity with SEQ ID NO: 440, wherein the bioluminescent complex exhibits detectable luminescence.
- the peptide amino acid sequence is selected from one of the amino acid sequences
- bioluminescent complexes comprise: (a) a first amino acid sequence that is not a fragment of a preexisting protein; and (b) a second amino acid sequence that is not a fragment of a preexisting protein, wherein the bioluminescent complex exhibits detectable luminescence, wherein the first amino acid sequence and the second amino acid sequence are associated.
- Some such bioluminescent complexes further comprise: (c) a third amino acid sequence comprising a first member of an interaction pair, wherein the third amino acid sequence is covalently attached to the first amino acid sequence; and (d) a fourth amino acid sequence comprising a second member of an interaction pair, wherein the fourth amino acid sequence is covalently attached to the second amino acid sequence.
- interactions e.g., non-covalent interactions (e.g., hydrogen bonds, ionic bonds, van der Waals forces, hydrophobic interactions, etc.) covalent interactions (e.g., disulfide bonds), etc.) between the first amino acid sequence and the second amino acid sequence do not significantly associate the first amino acid sequence and the second amino acid sequence in the absence of the interactions between the first member and the second member of the interaction pair.
- a first polypeptide chain comprises the first amino acid sequence and the third amino acid sequence
- a second polypeptide chain comprises the second amino acid sequence and the fourth amino acid sequence.
- the first polypeptide chain and the second polypeptide chain are expressed within a cell.
- the present invention provides a bioluminescent complex comprising: (a) a pair of non-luminescent elements, wherein each non-luminescent element is not a fragment of a preexisting protein; (b) an interaction pair, wherein each interaction element of the interaction pair is covalently attached to one of the non- luminescent elements.
- Various embodiments described herein provide methods of detecting an interaction between a first amino acid sequence and a second amino acid sequence comprising, for example, the steps of: (a) attaching the first amino acid sequence to a third amino acid sequence and attaching the second amino acid sequence to a fourth amino acid sequence, wherein the third and fourth amino acid sequences are not fragments of a preexisting protein, wherein a complex of the third and fourth amino acid sequences emits a detectable bioluminescent signal (e.g.,
- attaching the first amino acid sequence to the third amino acid sequence and the second amino acid sequence to the fourth amino acid sequence comprises forming a first fusion protein comprising the first amino acid sequence and the third amino acid sequence and forming a second fusion protein comprising the second amino acid sequence and the fourth amino acid sequence.
- the first fusion protein and the second fusion protein further comprise linkers between said first and third amino acid sequences and said second and fourth amino acid sequences, respectively.
- the first fusion protein is expressed from a first nucleic acid sequence coding for the first and third amino acid sequences
- the second fusion protein is expressed from a second nucleic acid sequence coding for the second and fourth amino acid sequences.
- a single vector comprises the first nucleic acid sequence and the second nucleic acid sequence.
- the first nucleic acid sequence and the second nucleic acid sequence are on separate vectors.
- the steps of (a) "attaching” and (b) "placing” comprise expressing the first and second fusion proteins within a cell.
- methods of creating, producing, generating, and/or optimizing a pair of non-luminescent elements comprising: (a) aligning the sequences of three or more related proteins; (b) determining a consensus sequence for the related proteins; (c) providing first and second fragments of a protein related to three or more proteins (or providing first and second fragments of one of the three or more proteins), wherein the fragments are individually substantially non-luminescent but exhibit luminescence upon interaction of the fragments; (d) mutating the first and second fragments at one or more positions each, wherein the mutations alter the sequences of the fragments to be more similar to a corresponding portion of the consensus sequence (e.g., wherein the mutating results in a pair of non-luminescent elements that are not fragments of a preexisting protein), and (e) testing the pair of non-luminescent elements for the absence (e.g., essential absence, substantial absence, etc.) of luminescence when unassociated, and luminescence upon association of the non-
- the non-luminescent elements exhibit enhancement of one or more traits compared to the first and second fragments, wherein the traits are selected from: increased reconstitution affinity, decreased reconstitution affinity, enhanced expression, increased intracellular solubility, increased intracellular stability, and increased intensity of reconstituted luminescence.
- the present invention provides detection reagents comprising: (a) a polypeptide comprising an amino acid sequence having less than 100% and greater than 40% sequence identity with SEQ ID NO: 440, wherein a detectable bioluminescent signal is produced when the polypeptide contacts a peptide consisting of SEQ ID NO: 2, and (b) a substrate for a bioluminescent complex produced by the polypeptide and a peptide consisting of SEQ ID NO: 2.
- the present invention provides detection reagents comprising: (a) a peptide comprising an amino acid sequence having less than 100% sequence identity with SEQ ID NO: 2, wherein a detectable bioluminescent signal is produced when the peptide contacts a polypeptide consisting of SEQ ID NO: 440, and (b) a substrate for a bioluminescent complex produced by the peptide and a polypeptide consisting of SEQ ID NO: 440.
- the present invention provides detection reagents comprising: (a) a peptide comprising an amino acid sequence having less than 100% and greater than 40% sequence identity with SEQ ID NO: 2, wherein a detectable bioluminescent signal is produced when the peptide contacts a polypeptide consisting of SEQ ID NO: 440, and (b) a substrate for a bioluminescent complex produced by the peptide and a polypeptide consisting of SEQ ID NO: 440.
- GVTGWRLCKRISA (SEQ ID NO: 236) peptide on luminescence resulting from
- Figure 2 shows a graph depicting the effect of various mutations of the SEQ ID NO: 440 polypeptide on luminescence resulting from complementation with GVTGWRLCKRISA (SEQ ID NO: 236) or GVTGWRLFKRISA (SEQ ID NO: 108) peptides.
- Figure 3 A shows the luminescence (RLUs) detected in each non-luminescent polypeptide (NLpoly) mutant containing a single glycine to alanine substitution.
- Figure 3B shows the fold increase in luminescence over wild-type.
- Figure 4A show the luminescence (RLUs) detected in each NLpoly mutant containing a composite of glycine to alanine substitutions.
- Figure 4B shows the fold increase in luminescence over wild-type.
- Figure 5 shows a graph depicting the luminescence (RLUs) detected in HT-NLpeptide fusions.
- Figure 6 shows a graph depicting the luminescence (RLUs) detected in HT-NLpep fusions.
- Figure 7 shows a graph depicting the luminescence (RLUs) detected in NLpeptide-HT fusions.
- Figure 8 shows the luminescence (RLUs) generated by a luminescent complex after freeze-thaw cycles of non- luminescent peptide (NLpep).
- Figure 9 shows concentration normalized activity of peptides, and the TMR gel used to determine the relative concentrations.
- Figure 10 shows a graph of the luminescence of various mutations of residue Rl 1 of NLpoly-5A2 in the presence of NLpep53 (top) and in the absence of complimentary peptide (bottom).
- Figure 11 shows a graph of the luminescence of various mutations of residue A15 of NLpoly 5A2 in the presence of NLpep53 (top) and in the absence of complimentary peptide (bottom).
- Figure 12 shows a graph of the luminescence of various mutations of residue LI 8 of NLpoly 5A2 in the presence of NLpep53 (top) and in the absence of complimentary peptide (bottom).
- Figure 13 shows a graph of the luminescence of various mutations of residue F31 of NLpoly 5A2 in the presence of NLpep53 (top) and in the absence of complimentary peptide (bottom).
- Figure 14 shows a graph of the luminescence of various mutations of residue V58 of
- NLpoly 5A2 in the presence of NLpep53 (top) and in the absence of complimentary peptide (bottom).
- Figure 15 shows a graph of the luminescence of various mutations of residue A67 of NLpoly 5A2 in the presence of NLpep53 (top) and in the absence of complimentary peptide (bottom).
- Figure 16 shows a graph of the luminescence of various mutations of residue Ml 06 of NLpoly 5A2 in the presence of NLpep53 (top) and in the absence of complimentary peptide (bottom).
- Figure 17 shows a graph of the luminescence of various mutations of residue LI 49 of
- NLpoly 5A2 in the presence of NLpep53 (top) and in the absence of complimentary peptide (bottom).
- Figure 18 shows a graph of the luminescence of various mutations of residue VI 57 of NLpoly 5A2 in the presence of NLpep53 (top) and in the absence of complimentary peptide (bottom).
- Figure 19 shows a graph of the luminescence of NLpep-HT fusions.
- Figure 20 shows a graph of the luminescence of NLpep-HT fusions, and a TMR gel indicating their relative expression levels.
- Figure 21 shows a graph of the luminescence of NLpep-HT fusions.
- Figure 22 shows a graph of the luminescence of NLpoly 5A2 (top)
- NLpoly5A2+Rl IE in the presence of various NLpeps (bottom) .
- Figure 23 shows a graph of the luminescence of NLpep-HT fusions.
- Figure 24 shows a graph of the luminescence of NLpolys 1-13 with NLpep53 (top) and without complimentary peptide (bottom).
- Figure 25 shows a graph of the luminescence of various NLpolys with NLpep53 with
- Figure 26 shows a graph comparing luminescence in the presence of a ratio of furimazine with coelenterazine for various NLpolys and NLpep53.
- Figure 27 shows a graph comparing luminescence in the presence of a ratio of furimazine to coelenterazine for various NLpolys and NLpep53.
- Figure 28 shows a graph comparing luminescence in the presence of furimazine with coelenterazine for various NLpolys and NLpep53 in HEK293 cell lysate.
- Figure 29 shows a graph of the luminescence of various combinations of NLpoly and NLpep pairs in DMEM buffer with furimazine.
- Figure 30 shows a graph of the signal/background luminescence of various combinations of NLpoly and NLpep pairs in DMEM buffer with furimazine.
- Figure 31 shows a graph of luminescence and substrate specificity of various NLpoly mutants with NLpep69 using either furimazine or coelenterazme as a substrate.
- Figure 32 shows a comparison of luminescence and substrate specificity of various
- Figure 33 shows a comparison of luminescence and substrate specificity of NLpoly mutants with NLpep78 using either furimazine or coelenterazme as a substrate, and under either lytic (bottom graph) or live cell (top graph) conditions.
- Figure 34 shows a comparison of luminescence and substrate specificity of various NLpoly mutants with NLpep79 using either furimazine or coelenterazme as a substrate, and under either lytic (bottom graph) or live cell (top graph) conditions.
- Figure 35 shows graphs of the luminescence of NLpep78-HT (top) and NLpep79-HT (bottom) fusions in the presence of various NLpolys.
- Figure 36 shows a graph of the luminescence of various NLpolys in the absence of
- Figure 37 shows graphs of the luminescence of NLpep78-HT (top) and NLpep79-HT (bottom) fusions in the presence of various NLpolys with either furimazine or coelenterazme substrates.
- Figure 38 shows a graph of the luminescence of NLpep78-HT with various NLpolys expressed in CHO and HeLa cells.
- Figure 39 shows graphs of raw and normalized luminescence from NLpoly fused to firefly luciferase expressed in HEK293, Hela, and CHO cell lysates.
- Figure 40 shows graphs of raw and normalized luminescence from NLpoly fused to click beetle red luciferase expressed in HEK293, Hela, and CHO cell lysates.
- Figure 41 shows a graphs of luminescence of complementation in live cells using either NLpoly wild-type or 5P.
- Figure 42 shows graphs of luminescence of cell-free complementation of NLpep78-HT fusion (top) and NLpep79-HT fusion (bottom) with various NLpolys.
- Figure 43 shows a graph of binding affinities for various combinations of NLpeps and NLpolys expressed in HeLa, HEK293 and CHO cell lysate.
- Figure 44 shows a graph of binding affinities for various combinations of NLpeps and NLpolys in PBS or NANOGLO buffer.
- Figure 45 shows a graph of binding affinities for NLpoly 5P with NLpep9 or NLpep53 expressed in HeLa, HEK293 or CHO cell lysate.
- Figure 46 shows a graph of luminescence of varying amounts of NLpolys in the absence of NLpep.
- Figure 47 shows a graph of background luminescence of various NLpoly variants.
- Figure 48 shows a graph of background luminescence of various NLpoly variants.
- Figure 49 shows a SDS-PAGE gel of total lysate and soluble fraction of several NLpoly variants
- Figure 50 shows (a) a SDS-PAGE gel of the total lysate and soluble fraction of NLpoly variants and (b) background luminescence of NLpoly variants.
- Figure 51 shows graphs of the luminescence generated with several NLpoly variants when complemented with lOnm (right) or lOOnM (left) of NLpep78.
