WO2014125374A2 - Highly galactosylated anti-tnf-alpha antibodies and uses thereof - Google Patents

Highly galactosylated anti-tnf-alpha antibodies and uses thereof Download PDF

Info

Publication number
WO2014125374A2
WO2014125374A2 PCT/IB2014/000692 IB2014000692W WO2014125374A2 WO 2014125374 A2 WO2014125374 A2 WO 2014125374A2 IB 2014000692 W IB2014000692 W IB 2014000692W WO 2014125374 A2 WO2014125374 A2 WO 2014125374A2
Authority
WO
WIPO (PCT)
Prior art keywords
antibodies
antibody
population
composition
produced
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/IB2014/000692
Other languages
English (en)
French (fr)
Other versions
WO2014125374A3 (en
Inventor
Harry M. Meade
Li-How Chen
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
LFB SA
Original Assignee
LFB SA
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to CN201480020371.4A priority Critical patent/CN105308068A/zh
Priority to CA2900909A priority patent/CA2900909A1/en
Priority to EP19194946.0A priority patent/EP3594231A1/en
Priority to JP2015557532A priority patent/JP2016508515A/ja
Priority to EP19194945.2A priority patent/EP3594230A1/en
Priority to MX2015010427A priority patent/MX2015010427A/es
Priority to BR112015019341A priority patent/BR112015019341A2/pt
Priority to EP14731999.0A priority patent/EP2956480B1/en
Priority to AU2014217561A priority patent/AU2014217561B2/en
Priority to ES14731999T priority patent/ES2755181T3/es
Priority to KR1020157025005A priority patent/KR20160002713A/ko
Priority to US14/767,117 priority patent/US10174110B2/en
Application filed by LFB SA filed Critical LFB SA
Publication of WO2014125374A2 publication Critical patent/WO2014125374A2/en
Publication of WO2014125374A3 publication Critical patent/WO2014125374A3/en
Priority to IL240443A priority patent/IL240443A0/en
Anticipated expiration legal-status Critical
Priority to US16/192,273 priority patent/US20190309058A1/en
Priority to US16/192,214 priority patent/US20190309057A1/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/24Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against cytokines, lymphokines or interferons
    • C07K16/241Tumor Necrosis Factors
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/395Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
    • A61K39/39508Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum from milk, i.e. lactoglobulins
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/395Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
    • A61K39/39533Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals
    • A61K39/3955Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals against proteinaceous materials, e.g. enzymes, hormones, lymphokines
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/04Drugs for disorders of the alimentary tract or the digestive system for ulcers, gastritis or reflux esophagitis, e.g. antacids, inhibitors of acid secretion, mucosal protectants
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/16Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00Drugs for dermatological disorders
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00Drugs for dermatological disorders
    • A61P17/06Antipsoriatics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00Drugs for skeletal disorders
    • A61P19/02Drugs for skeletal disorders for joint disorders, e.g. arthritis, arthrosis
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • A61P37/02Immunomodulators
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/04Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies from milk
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2803Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily
    • C07K16/283Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily against Fc-receptors, e.g. CD16, CD32, CD64
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/10Immunoglobulins specific features characterized by their source of isolation or production
    • C07K2317/12Immunoglobulins specific features characterized by their source of isolation or production isolated from milk
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/20Immunoglobulins specific features characterized by taxonomic origin
    • C07K2317/21Immunoglobulins specific features characterized by taxonomic origin from primates, e.g. man
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/40Immunoglobulins specific features characterized by post-translational modification
    • C07K2317/41Glycosylation, sialylation, or fucosylation
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/70Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/73Inducing cell death, e.g. apoptosis, necrosis or inhibition of cell proliferation
    • C07K2317/732Antibody-dependent cellular cytotoxicity [ADCC]
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/70Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/73Inducing cell death, e.g. apoptosis, necrosis or inhibition of cell proliferation
    • C07K2317/734Complement-dependent cytotoxicity [CDC]
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/70Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/76Antagonist effect on antigen, e.g. neutralization or inhibition of binding
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/90Immunoglobulins specific features characterized by (pharmaco)kinetic aspects or by stability of the immunoglobulin
    • C07K2317/92Affinity (KD), association rate (Ka), dissociation rate (Kd) or EC50 value

Definitions

  • the present invention relates in part to anti-TNF-alpha antibodies.
  • TNF-alpha is a pro -inflammatory cytokine, which plays a protective role against infection and injury in normal immune responses.
  • chronically elevated levels of TNF-alpha have been associated with pathogenesis of many autoimmune and inflammatory diseases.
  • a number of TNF-alpha binding therapeutics have been approved for treatment of autoimmune and inflammatory diseases including rheumatoid arthritis, psoriasis, Crohn's disease, ankylating spondylitis and ulcerative colitis.
  • Available therapeutic TNF-alpha binders include antibodies such as infliximab / Remicade (Centocor) a mouse-human chimeric monoclonal anti TNF-antibody, adalimumab / Humira (Abbott) a fully human anti- TNF antibody, and golimumab / Simponi (Centocor) a fully human anti-TNF antibody.
  • infliximab / Remicade Centocor
  • adalimumab / Humira Abbott
  • golimumab / Simponi Centocor
  • Therapeutic TNF-alpha binders that are antibody-based include Etanercept / Enbrel (Amgen) a fusion protein of the extracellular domain of TNF-receptor fused to the Fc region of Igl, and certolizumab pegol / Cimzia (UCB) a Pegylated Fab' fragment of humanized monoclonal anti-TNF antibody.
  • Amgen Etanercept / Enbrel
  • UMB certolizumab pegol / Cimzia
  • the therapeutic efficacy of the antibodies and antibody-based TNF-alpha binders varies based on the targeted pathology. In addition, many of the anti-TNF-alpha therapeutics show undesired side effects. Anti-TNF alpha antibodies with improved therapeutic properties are desired therefore.
  • the disclosure relates to highly galactosylated anti-TNF-alpha antibodies and compositions thereof. In one aspect, the disclosure relates to populations of anti-TNF-alpha antibodies with a high level of galactosylation, and compositions thereof. In one aspect, the disclosure relates to methods of production and use of highly galactosylated anti-TNF-alpha antibodies and populations of anti-TNF-alpha antibodies with a high level of galactosylation.
  • the disclosure provides an anti-TNF-alpha antibody, wherein the antibody is highly galactosylated. In some embodiments, the antibody is highly fucosylated. In some embodiments, the antibody comprises mono-galactosylated N-glycans. In some embodiments, the antibody comprises bi-galactosylated N-glycans. In some embodiments, the heavy chain of the antibody comprises SEQ ID NO: l, and the light chain of the antibody comprises SEQ ID NO:2. In some embodiments, the antibody is adalimumab. In some embodiments, the antibody is produced in mammary epithelial cells of a non-human mammal. In some embodiments, the antibody is produced in a transgenic non-human mammal. In some embodiments, the non-human mammal is a goat, sheep, bison, camel, cow, pig, rabbit, buffalo, horse, rat, mouse or llama. In some embodiments, the non-human mammal is a goat.
  • compositions of any of the antibodies disclosed herein wherein the composition further comprises milk.
  • the composition further comprises a pharmaceutically- acceptable carrier.
  • the disclosure provides a composition, comprising a population of antibodies, wherein the antibody is an anti-TNF-alpha antibody, and wherein the level of galactosylation of the antibodies in the population is at least 60%. In some embodiments, the level of galactosylation of the antibodies in the population is at least 70%. In some embodiments, the level of galactosylation of the antibodies in the population is at least 80%. In some embodiments, the level of fucosylation of the antibodies in the population is at least 50%.
  • the level of fucosylation of the antibodies in the population is at least 60%. In some embodiments of any of the compositions provided herein, the population comprises antibodies that comprise mono-galactosylated N-glycans. In some embodiments of any of the compositions provided herein, the population comprises antibodies that comprise bi-galactosylated N-glycans. In some embodiments of any of the compositions provided herein, the ratio of the level of galactosylation of the antibodies in the population to the level of fucosylation of the antibodies in the population is between 1.0 and 1.4.
  • the antibodies in the population comprise bi-galactosylated N-glycans and at least 25% of the antibodies in the population comprise mono-galactosylated N-glycans.
  • the heavy chain of the antibody comprises SEQ ID NO: l
  • the light chain of the antibody comprises SEQ ID NO:2.
  • the antibody is adalimumab.
  • the antibody is produced in mammary epithelial cells of a non-human mammal. In some embodiments of any of the compositions provided herein, the antibody is produced in a transgenic non-human mammal. In some embodiments, the non-human mammal is a goat, sheep, bison, camel, cow, pig, rabbit, buffalo, horse, rat, mouse or llama. In some embodiments,
  • the non-human mammal is a goat.
  • the composition further comprises milk.
  • the composition further comprises a pharmaceutically- acceptable carrier.
  • the population of antibodies has an increased level of complement dependent cytotoxicity (CDC) activity when compared to a population of antibodies not produced in mammary gland epithelial cells.
  • CDC complement dependent cytotoxicity
  • the population of antibodies has an increased level of antibody-dependent cellular cytotoxicity (ADCC) activity when compared to a population of antibodies not produced in mammary gland epithelial cells.
  • ADCC antibody-dependent cellular cytotoxicity
  • the population of antibodies has an increased ability to suppress TNF-alpha activity in a subject when compared to a population of antibodies not produced in mammary gland epithelial cells.
  • the population of antibodies has an increased ability to bind soluble TNF-alpha when compared to a population of antibodies not produced in mammary gland epithelial cells.
  • the population of antibodies has an increased ability to bind transmembrane TNF-alpha when compared to a population of antibodies not produced in mammary gland epithelial cells.
  • the population of antibodies not produced in mammary gland epithelial cells is produced in cell culture.
  • the level of galactosylation of the antibodies not produced in mammary gland epithelial cells is 50% or lower when compared to the level of galactosylation of the antibodies produced in mammary gland epithelial cells. In some embodiments of any of the compositions provided herein, the level of galactosylation of the antibodies not produced in mammary gland epithelial cells is 30% or lower when compared to the level of galactosylation of the antibodies produced in mammary gland epithelial cells.
  • the level of galactosylation of the antibodies not produced in mammary gland epithelial cells is 10% or lower when compared to the level of galactosylation of the antibodies produced in mammary gland epithelial cells.
  • the disclosure provides a method for producing a population of antibodies, comprising: expressing the population of antibodies in mammary gland epithelial cells of a non-human mammal such that a population of antibodies is produced, wherein the antibody is an anti-TNF-alpha antibody, wherein the level of galactosylation of the antibodies in the population is at least 60%.
  • the mammary gland epithelial cells are in culture and are transfected with a nucleic acid that comprises a sequence that encodes the antibody.
  • the mammary gland epithelial cells are in a non-human mammal engineered to express a nucleic acid that comprises a sequence that encodes the antibody in its mammary gland.
  • the nucleic acid comprises SEQ ID NO:3 and SEQ ID NO:4.
  • the mammary gland epithelial cells are goat, sheep, bison, camel, cow, pig, rabbit, buffalo, horse, rat, mouse or llama mammary gland epithelial cells. In some embodiments, the mammary gland epithelial cells are goat mammary gland epithelial cells.
  • the disclosure provides mammary gland epithelial cells that produce any of the antibodies, population of antibodies, or compositions disclosed herein.
  • the disclosure provides a transgenic non-human mammal comprising any of the mammary gland epithelial cells disclosed herein.
  • the disclosure provides a method comprising administering any of the antibodies, population of antibodies, or compositions disclosed herein to a subject in need thereof.
  • the subject has an inflammatory disorder or autoimmune disorder.
  • the inflammatory disorder or autoimmune disorder is rheumatoid arthritis, psoriasis, Crohn's disease, juvenile idiopathic arthritis, ankylozing spondylitis, ulcerative colitis, chronic inflammation, hepatitis, Behcet's disease, Wegener's granulomatosis, or sarcoidosis.
  • the disclosure provides a monoclonal anti-TNF antibody composition
  • a monoclonal anti-TNF antibody composition comprising monoclonal anti-TNF antibodies having glycan structures on the Fc glycosylation sites (Asn297, EU numbering), wherein said glycan structures have a galactose content of more than 60%.
  • the disclosure relates to an anti-TNF-alpha antibody, wherein the antibody contains an oligomannose.
  • the heavy chain of the antibody comprises SEQ ID NO: l
  • the light chain of the antibody comprises SEQ ID NO:2.
  • the antibody is adalimumab.
  • the antibody is produced in mammary epithelial cells of a non- human mammal. In some embodiments, the antibody is produced in a transgenic non-human mammal. In certain embodiments, the non-human mammal is a goat, sheep, bison, camel, cow, pig, rabbit, buffalo, horse, rat, mouse or llama. In certain embodiments, the non-human mammal is a goat.
  • an anti-TNF-alpha antibody that contains an oligomannose further comprising milk.
  • the disclosure relates to a composition
  • a composition comprising an anti-TNF-alpha antibody that contains an oligomannose, further comprising a pharmaceutically- acceptable carrier.
  • the disclosure relates to a composition, comprising: a population of antibodies, wherein the antibody is an anti-TNF-alpha antibody, and wherein the at least 30% of the antibodies contain at least one oligomannose.
  • the antibodies exhibit a high mannose glycosylation pattern.
  • at least one chain of the milk-derived antibodies contains an oligomannose and is non-fucosylated.
  • the major carbohydrate of the milk-derived antibodies is non-fucosylated.
  • the heavy chain of the antibody within the composition comprises SEQ ID NO: l
  • the light chain of the antibody comprises SEQ ID NO:2.