- Figure 52 shows graphs depicting background luminescence in E. coli lysate of various NLpoly variants.
- Figure 53 shows graphs depicting luminescence in E. coli lysate of various NLpoly variants complemented with NLpep78.
- Figure 54 shows graphs depicting luminescence in E. coli lysate of various NLpoly variants complemented with NLpep79.
- Figure 55 shows a graph of signal to background of various NLPolys variants complemented with NLpep78 or NLpep79 and normalized to NLpoly 5P.
- Figure 56 shows a graph depicting background, luminescence with NLpep79 (right) or NLpep78 (left) and signal-to-noise or various NLpoly variants.
- Figure 57 shows a SDS-PAGE gel of the total lysate and soluble fraction in various NLpoly 5P variants.
- Figure 58 shows (A) the amount of total lysate and soluble fraction of NLpoly 5P and
- NLpoly I107L (B) luminescence generated by NLpoly 5P or NLpoly I107L without NLpep or with NLpep78 or NLpep79 and (C) the improved signal-to-background of NLpoly I107L over NLpoly 5P.
- Figure 59 shows graphs of luminescence for various NLpoly variants (A) without complementary peptide, (B) with NLpep78-HT and (C) with NLpep79-HT.
- Figure 60 shows graphs of luminescence for various NLpoly variants (A) without complementary peptide, (B) with NLpep78-HT and (C) with NLpep79-HT.
- Figure 61 shows graphs of luminescence for various NLpoly variants (A) without complementary peptide, (B) with NLpep78-HT and (C) with NLpep79-HT.
- Figure 62 shows graphs of luminescence for various NLpoly variants (A) without complementary peptide, (B) with NLpep78-HT and (C) with NLpep79-HT.
- Figure 63 shows binding affinity between an elongated NLpoly variant (additional amino acids at the C-terminus) and a shortened NLpep (deleted amino acids at the N-terminus).
- Figure 64 shows a graph of binding affinity of various NLpoly variants with NLpep78.
- Figure 65 shows the binding and Vmax of NLpep80 and NLpep87 to 5P expressed in mammalian cells (CHO, HEK293T and HeLa).
- Figure 66 shows the binding and Vmax of NLpep80 and NLpep87 to NLpoly 5P expressed in E. coli.
- Figure 67 shows a graph of luminescence of shortened NLpolys with elongated NLpeps.
- Figure 68 shows graphs of Kd and Vmax of NLpoly 5P in HeLa lysate with various complementary NLpeps.
- Figure 69 shows a graph of binding affinities for several NLpoly variants with NLpep81.
- Figure 70 shows a graph of binding affinities for several NLpoly variants with NLpep82.
- Figure 71 shows a graph of binding affinities for several NLpoly mutants with NLpep78.
- Figure 72 shows a graph of Michaelis constants for several NLpoly mutants with NLpep78.
- Figure 73 shows graphs of luminescence from a tertiary complementation of two NLpeps and NLpoly 5P-B9.
- Figure 74 shows a graph of luminescence of titration of NLpoly 5P with NLpep88-HT.
- Figure 75 shows images of intracellular localization of various NLpep fusions with HaloTag (HT).
- Figure 76 shows images of intracellular localization of NLpoly(wt) and NLpoly(5P).
- Figure 77 demonstrates the ability to detect via complementation an NLPep-conjugated protein of interest following separation by SDS-PAGE and transfer to a PVDF membrane.
- Figure 78 shows a graph of relative luminescent signal from various NLpoly variants compared to NLpoly 5P (in the absence of NLpep).
- Figure 79 shows a graph of relative luminescent signal over background from various NLpolys compared to NLpoly 5P (in the absence of NLpep).
- Figure 80 compares the dissociation constants for NLpeps consisting of either 1 or 2 repeat units of NLpep78.
- Figure 81 shows the affinity between NLpoly 5A2 and NLpep86.
- Figure 82 shows graphs of the luminescence from NLpoly variants without NLpep, with NLpep78, and NLpep79.
- Figure 83-90 show the dissociation constants as well as the Vmax values for NLpoly
- 5A2, 5P, 8S and 1 IS with 96 variants of NLpeps.
- Figure 91 shows an image of a protein gel of total lysates and the soluble fraction of the same lysate for NLpoly variants.
- Figure 92 shows an image of a protein gel of total lysates and the soluble fraction of the same lysate for NLpoly variants as well as a table containing the dissociation constants for the same variants.
- Figure 93 shows the substrate specificity for NLpoly 5P and 1 IS with NLpep79 and demonstrates that NLpoly 1 IS has superior specificity for furimazine than 5P.
- Figure 94 shows an image of a protein gel that follows the affinity purification of NLpoly
- Figure 95 contains a table of the association and dissociation rate constants for the binding of NLpoly WT or 1 IS to NLpepWT, 78 or 79.
- Figure 96 shows the Km values for various pairs of NLpoly/NLpep.
- Figure 97 compares the dissociation constant for NLpoly 1 lS/NLpep79 at sub-saturating and saturating concentrations of furimazine.
- Figure 98 compares the Km values for NLpoly 5A2 with NLpepWT, 78 and 79.
- Figure 99 shows the luminescence of NLpolys from various steps in the evolution process in the absence of NLpep.
- Figure 100 shows the improvement in luminescence from E. co/z-derived NLpoly over the course of the evolution process with an overall ⁇ 10 5 improvement (from
- Figure 101 shows the improvement in luminescence from HeLa-expressed NLpoly over the course of the evolution process with an overall ⁇ 10 5 improvement (from
- Figure 102 shows the improvement in luminescence from HEK293 cell-expressed NLpoly over the course of the evolution process with an overall ⁇ 10 4 improvement (from
- Figure 103 shows dissociation constants and demonstrates a ⁇ 10 4 fold improvement in binding affinity from NLpolyWT:NLpepWT to NLpoly 11 S :NLpep86.
- Figure 104 shows an image of a protein gel of total lysates and the soluble fraction of the same lysate for NLpoly variants from various steps of the evolution process.
- Figure 105 shows luminescence of various NLpolys in the absence of NLpep and in the presence of NLpep78 and NLpep79.
- Figure 106 shows luminescence of various NLpolys in the absence of NLpep and in the presence of NLpep78 and NLpep79.
- Figure 107 shows luminescence of various NLpolys in the absence of NLpep and in the presence of NLpep78 and NLpep79.
- Figure 108 shows a comparison of luminescence generated by cells expressing different combinations of FRB and FKBP fused to NLpoly5P and NLpep80/87 after 15 min treatment with rapamycin or vehicle.
- Fold induction refers to signal generated in the presence of rapamycin compared to signal generated with vehicle.
- Figure 109 shows a comparison of luminescence generated by cells expressing different combinations of FRB and FKBP fused to NLpoly5P and NLpep80/87 after 60 min treatment with rapamycin or vehicle.
- Figure 110 shows a comparison of luminescence generated by cells expressing different combinations of FRB and FKBP fused to NLpoly5P and NLpep80/87 after 120 min treatment with rapamycin or vehicle.
- Figure 111 shows a comparison of luminescence generated by cells expressing different combinations of FRB and FKBP fused to NLpoly5P and NLpep80/87 after 120 min treatment with rapamycin or vehicle. All 8 possible combinations of FRB and FKBP fused to
- NLpoly/NLpep were tested and less total DNA was used.
- Figure 112 shows a comparison of luminescence generated by FRB or FKBP fusions expressed in the absence of binding partner.
- Figure 113 shows a comparison of luminescence generated by cells transfected with varying amounts of FRB-NLpoly5P and FKBP-NLpep80/87 DNA.
- Figure 114 shows a comparison of luminescence generated by cells transfected with varying amounts of FRB-NLpoly5P or FKBP-NLpep80/87 DNA in the absence of binding partner.
- Figure 115 shows a comparison of luminescence generated by cells transfected with varying amounts of FRB-NLpoly5P and FKBP-NLpep80/87 DNA. This example differs from Figure 113 in that lower levels of DNA were used.
- Figure 116 shows a comparison of luminescence generated by cells transfected with varying amounts of FRB-NLpoly5P or FKBP-NLpep80/87 DNA in the absence of binding partner. This differs from Figure 114 in that lower levels of DNA were used.
- Figure 117 shows a comparison of luminescence generated by cells transfected with varying amounts of FRB-NLpoly5P and FKBP-NLpep80 DNA after treatment with rapamycin for different lengths of time.
- Figure 118 shows a comparison of luminescence generated by cells transfected with varying amounts of FRB-NLpoly5P and FKBP-NLpep87 DNA after treatment with rapamycin for different lengths of time.
- Figure 119 shows a comparison of luminescence generated by cells expressing different combinations of FRB-NLpoly5P with FKBP-NLpep80/87/95/96/97. Assay was performed in both a two-day and three-day format.
- Figure 120 shows a comparison of luminescence generated by cells expressing different combinations of FRB-NLpoly5A2 with FKBP-NLpep80/87/95/96/97. Assay was performed in both a two-day and three-day format.
- Figure 121 shows a comparison of luminescence generated by cells expressing different combinations of FRB-NLpoly5A2 or FRB-NLpolyl lS with FKBP- NLpep 101/104/105/106/107/108/109/110.
- Figure 122 shows a comparison of luminescence generated by cells transfected with different combinations of FRB-NLpoly5 A2 or FRB-NLpolyl lS with FKBP- NLpep87/96/98/99/l 00/101/102/103.
- Figure 123 shows a comparison of luminescence generated by cells transfected with different levels of FRB-NLpolyl lS and FKBP-NLpep87/l 01/102/107 DNA.
- Figure 124 shows a comparison of luminescence generated by cells transfected with different levels of FRB-NLpoly5 A2 and FKBP-NLpep87/l 01/102/107 DNA.
- Figure 125 shows a rapamycin dose response curve showing luminescence of cells expressing FRB-NLpoly5P and FKBP-NLpep80/87 DNA.
- Figure 126 shows a rapamycin dose response curve showing luminescence of cells expressing FRB-NLpoly5A2 or FRB-NLpolyl lS and FKBP-NLpep87/101 DNA.
- Figure 127 shows a comparison of luminescence generated by cells expressing FRB-11S and FKBP-101 and treated with substrate PBI-4377 or furimazine.
- Figure 128 shows a rapamycin time course of cells expressing FRB-NLpolyl lS/5A2 and FKBP-NLpep87/101 conducted in the presence or absence of rapamycin wherein the rapamycin was added manually.
- Figure 129 shows a rapamycin time course of cells expressing FRB-NLpolyl lS/5A2 and FKBP-NLpep87/101 conducted in the presence or absence of rapamycin wherein the rapamycin was added via instrument injector.
- Figure 130 shows luminescence generated by FRB-NLpolyl lS and FKBP-NLpeplOl as measured on two different luminescence-reading instruments.
- Figure 131 provides images showing luminescence of cells expressing FRB-NLpolyl lS and FKBP-NLpep 101 at various times after treatment with rapamycin.
- Figure 132 provides a graph showing Image J quantitation of the signal generated by individual cells expressing FRB-NLpolyl lS and FKBP-NLpeplOl at various times after treatment with rapamycin.
- Figure 133 shows a comparison of luminescence in different cell lines expressing FRB- NLpoly 11 S and FKBP-NLpep 101.
- Figure 134 shows a comparison of luminescence generated by cells expressing FRB- NLpolyl lS and FKBP-NLpeplOl after treatment with the rapamycin competitive inhibitor FK506.
- Figure 135 shows (left side) luminescence generated by cells expressing FRB-NLpolyl lS and FKBP-NLpeplOl after treatment with the rapamycin competitive inhibitor FK506, and (right side) the percent of luminescence remaining after treatment with FK506.
- Figure 136 shows luminescence generated by cells transfected with different
- V2R-NLpoly5A2 or V2R-NLpolyl lS with NLpep87/101-ARRB2 in the presence or absence of the V2R agonist AVP.
- Figure 137 shows an AVP treatment time course showing luminescence generated by cells transfected with V2R-NLpoly 11 S and NLpep87/l 01 -ARRB2 after treatment with AVP wherein AVP was added manually.
- Figure 138 shows an AVP treatment time course showing luminescence generated by cells transfected with different combinations of V2R-NLpoly5A2 or V2R-NLpolyl lS with
- NLpep87/101-ARRB2 after treatment with AVP wherein AVP was added via instrument injector.
- Figure 139 shows an AVP treatment time course at 37°C showing luminescence generated by cells expressing different configurations of V2R and ARRB2 fused to NLpolyl lS and NLpep 101 after treatment with AVP.