  • the antibody is adalimumab.
  • the antibody is produced in mammary epithelial cells of a non-human mammal.
  • the antibody is produced in a transgenic non-human mammal.
  • the non- human mammal is a goat, sheep, bison, camel, cow, pig, rabbit, buffalo, horse, rat, mouse or llama.
  • the non-human mammal is a goat.
  • the composition further comprises milk. In some embodiments, the composition further comprises milk.
  • the composition further comprises a pharmaceutically-acceptable carrier.
  • the population of antibodies within the composition has an increased level of complement dependent cytotoxicity (CDC) activity when compared to a population of antibodies not produced in mammary gland epithelial cells.
  • CDC complement dependent cytotoxicity
  • the population of antibodies within the composition has an increased level of antibody-dependent cellular cytotoxicity (ADCC) activity when compared to a population of antibodies not produced in mammary gland epithelial cells.
  • ADCC antibody-dependent cellular cytotoxicity
  • the population of antibodies not produced in mammary gland epithelial cells is produced in cell culture.
  • an antibody contains an oligomannose
  • oligomannose is Man5.
  • an antibody contains an
  • the oligomannose is Man6. In some embodiments wherein an antibody contains an oligomannose, the oligomannose is Man7. In some embodiments wherein a composition comprises an antibody that contains an oligomannose, the oligomannose is Man5. In some embodiments wherein a composition comprises an antibody that contains an oligomannose, the oligomannose is Man6. In some embodiments wherein a composition comprises an antibody that contains an oligomannose, the oligomannose is Man7.
  • Fig. 1 shows a representative oligosaccharide signature of N-glycans of a population of highly galactosylated adalimumab antibodies from goat #1.
  • Fig. 2 shows an oligosaccharide signature of N-glycans of a population of highly galactosylated adalimumab antibodies from goat #1 at day 7 of lactation.
  • Fig. 3 shows an oligosaccharide signature of N-glycans of a population of highly galactosylated adalimumab antibodies from goat #1 at day 17 of lactation.
  • Fig. 4 shows an oligosaccharide signature of N-glycans of a population of highly galactosylated adalimumab antibodies from goat #1 at day 32 of lactation.
  • Fig. 5 shows a summary of the percentages of N-glycan oligosaccharides of populations of a highly galactosylated adalimumab antibodies from goat #1 at various days of lactation.
  • Fig. 6 shows an oligosaccharide signature of N-glycans of a population of highly galactosylated adalimumab antibodies from goat #2 at day 3 of hormone induced lactation.
  • Fig. 7 shows an oligosaccharide signature of N-glycans of a population of highly galactosylated adalimumab antibodies from goat #2 at day 11 of hormone induced lactation.
  • Fig. 8 shows an oligosaccharide signature of N-glycans of a population of highly galactosylated adalimumab antibodies from goat #2 at day 21 of hormone induced lactation.
  • Fig. 9 shows a summary of the percentages of N-glycan oligosaccharides of populations of a highly galactosylated adalimumab antibodies from goat #2 at various days of hormone induced lactation.
  • Fig. 10 shows that a transgenically produced adalimumab antibody binds soluble TNF-alpha.
  • Fig. 11 shows that a transgenically produced adalimumab antibody binds to CD 16 expressed on NK cells as shown by a competition assay with the anti-CD 16 antibody 3G8.
  • Fig. 12 shows that a transgenically produced adalimumab antibody binds both soluble TNF-alpha and Jurkat expressing CD 16 cells while an aglycosylated version of the transgenically produced adalimumab antibody does not.
  • Fig. 13 shows a summary of predominant glycan forms present in populations of transgenically produced adalimumab antibodies from nine different goats #1-9.
  • Fig. 14 shows a summary of the percentages of N-glycan oligosaccharides of populations of transgenically produced adalimumab antibodies from goat # 10 and goat # 1 during hormone induced lactation.
  • Fig. 15 shows a summary of N-glycan oligosaccharides of populations of
  • Fig. 16 shows antigenic recognition of transgenically produced adalimumab ("TG- adalimumab”) and Humira antibodies on membrane TNF-cc transfected Jurkat cells clone 2B3.
  • the results shown are expressed as MFI and derived from an average of 3 experiments. Mean + / - SEM.
  • Fig. 17 shows binding of anti-TNF-cc antibodies on CD 16 expressed by NK cells in a competition assay.
  • the mean fluorescence values (MFI) observed are expressed as the percent binding, where 100% is an arbitrary value corresponding to maximum 3G8 binding observed without the tested antibodies and 0% corresponds to the MFI in the absence of the antibody 3G8.
  • Fig. 18 shows binding of anti-TNF-cc antibodies on FcRn expressed by FcRn- transfected Jurkat cells in a competition assay with Alexa 488 coupled-Rituximab antibody.
  • the mean fluorescence values (MFI) observed are expressed as the percent binding (100% is an arbitrary value corresponding to maximum Rituximab-A488 binding alone), as a function of attested antibody concentration. Mean of 3 experiments + / - SEM.
  • Fig. 19 shows CDC activity of the anti TNF-cc antibodies on membrane TNF-cc transfected Jurkat cells clone 2B3 (mean of 4 assays). Results are expressed as percent of lysis of mbTNF-cc Jurkat cells as a function of antibody concentration. Mean +/- SEM.
  • Fig. 20 shows neutralization of TNF-cc-mediated cytotoxicity in L929 cells by anti- TNF-cc antibodies. Results are expressed as percent of neutralization as a function of antibody concentration. Mean of 4 assays +/- SEM.
  • Fig. 21 shows percent lysis (in arbitrary units) mediated by transgenically produced adalimumab compared to Humira.
  • Fig. 22 presents an inhibition curve showing CD 16 binding activity of transgenically produced adalimumab from nine different goats compared to Humira.
  • Fig. 23 presents IC50 values associated with CD 16 binding activity of transgenically produced adalimumab from nine different goats and Humira as assessed by a competitive assay using NK cells.
  • Fig. 24 shows CDC activity of transgenically produced adalimumab from nine different goats compared to Humira.
  • Fig. 25 shows EC50 values (ng/ml) associated with CDC activity of transgenically produced adalimumab from nine different goats compared to Humira.
  • the disclosure provides anti-TNF-alpha antibodies wherein the antibody is highly galactosylated.
  • Anti-TNF-alpha antibodies bind TNF-alpha and have been used as a therapeutic in a variety of diseases characterized by dysregulation of TNF-alpha, including inflammatory disorders.
  • the anti-TNF-alpha antibody that is highly galactosylated is infliximab / Remicade (Centocor), adalimumab / Humira (Abbott), or golimumab / Simponi (Centocor).
  • the anti-TNF-alpha antibody that is highly galactosylated is adalimumab.
  • the anti-TNF-alpha antibody that is highly galactosylated includes a heavy chain which comprises SEQ ID NO: l. In some embodiments, the anti-TNF- alpha antibody that is highly galactosylated includes a light chain which comprises SEQ ID NO:2. In some embodiments, the anti-TNF-alpha antibody that is highly galactosylated includes a heavy chain which comprises SEQ ID NO: 1 and a light chain which comprises SEQ ID NO:2. In some embodiments, the anti-TNF-alpha antibody that is highly galactosylated includes a heavy chain which comprises SEQ ID NO: 1 and a light chain which comprises SEQ ID NO:2. In some embodiments, the anti-TNF-alpha antibody that is highly
  • the anti-TNF-alpha antibody that is highly galactosylated includes a heavy chain which consists of SEQ ID NO: l.
  • the anti-TNF-alpha antibody that is highly galactosylated includes a light chain that consists of SEQ ID NO:2.
  • the anti-TNF-alpha antibody that is highly galactosylated includes a heavy chain which consists of SEQ ID NO: 1 and a light chain that consists of SEQ ID NO:2.
  • the anti-TNF-alpha antibody that is highly galactosylated is adalimumab.
  • the heavy chain of adalimumab is provided in SEQ ID NO: l:
  • the light chain of adalimumab is provided in SEQ ID NO:2:
  • sequences are based on the sequences of adalimumab published in US Patent 6,090,382. In some embodiments, the sequences of adalimumab are those as published in US Patent 6,090,382.
  • the disclosure also includes antibodies that are based on the sequence of adalimumab but that include mutations that provide the antibodies with additional beneficial desired properties related to
  • the disclosure provides highly galactosylated anti-TNF-alpha antibodies that can be used in anti-inflammatory treatment.
  • the anti-TNF-alpha antibody that is highly galactosylated is infliximab / Remicade (Centocor), adalimumab / Humira (Abbott), or golimumab / Simponi (Centocor).
  • the anti-TNF- alpha antibody is adalimumab.
  • the anti-TNF-alpha antibodies can be used in the treatment of inflammatory disorders and the treatment of autoimmune diseases.
  • the highly galactosylated anti-TNF- alpha antibodies are surprisingly effective in their anti-inflammatory activity because of their enhanced ADCC and CDC activities (as compared to non-highly galactosylated antibodies).
  • the highly galactosylated antibodies anti-TNF-alpha disclosed herein may include additional modifications to further increase their anti-inflammatory activity.
  • Anti-inflammatory activity of intravenous administered Ig can result from a subset of the IgG molecules that have terminal alpha-2,6- sialic acid linkages on their Fc-linked glycans.
  • the anti-inflammatory activity of a population of the intravenous administered Ig was increased by introducing a terminal alpha-2,6-sialic acid linkage on all Fc-linked glycans (See e.g., Anthony et al., Identification of a receptor required for the anti-inflammatory activity of IVIG, PNAS 105: 19571-19578, 2008).
  • the disclosure provides highly galactosylated anti-TNF-alpha antibodies that also have 2,6 sialylated Fc glycans.
  • the sialylation of the galactosylated anti-TNF alpha antibodies is believed to synergistically increase the anti-inflammatory action of the highly galactosylated anti-TNF-alpha antibodies.
  • the highly galactosylated anti-TNF-alpha antibodies disclosed herein are generated by producing the antibody in a transgenic mammal or mammary epithelial cells.
  • highly galactosylated anti-TNF-alpha antibodies generated by in a transgenic mammal or mammary epithelial cells are not fully sialylated.
  • the sialylation levels of such antibodies can be increased for instance by subjecting the antibodies to sialyl transferases.
  • the antibodies can be subjected to sialyl transferases in vitro or in vivo.
  • Highly galactosylated anti-TNF-alpha antibodies can be sialylated in vitro by subjecting the purified or partially antibody to a sialyl transferase and the appropriate saccharide based substrate.
  • Highly galactosylated anti-TNF-alpha antibodies can be sialylated in vivo by producing a sialyl transferase in the mammary gland or mammary epithelial cells.
  • the disclosure provides methods for the production in the mammary gland of transgenic animals and mammary epithelial cells of highly galactosylated anti-TNF- alpha antibodies, with increased levels of alpha-2,6-sialylation.
  • the methods provided herein allow for the production in the mammary gland of transgenic animals and mammary epithelial cells of highly galactosylated anti-TNF-alpha antibodies with increased antiinflammatory properties.
  • the disclosure provides transgenic animals (and mammary epithelial cells) that are transgenic for the production in the mammary gland of anti-TNF-alpha antibodies and that are transgenic for the production of sialyl transferase.
  • the therapeutic antibodies produced by such animals and cells are expected to be highly galactosylated and have increased levels of terminal alpha-2,6-sialic acid linkages on their Fc-linked glycans.
  • the transgenic animals (and mammary epithelial cells) are transgenic for the production in the mammary gland of an exogenous anti-TNF-alpha antibody and are transgenic for the production of sialyl transferase.
  • the anti-TNF-alpha antibody is adalimumab.
  • the disclosure provides methods of treating inflammation or autoimmune disease in a subject comprising administering to a subject the highly
  • galactosylated anti-TNF-alpha antibodies that have increased levels of terminal alpha-2,6- sialic acid linkages on their Fc-linked glycans.
  • the disclosure provides anti-TNF-alpha antibodies wherein the antibody is highly galactosylated. In some embodiments, the disclosure provides anti-TNF-alpha antibodies, wherein the antibody is highly fucosylated. In some embodiments, the disclosure provides anti-TNF-alpha antibodies, wherein the antibody is highly galactosylated and highly fucosylated. In some embodiments, the disclosure provides anti-TNF-alpha antibodies, wherein the antibody is highly galactosylated and highly fucosylated and has terminal sialic acid moieties on the Fc glycans. In some embodiments, the highly galactosylated antibody comprises one or more mono-galactosylated N-glycans. In some embodiments, the highly galactosylated antibody comprises bi-galactosylated N-glycans.
  • the disclosure provides a monoclonal anti-TNF antibody composition
  • a monoclonal anti-TNF antibody composition comprising monoclonal antibodies having on the Fc glycosylation sites (Asn 297, EU numbering) glycan structures, wherein said glycan structures have a galactose content more than 60%.
  • the anti-TNF monoclonal antibodies are purified.
  • the "EU numbering system” or "EU index” is generally used when referring to a residue in an immunoglobulin heavy chain constant region (e.g., the EU index reported in Kabat et al., Sequences of Proteins of Immunological Interest, 5th ed., Public Health Service, National Institutes of Health, Bethesda, MD (1991) expressly incorporated herein by reference).
  • the typical glycosylated residue position in an antibody is the asparagine at position 297 according to the EU numbering system ("Asn297"). It should be appreciated that any of the anti-TNF monoclonal antibodies disclosed herein may be partially or completely purified.
  • Antibodies can be glycosylated with an N-glycan at the Fc-gamma glycosylation site in the heavy chain (Asn297) of the Fc region.