- Figure 140 shows a comparison of luminescence in different cell lines expressing V2R- NLpep 11 S and NLpep 101 -ARRB2.
- Figure 141 shows 60X images showing luminescence of cells expressing V2R- NLpoly 11 S and NLpep 101 -ARRB2 at various times after treatment with AVP.
- Figure 142 shows 15 OX images showing luminescence of cells expressing V2R- NLpoly 11 S and NLpep 101 -ARRB2 at various times after treatment with AVP.
- Figure 143 shows a protein gel of total lysates and the soluble fraction of the same lysate for NLpoly variants.
- Figure 144 shows the dissociation constants for NLpoly 5P and combinations of mutations at positions 31, 46, 75, 76, and 93 in NLpoly 5P.
- Figure 145 shows a transferase example of post translational modification enzyme activity detection using an NLpep and aminopeptidase.
- Figure 146 shows a hydrolase example of post translational modification enzyme activity detection using an NLpep and methyl-specific antibody.
- Figure 147 contains wavelength scans for NLpoly WT complemented with either NLpep WT or NLpep WT conjugated to TMR.
- Figure 148 contains wavelength scans for NanoLuc fused to HaloTag (NL-HT) and
- NCT Non-chloroTOM
- Figure 149 shows a schematic a tertiary interaction wherein the energy transfer with an NLpoly and NLpep can also be used to measure three molecules interacting.
- a GPCR labeled with an NLpoly and a GPCR interacting protein labeled with an NLpep form a bioluminescent complex when they interact. This allows measurement of the binary interaction. If a small molecule GPCR ligand bearing an appropriate fluorescent moiety for energy transfer interacts with this system, energy transfer will occur. Therefore, the binary protein-protein interaction and the ternary drug-protein-protein interaction can be measured in the same experiment.
- Figure 150 shows a graph and table of binding affinities of NLpolyl IS to synthetic NLPep78 and NLPep78 at the N- or C-terminus of a fusion partner (HaloTag).
- Figure 151 shows a graph and table of binding affinities of NLpolyl IS to synthetic NLPep79 and NLPep79 at the N- or C-terminus of a fusion partner (HaloTag).
- Figure 152 shows a graph depicting normalized fluorescence intensity of NLpolyl IS with
- Figure 153 shows a graph depicting normalized fluorescence intensity of NLpolyl IS with NLPep86 or PBI-5434.
- Figure 154 shows a graph depicting normalized fluorescence intensity of NLpolyl IS with NLPep86 or PBI-5436.
- Figure 155 shows a graph demonstrating furimazine binding affinity in affinity buffer of complexes between NLpolyl IS and NLpep86, 78, 99, 101, 104, 128 and 114.
- Figure 156 shows a graph demonstrating furimazine binding affinity in NanoGlo assay buffer of complexes between NLpolyl IS and NLpep86, 78, 99, 101, 104, 128 and 114.
- Figure 157 shows graphs depicting the change in affinity (NLpolyl 56/NLPepl and
- Figure 158 shows graphs depicting the change in affinity (NLpolyl 56/NLPepl and
- Figure 159 shows a graph depicting Vmax and Bmax NLPolyl 56, NLPolyl IS, and NanoLuc® luciferase (Nluc) with NLPepl .
- Figure 160 shows a graph depicting RLU as a function of NLPep concentration for
- Figure 161 shows a Western blot depicting expression level in HEK293T cells of NLPolyl 56 and NLPolyl IS compared to full-length NanoLuc® luciferase.
- Figure 162 shows graphs depicting a comparison of the affinity of the ⁇ -lactamase SME and its inhibitor BLIPY50A as unfused proteins or when fused to NLPolyl IS and NLPepl 14.
- Figure 163 shows a comparison of luminescence generated by cells expressing different combinations of FRB-NLpolyl IS with FKBP-NLpeplOl/111-136
- Figure 164 shows a comparison of luminescence generated by cells expressing different combinations of FRB-NLpolyl IS with FKBP-NLpepl 14 and 137-143.
- Figure 165 shows rapamycin dose response curves of cells expressing FRB-NLpolyl IS and FKBP-NLpep78/79/99/l 01/104/114/128
- Figure 166 shows response of cells expressing FRB-NLpolyl IS and FKBP- 78/79/99/101/104/114/128 to the rapamycin competitive inhibitor FK506
- Figure 167 shows a comparison of luminescence generated by cells transfected with different ratios of FRB-NLpolyl IS and FKBP-NLpepl 14.
- Figure 168 shows a comparison of luminescence generated by cells expressing
- Figure 169 shows graphs depicting rapamycin (A) dose-specific and (B) time-specific induction of FRB-NLpolyl IS/FKBP-NLpepl 14 or split firefly complementation signals.
- Figure 170 shows graphs depicting FK506(A) dose-specific and (B) time-specific inhibition of FRB-NLpolyl IS/FKBP-NLpepl 14 or split firefly complementation signals.
- Figure 171 shows Western blots depicting similar expression levels of FKBP-NLpepl 14 and FKBP-Fluc(394-544) at equal levels of transfected DNA.
- Figure 172 shows graphs depicting (A) dose-specific and (B) time-specific inhibition of NLpolyl 1S-BRD4 and Histone H3.3-NLpepl 14 interaction by IBET-151.
- Figure 173 shows a graph depicting dose dependent increases in RAS/CRAF
- Figure 174 shows a graph depicting RLU as a function of NLPep concentration for NLpolyl IS and NLpep86, wt, and NLpepl 14.
- Figure 175 shows a schematic of an assay utilizing a high affinity peptide of a
- luminescent pair as an intracellular protein tag and the polypeptide of the luminescent pair as a detection reagent.
- Figure 176 shows a graph demonstrating the linear range of the affinity of NLpolyl IS and MLpep86.
- Figure 177 shows images demonstrating the sensitivity of detecting proteins tagged with a high affinity NLPep using 1 IS. This figure also compares the detection using NLPep/NLPoly to the detection using fluorescently labeled HaloTag.
- Figure 178 shows a graph demonstating the stability of NLpolyl IS.
- Figure 179 shows a graph demonstrating the linear range of the affinity of NLpolyl IS and NLpep78.
- Figure 180 shows a summary of NLpep sequences.
- High affinity (spontaneous) peptides are those peptides (NLpep) which bind to NLpolyl IS with high affinity.
- Dark/Quencher peptides are those peptides (NLpep) which can reduce the levels of light being produced or detected from NLpolyl IS.
- Figure 181 shows a schematic for the concept of structural complementation where the LSP and SSP (i.e., NLpoly and NLpep) are brought together to produce a bioluminescent signal (panels A, B). Upon disruption of a protein interaction (i.e. X and Y), LSP and SSP come apart resulting in a decrease in luminescence (Panel C).
- LSP and SSP i.e., NLpoly and NLpep
- Figure 182 A shows two options (A, B) for engineering structural complementation to be a loss of signal upon protein interaction between X and Y and a gain of signal upon disruption of the interaction between X and Y.
- Option A represents intermolecular structural complementation.
- Option B represents intramolecular structural complementation.
- Figure 182B shows a list of genetic constructs that could be suitable for intramolecular structural complementation.
- Figure 183 shows (A) inhibition of NLpolyl IS and NLpepl 14 binding by various dark peptides, and (B) dose-dependent inhibition by Lys-162 and Gin- 162 peptides.
- Figure 184 A shows that inhibition by Q-162 and A- 162 is dose-dependent.
- Panel B shows that Q-162 produces a signal on its own in a dose-dependent manner, while the dose- dependency of A- 162 is subtle at best.
- Figure 185 shows graphs demonstrating dose-response of the dark peptides with CP Nluc.
- Figure 186 shows graphs depicting a time course of dark peptide with CP Nluc.
- Figure 187 shows the dark peptide dose-dependent inhibition of luminescence generated from FRB-NLpolyl IS alone and also between FRB-NLpolyl IS and FKBP-NLpepl 14 in the presence and absence of rapamycin.
- Figure 188 shows the dark peptide dose-dependent inhibition of luminescence generated from either FRB-NanoLuc (311) or NanoLuc-FRB (307) in the presence and absence of rapamycin (RLU) .
- Figure 189 shows the dark peptide dose-dependent inhibition of luminescence generated from either FRB-NanoLuc (311) or NanoLuc-FRB (307) in the presence and absence of rapamycin (normalized to no dark peptide control; 100%).
- Figure 190 shows that the dark peptides, when fused to FKBP, can compete with both low (114) and high (80) affinity peptides (also FKBP fusions) and as a result reduce the total luminescence being produced and detected in live cells.
- Figure 191 shows the signal comparison between Flue and NLpep86-based assays for intracellular levels of Flue.
- Figure 192 shows graphs demonstrating the utility of tandem linked NLpeps in complementing Npoly 11 S .
- Figure 193 shows a graph demonstrating that NLpoly and NLpep components do not interfere with intracellular degradation of reporter protein FlucP.
- Figure 194 shows a schematic demonstrating and extracellular protease activity assay.
- Figure 195 shows a schematic of an assay for measuring the activity of an enzyme using a ProNLpep.
- Figure 196 shows a schematic of an assay for screening antibodies, proteins, peptides or transporters that mediate cellular internalization.
- Figure 197 shows a schematic of a post-translational modification transferase assay.
- Figure 198 shows a schematic of a post-translational modification hydrolase assay.
- Figure 199 shows graphs correlating Tyrosine Kinase SRC activity with luminescence over background in a post-translational modification assay.
- Figure 200 shows a graph depicting spontaneous complementation of three different versions of NLpolyl IS with twelve synthetic peptides.
- Figure 201 shows a schematic of a homogeneous immunoassay format utilizing fusions of NLpep and NLpoly with separate binding moieties A and B.
- Figure 202 shows graphs demonstrating: (A) reduction in background luminescence from NLpolyl IS upon complex formation with GWALFKK and Dabcyl-GWALFKK, and (B) NLpep86 forms a complex with NLpolyl IS in the presence of GWALFKK and Dabcyl - GWALFKK.
- Figure 203 shows graphs demonstrating: (A) VTGWALFEEIL (Trp 1 lmer) and
- VTGYALFEEIL Tyr 1 lmer induce luminescence over background (NLpolyl IS alone; no peptide control), and that the N-terminal Dabcyl versions of each provide significant quenching of this signal, and (B) that NLpep86 forms a complex with NLpolyl IS in the presence of Dabcyl versions of Trp 1 lmer and Tyr 1 lmer.
- the term "substantially” means that the recited characteristic, parameter, and/or value need not be achieved exactly, but that deviations or variations, including for example, tolerances, measurement error, measurement accuracy limitations and other factors known to skill in the art, may occur in amounts that do not preclude the effect the characteristic was intended to provide.
- a characteristic or feature that is substantially absent e.g.,
- substantially non-luminescent may be one that is within the noise, beneath background, below the detection capabilities of the assay being used, or a small fraction (e.g., ⁇ 1%, ⁇ 0.1%, ⁇ 0.01%, ⁇ 0.001%, ⁇ 0.00001%, ⁇ 0.000001%, 0.0000001%) of the significant characteristic (e.g., luminescent intensity of a biolummescent protein or biolummescent complex).
- bioluminescence refers to production and emission of light by a chemical reaction catalyzed by, or enabled by, an enzyme, protein, protein complex, or other biomolecule (e.g., biolummescent complex).
- a substrate for a biolummescent entity e.g., biolummescent protein or biolummescent complex
- the substrate subsequently emits light.
- the term "complementary” refers to the characteristic of two or more structural elements (e.g., peptide, polypeptide, nucleic acid, small molecule, etc.) of being able to hybridize, dimerize, or otherwise form a complex with each other.
- structural elements e.g., peptide, polypeptide, nucleic acid, small molecule, etc.
- Complementary peptide and polypeptide are capable of coming together to form a complex.
- Complementary elements may require assistance to form a complex (e.g., from interaction elements), for example, to place the elements in the proper conformation for complementarity, to co-localize complementary elements, to lower interaction energy for complementary, etc.
- the term “complex” refers to an assemblage or aggregate of molecules (e.g., peptides, polypeptides, etc.) in direct and/or indirect contact with one another.
- "contact,” or more particularly, “direct contact” means two or more molecules are close enough so that attractive noncovalent interactions, such as Van der Waal forces, hydrogen bonding, ionic and hydrophobic interactions, and the like, dominate the interaction of the molecules.
- a complex of molecules e.g., a peptide and polypeptide
- the term “complex” unless described as otherwise, refers to the assemblage of two or more molecules (e.g., peptides, polypeptides or a combination thereof).