  • antibodies include two heavy chains and each antibody therefore can have two Fc-gamma N-glycans.
  • a variety of glycosylation patterns have been observed at the Fc gamma glycosylation site and the oligosaccharides found at this site include galactose, N-acetylglucosamine (GlcNac), mannose, sialic acid, N-acetylneuraminic acid (NeuAc or NANA), N-glycolylneuraminic (NGNA) and fucose.
  • N-glycans found at the Fc gamma glycosylation site generally have a common core structure consisting of an unbranched chain of a first N-acetylglucosamine (GlcNAc), which is attached to the asparagine of the antibody, a second GlcNAc that is attached to the first GlcNac and a first mannose that is attached to the second GlcNac.
  • GlcNAc N-acetylglucosamine
  • Two additional mannoses are attached to the first mannose of the GlcNAc-GlcNAc-mannose chain to complete the core structure and providing two "arms" for additional glycosylation.
  • fucose residues may be attached to the N-linked first GlcNAc.
  • the two arm core structure is also referred to as the "antenna".
  • the most common type of glycosylation of the "arms" of the N-glycan motifs found in plasma antibodies is of the complex type, i.e., consisting of more than one type of monosaccharide.
  • GlcNAc transferases attach GlcNAc residues to the mannoses of the glycan core, which can be further extended by galactose, sialic acid and fucose residues. This glycosylation motif is called "complex" structure.
  • a second glycosylation motif found on the "arms" of the N-glycan core structure is a "high-mannose” motif, which is characterized by additional mannoses (attached either as branched or unbranded chains).
  • a third glycosylation motif is a hybrid structures in which one of the arms is mannose substituted while the other arm is complex.
  • a “galactosylated” antibody refers to any antibody that has at least one galactose monosaccharide in one of its N-glycans.
  • Galactosylated antibodies include antibodies where the two N-glycans each have complex type motifs on each of the arms of the N-glycan motifs, antibodies where the two N-glycans have a complex type motif on only one of the arms of the N-glycan motifs, antibodies that have one N-glycan with complex type motifs on each of the arms of the N-glycan, and antibodies that have one N-glycan with a complex type motif on only one of the arms of the N-glycan motifs.
  • Antibodies that include at least one galactose monosaccharide include antibodies with N-glycans such as Gl (one galactose), GIF (one galactose, one fucose), G2 (two galactoses) and G2F (two galactoses, one fucose).
  • N-glycans such as Gl (one galactose), GIF (one galactose, one fucose), G2 (two galactoses) and G2F (two galactoses, one fucose).
  • the N-glycan that includes at least one galactose monosaccharide can be sialylated or not sialylated.
  • the N-glycans may also contain additional galactose residues, such as alpha-Gal, in one or more arms of the complex glycan motif, potentially resulting in an N-glycan with four galactose moieties.
  • a “highly galactosylated” antibody refers to an antibody that includes at least two galactose monosaccharides in the N-glycan motifs.
  • Highly galactosylated antibodies include antibodies where the two N-glycans each have complex type motifs on each of the arms of the N-glycan motifs, antibodies where the two N-glycans have a complex type motif on only one of the arms of the N-glycan motifs, and antibodies that have one N- glycan with a complex type motif on each of the arms of the N-glycan.
  • highly galactosylated antibodies include antibodies in which both N-glycans each include one galactose in the glycan motif (e.g., Gl or GIF), antibodies that include at least one N-glycan with two galactoses in the glycan motif (e.g., G2 or G2F), and antibodies with 3 or 4 galactoses in the glycan motif (e.g., (i) one N-glycan with a Gl glycan motif and one N- glycan with a G2 or G2F glycan motif or (ii) two N-glycan with G2 or G2F).
  • the highly galactosylated antibody includes at least three galactose
  • the highly galactosylated antibody includes at least four galactose monosaccharides in the glycan motifs.
  • the glycosylation exhibits a high mannose glycosylation pattern.
  • a "high mannose glycosylation pattern" is intended to refer to an antibody that contains at least one oligomannose or a composition of antibodies wherein at least 30% of the antibodies contain at least one oligomannose. In some embodiments at least 30%, 40%, 50%, 60%, 70%, 80%, 90% or more of the carbohydrates of the antibodies are oligomannose. In some embodiments at least 30%, 40%, 50%, 60%, 70%, 80%, 90% or more of the carbohydrates of the antibodies are non-fucosylated oligomannose. In other embodiments less than 50%, 40%, 30%, 20%, 10%, 5% or fewer of the carbohydrates of the antibodies are fucose-containing.
  • the antibodies are low in fucose and high in oligomannose. Therefore, in further embodiments at least 30%, 40%, 50%, 60%, 70%, 80% or 90% or more of the carbohydrates of the antibodies are oligomannose and less than 50%, 40%, 30%, 20%, 10% or 5% of the carbohydrates of the antibodies are fucose- containing. Therefore, in yet a further embodiment at least 30%, 40%, 50%, 60%, 70%, 80% or 90% or more of the carbohydrates of the antibodies are non-fucosylated oligomannose and less than 50%, 40%, 30%, 20%, 10% or 5% of the carbohydrates of the antibodies are fucose- containing.
  • mannose-containing oligosaccharides range from Man5 to Man9, with the number indicating the number of mannose residues.
  • mannose- containing oligosaccharides can include Man5, Man6, Man7, Man8 and Man9.
  • transgenically produced adalimumab exhibits a high Man6 content, as revealed by goats 2, 4 and 5 described herein.
  • the major carbohydrate in transgenically produced adalimumab is Man5.
  • at least 10%, 15%, or more of the carbohydrates in transgenically produced adalimumab are Man5.
  • At least 20% of the carbohydrates in transgenically produced adalimumab are Man5.
  • the major carbohydrate in transgenically produced adalimumab is Man6.
  • carbohydrates in transgenically produced adalimumab are Man6.
  • at least 20% of the carbohydrates in transgenically produced adalimumab are Man6
  • the major carbohydrate in transgenically produced adalimumab is Man7.
  • at least 10%, 15%, or more of the carbohydrates in transgenically produced adalimumab are Man7.
  • at least 20% of the carbohydrates in transgenically produced adalimumab are Man7.
  • the glycosylation pattern of the N-glycans can be determined by a variety of methods known in the art. For example, methods of analyzing carbohydrates on proteins have been described in U.S. Patent Applications US 2006/0057638 and US 2006/0127950. The methods of analyzing carbohydrates on proteins are incorporated herein by reference.
  • the highly galactosylated antibody is produced in mammary epithelial cells of a non-human mammal.
  • the antibody is produced in a transgenic non-human mammal.
  • the non-human mammal is a goat, sheep, bison, camel, cow, pig, rabbit, buffalo, horse, rat, mouse or llama.
  • the non-human mammal is a goat.
  • the highly glycosylated antibody is produced in cells other than in mammary epithelial cells of a non-human mammal. In some embodiments, the antibody is produced in cells other than in mammary epithelial cells of a non-human mammal and modified after production to increase the number of galactose groups on the N-glycan (e.g., through the action of enzymes such as transferases).
  • the disclosure provides compositions comprising highly galactosylated antibodies.
  • the composition comprising highly galactosylated antibodies further comprises milk. In some embodiments, the composition comprising highly galactosylated antibodies further comprises a pharmaceutically- acceptable carrier.
  • the disclosure provides compositions comprising monoclonal anti-TNF antibody compositions having on the Fc glycosylation sites (Asn 297, EU numbering) glycan structures, wherein said glycan structures of the monoclonal antibodies have a galactose content more than 60%.
  • the composition comprising monoclonal anti- TNF antibody compositions further comprises milk.
  • the composition comprising monoclonal anti-TNF antibody compositions further comprises a
  • the disclosure provides a composition comprising a population of antibodies, wherein the antibody is an anti-TNF- alpha antibody, and wherein the level of galactosylation of the antibodies in the population is at least 60%. In some embodiments, the level of galactosylation of the antibodies in the population is at least 70%. In some embodiments, the level of galactosylation of the antibodies in the population is at least 80%. In some embodiments, the level of fucosylation of the antibodies in the population is at least 50%. In some embodiments, the level of fucosylation of the antibodies in the population is at least 60%. In some embodiments, the population comprises antibodies that comprise mono- galactosylated N-glycans.
  • the population comprises antibodies that comprise bi-galactosylated N-glycans.
  • the ratio of the level of galactosylation of the antibodies in the population to the level of fucosylation of the antibodies in the population is between 1.0 and 1.4.
  • at least 35% of the antibodies in the population comprise bi-galactosylated N-glycans and at least 25% of the antibodies in the population comprise mono-galactosylated N-glycans.
  • the level of sialylation in the antibodies is at least 50%. In some embodiments, the level of sialylation in the antibodies is at least 70%. In some embodiments, the level of sialylation in the antibodies is at least 90%. In some embodiments, the antibodies are fully sialylated.
  • the anti-TNF-alpha antibody of the populations of antibodies with a high level of galactosylation is infliximab / Remicade (Centocor), adalimumab / Humira (Abbott), or golimumab / Simponi (Centocor).
  • the anti-TNF- alpha antibody of the populations of antibodies with a high level of galactosylation is adalimumab.
  • the anti-TNF-alpha antibody of the populations of antibodies with a high level of galactosylation comprises a heavy chain which comprises SEQ ID NO: l.
  • the anti-TNF-alpha antibody of the populations of antibodies with a high level of galactosylation comprises a light chain which comprises SEQ ID NO:2. In some embodiments, the anti-TNF-alpha antibody of the populations of antibodies with a high level of galactosylation comprises a heavy chain which comprises SEQ ID NO: 1 and a light chain which comprises SEQ ID NO:2. In some embodiments, the anti-TNF-alpha antibody of the populations of antibodies with a high level of galactosylation comprises a heavy chain which consists of SEQ ID NO: l.
  • the anti- TNF-alpha antibody of the populations of antibodies with a high level of galactosylation comprises a light chain that consists of SEQ ID NO:2.
  • the anti-TNF- alpha antibody of the populations of antibodies with a high level of galactosylation comprises a heavy chain which consists of SEQ ID NO: 1 and a light chain that consists of SEQ ID NO:2.
  • the anti-TNF-alpha antibody of the populations of antibodies with a high level of galactosylation is adalimumab.
  • N-glycans The biosynthesis of N-glycans is not regulated by a template, as is the case with proteins, but is mainly dependent on the expression and activity of specific
  • glycosyltransferases in a cell. Therefore, a glycoprotein, such as an antibody Fc domain, normally exists as a heterogeneous population of glycoforms which carry different glycans on the same protein backbone.
  • a population of anti-TNF-alpha antibodies that is highly galactosylated is a population of antibodies wherein the level of galactosylation of the antibodies in the population is at least 50 %, at least 60%, at least 70%, at least 80%, at least 90%, up to 100% of galactosylation. In some embodiments of the population of antibodies that is highly galactosylated, the level of galactosylation of the antibodies in the population is at least 60%.
  • the level of galactosylation as used herein is determined by the following formula:
  • n represents the number of analyzed N-glycan peaks of a chromatogram, such as a Normal-Phase High Performance Liquid Chromatography (NP HPLC) spectrum - "number of Gal” represents the number of Galactose motifs on the antennae of the glycan corresponding to the peak, and
  • number of A corresponds to the number of N-acetylglucosamine motifs on the antennae of the glycan form corresponding to the peak (excluding the two N- acetylglucosamine motifs of the core structure)
  • the level of galactosylation of antibodies in a population of antibodies can be determined, for instance, by releasing the N-glycans from the antibodies, resolving the N- glycans on a chromatogram, identifying the oligosaccharide motif of the N-glycan that corresponds to a specific peak, determining the peak intensity and applying the data to the formula provided above.
  • Anti-TNF- alpha antibodies that are galactosylated include antibodies that are mono- galactosylated N-glycans and bi-galactosylated N-glycans.
  • the population comprises antibodies that comprise mono-galactosylated N-glycans, which may or may not be sialylated.
  • at least 1%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, up to 100% of the antibody N-glycans comprise mono-galactosylated N-glycans.
  • at least 25% of the antibodies comprise mono-galactosylated N-glycans.
  • the population comprises antibodies that comprise bi-galactosylated N-glycans, which may or may not be sialylated.
  • at least 1%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, up to 100% of the antibody N-glycans comprise bi-galactosylated N-glycans.
  • at least 35% of the antibodies comprise bi-galactosylated N-glycans.
  • the population comprises antibodies that comprise mono-galactosylated N-glycans, which may or may not be sialylated, and antibodies that comprise bi-galactosylated N-glycans, which may or may not be sialylated.
  • At least 1%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, up to 99% of the antibody N-glycans comprise mono-galactosylated N-glycans, and at least 1%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, up to 99% of the antibody N-glycans comprise bi-galactosylated N-glycans.
  • At least 25% of the antibody N-glycans comprise mono-galactosylated N-glycans and at least 35% of the antibodies comprise bi-galactosylated N-glycans.
  • the population comprises antibodies that are highly fucosylated.
  • a population of antibodies that is highly fucosylated is a population of antibodies wherein the level of fucosylation of the antibody N-glycans in the population is at least 40 %, at least 50 %, at least 60%, at least 70%, at least 80%, at least 90%, up to 100% of fucosylation.
  • the level of fucosylation of the antibody N-glycans is at least 50%.
  • the level of fucosylation as used herein is determined by the following formula:
  • n the number of analyzed N-glycan peaks of a chromatogram, such as a Normal-Phase High Performance Liquid Chromatography (NP HPLC) spectrum, and
  • number of Fucose represents the number of Fucose motifs on the glycan corresponding to the peak
  • % relative Area corresponds to % of the Area under the corresponding peak containing the Fucose motif.
  • Antibodies that are fucosylated include antibodies that have at least one fucose monosaccharide in one of its N-glycans. Antibodies that are fucosylated include antibodies that have a fucose monosaccharide in each of its N-glycans.
  • the population of anti-TNF-alpha antibodies disclosed herein relates to a population wherein the level of galactosylation of the antibody N-glycans in the population is at least 60% and the level of fucosylation of the antibodies in the population is at least 50%.
  • the population of antibodies disclosed herein relates to a population wherein the level of galactosylation of the antibody N-glycans in the population is at least 50%, and the level of fucosylation of the antibody N-glycans in the population is at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, up to 100%.
  • the population of antibodies disclosed herein relates to a population wherein the level of galactosylation of the antibody N-glycans in the population is at least 60%, and the level of fucosylation of the antibody N-glycans in the population is at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, up to 100%.
  • the population of antibodies disclosed herein relates to a population wherein the level of galactosylation of the antibody N-glycans in the population is at least 70%, and the level of fucosylation of the antibody N-glycans in the population is at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, up to 100%. In some embodiments, the population of antibodies disclosed herein relates to a population wherein the level of galactosylation of the antibody N-glycans in the population is at least 80%, and the level of fucosylation of the antibody N-glycans in the population is at least 60%, at least 70%, at least 80%, at least 90%, up to 100%.
  • the population of antibodies disclosed herein relates to a population wherein the level of galactosylation of the antibody N-glycans in the population is at least 90%, and the level of fucosylation of the antibody N-glycans in the population is at least 60%, at least 70%, at least 80%, at least 90%, up to 100%. In some embodiments, the population of antibodies disclosed herein relates to a population wherein the level of galactosylation of the antibody N-glycans in the population is up to 100% and the level of fucosylation of the antibody N-glycans in the population is at least 60%, at least 70%, at least 80%, at least 90%, up to 100%.
  • the disclosure relates to a composition
  • a composition comprising a population of anti- TNF-alpha antibodies with a specific ratio of the percentage of antibody N-glycans in the population that are galactosylated at the Fc-gamma-glycosylation site to the percentage of antibody N-glycans in the population that are fucosylated at the Fc-gamma-glycosylation site.
  • the disclosure relates to a composition comprising a population of antibodies wherein the ratio of the level of galactosylation of the antibody N-glycans in the population to the level of fucosylation of the antibody N-glycans in the population is between 0.5 and 2.5, between 0.6 and 2.0, between 0.7 and 1.8, between 0.8 and 1.6, or between 1.0 and 1.4. In some embodiments, the disclosure relates to a composition comprising a population of antibodies wherein the ratio of the level of galactosylation of the antibody N- glycans in the population to the level of fucosylation of the antibody N-glycans in the population is between 1.0 and 1.4, for example 1.2.
  • the antibodies and populations of antibodies disclosed herein are highly sialylated.
  • sialylation refers to 2,6 alpha sialylation on the terminal galactose residues of the Fc glycans.
  • in a population of highly sialylated antibodies at least 50% of the terminal galactose moieties are sialylated.
  • in a population of highly sialylated antibodies at least 50%, at least 60%, at least 70%, at least 80%, at least 90% and up to 100% of the terminal galactose moieties are sialylated.
  • the disclosure provides populations of antibodies that are at least 60% galactosylated and in which at least 50%, at least 60%, at least 70%, at least 80%, at least 90% and up to 100% of the terminal galactose moieties are sialylated. In some embodiments, the disclosure provides populations of antibodies that are at least 70% galactosylated and in which at least 50%, at least 60%, at least 70%, at least 80%, at least
  • the disclosure provides populations of antibodies that are at least 80% galactosylated and in which at least 50%, at least 60%, at least 70%, at least 80%, at least 90% and up to 100% of the terminal galactose moieties are sialylated. In some embodiments, the disclosure provides populations of antibodies that are at least 90% galactosylated and in which at least 50%, at least 60%, at least 70%, at least 80%, at least 90% and up to 100% of the terminal galactose moieties are sialylated.
  • the population of anti-TNF- alpha antibodies with a high level of galactosylation is produced in mammary epithelial cells of a non-human mammal.
  • the population of anti-TNF-alpha antibodies is produced in a transgenic non-human mammal.
  • the non-human mammal is a goat, sheep, bison, camel, cow, pig, rabbit, buffalo, horse, rat, mouse or llama.
  • the non- human mammal is a goat.
  • the population of anti-TNF-alpha antibodies with a high level of galactosylation is produced in cells other than mammary epithelial cells of a non-human mammal.
  • the population of anti-TNF-alpha antibodies is modified after production in cells other than mammary epithelial cells of a non-human mammal to increase the number of galactose groups in the population of antibodies (e.g., through the action of enzymes such as transferases).
  • the disclosure provides compositions comprising populations of anti- TNF-alpha antibodies with a high level of galactosylation.
  • the composition comprising anti-TNF-alpha antibodies with a high level of galactosylation further comprises milk. In some embodiments, the composition comprising anti-TNF-alpha antibodies with a high level of galactosylation further comprises a pharmaceutically- acceptable carrier.
  • compositions comprising populations of anti- TNF-alpha antibodies with high levels of galactosylation (e.g., at least 70%), wherein the population of antibodies is produced in mammary epithelial cells of a non-human mammal, and wherein the population of antibodies has an increased level of galactosylation when compared to the population of antibodies not produced in mammary gland epithelial cells.
  • the population of antibodies not produced in mammary gland epithelial cells is produced in cell culture.
  • antibodies "produced in cell culture” when compared to antibodies produced in mammary epithelial cells refers to antibodies produced in standard production cell lines (e.g., CHO cells) but excluding mammary epithelial cells.
  • the level of galactosylation of the antibodies not produced in mammary gland epithelial cells is 90% or lower, 80% or lower, 70% or lower, 60% or lower, 50% or lower, 40% or lower, 30% or lower, 20% or lower, 10% or lower when compared to the level of galactosylation of the antibodies produced in mammary epithelial cells of a non-human mammal.
  • the level of galactosylation of the antibodies not produced in mammary gland epithelial cells is 50% or lower when compared to the level of
  • the level of galactosylation of the antibodies not produced in mammary gland epithelial cells is 30% or lower when compared to the level of
  • the level of galactosylation of the antibodies not produced in mammary gland epithelial cells is 10% or lower when compared to the level of
  • compositions comprising populations of anti- TNF-alpha antibodies with high levels of fucosylation (e.g., at least 60%), wherein the population of antibodies is produced in mammary epithelial cells of a non-human mammal, and wherein the population of antibodies has an increased level of fucosylation when compared to the population of antibodies not produced in mammary gland epithelial cells.
  • the population of antibodies not produced in mammary gland epithelial cells is produced in cell culture.
  • the level of fucosylation of the antibodies not produced in mammary gland epithelial cells is 90% or lower, 80% or lower, 70% or lower, 60% or lower, 50% or lower, 40% or lower, 30% or lower, 20% or lower, 10% or lower when compared to the level of fucosylation of the antibodies produced in mammary epithelial cells of a non-human mammal. In some embodiments, the level of fucosylation of the antibodies not produced in mammary gland epithelial cells is 50% or lower when compared to the level of fucosylation of the antibodies produced in mammary epithelial cells of a non-human mammal.
  • the level of fucosylation of the antibodies not produced in mammary gland epithelial cells is 30% or lower when compared to the level of fucosylation of the antibodies produced in mammary epithelial cells of a non-human mammal. In some embodiments, the level of fucosylation of the antibodies not produced in mammary gland epithelial cells is 10% or lower when compared to the level of fucosylation of the antibodies produced in mammary epithelial cells of a non-human mammal.
  • compositions comprising populations of anti- TNF-alpha antibodies with high levels of galactosylation and fucosylation, wherein the population of antibodies is produced in mammary epithelial cells of a non-human mammal, and wherein the population of antibodies has an increased level of galactosylation and fucosylation when compared to the population of antibodies not produced in mammary gland epithelial cells.
  • the term "antibody” refers to a glycoprotein comprising at least two heavy (H) chains and two light (L) chains.
  • Each heavy chain is comprised of a heavy chain variable region (abbreviated herein as HCVR or VH) and a heavy chain constant region.
  • the heavy chain constant region is comprised of three domains, CHI, CH2 and CH3.
  • Each light chain is comprised of a light chain variable region (abbreviated herein as LCVR or VL) and a light chain constant region.
  • the light chain constant region is comprised of one domain, CL.
  • the VH and VL regions can be further subdivided into regions of
  • variable regions of the heavy and light chains contain a binding domain that interacts with an antigen.
  • the antigen is TNF-alpha, either in soluble form, in transmembrane form, or both.
  • the constant regions of the antibodies may mediate the binding of the immunoglobulin to host tissues or factors, including various cells of the immune system (e.g., effector cells) and the first component (Clq) of the classical complement system. Formation of a mature functional antibody molecule can be accomplished when two proteins are expressed in stoichiometric quantities and self-assemble with the proper configuration.
  • antibodies is also meant to encompass antigen-binding fragments thereof.
  • Methods for making antibodies and antigen-binding fragments are well known in the art (see, e.g., Sambrook et al, "Molecular Cloning: A Laboratory Manual” (2nd Ed.), Cold Spring Harbor Laboratory Press (1989); Lewin, “Genes IV", Oxford University Press, New York, (1990), and Roitt et al., "Immunology” (2nd Ed.), Gower Medical Publishing, London, New York (1989), WO2006/040153, WO2006/122786, and WO2003/002609).
  • an "antigen-binding fragment" of an antibody refers to one or more portions of an antibody that retain the ability to specifically bind to an antigen, e.g., TNF-alpha. It has been shown that the antigen-binding function of an antibody can be performed by fragments of a full-length antibody.
  • binding fragments encompassed within the term "antigen-binding fragment" of an antibody include (i) a Fab fragment, a monovalent fragment consisting of the VL, VH, CL and CHI domains; (ii) a F(ab')2 fragment, a bivalent fragment comprising two Fab fragments linked by a disulfide bridge at the hinge region; (iii) a Fd fragment consisting of the VH and CHI domains; (iv) a Fv fragment consisting of the VL and VH domains of a single arm of an antibody, (v) a dAb fragment (Ward et al., (1989) Nature 341 :544-546) which consists of a VH domain; and (vi) an isolated complementarity determining region (CDR).
  • a Fab fragment a monovalent fragment consisting of the VL, VH, CL and CHI domains
  • F(ab')2 fragment a bivalent fragment comprising two Fab fragments linked by a
  • the two domains of the Fv fragment, V and VH are coded for by separate genes, they can be joined, using recombinant methods, by a synthetic linker that enables them to be made as a single protein chain in which the VL and VH regions pair to form monovalent molecules (known as single chain Fv (scFv); see e.g., Bird et al. (1988) Science 242:423-426; and Huston et al. (1988) Proc. Natl. Acad. Sci. USA 85:5879-5883).
  • single chain Fv single chain Fv
  • Such single chain antibodies are also intended to be encompassed within the term "antigen- binding portion" of an antibody.
  • These antibody fragments are obtained using conventional procedures, such as proteolytic fragmentation procedures, as described in J. Goding,
  • the antibodies are of the isotype IgG, IgA or IgD.
  • the antibodies are selected from the group consisting of IgGl, IgG2, IgG3, IgG4, IgM, IgAl, IgA2, IgAsec, IgD, IgE or has immunoglobulin constant and/or variable domain of IgGl, IgG2, IgG3, IgG4, IgM, IgAl, IgA2, IgAsec, IgD or IgE.
  • the antibodies are bispecific or multispecific antibodies.
  • the antibodies of the present disclosure can be modified to be in the form of a bispecific antibody, or a multispecific antibody.
  • bispecific antibody is intended to include any agent, e.g., a protein, peptide, or protein or peptide complex, which has two different binding specificities which bind to, or interact with (a) a cell surface antigen and (b) an Fc receptor on the surface of an effector cell.
  • multispecific antibody is intended to include any agent, e.g., a protein, peptide, or protein or peptide complex, which has more than two different binding specificities which bind to, or interact with (a) a cell surface antigen, (b) an Fc receptor on the surface of an effector cell, and (c) at least one other component.
  • the disclosure includes, but is not limited to, bispecific, trispecific, tetraspecific, and other multispecific antibodies which are directed to cell surface antigens, and to Fc receptors on effector cells.
  • bispecific antibodies further includes diabodies.
  • Diabodies are bivalent, bispecific antibodies in which the VH and VL domains are expressed on a single polypeptide chain, but using a linker that is too short to allow for pairing between the two domains on the same chain, thereby forcing the domains to pair with complementary domains of another chain and creating two antigen-binding sites (see e.g., HoUiger, P., et al. (1993) Proc. Natl. Acad. Sci. USA 90:6444-6448; Poijak, R.J., et al. (1994) Structure 2: 1121- 1123).
  • antibodies also encompasses different types of antibodies, e.g., recombinant antibodies, monoclonal antibodies, humanized antibodies or chimeric antibodies, or a mixture of these.
  • the antibodies are recombinant antibodies.
  • recombinant antibody is intended to include antibodies that are prepared, expressed, created or isolated by recombinant means, such as antibodies isolated from an animal that is transgenic for another species' immunoglobulin genes, antibodies expressed using a recombinant expression vector transfected into a host cell, antibodies isolated from a recombinant, combinatorial antibody library, or antibodies prepared, expressed, created or isolated by any other means that involves splicing of immunoglobulin gene sequences to other DNA sequences.