- non-luminescent refers to an entity (e.g., peptide, polypeptide, complex, protein, etc.) that exhibits the characteristic of not emitting a detectable amount of light in the visible spectrum (e.g., in the presence of a substrate).
- an entity may be referred to as non-luminescent if it does not exhibit detectable luminescence in a given assay.
- non-luminescent is synonymous with the term “substantially non- luminescent.
- a non-luminescent polypeptide is substantially non- luminescent, exhibiting, for example, a 10-fold or more (e.g., 100-fold, 200-fold, 500-fold, lxl0 3 -fold, lxl0 4 -fold, lxl0 5 -fold, lxl0 6 -fold, lxl 0 7 -fold, etc.) reduction in luminescence compared to a complex of the NLpoly with its non-luminescent complement peptide.
- an entity is "non-luminescent" if any light emission is sufficiently minimal so as not to create interfering background for a particular assay.
- non-luminescent peptide e.g., NLpep
- non-luminescent polypeptide e.g., NLpoly
- peptides and polypeptides that exhibit substantially no luminescence (e.g., in the presence of a substrate), or an amount that is beneath the noise, or a 10-fold or more (e.g., 100-fold, 200-fold, 500-fold, lxl0 3 -fold, lxl0 4 -fold, lxl0 5 -fold, lxlO 6 - fold, lxl0 7 -fold, etc.) when compared to a significant signal (e.g., luminescent complex) under standard conditions (e.g., physiological conditions, assay conditions, etc.) and with typical instrumentation (e.g., luminometer, etc.).
- a significant signal e.g., luminescent complex
- non-luminescent peptides and polypeptides assemble, according to the criteria described herein, to form a bioluminescent complex.
- a "non-luminescent element” is a non-luminescent peptide or non- luminescent polypeptide.
- bioluminescent complex refers to the assembled complex of two or more non-luminescent peptides and/or non-luminescent polypeptides. The biolummescent complex catalyzes or enables the conversion of a substrate for the biolummescent complex into an unstable form; the substrate subsequently emits light.
- non-luminescent pair two non-luminescent elements that form a biolummescent complex may be referred to as a "non- luminescent pair.” If a biolummescent complex is formed by three or more non-luminescent peptides and/or non-luminescent polypeptides, the uncomplexed constituents of the
- biolummescent complex may be referred to as a "non-luminescent group.”
- interaction element refers to a moiety that assists in bringing together a pair of non-luminescent elements or a non-luminescent group to form a
- a pair of interaction elements (a.k.a.
- interaction pair is attached to a pair of non-luminescent elements (e.g., non-luminescent peptide/polypeptide pair), and the attractive interaction between the two interaction elements facilitates formation of the biolummescent complex; although the present invention is not limited to such a mechanism, and an understanding of the mechanism is not required to practice the invention.
- Interaction elements may facilitate formation of the biolummescent complex by any suitable mechanism (e.g., bringing non-luminescent pair/group into close proximity, placing a non- luminescent pair/group in proper conformation for stable interaction, reducing activation energy for complex formation, combinations thereof, etc.).
- An interaction element may be a protein, polypeptide, peptide, small molecule, cofactor, nucleic acid, lipid, carbohydrate, antibody, etc.
- An interaction pair may be made of two of the same interaction elements (i.e. homopair) or two different interaction elements (i.e. heteropair).
- the interaction elements may be the same type of moiety (e.g., polypeptides) or may be two different types of moieties (e.g., polypeptide and small molecule).
- an interaction pair in which complex formation by the interaction pair is studied, an interaction pair may be referred to as a "target pair” or a “pair of interest,” and the individual interaction elements are referred to as “target elements” (e.g., “target peptide,” “target polypeptide,” etc.) or “elements of interest” (e.g., "peptide of interest,” “polypeptide or interest,” etc.).
- preexisting protein refers to an amino acid sequence that was in physical existence prior to a certain event or date.
- a "peptide that is not a fragment of a preexisting protein” is a short amino acid chain that is not a fragment or sub-sequence of a protein (e.g., synthetic or naturally-occurring) that was in physical existence prior to the design and/or synthesis of the peptide.
- fragment refers to a peptide or polypeptide that results from dissection or “fragmentation” of a larger whole entity (e.g., protein, polypeptide, enzyme, etc.), or a peptide or polypeptide prepared to have the same sequence as such. Therefore, a fragment is a subsequence of the whole entity (e.g., protein, polypeptide, enzyme, etc.) from which it is made and/or designed.
- a peptide or polypeptide that is not a subsequence of a preexisting whole protein is not a fragment (e.g., not a fragment of a preexisting protein).
- a peptide or polypeptide that is "not a fragment of a preexisting bioluminescent protein” is an amino acid chain that is not a subsequence of a protein (e.g., natural or synthetic) that: (1) was in physical existence prior to design and/or synthesis of the peptide or polypeptide, and (2) exhibits substantial bioluminescent activity.
- subsequence refers to peptide or polypeptide that has 100% sequence identify with another, larger peptide or polypeptide.
- the subsequence is a perfect sequence match for a portion of the larger amino acid chain.
- sequence identity refers to the degree two polymer sequences
- sequence similarity refers to the degree with which two polymer sequences (e.g., peptide, polypeptide, nucleic acid, etc.) have similar polymer sequences.
- similar amino acids are those that share the same biophysical characteristics and can be grouped into the families, e.g., acidic (e.g., aspartate, glutamate), basic (e.g., lysine, arginine, histidine), non-polar (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan) and uncharged polar (e.g., glycine, asparagine, glutamine, cysteine, serine, threonine, tyrosine).
- acidic e.g., aspartate, glutamate
- basic e.g., lysine, arginine, histidine
- non-polar e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan
- uncharged polar e.g.
- the "percent sequence identity” is calculated by: (1) comparing two optimally aligned sequences over a window of comparison (e.g., the length of the longer sequence, the length of the shorter sequence, a specified window), (2) determining the number of positions containing identical (or similar) monomers (e.g., same amino acids occurs in both sequences, similar amino acid occurs in both sequences) to yield the number of matched positions, (3) dividing the number of matched positions by the total number of positions in the comparison window (e.g., the length of the longer sequence, the length of the shorter sequence, a specified window), and (4) multiplying the result by 100 to yield the percent sequence identity or percent sequence similarity.
- a window of comparison e.g., the length of the longer sequence, the length of the shorter sequence, a specified window
- peptides A and B are both 20 amino acids in length and have identical amino acids at all but 1 position, then peptide A and peptide B have 95% sequence identity. If the amino acids at the non-identical position shared the same biophysical characteristics (e.g., both were acidic), then peptide A and peptide B would have 100% sequence similarity. As another example, if peptide C is 20 amino acids in length and peptide D is 15 amino acids in length, and 14 out of 15 amino acids in peptide D are identical to those of a portion of peptide C, then peptides C and D have 70%> sequence identity, but peptide D has 93.3%) sequence identity to an optimal comparison window of peptide C.
- any gaps in aligned sequences are treated as mismatches at that position.
- physiological conditions encompasses any conditions compatible with living cells, e.g., predominantly aqueous conditions of a temperature, pH, salinity, chemical makeup, etc. that are compatible with living cells.
- sample is used in its broadest sense. In one sense, it is meant to include a specimen or culture obtained from any source, as well as biological and environmental samples.
- Biological samples may be obtained from animals (including humans) and encompass fluids, solids, tissues, and gases.
- Biological samples include blood products, such as plasma, serum and the like.
- Sample may also refer to cell lysates or purified forms of the peptides and/or polypeptides described herein.
- Cell lysates may include cells that have been lysed with a lysing agent or lysates such as rabbit reticulocyte or wheat germ lysates. Sample may also include cell- free expression systems.
- Environmental samples include environmental material such as surface matter, soil, water, crystals and industrial samples. Such examples are not however to be construed as limiting the sample types applicable to the present invention.
- peptide and polypeptide refer to polymer compounds of two or more amino acids joined through the main chain by peptide amide bonds (— C(0)NH— ).
- peptide typically refers to short amino acid polymers (e.g., chains having fewer than 25 amino acids), whereas the term “polypeptide” typically refers to longer amino acid polymers (e.g., chains having more than 25 amino acids).
- protein interactions with small molecules, nucleic acids, other proteins, etc. are detected based on the association of two non-luminescent elements that come together to from a bioluminescent complex capable of producing a detectable signal (e.g., luminescence).
- a bioluminescent complex capable of producing a detectable signal (e.g., luminescence).
- the formation of the bioluminescent complex is dependent upon the protein interaction that is being monitored.
- compositions and methods for the assembly of a bioluminescent complex from two or more non-luminescent peptide and/or polypeptide units e.g., non- luminescent pair.
- the non-luminescent peptide and/or polypeptide units are not fragments of a preexisting protein (e.g., are not complementary subsequences of a known polypeptide sequence).
- bioluminescent activity is conferred upon a non- luminescent polypeptide via structural complementation with a non-luminescent peptide.
- non-luminescent pairs for use in detecting and monitoring molecular interactions (e.g., protein-protein, protein-DNA, protein-R A interactions, RNA-DNA, protein-small molecule, RNA-small-molecule, etc.).
- complementary panels of interchangeable non-luminescent elements e.g., peptides and polypeptides
- variable affinities and luminescence upon formation of the various bioluminescent complexes e.g., a high-affinity/high-luminescence pair, a moderate- affinity/high-luminescence pair, a low-affinity/moderate-luminescence pair, etc.
- non-luminescent elements Utilizing different combinations of non-luminescent elements provides an adaptable system comprising various pairs ranging from lower to higher affinities, luminescence and other variable characteristics. This adaptability allows the detection/monitoring of molecular interactions to be fine-tuned to the specific molecule(s) of interest and expands the range of molecular interactions that can be monitored to include interactions with very high or low affinities. Further provided herein are methods by which non-luminescent pairs (or groups) and panels of non- luminescent pairs (or groups) are developed and tested.
- the interaction between the peptide/polypeptide members of the non-luminescent pair alone is insufficient to form the bioluminescent complex and produce the resulting bioluminescent signal.
- an interaction element is attached to each peptide/polypeptide member of the non- luminescent pair, then the interactions of the interaction pair (e.g., to form an interaction complex) facilitate formation of the bioluminescent complex.
- the bioluminescent signal from the bioluminescent complex serves as a reporter for the formation of the interaction complex.
- an interaction complex is formed, then a bioluminescent complex is formed, and a bioluminescent signal is detected/measured/monitored (e.g., in the presence of substrate). If an interaction complex fails to form (e.g., due to unfavorable conditions, due to unstable interaction between the interaction elements, due to incompatible interaction elements), then a bioluminescent complex does not form, and a bioluminescent signal is not produced.
- the interaction pair comprises two molecules of interest (e.g., proteins of interest).
- assays can be performed to detect the interaction of two molecules of interest by tethering each one to a separate member of a non-luminescent pair. If the molecules of interest interact (e.g., transiently interact, stably interact, etc.), the non- luminescent pair is brought into close proximity in a suitable conformation and a bioluminescent complex is formed (and bioluminescent signal is produced/detected (in the presence of substrate)).
- the non-luminescent pair does not interact in a sufficient manner, and a bioluminescent signal is not produced or only weakly produced.
- Such embodiments can be used to study the effect of inhibitors on complex formation, the effect of mutations on complex formation, the effect of conditions (e.g., temperature, pH, etc.) on complex formation, the interaction of a small molecule (e.g., potential therapeutic) with a target molecule, etc.
- Different non-luminescent pairs may require different strength, duration and/or stability of the interaction complex to result in bioluminescent complex formation.
- a stable interaction complex is required to produce a detectable bioluminescent signal. In other embodiments, even a weak or transient interaction complex results in
- bioluminescent complex formation In some embodiments, the strength or extent of an interaction complex is directly proportional to the strength of the resulting bioluminescent signal. Some non-luminescent pairs produce a detectable signal when combined with an interaction complex with a high millimolar dissociation constant (e.g., K d >100 mM).
- K d millimolar dissociation constant
- non- luminescent pairs require an interaction pair with a low millimolar (e.g., K d ⁇ 100 mM), micromolar (e.g., K d ⁇ l mM), nanomolar (e.g., K d ⁇ l ⁇ ), or even picomolar (e.g., K d ⁇ l nM) dissociation constant in order to produce a bioluminescent complex with a detectable signal.