  • the antibodies can be chimeric or humanized antibodies.
  • chimeric antibody refers to an antibody that combines parts of a non-human (e.g., mouse, rat, rabbit) antibody with parts of a human antibody.
  • humanized antibody refers to an antibody that retains only the antigen- binding CDRs from the parent antibody in association with human framework regions (see, Waldmann, 1991, Science 252: 1657). Such chimeric or humanized antibodies retaining binding specificity of the murine antibody are expected to have reduced immunogenicity when administered in vivo for diagnostic, prophylactic or therapeutic applications according to the disclosure.
  • the antibodies are human antibodies.
  • the term "human antibody”, as used herein, is intended to include antibodies having variable and constant regions derived from human germline immunoglobulin sequences.
  • the human antibodies of the disclosure may include amino acid residues not encoded by human germline
  • immunoglobulin sequences e.g., mutations introduced by random or site-specific
  • Human antibodies are generated using transgenic mice carrying parts of the human immune system rather than the mouse system. Fully human monoclonal antibodies also can be prepared by immunizing mice transgenic for large portions of human immunoglobulin heavy and light chain loci. See, e.g., U.S. patents 5,591,669, 5,598,369, 5,545,806, 5,545,807, 6,150,584, and references cited therein, the contents of which are incorporated herein by reference. These animals have been genetically modified such that there is a functional deletion in the production of endogenous (e.g., murine) antibodies.
  • the animals are further modified to contain all or a portion of the human germ-line immunoglobulin gene locus such that immunization of these animals results in the production of fully human antibodies to the antigen of interest.
  • monoclonal antibodies are prepared according to standard hybridoma technology. These monoclonal antibodies have human immunoglobulin amino acid sequences and therefore will not provoke human anti-mouse antibody (HAMA) responses when administered to humans.
  • the human antibodies like any of the antibodies provided herein can be monoclonal antibodies.
  • the antibody is a full-length antibody. In some embodiments the full-length antibody comprises a heavy chain and a light chain. In some embodiments, the antibody is an anti-TNF-alpha antibody. In some embodiments, the heavy chain comprises SEQ ID NO: 1 and the light chain comprises SEQ ID NO: 2. In some embodiments, the antibody is adalimumab.
  • compositions comprising populations of anti-TNF-alpha antibodies with high levels of galactosylation have high complement dependent cytotoxicity (CDC) activity.
  • compositions comprising populations of anti- TNF-alpha antibodies with high levels of galactosylation have high antibody-dependent cellular cytotoxicity (ADCC) activity.
  • compositions comprising populations of anti-TNF-alpha antibodies with high levels of galactosylation have high complement dependent cytotoxicity (CDC) activity and have high antibody-dependent cellular cytotoxicity (ADCC) activity.
  • the population of anti-TNF-alpha antibodies with high levels of galactosylation has an increased level of complement dependent cytotoxicity (CDC) activity when compared to a population of antibodies that have low levels of galactosylation.
  • CDC complement dependent cytotoxicity
  • the population of antibodies with high levels of galactosylation and the population of antibodies that have low levels of galactosylation are directed to the same antigen epitope.
  • the nucleic acid encodes the antibody adalimumab.
  • a population of antibodies that has low levels of galactosylation refers to a population of antibodies wherein the level of galactosylation of the antibodies in the population is less than 50 %, less than 40%, less than 30%, less than 20%, less than 10%, down to 0%.
  • the CDC activity of a population of antibodies with high levels of galactosylation is at least 1.1 times higher, at least 1.2 times higher, at least 1.3 times higher, at least 1.4 times higher, at least 1.5 times higher, at least 1.6 times higher, at least 1.7 times higher, at least 1.8 times higher, at least 1.9 times higher, at least 2 times higher, at least 3 times higher, at least 5 times higher, at least 10 times higher, up to at least 100 times higher or more when compared to a population of antibodies that have low levels of galactosylation.
  • the population of antibodies that are highly galactosylated are highly fucosylated (have high levels of fucosylation). In some embodiments, the population of antibodies that are highly galactosylated and highly fucosylated has an increased level of complement dependent cytotoxicity (CDC) activity when compared to a population of antibodies that are low galactose and low fucose (have low levels of galactosylation and fucosylation). In some embodiments, the population of antibodies that is highly galactosylated are highly fucosylated (have high levels of fucosylation). In some embodiments, the population of antibodies that are highly galactosylated and highly fucosylated has an increased level of complement dependent cytotoxicity (CDC) activity when compared to a population of antibodies that are low galactose and low fucose (have low levels of galactosylation and fucosylation). In some embodiments, the population of antibodies that is highly
  • the galactosylated and highly fucosylated and the population of antibodies that is low galactose and low fucose are directed to the same antigen epitope.
  • the population of antibodies that is highly galactosylated and highly fucosylated and the population of antibodies that is low galactose and low fucose are encoded by the same nucleic acid.
  • the nucleic acid encodes the antibody adalimumab.
  • a population of antibodies that are low fucose or that have low levels of fucosylation refers to a population of antibodies wherein the level of fucosylation of the antibodies in the population is less than 50%, less than 40%, less than 30%, less than 20%, less than 10%, down to 0%.
  • the CDC activity of a population of antibodies that is highly galactosylated and highly fucosylated is at least 1.1 times higher, at least 1.2 times higher, at least 1.3 times higher, at least 1.4 times higher, at least 1.5 times higher, at least 1.6 times higher, at least 1.7 times higher, at least 1.8 times higher, at least 1.9 times higher, at least 2 times higher, at least 3 times higher, at least 5 times higher, at least 10 times higher, up to at least 100 times higher or more when compared to a population of antibodies that is low galactose and low fucose.
  • the population of antibodies that is highly galactosylated and is produced in mammary gland epithelial cells has an increased level of complement dependent cytotoxicity (CDC) activity when compared to a population of antibodies that is not produced in mammary gland epithelial cells.
  • the population of antibodies not produced in mammary gland epithelial cells is produced in cell culture.
  • the population of antibodies that is highly galactosylated produced in mammary gland epithelial cells and the population of antibodies that is not produced in mammary gland epithelial cells may be encoded by the same nucleic acid.
  • the nucleic acid encodes the antibody adalimumab.
  • the CDC activity of a population of antibodies that is highly galactosylated and is produced in mammary gland epithelial cells is at least 1.1 times higher, at least 1.2 times higher, at least 1.3 times higher, at least 1.4 times higher, at least 1.5 times higher, at least 1.6 times higher, at least 1.7 times higher, at least 1.8 times higher, at least 1.9 times higher, at least 2 times higher, at least 3 times higher, at least 5 times higher, at least 10 times higher, up to at least 100 times higher or more when compared to a population of antibodies that is not produced in mammary gland epithelial cells.
  • compositions of the populations of antibodies disclosed herein have a high (complement dependent cytotoxicity) CDC activity.
  • Antibodies can act as a therapeutic through various mechanisms, one of which is through CDC activity.
  • Some therapeutic antibodies that bind to target cellular receptors can also bind proteins of the complement pathway. Binding of the complement proteins results in a complement cascade (through CI -complex activation) that eventually results in the formation of a "membrane attack complex" causing cell lysis and death of the cell to which the therapeutic antibody is bound (See e.g., Reff M. E. Blood 1994, 83: 435).
  • a population of antibodies that has an increased level of complement dependent cytotoxicity (CDC) activity is a population of antibodies that induces a larger amount of cell lysis as compared to a population of antibodies that has does not have an increased level of complement dependent cytotoxicity (CDC) activity.
  • Methods for determining the level of CDC are known in the art and are often based on determining the amount of cell lysis. Commercial kits for determining CDC activity can be purchased for instance from Genscript (Piscataway, NJ).
  • the population of anti-TNF-alpha antibodies with high levels of galactosylation has an increased level of antibody-dependent cellular cytotoxicity (ADCC) activity when compared to a population of antibodies that have low levels of galactosylation.
  • the disclosure provides compositions comprising populations of anti-TNF-alpha antibodies with a high level of galactosylation wherein the population of antibodies is produced in mammary epithelial cells of a non-human mammal, and wherein the population of antibodies has an increased level of antibody- dependent cellular cytotoxicity (ADCC) activity when compared to a population of antibodies not produced in mammary gland epithelial cells.
  • ADCC antibody-dependent cellular cytotoxicity
  • the population of antibodies not produced in mammary gland epithelial cells is produced in cell culture.
  • the population of anti-TNF-alpha antibodies with high levels of galactosylation e.g., at least 70%
  • the population of antibodies that are highly galactosylated has an increased level of antibody-dependent cellular cytotoxicity (ADCC) when compared to a population of antibodies that are low galactose.
  • the ADCC activity of a population of antibodies that is highly galactosylated is at least 1.1 times higher, 1.2 times higher, 1.3 times higher, 1.4 times higher, 1.5 times higher, 1.6 times higher, 1.7 times higher, 1.8 times higher, 1.9 times higher, 2 times higher, 3 times higher, 5 times higher, 10 times higher, 100 times higher or more when compared to a population of antibodies that are low galactose.
  • the population of antibodies that are highly galactosylated and is produced in mammary gland epithelial cells has an increased level of antibody-dependent cellular cytotoxicity (ADCC) when compared to a population of antibodies that is not produced in mammary gland epithelial cells.
  • ADCC antibody-dependent cellular cytotoxicity
  • the ADCC activity of a population of antibodies that is highly galactosylated and produced in mammary gland epithelial cells is at least 1.1 times higher, 1.2 times higher, 1.3 times higher, 1.4 times higher, 1.5 times higher, 1.6 times higher, 1.7 times higher, 1.8 times higher, 1.9 times higher, 2 times higher, 3 times higher, 5 times higher, 10 times higher, 100 times higher or more when compared to a population of antibodies that is not produced in mammary gland epithelial cells.
  • the population of antibodies that is highly galactosylated and is produced in mammary gland epithelial cells has an increased level of antibody-dependent cellular cytotoxicity (ADCC) when compared to a population of antibodies that is not produced in mammary gland epithelial cells.
  • ADCC antibody-dependent cellular cytotoxicity
  • the population of antibodies not produced in mammary gland epithelial cells is produced in cell culture.
  • compositions of the populations of antibodies disclosed herein have a high ADCC activity.
  • Antibodies can act as a therapeutic through various mechanisms, one of which is through ADCC activity.
  • Therapeutic antibodies that bind to cellular receptors on a target cell, and that include the Fc glycosylation site can also bind the Fc-receptor resulting in the anchoring of cells expressing the Fc-receptor to the target cell.
  • the affinity of binding of the Fc regions of antibodies generally is dependent on the nature of the glycosylation of the Fc glycosylation site.
  • the Fc receptor is found on a number of immune cells including natural killer cells, macrophages, neutrophils, and mast cells.
  • a population of antibodies that has an increased level of antibody-dependent cellular cytotoxicity (ADCC) activity is a population of antibodies that shows increased binding to cells expressing CD 16 as compared to a population of antibodies that does not have an increased level of antibody-dependent cellular cytotoxicity (ADCC) activity.
  • ADCC antibody-dependent cellular cytotoxicity
  • a population of antibodies that has an increased level of antibody-dependent cellular cytotoxicity (ADCC) activity is a population of antibodies that shows increased induction of IL-2 production (e.g., in natural killer cells) as compared to a population of antibodies that has does not have an increased level of antibody-dependent cellular cytotoxicity (ADCC) activity.
  • ADCC antibody-dependent cellular cytotoxicity
  • Commercial kits for determining ADCC activity can be purchased for instance from Genscript (Piscataway, NJ) and Promega (Madison, WI).
  • determining ADCC activity is performed by evaluating the ability to bind CD16.
  • the population of anti-TNF- alpha antibodies with high levels of galactosylation (e.g., at least 70%) has an increased ability to suppress TNF-alpha activity in a subject when compared to a population of antibodies that have low levels of
  • compositions comprising populations of anti-TNF- alpha antibodies with high levels of galactosylation, wherein the population of antibodies is produced in mammary epithelial cells of a non-human mammal, and wherein the population of antibodies has an increased ability to suppress TNF-alpha activity in a subject when compared to a population of antibodies not produced in mammary gland epithelial cells.
  • compositions comprising populations of anti- TNF-alpha antibodies with high levels of galactosylation, wherein the population of antibodies is produced in mammary epithelial cells of a non-human mammal, and wherein the population of antibodies has an increased ability to bind soluble TNF-alpha when compared to a population of antibodies not produced in mammary gland epithelial cells.
  • compositions comprising populations of anti- TNF-alpha antibodies with high levels of galactosylation, wherein the population of antibodies is produced in mammary epithelial cells of a non-human mammal, and wherein the population of antibodies has an increased ability to bind transmembrane TNF-alpha when compared to a population of antibodies not produced in mammary gland epithelial cells.
  • the population of antibodies that are highly galactosylated has an increased ability to suppress TNF-alpha activity, bind soluble TNF-alpha and/or bind transmembrane TNF-alpha when compared to a population of antibodies that are low galactose.
  • the increased ability to suppress TNF-alpha activity, bind soluble TNF-alpha and/or bind transmembrane TNF-alpha of a population of antibodies that is highly galactosylated is at least 1.1 times higher, 1.2 times higher, 1.3 times higher, 1.4 times higher, 1.5 times higher, 1.6 times higher, 1.7 times higher, 1.8 times higher, 1.9 times higher, 2 times higher, 3 times higher, 5 times higher, 10 times higher, 100 times higher or more when compared to a population of antibodies that are low galactose.
  • the population of antibodies that are highly galactosylated and is produced in mammary gland epithelial cells has an increased ability to suppress TNF-alpha activity, bind soluble TNF-alpha and/or bind transmembrane TNF-alpha when compared to a population of antibodies that is not produced in mammary gland epithelial cells.
  • galactosylated and produced in mammary gland epithelial cells is at least 1.1 times higher, 1.2 times higher, 1.3 times higher, 1.4 times higher, 1.5 times higher, 1.6 times higher, 1.7 times higher, 1.8 times higher, 1.9 times higher, 2 times higher, 3 times higher, 5 times higher, 10 times higher, 100 times higher or more when compared to a population of antibodies that is not produced in mammary gland epithelial cells.
  • the population of antibodies that is highly galactosylated and is produced in mammary gland epithelial cells has increased ability to suppress TNF-alpha activity, bind soluble TNF-alpha and/or bind transmembrane TNF-alpha when compared to a population of antibodies that is not produced in mammary gland epithelial cells.
  • the population of antibodies not produced in mammary gland epithelial cells is produced in cell culture.
  • the populations of anti-TNF-alpha antibodies produced in mammary gland epithelial cells are superior to non-mammary gland epithelial cells produced antibodies in suppressing TNF-alpha activity in a subject.
  • Determining the level of TNF- alpha activity in a subject can be evaluated for instance, by administering the population of antibodies to a subject suffering from a disease characterized by increased TNF-alpha activity (e.g., rheumatoid arthritis) or an established model for such a disease. (See e.g., Horiuchi et al., Rheumatology et al. 49: 1215).
  • the populations of anti-TNF-alpha antibodies produced in mammary gland epithelial cells are superior to non-mammary gland epithelial cells produced antibodies in binding soluble TNF-alpha. In some embodiments, the populations of anti- TNF-alpha antibodies produced in mammary gland epithelial cells are superior to non- mammary gland epithelial cells produced antibodies in binding transmembrane TNF-alpha. Assays for determining the level of binding to soluble TNF-alpha or transmembrane TNF- alpha are well-established (See e.g., Horiuchi et al., Rheumatology et al. 49: 1215). Non-human mammary gland epithelial cells and transgenic animals
  • the disclosure provides mammary gland epithelial cells that produce highly galactosylated anti-TNF- alpha antibodies or populations of anti-TNF-alpha antibodies with a high level of galactosylation.
  • the disclosure provides a transgenic non-human mammal that produces highly galactosylated anti-TNF-alpha antibody or populations of anti-TNF-alpha antibodies with a high level of galactosylation
  • the disclosure relates to mammalian mammary epithelial cells that produce glycosylated antibodies.
  • Methods are provided herein for producing glycosylated antibodies in mammalian mammary epithelial cells. This can be accomplished in cell culture by culturing mammary epithelial cell (in vitro or ex vivo). This can also be accomplished in a transgenic animal (in vivo).
  • the mammalian mammary gland epithelial cells are in a transgenic animal.
  • the mammalian mammary gland epithelial cells have been engineered to express recombinant antibodies in the milk of a transgenic animal, such as a mouse or goat.
  • the expression of the gene(s) encoding the recombinant protein can be, for example, under the control of the goat ⁇ -casein regulatory elements.
  • Expression of recombinant proteins, e.g., antibodies, in both mice and goat milk has been established previously (see, e.g., US Patent Application US-2008-0118501-Al).
  • the expression is optimized for individual mammary duct epithelial cells that produce milk proteins.
  • Transgenic animals capable of producing recombinant antibodies can be generated according to methods known in the art (see, e.g., U.S. Patent No. 5,945,577 and US Patent Application US-2008-0118501-Al).
  • Animals suitable for transgenic expression include, but are not limited to goat, sheep, bison, camel, cow, pig, rabbit, buffalo, horse, rat, mouse or llama.
  • Suitable animals also include bovine, caprine, ovine and porcine, which relate to various species of cows, goats, sheep and pigs (or swine), respectively.
  • Suitable animals also include ungulates.
  • ungulate is of or relating to a hoofed typically herbivorous quadruped mammal, including, without limitation, sheep, swine, goats, cattle and horses. Suitable animals also include dairy animals, such as goats and cattle, or mice. In some embodiments, the animal suitable for transgenic expression is a goat.
  • transgenic animals are generated by generation of primary cells comprising a construct of interest followed by nuclear transfer of primary cell nucleus into enucleated oocytes.
  • Primary cells comprising a construct of interest are produced by injecting or transfecting primary cells with a single construct comprising the coding sequence of an antibody of interest, e.g., the heavy and light chains of adalimumab, or by co- transfecting or co-injecting primary cells with separate constructs comprising the coding sequences of the heavy and light chains of an antibody, e.g., adalimumab.
  • These cells are then expanded and characterized to assess transgene copy number, transgene structural integrity and chromosomal integration site.
  • nuclear transfer refers to a method of cloning wherein the nucleus from a donor cell is transplanted into an enucleated oocyte.
  • Coding sequences for antibodies to be expressed in mammalian mammary epithelial cells can be obtained by screening libraries of genomic material or reverse-translated messenger RNA derived from the animal of choice (such as humans, cattle or mice), from sequence databases such as NCBI, Genbank, or by obtaining the sequences of antibodies using methods known in the art, e.g. peptide mapping.
  • the sequences can be cloned into an appropriate plasmid vector and amplified in a suitable host organism, like E. coli.
  • a "vector" may be any of a number of nucleic acids into which a desired sequence may be inserted by restriction and ligation for transport between different genetic
  • Vectors are typically composed of DNA although RNA vectors are also available. Vectors include, but are not limited to, plasmids and phagemids.
  • a cloning vector is one which is able to replicate in a host cell, and which is further characterized by one or more endonuclease restriction sites at which the vector may be cut in a determinable fashion and into which a desired DNA sequence may be ligated such that the new recombinant vector retains its ability to replicate in the host cell.
  • An expression vector is one into which a desired DNA sequence may be inserted by restriction and ligation such that it is operably joined to regulatory sequences and may be expressed as an RNA transcript.
  • Vectors may further contain one or more marker sequences suitable for use in the identification of cells which have or have not been transformed or transfected with the vector.
  • Markers include, for example, genes encoding proteins which increase or decrease either resistance or sensitivity to antibiotics or other compounds, genes which encode enzymes whose activities are detectable by standard assays known in the art (e.g., ?-galactosidase or alkaline phosphatase), and genes which visibly affect the phenotype of transformed or transfected cells, hosts, colonies or plaques.
  • the coding sequence of antibodies or the heavy and light chains of antibodies of interest can be operatively linked to a control sequence which enables the coding sequence to be expressed in the milk of a transgenic non-human mammal.
  • the DNA construct can be excised, purified from the remains of the vector and introduced into expression vectors that can be used to produce transgenic animals.
  • the transgenic animals will have the desired transgenic protein integrated into their genome.
  • a DNA sequence which is suitable for directing production to the milk of transgenic animals can carry a 5'-promoter region derived from a naturally-derived milk protein. This promoter is consequently under the control of hormonal and tissue-specific factors and is most active in lactating mammary tissue. In some embodiments the promoter used is a milk- specific promoter.
  • a "milk- specific promoter” is a promoter that naturally directs expression of a gene in a cell that secretes a protein into milk (e.g., a mammary epithelial cell) and includes, for example, the casein promoters, e.g., cc-casein promoter (e.g., alpha S- l casein promoter and alpha S2-casein promoter), ⁇ -casein promoter (e.g., the goat beta casein gene promoter (DiTullio, BIOTECHNOLOGY 10:74-77, 1992), ⁇ -casein promoter, K-casein promoter, whey acidic protein (WAP) promoter (Gorton et al., BIOTECHNOLOGY 5: 1183-1187, 1987), ⁇ -lactoglobulin promoter (Clark et al., BIOTECHNOLOGY 7: 487-492,
  • casein promoters e.g., cc-casein promoter (e
  • a-lactalbumin promoter Soulier et al., FEBS LETTS. 297: 13, 1992.
  • promoters that are specifically activated in mammary tissue such as, for example, the long terminal repeat (LTR) promoter of the mouse mammary tumor virus (MMTV).
  • LTR long terminal repeat
  • MMTV mouse mammary tumor virus
  • the promoter is a caprine beta casein promoter.
  • the promoter can be operably linked to a DNA sequence directing the production of a protein leader sequence which directs the secretion of the transgenic protein across the mammary epithelium into the milk.
  • a coding sequence and regulatory sequences e.g., a promoter
  • a "leader sequence” or “signal sequence” is a nucleic acid sequence that encodes a protein secretory signal, and, when operably linked to a downstream nucleic acid molecule encoding a transgenic protein directs secretion.
  • the leader sequence may be the native human leader sequence, an artificially- derived leader, or may be obtained from the same gene as the promoter used to direct transcription of the transgene coding sequence, or from another protein that is normally secreted from a cell, such as a mammalian mammary epithelial cell.
  • a 3'-sequence which can be derived from a naturally secreted milk protein, can be added to improve stability of mRNA.
  • the heavy and light chain constructs can be transfected into primary goat skin epithelial cells, which are expanded and fully characterized to assess transgene copy number, transgene structural integrity and chromosomal integration site.
  • nuclear transfer refers to a method of cloning wherein the nucleus from a donor cell is transplanted into an enucleated oocyte.
  • Cloning will result in a multiplicity of transgenic animals - each capable of producing an antibody or other gene construct of interest.
  • the production methods include the use of the cloned animals and the offspring of those animals.
  • Cloning also encompasses the nuclear transfer of fetuses, nuclear transfer, tissue and organ transplantation and the creation of chimeric offspring.
  • One step of the cloning process comprises transferring the genome of a cell, e.g., a primary cell that contains the transgene of interest into an enucleated oocyte.
  • transgene refers to any piece of a nucleic acid molecule that is inserted by artifice into a cell, or an ancestor thereof, and becomes part of the genome of an animal which develops from that cell.
  • a transgene may include a gene which is partly or entirely exogenous (i.e., foreign) to the transgenic animal, or may represent a gene having identity to an endogenous gene of the animal.
  • Suitable mammalian sources for oocytes include goats, sheep, cows, pigs, rabbits, guinea pigs, mice, hamsters, rats, non-human primates, etc.
  • oocytes are obtained from ungulates, and most preferably goats or cattle.
  • oocytes may preferably be matured in vivo before these cells may be used as recipient cells for nuclear transfer, and before they were fertilized by the sperm cell to develop into an embryo.
  • Metaphase II stage oocytes which have been matured in vivo, have been successfully used in nuclear transfer techniques. Essentially, mature metaphase II oocytes are collected surgically from either non- super ovulated or super ovulated animals several hours past the onset of estrus or past the injection of human chorionic gonadotropin (hCG) or similar hormone.
  • hCG human chorionic gonadotropin
  • the transgenic animals e.g., goats
  • mammary epithelial cells are generated through microinjection.
  • Microinjection in goats is described for instance in US 7,928,064. Briefly, fertilized goat eggs are collected from the PBS oviductal flushings on a stereomicroscope, and washed in medium containing 10% fetal bovine serum (FBS). In cases where the pronuclei were visible, the embryos can be immediately microinjected. If pronuclei are not visible, the embryos can be placed media for short term culture until the pronuclei became visible (Selgrath, et al., Theriogenology, 1990. p. 1195- 1205).
  • FBS fetal bovine serum
  • One-cell goat embryos are placed in a microdrop of medium under oil on a glass depression slide. Fertilized eggs having two visible pronuclei and can be immobilized on a flame-polished holding micropipet on an upright microscope with a fixed stage.
  • a pronucleus can be microinjected with the appropriate antibody encoding construct in injection buffer using a fine glass microneedle (Selgrath, et al., Theriogenology, 1990. p. 1195-1205). After microinjection, surviving embryos are placed in a culture and incubated until the recipient animals are prepared for embryo transfer (Selgrath, et al., Theriogenology, 1990. p. 1195- 1205).
  • the disclosure provides mammary gland epithelial cells that produce the antibodies or populations of antibodies disclosed herein.
  • the antibody comprises a nucleic acid comprising SEQ ID NO: 3 and a nucleic acid comprising SEQ ID NO: 4.
  • the nucleic acid comprising SEQ ID NO: 3 and the nucleic acid comprising SEQ ID NO: 4 are connected.
  • Connected is used herein to mean the nucleic acids are physically linked, e.g., within the same vector or within approximately the same genomic location.
  • the mammary epithelial cells above are in a transgenic non-human mammal.
  • the transgenic non-human mammal is a goat.