- a low millimolar e.g., K d ⁇ 100 mM
- micromolar e.g., K d ⁇ l mM
- nanomolar e.g., K d ⁇ l ⁇
- picomolar e.g., K d ⁇ l nM
- one or more of the non-luminescent peptides/polypeptides are not fragments of a pre-existing protein. In some embodiments, one or more of the non- luminescent peptides/polypeptides are not fragments of a pre-existing bioluminescent protein. In some embodiments, neither/none of the non-luminescent peptides/polypeptides are fragments of a preexisting protein. In some embodiments, neither/none of the non-luminescent
- peptides/polypeptides are fragments of a pre-existing bioluminescent protein.
- neither the non-luminescent peptide nor non-luminescent polypeptide that assemble together to form a bioluminescent complex are fragments of a pre-existing protein.
- a non-luminescent element for use in embodiments of the present invention is not a subsequence of a preexisting protein.
- a non-luminescent pair for use in embodiments described herein does not comprise complementary subsequences of a preexisting protein.
- non-luminescent peptides/polypeptides are substantially non- luminescent in isolation.
- suitable conditions e.g., physiological conditions
- non-luminescent peptides/polypeptides when placed in suitable conditions (e.g., physiological conditions), interact to form a
- bioluminescent complex and produce a bioluminescent signal in the presence of substrate.
- interaction elements e.g.,
- non-luminescent peptides/polypeptides are unable to form a bioluminescent complex or only weakly form a complex.
- non- luminescent peptides/polypeptides are substantially non-luminescent in each other's presence alone, but produce significant detectable luminescence when aggregated, associated, oriented, or otherwise brought together by interaction elements.
- peptides and/or polypeptides that assemble into the bio luminescent complex produce a low level of luminescence in each other's presence, but undergo a significant increase in detectable luminescence when aggregated, associated, oriented, or otherwise brought together by interaction elements.
- interaction elements e.g., complementary interaction elements attached to the component peptide and polypeptide
- compositions and methods described herein comprise one or more interaction elements.
- an interaction element is a moiety (e.g., peptide, polypeptide, protein, small molecule, nucleic acid, lipid, carbohydrate, etc.) that is attached to a peptide and/or polypeptide to assemble into the bioluminescent complex.
- the interaction element facilitates the formation of a bioluminescent complex by any suitable mechanism, including: interacting with one or both non-luminescent elements, inducing a conformational change in a non-luminescent element, interacting with another interaction element (e.g., an interaction element attached to the other non-luminescent element), bringing non-luminescent elements into close proximity, orienting non-luminescent elements for proper interaction, etc.
- a bioluminescent complex by any suitable mechanism, including: interacting with one or both non-luminescent elements, inducing a conformational change in a non-luminescent element, interacting with another interaction element (e.g., an interaction element attached to the other non-luminescent element), bringing non-luminescent elements into close proximity, orienting non-luminescent elements for proper interaction, etc.
- one or more interaction elements are added to a solution containing the non-luminescent elements, but are not attached to the non- luminescent elements.
- the interaction element(s) interact with the non-luminescent elements to induce formation of the bioluminescent complex or create conditions suitable for formation of the bioluminescent complex.
- a single interaction element is attached to one member of a non-luminescent pair.
- the lone interaction element interacts with one or both of the non-luminescent elements to create favorable interactions for formation of the bioluminescent complex.
- one interaction element is attached to each member of a non-luminescent pair. Favorable interactions between the interaction elements facilitate interactions between the non-luminescent elements.
- the interaction pair may stably interact, transiently interact, form a complex, etc.
- the interaction of the interaction pair facilitates interaction of the non-luminescent elements (and formation of a bioluminescent complex) by any suitable mechanism, including, but not limited to: bringing the non-luminescent pair members into close proximity, properly orienting the non-luminescent pair members from interaction, reducing non-covalent forces acting against non-luminescent pair interaction, etc.
- an interaction pair comprises any two chemical moieties that facilitate interaction of an associated non-luminescent pair.
- An interaction pair may consist of, for example: two complementary nucleic acids, two polypeptides capable of dimerization (e.g., homodimer, heterodimer, etc.), a protein and ligand, protein and small molecule, an antibody and epitope, a reactive pair of small molecules, etc. Any suitable pair of interacting molecules may find use as an interaction pair.
- an interaction pair comprises two molecules of interest (e.g., proteins of interest) or target molecules.
- compositions and methods herein provide useful assays (e.g., in vitro, in vivo, in situ, whole animal, etc.) for studying the interactions between a pair of target molecules.
- a pair off interaction elements each attached to one of the non- luminescent elements, interact with each other and thereby facilitate formation of the
- bioluminescent complex In some embodiments, the presence of a ligand, substrate, co-factor or addition interaction element (e.g., not attached to non-luminescent element) is necessary to induce the interaction between the interaction elements and facilitate bioluminescent complex formation. In some embodiments, detecting a signal from the bioluminescent complex indicates the presence of the ligand, substrate, co-factor or addition interaction element or conditions that allow for interaction with the interaction elements.
- a pair off interaction elements, and a pair of non-luminescent elements are all present in a single amino acid chain (e.g., (interaction element l)-NLpep- (interaction element 2)-NLpoly, NLpoly-(interaction element l)-NLpep ⁇ (interaction element 2), NLpoly-(interaction element l)-(interaction element 2)-NLpep, etc.).
- a pair off interaction elements, and a pair of non-luminescent elements are all present in a single amino acid chain
- a ligand, substrate, co-factor or addition interaction element is required for the interaction pair to form an interaction complex and facilitate formation of the
- an interaction element and a non-luminescent element are attached, fused, linked, connected, etc.
- a first non-luminescent element and a first interaction element are attached to each other, and a second non-luminescent element and a second interaction element are attached to each other.
- Attachment of signal and interaction elements may be achieved by any suitable mechanism, chemistry, linker, etc.
- the interaction and non-luminescent elements are typically attached through covalent connection, but non- covalent linking of the two elements is also provided.
- the signal and interaction elements are directly connected and, in other embodiments, they are connected by a linker.
- the signal and interaction elements are contained within a single amino acid chain.
- a single amino acid chain comprises, consists of, or consists essentially of a non- luminescent element and interaction element.
- a single amino acid chain comprises, consists of, or consists essentially of a non-luminescent element, an interaction element, and optionally one or more an N-terminal sequence, a C-terminal sequence, regulatory elements (e.g., promoter, translational start site, etc.), and a linker sequence.
- the signal and interaction elements are contained within a fusion polypeptide.
- the signal and interaction elements (and any other amino acid segments to be included in the fusion) may be expressed separately; however, in other embodiments, a fusion protein is expressed that comprises or consist of both the interaction and signal sequences.
- a first fusion protein comprising a first non-luminescent element and first interaction element as well as a second fusion protein comprising a second non- luminescent element and second interaction element are expressed within the same cells.
- the first and second fusion proteins are purified and/or isolated from the cells, or the interaction of the fusion proteins is assayed within the cells.
- first and second fusion proteins are expressed in separate cells and combined (e.g., following purification and/or isolation, or following fusion of the cells or portions of the cells, or by transfer of a fusion protein from one cell to another, or by secretion of one or more fusion proteins into the extracellular medium) for signal detection.
- one or more fusion proteins are expressed in cell lysate (e.g., rabbit reticulocyte lysate) or in a cell-free system. In some embodiments, one or more fusion proteins are expressed from the genome of a virus or other cellular pathogen.
- nucleic acids DNA, RNA, vectors, etc. are provided that encode peptide, polypeptides, fusion polypeptide, fusion proteins, etc. of the present invention.
- Such nucleic acids and vectors may be used for expression, transformation, transfection, injection, etc.
- a non-luminescent element and interaction element are connected by a linker.
- a linker connects the signal and interaction elements while providing a desired amount of space/distance between the elements.
- a linker allows both the signal and interaction elements to form their respective pairs (e.g., non- luminescent pair and interaction pair) simultaneously.
- a linker assists the interaction element in facilitating the formation of a non-luminescent pair interaction.
- the linkers that connect each non-luminescent element to their respective interaction elements position the non-luminescent elements at the proper distance and conformation to form a bioluminescent complex.
- an interaction element and non-luminescent element are held in close proximity (e.g., ⁇ 4 monomer units) by a linker.
- a linker provides a desired amount of distance (e.g., 1, 2, 3, 4, 5, 6...10... 20, or more monomer units) between signal and interaction elements (e.g., to prevent undesirable interactions between signal and interaction elements, for steric considerations, to allow proper orientation of non-luminescent element upon formation of interaction complex, to allow propagation of a complex-formation from interaction complex to non-luminescent elements, etc.).
- a linker provides appropriate attachment chemistry between the signal and interaction elements.
- a linker may also improve the synthetic process of making the signal and interaction element (e.g., allowing them to be synthesized as a single unit, allowing post synthesis connection of the two elements, etc.).
- a linker is any suitable chemical moiety capable of linking, connecting, or tethering a non-luminescent element to an interaction element.
- a linker is a polymer of one or more repeating or non-repeating monomer units (e.g., nucleic acid, amino acid, carbon-containing polymer, carbon chain, etc.).
- a linker when present, is typically an amino acid chain.
- a linker may comprise any chemical moiety with functional (or reactive) groups at either end that are reactive with functional groups on the signal and interaction elements, respectively. Any suitable moiety capable of tethering the signal and interaction elements may find use as a linker.
- linker is a single covalent bond.
- the linker comprises a linear or branched, cyclic or heterocyclic, saturated or unsaturated, structure having 1-20 nonhydrogen atoms (e.g., C, N, P, O and S) and is composed of any combination of alkyl, ether, thioether, imine, carboxylic, amine, ester, carboxamide, sulfonamide, hydrazide bonds and aromatic or heteroaromatic bonds.
- linkers are longer than 20 nonhydrogen atoms (e.g.
- the linker comprises 1-50 non- hydrogen atoms (in addition to hydrogen atoms) selected from the group of C, N, P, O and S (e.g. 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40,41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 non-hydrogen atoms).
- 1-50 non- hydrogen atoms selected from the group of C, N, P, O and S (e.g. 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40,41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 non-hydrogen atoms).
- the present invention is not limited by the types of linkers available.
- the signal and interaction elements are linked, either directly (e.g. linker consists of a single covalent bond) or linked via a suitable linker.
- the present invention is not limited to any particular linker group.
- linker groups are contemplated, and suitable linkers could comprise, but are not limited to, alkyl groups, methylene carbon chains, ether, polyether, alkyl amide linker, a peptide linker, a modified peptide linker, a Poly(ethylene glycol) (PEG) linker, a streptavidin-biotin or avidin- biotin linker, polyaminoacids (e.g. polylysine), functionalised PEG, polysaccharides, glycosaminoglycans, dendritic polymers (WO93/06868 and by Tomalia et al. in Angew. Chem.
- oligonucleotide linker e.g., enzymatically (e.g., TEV protease site), chemically, photoinduced, etc.
- substantially non-luminescent peptides and polypeptides are provided with less than 100% sequence identity and/or similarity to any portion of an existing luciferase (e.g., a firefly luciferase, a Renilla luciferase, an Oplophorus luciferase, enhanced Oplophorus luciferases as described in U.S. Pat. App. 2010/0281552 and U.S. Pat. App.
- an existing luciferase e.g., a firefly luciferase, a Renilla luciferase, an Oplophorus luciferase, enhanced Oplophorus luciferases as described in U.S. Pat. App. 2010/0281552 and U.S. Pat. App.
- Certain embodiments of the present invention involve the formation of bio luminescent complexes of non- luminescent peptides and polypeptides with less than 100% sequence identity with all or a portion (e.g., 8 or more amino acids, less than about 25 amino acids for peptides) of SEQ ID NO: 2157 (e.g., complete NANOLUC sequence).
- Certain embodiments of the present invention involve the formation of bio luminescent complexes of non- luminescent peptides and polypeptides with less than 100%, but more than 40% (e.g., >40%, >45%, >50%, >55%, >60%, >65%, >70%, >75%, >80%, >85%, >90%, >95%, >98%, >99%) sequence identity with all or a portion (e.g., 8 or more amino acids, less than about 25 amino acids for peptides) of SEQ ID NO: 2157 (e.g., complete NANOLUC sequence).