  • a nucleic acid sequence encoding the heavy chain of adalimumab is provided in SEQ ID NO:3: ATGGAATTCGGCCTGAGCTGGCTGTTCCTGGTGGCCATCCTGAAGGGCGTGCAGT GCGAGGTGCAGCTGGTGGAGTCTGGCGGAGGACTGGTGCAGCCCGGCAGAAGCC TGAGACTGAGCTGCGCCGCCAGCGGCTTCACCTTCGACGACTACGCCATGCACTG GGTCCGCCAGGCCCCTGGAAAGGGCCTGGAATGGGTGTCCGCCATCACCTGGAA CAGCGGCCACATCGACTACGCCGACAGCGTGGAGGGCAGGTTCACCATCAGCAG GGACAACGCCAAGAACAGCCTGTACCTGCAGATGAACAGCCTGAGGGCCGAGGA CACCGCCGTGTACTACTGCCATCATGCCAAGGTGTCCTACCTGAGCACCGCCAGCAGCCTG GATTACTGGGGCCAGGGCACCCTGGTGACCGTGTCCAGCGCCAGCACCAAGGGCCCTAGCGTGT
  • a nucleic acid sequence encoding the light chain of adalimumab is provided in SEQ ID NO:4: ATGGACATGAGAGTGCCCGCTCAGCTGCTGGGACTGCTGCTGCTGTGGCTGAGA GGCGCCAGATGCGACATCCAGATGACCCAGAGCCCTTCTAGCCTGAGCGCCAGC GTGGGCGACAGAGTGACCATCACCTGTAGGGCCAGCCAGGGCATCAGGAACTAC CTGGCCTGGTATCAGCAGAAGCCCGGCAAGGCCCCCAAGCTGCTGATCTACGCC GCCAGCACCCTGCAGAGCGGCGTGCCCAGCAGATTCAGCGGCAGCGGCTCCGGC ACCGACTTC ACCCTGACCATCAGC AGCCTGC AGCCTGAGGACGTGGCC ACCTACT ACTGCCAGAGGTACAACAGGGCCCCCTACACCTTCGGACAGGGCACCAAGGTGG AGATCAAGAGGACCGTGGCCAGCGTGTTCATCTTCCCACCCAGCGACGA GCAGCTGA
  • the anti-TNF-alpha antibody is adalimumab.
  • the transgene DNA construct comprises SEQ ID NO: 3 and/or SEQ ID NO:4.
  • the non-human transgenic mammal is a goat.
  • the disclosure provides a method of: (a) providing a non-human transgenic mammal engineered to express an anti-TNF- alpha antibody,
  • the anti-TNF-alpha antibody comprises a heavy chain comprising SEQ ID NO: 1 and a light chain comprising SEQ ID NO:2.
  • the anti-TNF-alpha antibody is adalimumab.
  • lactation One of the tools used to predict the quantity and quality of the recombinant protein expressed in the mammary gland is through the induction of lactation (Ebert KM, 1994). Induced lactation allows for the expression and analysis of protein from the early stage of transgenic production rather than from the first natural lactation resulting from pregnancy, which is at least a year later. Induction of lactation can be done either hormonally or manually.
  • compositions of glycosylated antibodies provided herein further comprise milk.
  • the methods provided herein include a step of isolating a population of antibodies from the milk of a transgenic animal. Methods for isolating antibodies from the milk of transgenic animal are known in the art and are described for instance in Pollock et al., Journal of Immunological Methods, Volume 231, Issues 1-2, 10 December 1999, Pages 147-157.
  • the methods provided herein include a step of purifying glycosylated antibodies with a desired amount of galactosylation.
  • the disclosure provides methods comprising administering highly galactosylated antibodies, compositions of highly galactosylated antibodies, populations of antibodies with a high level of galactosylated antibodies or compositions comprising populations of antibodies with a high level of galactosylated antibodies, to a subject in need thereof.
  • the subject has an inflammatory disorder or autoimmune disorder.
  • the inflammatory disorder or autoimmune disorder is rheumatoid arthritis, psoriasis, Crohn's disease, juvenile idiopathic arthritis, ankylozing spondylitis, ulcerative colitis, chronic inflammation, hepatitis, Behcet's disease, Wegener's granulomatosis, or sarcoidosis.
  • the disclosure provides methods for administering any one of antibodies or compositions described herein to a subject in need thereof.
  • the subject has an immune disorder or disorder associated with inflammation.
  • Immune disorders and disorders associated with inflammation include but are not limited, to adult respiratory distress syndrome, arteriosclerosis, asthma, atherosclerosis, cholecystitis, cirrhosis, Crohn's disease, diabetes mellitus, emphysema, hypereosinophilia, inflammation, irritable bowel syndrome, multiple sclerosis, myasthenia gravis, myocardial or pericardial inflammation, osteoarthritis, osteoporosis, pancreatitis, rheumatoid arthritis, scleroderma, colitis, systemic lupus erythematosus, lupus nephritis, diabetes mellitus, inflammatory bowel disease, celiac disease, an autoimmune thyroid disease, Addison's disease, Sjogren'
  • the disclosure provides methods for administering any one of antibodies or compositions described herein to a subject in need thereof.
  • a subject in need of treatments is a subject with a disease characterized by a dysregulation of TNF levels.
  • Disease characterized by a dysregulation of TNF levels include Alzheimer, cancer and depression.
  • compositions which comprise an amount of an antibody or population of antibodies and a pharmaceutically acceptable vehicle, diluent or carrier.
  • the compositions comprise milk.
  • the disclosure provides a method of treating a subject, comprising administering to a subject a composition provided in an amount effective to treat a disease the subject has or is at risk of having is provided.
  • the subject is a human.
  • the subject is a non-human animal, e.g., a dog, cat, horse, cow, pig, sheep, goat or primate.
  • therapeutically effective or “an amount effective to treat” denotes the amount of antibody or of a composition needed to inhibit or reverse a disease condition (e.g., to treat the inflammation). Determining a therapeutically effective amount specifically depends on such factors as toxicity and efficacy of the medicament. These factors will differ depending on other factors such as potency, relative bioavailability, patient body weight, severity of adverse side-effects and preferred mode of administration. Toxicity may be determined using methods well known in the art. Efficacy may be determined utilizing the same guidance. Efficacy, for example, can be measured by a decrease in inflammation. A pharmaceutically effective amount, therefore, is an amount that is deemed by the clinician to be toxicologically tolerable, yet efficacious.
  • Dosage may be adjusted appropriately to achieve desired drug (e.g., anti-TNF- alpha antibodies) levels, local or systemic, depending upon the mode of administration. In the event that the response in a subject is insufficient at such doses, even higher doses (or effective higher doses by a different, more localized delivery route) may be employed to the extent that patient tolerance permits. Multiple doses per day are contemplated to achieve appropriate systemic levels of antibodies. Appropriate systemic levels can be determined by, for example, measurement of the patient's peak or sustained plasma level of the drug.
  • the amount of antibody or pharmaceutical composition administered to a subject is 50 to 500 mg/kg, 100 to 400 mg/kg, or 200 to 300 mg/kg per week. In one embodiment the amount of antibody or pharmaceutical composition administered to a subject is 250 mg/kg per week. In some embodiments, an initial dose of 400 mg/kg is administered a subject the first week, followed by administration of 250 mg/kg to the subject in subsequent weeks. In some embodiments the administration rate is less than 10 mg/min. In some embodiments, administration of the antibody or pharmaceutical composition to a subject occurs at least one hour prior to treatment with another therapeutic agent. In some embodiments, a pre-treatment is administered prior to administration of the antibody or pharmaceutical composition.
  • compositions provided are employed for in vivo applications.
  • the compositions used may be in the dosage form of solid, semi-solid or liquid such as, e.g., tablets, pills, powders, capsules, gels, ointments, liquids, suspensions, or the like.
  • the compositions are administered in unit dosage forms suitable for single administration of precise dosage amounts.
  • the compositions may also include, depending on the formulation desired, pharmaceutically acceptable carriers or diluents, which are defined as aqueous-based vehicles commonly used to formulate pharmaceutical compositions for animal or human administration. The diluent is selected so as not to affect the biological activity of the human recombinant protein of interest.
  • diluents examples include distilled water, physiological saline, Ringer's solution, dextrose solution, and Hank's solution.
  • the same diluents may be used to reconstitute a lyophilized recombinant protein of interest.
  • the diluents may be distilled water, physiological saline, Ringer's solution, dextrose solution, and Hank's solution.
  • the same diluents may be used to reconstitute a lyophilized recombinant protein of interest.
  • the diluents are distilled water, physiological saline, Ringer's solution, dextrose solution, and Hank's solution.
  • the same diluents may be used to reconstitute a lyophilized recombinant protein of interest.
  • the diluents may be used to reconstitute a lyophilized recombinant protein of interest.
  • composition may also include other medicinal agents, pharmaceutical agents, carriers, adjuvants, nontoxic, non-therapeutic, non-immunogenic stabilizers, etc. Effective amounts of such diluent or carrier are amounts which are effective to obtain a
  • compositions provided herein are sterile.
  • Administration during in vivo treatment may be by any number of routes, including oral, parenteral, intramuscular, intranasal, sublingual, intratracheal, inhalation, ocular, vaginal, and rectal.
  • Intracapsular, intravenous, and intraperitoneal routes of administration may also be employed.
  • the route of administration varies depending on the disorder to be treated.
  • the compositions or antibodies herein may be administered to a subject via oral, parenteral or topical administration.
  • the compositions or antibodies herein are administered by intravenous infusion.
  • compositions when it is desirable to deliver them systemically, may be formulated for parenteral administration by injection, e.g., by bolus injection or continuous infusion.
  • Formulations for injection may be presented in unit dosage form, e.g., in ampoules or in multi-dose containers, with an added preservative.
  • the compositions may take such forms as suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents.
  • compositions for parenteral administration include aqueous solutions of the active compositions in water soluble form.
  • suspensions of the active compositions may be prepared as appropriate oily injection suspensions.
  • Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil, or synthetic fatty acid esters, such as ethyl oleate or triglycerides, or liposomes.
  • Aqueous injection suspensions may contain substances which increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol, or dextran.
  • the suspension may also contain suitable stabilizers or agents which increase the solubility of the compositions to allow for the preparation of highly concentrated solutions.
  • the active compositions may be in powder form for constitution with a suitable vehicle, e.g., sterile pyrogen-free water, before use.
  • the pharmaceutical compositions may take the form of, for example, tablets or capsules prepared by conventional means with pharmaceutically acceptable excipients such as binding agents (e.g., pregelatinised maize starch,
  • polyvinylpyrrolidone or hydroxypropyl methylcellulose e.g., polyvinylpyrrolidone or hydroxypropyl methylcellulose
  • fillers e.g., lactose,
  • microcrystalline cellulose or calcium hydrogen phosphate may be coated by methods well known in the art.
  • Liquid preparations for oral administration may take the form of, for example, solutions, syrups or suspensions, or they may be presented as a dry product for constitution with water or other suitable vehicle before use.
  • Such liquid preparations may be prepared by conventional means with pharmaceutically acceptable additives such as suspending agents (e.g., sorbitol syrup, cellulose derivatives or hydrogenated edible fats); emulsifying agents (e.g., lecithin or acacia); non-aqueous vehicles (e.g., almond oil, oily esters, ethyl alcohol or fractionated vegetable oils); and preservatives (e.g., methyl or propyl- p-hydroxybenzoates or sorbic acid).
  • suspending agents e.g., sorbitol syrup, cellulose derivatives or hydrogenated edible fats
  • emulsifying agents e.g., lecithin or acacia
  • non-aqueous vehicles e.g., almond oil, oily esters, ethyl alcohol or fractionated vegetable oils
  • preservatives e.g., methyl or propyl- p-hydroxybenzoates or sorbic acid
  • the preparations may also contain buffer
  • the chemical modification contemplated is the attachment of at least one molecule to the antibodies, where said molecule permits (a) inhibition of proteolysis; and (b) uptake into the blood stream from the stomach or intestine. Also desired is the increase in overall stability of the antibodies and increase in circulation time in the body.
  • examples of such molecules include: polyethylene glycol, copolymers of ethylene glycol and propylene glycol, carboxymethyl cellulose, dextran, polyvinyl alcohol, polyvinyl pyrrolidone and polyproline. Abuchowski and Davis, 1981, “Soluble Polymer-Enzyme Adducts" In: Enzymes as Drugs, Hocenberg and Roberts, eds., Wiley-Interscience, New York, NY, pp.
  • the location of release may be the stomach, the small intestine (the duodenum, the jejunum, or the ileum), or the large intestine.
  • the release will avoid the deleterious effects of the stomach environment, either by protection of the antibody or by release of the biologically active material beyond the stomach environment, such as in the intestine.
  • compositions may take the form of tablets or lozenges formulated in conventional manner.
  • compositions for use according to the present disclosure may be conveniently delivered in the form of an aerosol spray presentation from pressurized packs or a nebulizer, with the use of a suitable propellant, e.g.,
  • the dosage unit may be determined by providing a valve to deliver a metered amount.
  • Capsules and cartridges of e.g. gelatin for use in an inhaler or insufflator may be formulated containing a powder mix of the
  • compositions and a suitable powder base such as lactose or starch.
  • compositions can be delivered to the lungs of a mammal while inhaling and traverses across the lung epithelial lining to the blood stream.
  • Contemplated for use in the practice of this disclosure are a wide range of mechanical devices designed for pulmonary delivery of therapeutic products, including but not limited to nebulizers, metered dose inhalers, and powder inhalers, all of which are familiar to those skilled in the art.
  • Nasal delivery of a pharmaceutical composition disclosed herein is also contemplated.
  • Nasal delivery allows the passage of a pharmaceutical composition of the present disclosure to the blood stream directly after administering the therapeutic product to the nose, without the necessity for deposition of the product in the lung.
  • Formulations for nasal delivery include those with dextran or cyclodextran.
  • compositions may also be formulated in rectal or vaginal compositions such as suppositories or retention enemas, e.g., containing conventional suppository bases such as cocoa butter or other glycerides.
  • compositions also may comprise suitable solid or gel phase carriers or excipients.
  • suitable solid or gel phase carriers or excipients include but are not limited to calcium carbonate, calcium phosphate, various sugars, starches, cellulose derivatives, gelatin, and polymers such as polyethylene glycols.
  • Suitable liquid or solid pharmaceutical preparation forms are, for example, aqueous or saline solutions for inhalation, microencapsulated, encochleated, coated onto microscopic gold particles, contained in liposomes, nebulized, aerosols, pellets for implantation into the skin, or dried onto a sharp object to be scratched into the skin.