- 40% e.g., >40%, >45%, >50%, >55%, >60%, >65%, >70%, >75%, >80%, >85%, >90%, >95%, >98%, >99%
- non-luminescent peptides and polypeptides are provided with less than 100% sequence similarity with a portion (e.g., 8 or more amino acids, less than about 25 amino acids for peptides) of SEQ ID NO: 2157 (e.g., peptides and
- non- luminescent peptides and polypeptides are provided with less than 100%, but more than 40%> (e.g., >40%, >45%, >50%, >55%, >60%, >65%, >70%, >75%, >80%, >85%, >90%, >95%,
- sequence similarity with a portion (e.g., 8 or more amino acids, less than about 25 amino acids for peptides) of SEQ ID NO: 2157 (e.g., peptides and polypeptides that interact to form bioluminescent complexes).
- Non-luminescent peptides are provided that have less than 100% sequence identity and/or similarity with about a 25 amino acid or less portion of SEQ ID NO: 2157, wherein such peptides form a bioluminescent complex when combined under appropriate conditions (e.g., stabilized by an interaction pair) with a polypeptide having less than 100%, but more than 40% (e.g., >40%, >45%, >50%, >55%, >60%, >65%, >70%, >75%, >80%, >85%, >90%, >95%, >98%, >99%) sequence identity and/or similarity with another portion SEQ ID NO: 2157.
- Non-luminescent peptides are provided that have less than 100%>sequence identity and/or similarity with about a 25 amino acid or less portion of SEQ ID NO: 2157, wherein such peptides form a bioluminescent complex when combined under appropriate conditions (e.g., stabilized by an interaction pair) with a polypeptide having less than 100%, but more than 40% (e.g., >40%, >45%, >50%, >55%, >60%, >65%, >70%, >75%, >80%, >85%, >90%, >95%, >98%, >99%) sequence identity and/or similarity with another portion SEQ ID NO: 2157.
- Non- luminescent peptides are provided that have less than 100%, but more than 40%> (e.g., >40%>, >45%, >50%, >55%, >60%, >65%, >70%, >75%, >80%, >85%, >90%, >95%, >98%, >99%) sequence identity and/or similarity with about a 25 amino acid or less portion of SEQ ID NO: 2157, wherein such peptides form a bioluminescent complex when combined under appropriate conditions (e.g., stabilized by an interaction pair) with a polypeptide having less than 100%, but more than 40% (e.g., >40%, >45%, >50%, >55%, >60%, >65%, >70%, >75%, >80%, >85%, >90%, >95%, >98%, >99%) sequence identity and/or similarity with another portion SEQ ID NO: 2157.
- 40% e.g., >40%>, >45%, >50%, >55%,
- non-luminescent polypeptides are provided that have less than 100%), but more than 40% (e.g., >40%, >45%, >50%, >55%, >60%, >65%, >70%, >75%, >80%, >85%, >90%, >95%, >98%, >99%) sequence identity or similarity with a portion of SEQ ID NO: 2157, wherein such polypeptides form a bioluminescent complex when combined under appropriate conditions (e.g., stabilized by an interaction pair) with a peptide having less than 100%), but optionally more than 40% (e.g., >40%, >45%, >50%, >55%, >60%, >65%, >70%, >75%, >80%, >85%, >90%, >95%, >98%, >99%) sequence identity and/or similarity with another portion SEQ ID NO: 2157.
- 40% e.g., >40%, >45%, >50%, >55%, >60%, >65%, >70
- non- luminescent peptides with less than lOOsequence identity or similarity with SEQ ID NO: 2 are provided.
- non- luminescent peptides with less than 100%, but more than 40% e.g., >40%, >45%, >50%, >55%, >60%, >65%, >70%, >75%, >80%, >85%, >90%, >95%, >98%, >99% sequence identity or similarity with SEQ ID NO: 2 are provided.
- non- luminescent polypeptides with less than 100 sequence identity or similarity with SEQ ID NO: 440 are provided.
- non- luminescent polypeptides with less than 100%, but more than 40% (e.g., >40%, >45%, >50%, >55%, >60%, >65%, >70%, >75%, >80%, >85%, >90%, >95%, >98%, >99%) sequence identity or similarity with SEQ ID NO: 440 are provided.
- non-luminescent peptides that find use in embodiments of the present invention include peptides with one or more amino acid substitutions, deletions, or additions from GVTGWRLCK ISA (SEQ ID NO: 236).
- the present invention provides peptides comprising one or more of amino acid sequences of Table 1 , and/or nucleic acids comprising the nucleic acid sequences of Table 1 (which code for the peptide sequences of Table 1). Table 1.
- NLpep20 (w/ Met) N.A. ATGGGACAGACCGGCTGGCGGCTGTGCAAGCGCATTAGCGCG
- NLpep21 (w/ Met) N.A. ATGGGAAGCACCGGCTGGCGGCTGTGCAAGCGCATTAGCGCG
- NLpep22 (w/ Met) N.A. ATGGGAGTGGTGGGCTGGCGGCTGTGCAAGCGCATTAGCGCG
- NLpep28 (w/ Met) N.A. ATGGGAGTGACCGGCTGGCGGCACTGCAAGCGCATTAGCGCG
- NLpep35 (w/ Met) N.A. ATGGGAGTGACCGGCTGGCGGCTGTGCAAGAAGATTAGCGCG
- NLpep36 (w/ Met) N.A. ATGGGAGTGACCGGCTGGCGGCTGTGCAAGAACATTAGCGCG
- NLpep37 (w/ Met) N.A. ATGGGAGTGACCGGCTGGCGGCTGTGCAAGCGCGTGAGCGCG
- NLpep40 (w/ Met) N.A. ATGGGAGTGACCGGCTGGCGGCTGTGCAAGCGCCGGAGCGCG 80 NLpep40 (w/ Met) A.A. MGVTGWRLCK SA
- peptides from Table 1 are provided.
- peptides comprise a single amino acid difference from GVTGWRLCKRISA (SEQ ID NO: 236) and/or any of the peptides listed in Table 1.
- peptides comprise two or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, etc.) amino acid differences from GVTGWRLCKRISA (SEQ ID NO: 236) and/or any of the peptides listed in Table 1.
- peptides comprise two or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, etc.) amino acid differences from GVTGWRLCKRISA (SEQ ID NO: 236) and/or any of the peptides listed in Table 1.
- peptides comprise two or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, etc.) amino acid differences from GVTGWRLCKRISA (SEQ ID NO: 236) and/or any of the peptides listed in Table 1.
- peptides comprise two or more (e.g., 2, 3,
- peptides are provided comprising one of the amino acid sequences of SEQ ID NOS: 3-438 and 2162-2365. In some embodiments, peptides are provided comprising one of the amino acid sequences of SEQ ID NOS: 3-438 and 2162-2365 with one or more additions, substitutions, and/or deletions. In some embodiments, a peptide or a portion thereof comprises greater than 70% sequence identity (e.g., 71%, 75%, 80%, 85%, 90%, 95%, 99%) with one or more of the amino acid sequence of SEQ ID NOS: 3-438 and 2162-2365.
- nucleic acids are provided comprising one of the nucleic acid coding sequences of SEQ ID NOS: 3-438 and 2162-2365. In some embodiments, nucleic acids are provided comprising one of the nucleic acid sequences of SEQ ID NOS: 3-438 and 2162-2365with one or more additions, substitutions, and/or deletions. In some embodiments, a nucleic acid or a portion thereof comprises greater than 70% sequence identity (e.g., 71%, 75%, 80%, 85%, 90%, 95%, 99%) with one or more of the nucleic acid sequence of SEQ ID NOS: 3-438 and 2162-2365.
- nucleic acids are provided that code for one of the amino acid sequences of SEQ ID NOS: 3-438 and 2162-2365. In some embodiments, nucleic acids are provided that code for one of the amino acid sequences of SEQ ID NOS: 3-438 and 2162-2365 with one or more additions, substitutions, and/or deletions. In some embodiments, a nucleic acid is provided that codes for an amino acid with greater than 70% sequence identity (e.g., 71%, 75%, 80%, 85%, 90%, 95%, 99%) with one or more of the amino acid sequences of SEQ ID NOS: 3-438 and 2162-2365.
- 70% sequence identity e.g., 71%, 75%, 80%, 85%, 90%, 95%, 99%
- nucleic acid from Table 1 is provided.
- a nucleic acid encoding a peptide from Table 1 is provided.
- a nucleic acid of the present invention codes for a peptide that comprises a single amino acid difference from MGVTGWRLCERILA (SEQ ID NO: 2) and/or any of the peptides listed in Table 1.
- nucleic acids code for peptides comprising two or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, etc.) amino acid differences from MGVTGWRLCERILA (SEQ ID NO: 2) and/or any of the peptides listed in Table 1.
- nucleic acids are provided comprising the sequence of one of the nucleic acids in Table 1.
- nucleic acids are provided comprising one of the nucleic acids of Table 1 with one or more additions,
- a nucleic acid or a portion thereof comprises greater than 70% sequence identity (e.g., 71%, 75%, 80%, 85%, 90%, 95%, 99%) with one or more of the nucleic acids of Table 1.
- non-luminescent polypeptides that find use in embodiments of the present invention include polypeptides with one or more amino acid substitutions, deletions, or additions from SEQ ID NO: 440.
- the present invention provides polypeptides comprising one or more of amino acid sequences of Table 2, and/or nucleic acids comprising the nucleic acid sequences of Table 2 (which code for the polypeptide sequences of Table 2). Table 2. Pol e tide se uences
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Medicinal Chemistry (AREA)
- Biomedical Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Physics & Mathematics (AREA)
- Genetics & Genomics (AREA)
- Hematology (AREA)
- Urology & Nephrology (AREA)
- Zoology (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Wood Science & Technology (AREA)
- Business, Economics & Management (AREA)
- General Physics & Mathematics (AREA)
- Analytical Chemistry (AREA)
- Biophysics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Cell Biology (AREA)
- Pathology (AREA)
- Food Science & Technology (AREA)
- Accounting & Taxation (AREA)
- Finance (AREA)
- Development Economics (AREA)
- General Engineering & Computer Science (AREA)
- Signal Processing (AREA)
- Strategic Management (AREA)
- Computer Networks & Wireless Communication (AREA)
- General Business, Economics & Management (AREA)
- Theoretical Computer Science (AREA)
- Marketing (AREA)
- Economics (AREA)
- Veterinary Medicine (AREA)
Priority Applications (22)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP14769752.8A EP2970412B1 (en) | 2013-03-15 | 2014-03-13 | Activation of bioluminescence by structural complementation |
| DK14769752.8T DK2970412T5 (da) | 2013-03-15 | 2014-03-13 | Aktivering af bioluminescens via strukturel komplementering |
| EP22182344.6A EP4177261A1 (en) | 2013-03-15 | 2014-03-13 | Activation of bioluminescence by structural complementation |
| KR1020157024687A KR20150129721A (ko) | 2013-03-15 | 2014-03-13 | 구조적 보완에 의한 바이오발광성의 활성화 |
| CN202310649630.0A CN117024548A (zh) | 2013-03-15 | 2014-03-13 | 通过结构互补激活生物发光 |
| KR1020237017712A KR20230079494A (ko) | 2013-03-15 | 2014-03-13 | 구조적 보완에 의한 바이오발광성의 활성화 |
| PL14769752.8T PL2970412T3 (pl) | 2013-03-15 | 2014-03-13 | Aktywacja bioluminescencji przez dopełnienie strukturalne |
| AU2014236949A AU2014236949C1 (en) | 2013-03-15 | 2014-03-13 | Activation of bioluminescence by structural complementation |
| SG11201507306VA SG11201507306VA (en) | 2013-03-15 | 2014-03-13 | Activation of bioluminescence by structural complementation |
| KR1020217008951A KR102675860B1 (ko) | 2013-03-15 | 2014-03-13 | 구조적 보완에 의한 바이오발광성의 활성화 |
| ES14769752T ES2926463T3 (es) | 2013-03-15 | 2014-03-13 | Activación de la bioluminiscencia mediante complementación estructural |
| IL286816A IL286816B (en) | 2013-03-15 | 2014-03-13 | Activation of biological light emission through structural complementation |
| CA2906063A CA2906063C (en) | 2013-03-15 | 2014-03-13 | ACTIVATION OF BIOLUMINESCENCE THROUGH STRUCTURAL COMPLEMENTATION |
| BR112015023394A BR112015023394B8 (pt) | 2013-03-15 | 2014-03-13 | Sistema e complexo bioluminescente |
| EP20197758.4A EP3783011B1 (en) | 2013-03-15 | 2014-03-13 | Activation of bioluminescence by structural complementation |
| EP22196592.4A EP4169935A1 (en) | 2013-03-15 | 2014-03-13 | Activation of bioluminescence by structural complementation |
| CN201480015213.XA CN105143249A (zh) | 2013-03-15 | 2014-03-13 | 通过结构互补激活生物发光 |
| JP2016502113A JP6654557B2 (ja) | 2013-03-15 | 2014-03-13 | 構造的相補性による生物発光の活性化 |
| IL240985A IL240985B (en) | 2013-03-15 | 2015-09-01 | Activation of biological light emission through structural complementation |
| AU2018256548A AU2018256548B2 (en) | 2013-03-15 | 2018-10-31 | Activation of bioluminescence by structural complementation |
| IL273989A IL273989B (en) | 2013-03-15 | 2020-04-16 | Activation of biological light emission through structural complementation |
| AU2020213288A AU2020213288B2 (en) | 2013-03-15 | 2020-08-04 | Activation of bioluminescence by structural complementation |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201361791549P | 2013-03-15 | 2013-03-15 | |
| US61/791,549 | 2013-03-15 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2014151736A1 true WO2014151736A1 (en) | 2014-09-25 |
Family
ID=51581027
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2014/026354 Ceased WO2014151736A1 (en) | 2013-03-15 | 2014-03-13 | Activation of bioluminescence by structural complementation |
Country Status (15)
| Country | Link |
|---|---|
| US (11) | US9797889B2 (https=) |
| EP (4) | EP4169935A1 (https=) |
| JP (4) | JP6654557B2 (https=) |
| KR (3) | KR102675860B1 (https=) |
| CN (2) | CN117024548A (https=) |
| AU (3) | AU2014236949C1 (https=) |
| BR (1) | BR112015023394B8 (https=) |
| CA (3) | CA3249512A1 (https=) |
| DK (2) | DK2970412T5 (https=) |
| ES (2) | ES2926463T3 (https=) |
| IL (3) | IL286816B (https=) |
| PL (2) | PL3783011T3 (https=) |
| PT (2) | PT2970412T (https=) |
| SG (2) | SG11201507306VA (https=) |
| WO (1) | WO2014151736A1 (https=) |
Cited By (14)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US9797890B2 (en) | 2013-03-15 | 2017-10-24 | Promega Corporation | Activation of bioluminescence by structural complementation |
| EP3254113A4 (en) * | 2015-02-05 | 2018-06-27 | Promega Corporation | Luciferase-based thermal shift assays |
| WO2020072775A2 (en) | 2018-10-03 | 2020-04-09 | Promega Corporation | Compositions and methods for stabilizing coelenterazine and analogs and derivatives thereof |
| US10634680B2 (en) | 2016-04-26 | 2020-04-28 | University Of Utah Research Foundation | Target-binding activated split reporter systems for analyte detection and related components and methods |
| WO2020113036A2 (en) | 2018-11-28 | 2020-06-04 | Promega Corporation | Reactive peptide labeling |
| CN112567028A (zh) * | 2018-06-12 | 2021-03-26 | 普洛麦格公司 | 多部分萤光素酶 |
| US20210215682A1 (en) * | 2018-02-26 | 2021-07-15 | Technische Universiteit Eindhoven | Bioluminescent biosensor for detecting and quantifying biomolecules |
| WO2021194343A1 (en) | 2020-03-25 | 2021-09-30 | Erasmus University Medical Center Rotterdam | Reporter system for radionuclide imaging |
| EP3953374A4 (en) * | 2019-04-10 | 2023-06-07 | Promega Corporation | COMPOSITIONS AND METHODS FOR DETECTION OF ANALYTES USING BIOLUMINESCENCE |
| EP4219736A1 (en) * | 2014-09-12 | 2023-08-02 | Promega Corporation | Internal protein tags |
| US11788069B2 (en) | 2016-10-20 | 2023-10-17 | President And Fellows Of Harvard College | In vitro and cell based assays for measuring the activity of botulinum neurotoxins |
| US11913944B2 (en) | 2019-03-20 | 2024-02-27 | Promega Corporation | Photoaffinity probes |
| US12061202B2 (en) | 2019-12-10 | 2024-08-13 | Promega Corporation | Compositions and methods for bioluminescent detection using multifunctional probes |
| US12606863B2 (en) | 2021-05-13 | 2026-04-21 | Promega Corporation | Bioluminescent detection of DNA synthesis |
Families Citing this family (26)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US11365402B2 (en) | 2014-09-12 | 2022-06-21 | Promega Corporation | Internal protein tags |
| EP3395803A1 (en) | 2017-04-28 | 2018-10-31 | Institut Pasteur | Imidazopyrazine derivatives, process for preparation thereof, and their uses as luciferins |
| US11579149B2 (en) * | 2017-11-01 | 2023-02-14 | Queen's University At Kingston | Hippo pathway bioluminescent biosensor |
| EP4140991B1 (en) | 2018-06-01 | 2024-05-15 | Promega Corporation | Inhibitors of oplophorus luciferase-derived bioluminescent complexes |
| US10962538B2 (en) | 2018-06-14 | 2021-03-30 | The Trustees Of Columbia University In The City Of New York | Assays using arrestin recruitment and unmodified receptors |
| US20200200765A1 (en) | 2018-12-04 | 2020-06-25 | Promega Corporation | Broad spectrum gpcr binding agents |
| US11360096B2 (en) | 2019-05-16 | 2022-06-14 | Duke University | Complex BRET technique for measuring biological interactions |
| CN114450326B (zh) | 2019-06-24 | 2025-02-11 | 普罗美加公司 | 用于将生物分子递送到细胞中的改性聚胺聚合物 |
| DE102019127894B4 (de) * | 2019-10-16 | 2022-05-12 | Sensor-Instruments Entwicklungs- Und Vertriebs-Gmbh | Produktkennzeichnungssystem und verfahren zur kennzeichnung eines produkts |
| US20230031446A1 (en) * | 2019-11-22 | 2023-02-02 | The Regents Of The University Of California | Split-enzyme system to detect specific dna in living cells |
| KR20220121816A (ko) | 2019-11-27 | 2022-09-01 | 프로메가 코포레이션 | 다분할 루시퍼라제 펩타이드 및 폴리펩타이드 |
| US20230257726A1 (en) * | 2020-05-11 | 2023-08-17 | Chan Zuckerberg Biohub, Inc. | Ace2 compositions and methods |
| JP7677997B2 (ja) | 2020-05-22 | 2025-05-15 | プロメガ コーポレイション | キナーゼターゲットエンゲージメントの増強 |
| CN116391129A (zh) | 2020-08-28 | 2023-07-04 | 普罗美加公司 | 针对ras蛋白的靶标接合测定法 |
| US20240252689A1 (en) * | 2021-05-18 | 2024-08-01 | The Board Of Regents Of The University Of Texas System | Poly-adp ribose (par) tracker optimized split-protein reassembly par detection reagents |
| EP4519426A2 (en) | 2022-05-04 | 2025-03-12 | Promega Corporation | Split modified dehalogenase variants |
| US20240060059A1 (en) | 2022-05-04 | 2024-02-22 | Promega Corporation | Circularly permuted dehalogenase variants |
| JP2025515181A (ja) | 2022-05-04 | 2025-05-13 | プロメガ コーポレイション | 伸長表面ループ領域を有する修飾デハロゲナーゼ |
| WO2023215497A1 (en) | 2022-05-04 | 2023-11-09 | Promega Corporation | Photoactivatable compounds and uses thereof |
| WO2024151471A1 (en) * | 2023-01-09 | 2024-07-18 | The United States Of America, As Represented By The Secretary, Department Of Health And Human Services | High-throughput assay based on ligand-biased structural dynamics response |
| EP4700040A1 (en) * | 2023-04-21 | 2026-02-25 | Shenzhen Loggene Life Science & Technology Co., Ltd. | Peptide and luminescent complex containing same |
| AU2024265176A1 (en) * | 2023-05-04 | 2025-12-11 | Promega Corporation | Complementation-based tags and reporters for dual-modality labeling |
| WO2025064581A1 (en) * | 2023-09-18 | 2025-03-27 | The Brigham And Women’S Hospital, Inc. | Biosensor platform for the rapid detection of analytes |
| WO2025158412A1 (en) | 2024-01-26 | 2025-07-31 | Biohaven Therapeutics Ltd. | BIFUNCTIONAL DEGRADERS OF IgG4 IMMUNOGLOBULINS |
| WO2026008850A1 (en) | 2024-07-04 | 2026-01-08 | Insempra Gmbh | Linear nucleic acid templates for high-efficient cell-free protein expression |
| WO2026008852A2 (en) | 2024-07-04 | 2026-01-08 | Insempra Gmbh | Optimized media for highly efficient cell-free protein expression systems |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP1156103A2 (en) | 2000-04-26 | 2001-11-21 | Chisso Corporation | Oplophorus luciferase |
| US20090170069A1 (en) * | 2007-11-01 | 2009-07-02 | The Arizona Board Of Regents On Behalf Of The University Of Arizona | Cell free methods for detecting protein-ligand binding |
| US20120117667A1 (en) * | 2010-11-02 | 2012-05-10 | Klaubert Dieter H | Novel coelenterazine substrates and methods of use |
| WO2014093677A1 (en) | 2012-12-12 | 2014-06-19 | Promega Corporation | Recognition of cellular target binding by a bioactive agent using intracellular bioluminescence resonance energy transfer |
Family Cites Families (25)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4444879A (en) * | 1981-01-29 | 1984-04-24 | Science Research Center, Inc. | Immunoassay with article having support film and immunological counterpart of analyte |
| US5914095A (en) | 1989-04-07 | 1999-06-22 | Salutar, Inc. | Polychelants containg amide bonds |
| WO1994009056A1 (en) | 1992-10-14 | 1994-04-28 | Sterling Winthrop Inc. | Chelating polymers |
| US5756688A (en) | 1992-10-14 | 1998-05-26 | Sterling Winthrop Inc. | MR imaging compositions and methods |
| GB9503969D0 (en) | 1995-02-28 | 1995-04-19 | Sams Bernard | Incrementing mechanism |
| CA2196496A1 (en) | 1997-01-31 | 1998-07-31 | Stephen William Watson Michnick | Protein fragment complementation assay for the detection of protein-protein interactions |
| US5879739A (en) | 1997-02-20 | 1999-03-09 | Tower Semiconductor Ltd. | Batch process for forming metal plugs in a dielectric layer of a semiconductor wafer |
| JP4613441B2 (ja) * | 2000-04-26 | 2011-01-19 | チッソ株式会社 | 新規ルシフェラーゼおよび発光蛋白質 |
| US20040181830A1 (en) | 2001-05-07 | 2004-09-16 | Kovalic David K. | Nucleic acid molecules and other molecules associated with plants and uses thereof for plant improvement |
| US7008642B1 (en) | 2001-02-12 | 2006-03-07 | Advanced Cardiovascular Systems, Inc. | Compositions for achieving a therapeutic effect in an anatomical structure and methods of using the same |
| US7195884B2 (en) | 2002-07-19 | 2007-03-27 | Promega Corp. | Methods and kits for transferases |
| US20040115814A1 (en) * | 2002-09-30 | 2004-06-17 | Protein Design Labs, Inc. | Efficient generation of stable expression cell lines through the use of scorable homeostatic reporter genes |
| US7237811B1 (en) * | 2005-04-20 | 2007-07-03 | Lawrence Barry G | Casement window latch assembly |
| EP1931787A4 (en) | 2005-09-30 | 2010-10-20 | Univ Montana State | SYSTEM FOR DETECTING PROTEIN-PROTEIN INTERACTIONS |
| US7601517B2 (en) | 2006-01-10 | 2009-10-13 | Stanford University | Split protein self complementing fragments, systems, and methods of use thereof |
| US20130332133A1 (en) | 2006-05-11 | 2013-12-12 | Ramot At Tel Aviv University Ltd. | Classification of Protein Sequences and Uses of Classified Proteins |
| US20090075313A1 (en) | 2007-05-04 | 2009-03-19 | Stanford University | Split protein fragments, split protein systems, methods of making split protein systems, and methods of using split protein systems |
| JP5554713B2 (ja) * | 2007-11-15 | 2014-07-23 | エンドサイト,インク. | 接合体を投与する方法 |
| GB2479847B (en) | 2009-02-09 | 2014-02-19 | Jnc Corp | Coelenterazine analogs and manufacturing method thereof |
| WO2010119721A1 (ja) | 2009-04-17 | 2010-10-21 | 独立行政法人産業技術総合研究所 | 超高輝度で安定な人工生物発光酵素 |
| LT3409764T (lt) | 2009-05-01 | 2020-06-10 | Promega Corporation | Sintetinės oplophorus liuciferazės su sustiprinta šviesos išeiga |
| EP4012714A1 (en) | 2010-03-23 | 2022-06-15 | Iogenetics, LLC. | Bioinformatic processes for determination of peptide binding |
| US20150125438A1 (en) * | 2012-07-20 | 2015-05-07 | Sang Jae Kim | Anti-Inflammatory Peptides and Composition Comprising the Same |
| SG11201507306VA (en) | 2013-03-15 | 2015-10-29 | Promega Corp | Activation of bioluminescence by structural complementation |
| EP4219736A1 (en) * | 2014-09-12 | 2023-08-02 | Promega Corporation | Internal protein tags |
-
2014
- 2014-03-13 SG SG11201507306VA patent/SG11201507306VA/en unknown
- 2014-03-13 IL IL286816A patent/IL286816B/en unknown
- 2014-03-13 US US14/209,546 patent/US9797889B2/en active Active
- 2014-03-13 PL PL20197758.4T patent/PL3783011T3/pl unknown
- 2014-03-13 ES ES14769752T patent/ES2926463T3/es active Active
- 2014-03-13 KR KR1020217008951A patent/KR102675860B1/ko active Active
- 2014-03-13 SG SG10201601929YA patent/SG10201601929YA/en unknown
- 2014-03-13 PT PT147697528T patent/PT2970412T/pt unknown
- 2014-03-13 CA CA3249512A patent/CA3249512A1/en active Pending
- 2014-03-13 CN CN202310649630.0A patent/CN117024548A/zh active Pending
- 2014-03-13 EP EP22196592.4A patent/EP4169935A1/en active Pending
- 2014-03-13 US US14/209,610 patent/US9797890B2/en active Active
- 2014-03-13 CN CN201480015213.XA patent/CN105143249A/zh active Pending
- 2014-03-13 KR KR1020157024687A patent/KR20150129721A/ko not_active Ceased
- 2014-03-13 KR KR1020237017712A patent/KR20230079494A/ko not_active Ceased
- 2014-03-13 EP EP14769752.8A patent/EP2970412B1/en active Active
- 2014-03-13 PL PL14769752.8T patent/PL2970412T3/pl unknown
- 2014-03-13 AU AU2014236949A patent/AU2014236949C1/en active Active
- 2014-03-13 PT PT201977584T patent/PT3783011T/pt unknown
- 2014-03-13 BR BR112015023394A patent/BR112015023394B8/pt active IP Right Grant
- 2014-03-13 EP EP22182344.6A patent/EP4177261A1/en active Pending
- 2014-03-13 EP EP20197758.4A patent/EP3783011B1/en active Active
- 2014-03-13 DK DK14769752.8T patent/DK2970412T5/da active
- 2014-03-13 CA CA2906063A patent/CA2906063C/en active Active
- 2014-03-13 ES ES20197758T patent/ES2929362T3/es active Active
- 2014-03-13 CA CA3254603A patent/CA3254603A1/en active Pending
- 2014-03-13 DK DK20197758.4T patent/DK3783011T5/da active
- 2014-03-13 WO PCT/US2014/026354 patent/WO2014151736A1/en not_active Ceased
- 2014-03-13 JP JP2016502113A patent/JP6654557B2/ja active Active
-
2015
- 2015-09-01 IL IL240985A patent/IL240985B/en active IP Right Grant
-
2016
- 2016-03-17 US US15/073,249 patent/US9869670B2/en active Active
-
2017
- 2017-09-27 US US15/717,534 patent/US10107800B2/en active Active
-
2018
- 2018-02-19 US US15/899,219 patent/US10184936B2/en active Active
- 2018-06-29 US US16/023,972 patent/US10288605B2/en active Active
- 2018-07-13 US US16/035,117 patent/US10648971B2/en active Active
- 2018-10-31 AU AU2018256548A patent/AU2018256548B2/en active Active
-
2020
- 2020-01-30 JP JP2020013133A patent/JP7280842B2/ja active Active
- 2020-04-16 IL IL273989A patent/IL273989B/en unknown
- 2020-04-17 US US16/851,841 patent/US11493504B2/en active Active
- 2020-08-04 AU AU2020213288A patent/AU2020213288B2/en active Active
-
2022
- 2022-11-07 US US18/053,273 patent/US12367513B2/en active Active
-
2023
- 2023-01-13 JP JP2023004036A patent/JP7532562B2/ja active Active
-
2024
- 2024-07-31 JP JP2024124929A patent/JP7843318B2/ja active Active
- 2024-09-19 US US18/890,453 patent/US12366572B2/en active Active
- 2024-09-23 US US18/893,549 patent/US20250045806A1/en active Pending
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP1156103A2 (en) | 2000-04-26 | 2001-11-21 | Chisso Corporation | Oplophorus luciferase |
| US20090170069A1 (en) * | 2007-11-01 | 2009-07-02 | The Arizona Board Of Regents On Behalf Of The University Of Arizona | Cell free methods for detecting protein-ligand binding |
| US20120117667A1 (en) * | 2010-11-02 | 2012-05-10 | Klaubert Dieter H | Novel coelenterazine substrates and methods of use |
| US20120174242A1 (en) | 2010-11-02 | 2012-07-05 | Brock Binkowski | Oplophorus-derived luciferases, novel coelenterazine substrates, and methods of use |
| WO2014093677A1 (en) | 2012-12-12 | 2014-06-19 | Promega Corporation | Recognition of cellular target binding by a bioactive agent using intracellular bioluminescence resonance energy transfer |
Non-Patent Citations (5)
| Title |
|---|
| HALL ET AL., ACS CHEM. BIOL., vol. 7, 2012 |
| HALL ET AL.: "Engineered Luciferase Reporter from a Deep Sea Shrimp Utilizing a Novel Imidazopyrazinone Substrate", ACS CHEM. BIOL., vol. 7, 15 August 2012 (2012-08-15), pages 1848 - 1857, XP055256124 * |
| INOUYE ET AL., FEBS LETTERS, vol. 481, no. 1, 2000 |
| KERPPOLA ET AL.: "Complementary Methods for Studies of Protein Interactions in Living Cells", NAT METHODS., vol. 3, no. 12, December 2006 (2006-12-01), pages 969 - 971., XP009102126 * |
| MIE ET AL., THE ANALYST, vol. 137, no. 5, 7 March 2012 (2012-03-07), pages 1085 - 9 |
Cited By (36)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US12367513B2 (en) | 2013-03-15 | 2025-07-22 | Promega Corporation | Activation of bioluminescence by structural complementation |
| US9797890B2 (en) | 2013-03-15 | 2017-10-24 | Promega Corporation | Activation of bioluminescence by structural complementation |
| US9869670B2 (en) | 2013-03-15 | 2018-01-16 | Promega Corporation | Activation of bioluminescence by structural complementation |
| US12366572B2 (en) | 2013-03-15 | 2025-07-22 | Promega Corporation | Activation of bioluminescence by structural complementation |
| US10107800B2 (en) | 2013-03-15 | 2018-10-23 | Promega Corporation | Activation of bioluminescence by structural complementation |
| US10184936B2 (en) | 2013-03-15 | 2019-01-22 | Promega Corporation | Activation of bioluminescence by structural complementation |
| US10288605B2 (en) | 2013-03-15 | 2019-05-14 | Promega Corporation | Activation of bioluminescence by structural complementation |
| US11493504B2 (en) | 2013-03-15 | 2022-11-08 | Promega Corporation | Activation of bioluminescene by structural complementation |
| US9797889B2 (en) | 2013-03-15 | 2017-10-24 | Promega Corporation | Activation of bioluminescence by structural complementation |
| US10648971B2 (en) | 2013-03-15 | 2020-05-12 | Promega Corporation | Activation of bioluminescence by structural complementation |
| EP4219736A1 (en) * | 2014-09-12 | 2023-08-02 | Promega Corporation | Internal protein tags |
| US10571471B2 (en) | 2015-02-05 | 2020-02-25 | Promega Corporation | Luciferase-based thermal shift assays |
| EP3254113A4 (en) * | 2015-02-05 | 2018-06-27 | Promega Corporation | Luciferase-based thermal shift assays |
| EP4455668A3 (en) * | 2015-02-05 | 2025-02-19 | Promega Corporation | Luciferase-based thermal shift assays |
| US10928400B2 (en) | 2015-02-05 | 2021-02-23 | Promega Corporation | Luciferase-based thermal shift assays |
| US11899021B2 (en) | 2015-02-05 | 2024-02-13 | Promega Corporation | Luciferase-based thermal shift assays |
| US11567083B2 (en) | 2015-02-05 | 2023-01-31 | Promega Corporation | Luciferase-based thermal shift assays |
| US10634680B2 (en) | 2016-04-26 | 2020-04-28 | University Of Utah Research Foundation | Target-binding activated split reporter systems for analyte detection and related components and methods |
| US12253523B2 (en) | 2016-04-26 | 2025-03-18 | University Of Utah Research Foundation | Target-binding activated split reporter systems for analyte detection and related components and methods |
| US11774453B2 (en) | 2016-04-26 | 2023-10-03 | University Of Utah Research Foundation | Target-binding activated split reporter systems for analyte detection and related components and methods |
| US11788069B2 (en) | 2016-10-20 | 2023-10-17 | President And Fellows Of Harvard College | In vitro and cell based assays for measuring the activity of botulinum neurotoxins |
| US20210215682A1 (en) * | 2018-02-26 | 2021-07-15 | Technische Universiteit Eindhoven | Bioluminescent biosensor for detecting and quantifying biomolecules |
| CN112567028A (zh) * | 2018-06-12 | 2021-03-26 | 普洛麦格公司 | 多部分萤光素酶 |
| EP3807419A4 (en) * | 2018-06-12 | 2022-09-07 | Promega Corporation | MULTIPLE LUCIFERASE |
| WO2020072775A2 (en) | 2018-10-03 | 2020-04-09 | Promega Corporation | Compositions and methods for stabilizing coelenterazine and analogs and derivatives thereof |
| US11534504B2 (en) | 2018-10-03 | 2022-12-27 | Promega Corporation | Compositions and methods for stabilizing coelenterazine and analogs and derivatives thereof |
| EP4015644A1 (en) | 2018-10-03 | 2022-06-22 | Promega Corporation | Compositions and methods for stabilizing coelenterazine and analogs and derivatives thereof |
| WO2020113036A3 (en) * | 2018-11-28 | 2020-07-16 | Promega Corporation | Reactive peptide labeling |
| WO2020113036A2 (en) | 2018-11-28 | 2020-06-04 | Promega Corporation | Reactive peptide labeling |
| US11175228B2 (en) | 2018-11-28 | 2021-11-16 | Promega Corporation | Reactive peptide labeling |
| US11913944B2 (en) | 2019-03-20 | 2024-02-27 | Promega Corporation | Photoaffinity probes |
| EP3953374A4 (en) * | 2019-04-10 | 2023-06-07 | Promega Corporation | COMPOSITIONS AND METHODS FOR DETECTION OF ANALYTES USING BIOLUMINESCENCE |
| AU2020272037B2 (en) * | 2019-04-10 | 2025-11-27 | Promega Corporation | Compositions and methods for analyte detection using bioluminescence |
| US12061202B2 (en) | 2019-12-10 | 2024-08-13 | Promega Corporation | Compositions and methods for bioluminescent detection using multifunctional probes |
| WO2021194343A1 (en) | 2020-03-25 | 2021-09-30 | Erasmus University Medical Center Rotterdam | Reporter system for radionuclide imaging |
| US12606863B2 (en) | 2021-05-13 | 2026-04-21 | Promega Corporation | Bioluminescent detection of DNA synthesis |
Also Published As
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US12366572B2 (en) | Activation of bioluminescence by structural complementation |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| WWE | Wipo information: entry into national phase |
Ref document number: 201480015213.X Country of ref document: CN |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 14769752 Country of ref document: EP Kind code of ref document: A1 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 240985 Country of ref document: IL |
|
| ENP | Entry into the national phase |
Ref document number: 20157024687 Country of ref document: KR Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 2906063 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2014769752 Country of ref document: EP |
|
| ENP | Entry into the national phase |
Ref document number: 2016502113 Country of ref document: JP Kind code of ref document: A |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 2014236949 Country of ref document: AU Date of ref document: 20140313 Kind code of ref document: A |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01A Ref document number: 112015023394 Country of ref document: BR |
|
| ENP | Entry into the national phase |
Ref document number: 112015023394 Country of ref document: BR Kind code of ref document: A2 Effective date: 20150914 |