  • the pharmaceutical compositions also include granules, powders, tablets, coated tablets, (micro)capsules, suppositories, syrups, emulsions, suspensions, creams, drops or preparations with protracted release of active compositions, in whose preparation excipients and additives and/or auxiliaries such as disintegrants, binders, coating agents, swelling agents, lubricants, flavorings, sweeteners or solubilizers are customarily used as described above.
  • the pharmaceutical compositions are suitable for use in a variety of drug delivery systems. For a brief review of methods for drug delivery, see Langer, Science 249: 1527-1533, 1990, which is incorporated herein by reference.
  • the antibodies and optionally other therapeutics may be administered per se (neat) or in the form of a pharmaceutically acceptable salt.
  • the salts should be pharmaceutically acceptable, but non-pharmaceutically acceptable salts may conveniently be used to prepare pharmaceutically acceptable salts thereof.
  • Such salts include, but are not limited to, those prepared from the following acids: hydrochloric, hydrobromic, sulphuric, nitric, phosphoric, maleic, acetic, salicylic, p-toluene sulphonic, tartaric, citric, methane sulphonic, formic, malonic, succinic, naphthalene-2- sulphonic, and benzene sulphonic.
  • such salts can be prepared as alkaline metal or alkaline earth salts, such as sodium, potassium or calcium salts of the carboxylic acid group.
  • Suitable buffering agents include: acetic acid and a salt (1-2% w/v); citric acid and a salt (1-3% w/v); boric acid and a salt (0.5-2.5% w/v); and phosphoric acid and a salt (0.8-2% w/v).
  • Suitable preservatives include benzalkonium chloride (0.003-0.03% w/v);
  • chlorobutanol (0.3-0.9% w/v); parabens (0.01-0.25% w/v) and thimerosal (0.004-0.02% w/v).
  • compositions of the disclosure contain an effective amount of the antibodies and optionally therapeutic agents included in a pharmaceutically-acceptable carrier.
  • pharmaceutically-acceptable carrier means one or more compatible solid or liquid filler, diluents or encapsulating substances which are suitable for administration to a human or other vertebrate animal.
  • carrier denotes an organic or inorganic ingredient, natural or synthetic, with which the active ingredient is combined to facilitate the application.
  • the components of the pharmaceutical compositions also are capable of being commingled with the compositions of the present disclosure, and with each other, in a manner such that there is no interaction which would substantially impair the desired pharmaceutical efficiency.
  • the therapeutic agent(s), including specifically but not limited to the antibodies, may be provided in particles.
  • Particles as used herein means nano or microparticles (or in some instances larger) which can consist in whole or in part of the antibody or other therapeutic agents administered with the antibody.
  • the particle may include, in addition to the therapeutic agent(s), any of those materials routinely used in the art of pharmacy and medicine, including, but not limited to, erodible, nonerodible, biodegradable, or
  • the particles may be microcapsules which contain the antibody in a solution or in a semi-solid state.
  • the particles may be of virtually any shape.
  • the disclosure provides methods for production of highly galactosylated anti-TNF-alpha antibodies and populations with high levels of galactosylated antibodies.
  • the disclosure provides a method for producing a population of antibodies, comprising: expressing the population of antibodies in mammary gland epithelial cells of a non-human mammal such that a population of antibodies is produced, wherein the antibody is an anti-TNF-alpha antibody, and wherein the level of galactosylation of the antibodies in the population is at least 70%.
  • the anti-TNF-alpha antibody is adalimumab.
  • the mammary gland epithelial cells are in culture and are transfected with a nucleic acid that comprises a sequence that encodes the antibody.
  • the nucleic acid comprise SEQ ID NO:3 and SEQ ID NO:4.
  • the mammary gland epithelial cells are in a non-human mammal engineered to express a nucleic acid that comprises a sequence that encodes the antibody in its mammary gland.
  • the mammary gland epithelial cells are goat, sheep, bison, camel, cow, pig, rabbit, buffalo, horse, rat, mouse or llama mammary gland epithelial cells.
  • the mammary gland epithelial cells are goat mammary gland epithelial cells.
  • the disclosure provides mammary gland epithelial cells that express the highly galactosylated anti-TNF-alpha antibodies or populations with high levels of galactosylated antibodies disclosed herein.
  • the disclosure provides a transgenic non-human mammal comprising mammary gland epithelial cells that express the highly galactosylated anti-TNF-alpha antibodies or populations with high levels of galactosylated antibodies disclosed herein.
  • the disclosure provides a method for the production of a glycosylated antibody or population of glycosylated antibodies, the process comprising expressing in the milk of a transgenic non-human mammal a glycosylated antibody encoded by a nucleic acid construct.
  • the mammalian mammary epithelial cells are of a non-human mammal engineered to express the antibody in its milk.
  • the mammalian mammary epithelial cells are mammalian mammary epithelial cells in culture.
  • the method comprises: producing a population of glycosylated antibodies in mammary gland epithelial cells such that the population of glycosylated antibodies produced comprises a specific percentage of galactosylation (e.g., at least 70%, at least 80%, at least 90%, or higher).
  • the antibody is an anti-TNF-alpha antibody.
  • the glycosylated antibodies comprise a heavy chain comprising SEQ ID NO: 1 and a light chain comprising SEQ ID NO:2. In some embodiments, this method is performed in vitro. In other embodiments, this method is performed in vivo, e.g., in the mammary gland of a transgenic goat.
  • the methods above further comprise steps for inducing lactation.
  • the methods further comprise additional isolation and/or purification steps.
  • the methods further comprise steps for comparing the glycosylation pattern of the antibodies obtained with antibodies produced in cell culture, e.g. non-mammary cell culture.
  • the methods further comprise steps for comparing the glycosylation pattern of the antibodies obtained to antibodies produced by non-mammary epithelial cells.
  • Such cells can be cells of a cell culture.
  • the glycosylation pattern is the amount of galactose present on an antibody or population of antibodies.
  • the method further comprises comparing the percentage of galactosylation present in the population of glycosylated antibodies to the percentage of galactosylation present in a population of glycosylated antibodies produced in cell culture, e.g. non-mammary cell culture.
  • Experimental techniques for assessing the glycosylation pattern of the antibodies can be any of those known to those of ordinary skill in the art or as provided herein, such as below in the Examples. Such methods include, e.g., liquid chromatography mass spectrometry, tandem mass spectrometry, and Western blot analysis.
  • the antibodies can be obtained, in some embodiments, by collecting the antibodies from the milk of a transgenic animal produced as provided herein or from an offspring of said transgenic animal.
  • the antibodies produced by the transgenic mammal is produced at a level of at least 1 gram per liter of milk produced.
  • the method according to the invention allows the production of more than 4 grams per liter of milk produced, advantageously more than 5, 10, 15, 20, 25, 30, 35, grams per liter, advantageously up to 70 grams per liter.
  • Transgenic goats were generated that include the nucleic acid sequence encoding the adalimumab antibody in their genome.
  • the goats producing adalimumab were generated using traditional micoinjection techniques (See e.g., US 7,928,064).
  • the cDNA encoding the heavy and light chain (SEQ ID NO:3 and SEQ ID NO:4) was synthesized based on the published amino acid sequence (US Patent 6,090,382). These DNA sequences were ligated with the beta casein expression vector to yield constructs BC2601 HC and BC2602 LC.
  • the nucleic acid sequence encoding adalimumab is under the control of a promoter facilitating the expression of adalimumab in the mammary gland of the goats.
  • the prokaryotic sequences were removed and the DNA microinjected into pre-implantation embryos of the goat. These embryos were then transferred to pseudo pregnant females. The progeny that resulted were screened for the presence of the transgenes. Those that carried both chains were identified as transgenic founders.
  • the founder animals were bred. Following pregnancy and parturition they were milked. The time course was in days starting lactation after parturation (e.g., day 3, day 7, day 11). The adalimumab antibody was purified from the milk at each time point and characterized as described herein.
  • TNF-cc 5 ⁇ g/ml of TNF-cc was coated overnight at 4 °C in a 96 well plate in 100 ⁇ of PBS per well. After blocking of nonspecific sites (incubation with 200 ⁇ PBS/1% BSA, lh RT), transgenically produced adalimumab or deglycosylated adalimumab was added at various concentrations (0 to 10 ⁇ g/ml) for 20 min in PBS/1% BSA. After washing, the binding of transgenically produced adalimumab to coated TNF-cc was evaluated by the addition of a goat anti-human IgG (H+L) coupled to peroxidase, followed by substrate ( ⁇ 2 0 2 and tetramethylbenzidine).
  • H+L goat anti-human IgG
  • NK cells Natural killer cells
  • the NK cells were purified by negative depletion (Miltenyi) from the peripheral blood of healthy donors.
  • the NK cells were then incubated with variable concentrations (0 to 83 ⁇ g/ml) of transgenically produced adalimumab and the anti-CD 16 antibody 3G8 conjugated to a fluorochrome (3G8-PE), at a fixed concentration.
  • 3G8-PE fluorochrome
  • the mean fluorescence values (MFI) observed were expressed as the percent binding, where a value of 100% corresponds the value observed without the tested transgenically produced adalimumab that thus corresponds to maximum 3G8 binding.
  • a value of 0% corresponds to the MFI in the absence of the antibody 3G8.
  • IC 50 the antibody concentration required to induce inhibition of 3G8 binding by 50% of Imax, were calculated using PRISM software. The results are shown in Figure 11.
  • Jurkat-CD16 cells were incubated with 10 ⁇ g/ml of transgenically produced adalimumab or the deglycosylated version thereof for 20 min at 4 °C. After washing, 100 ⁇ of TNF-a was added to the cell pellet at a final concentration of 1 ⁇ g/ml, 20 min at 4°C. After subsequent washing, the cells were incubated with 5 ⁇ g/ml of a biotinylated goat anti- human TNF-a antibody, 20 min at 4°C. After another round of washing, the binding of TNF- ⁇ was visualized by the addition of streptavidin coupled to PE-fluorochrome for 20 min at 4°C. Samples were analyzed by flux cytometry. The results are shown in Figure 12.
  • Example 1 Transgenically produced adalimumab
  • glycosylation pattern of the adalimumab antibodies produced in the milk of transgenic goats was determined by releasing the N-glycans from antibody and running the released oligosaccharides on a column ("oligosaccharide signature").
  • gures 1-4 and 6-8 show the N-glycan oligosaccharides released from the transgenically produced adalimumab antibody from goat #1 ( Figures 1-4) and goat #2 ( Figures 6-8).
  • the monosaccharide groups are depicted as follows:
  • Figure 1 shows a representative chromatogram of N-glycan oligosaccharides released from the transgenic adalimumab antibody produced in the milk of goat #1.
  • chromatogram shows that of the fourteen major N-glycan oligosaccharides produced, twelve have at least one galactose in the N-glycan chain, with four oligosaccharides having two galactoses. Only two of the oligosaccharides are purely oligomannose (See peak 1 and peak 3).
  • Figure 1 also shows that of the fourteen major oligosaccharides produced, nine are fucosylated All of the fucosylated oligosaccharides are also galactosylated.
  • Figures 2-4 show chromatograms of N-glycan oligosaccharides released from the transgenic adalimumab antibody produced in the milk of goat #1 as harvested after 7 days of lactation (Figure 2), 17 days of lactation (Figure 3), and 32 days of lactation (Figure 4).
  • Figure 5 also shows a tabulation of the overall percentage of mono-galactosylation, percentage of bi- galactosylation, percentage of total galactosylation (mono-galactosylation + bi- galactosylation), percentage of galactosylation as calculated according to the formula provided above, percentage of fucosylation as calculated according to the formula provided above, the ratio of galactosylation to fucosylation and the percentage of glycan structures with at least one sialic acid (% sialylation).
  • Table 1 N-glycan oligosaccharides isolated from adalimumab antibodies from goat #1 day 7 day 17 day 32 average mono-Gal (%): 30.8 42.9 44.1 39.2
  • Figures 6-8 show chromatograms of N-glycan oligosaccharides released from the transgenically produced adalimumab antibody in the milk of goat #2 as harvested after 3 days of lactation (Figure 6), 11 days of lactation (Figure 7), and 21 days of hormone induced lactation (Figure 8).
  • Figure 9 also shows a tabulation of the overall percentage of mono-galactosylation, percentage of bi- galactosylation, percentage of total galactosylation (mono-galactosylation + bi- galactosylation), percentage of galactosylation as calculated according to the formula provided above, percentage of fucosylation as calculated according to the formula provided above, the ratio of galactosylation to fucosylation and the percentage of glycan structures with at least one sialic acid (% sialylation).
  • the results are also summarized below:
  • FIG 10 shows that transgenically produced adalimumab can bind soluble TNF- alpha coated in 96-well plates. Transgencially produced adalimumab that was aglycosylated was able to bind soluble TNF-alpha as well (data not shown).
  • FIG 11 shows that transgenically produced adalimumab binds CD 16 expressed by natural killer (NK) cells.
  • the binding was shown in a competition experiment with the anti- CD 16 binding antibody 3G8.
  • the binding of a transgenically produced adalimumab to CD 16 is stronger than the binding of a poorly galactosylated antibody to CD16 (data not shown).
  • the transgenically produced adalimumab is therefore expected to have a higher ADCC activity.
  • Figure 12 shows that a transgenically produced adalimumab antibody binds both soluble TNF-alpha and Jurkat expressing CD 16 cells while an aglycosylated version of the transgenically produced adalimumab antibody does not.
  • the transgenically produced adalimumab antibody therefore is expected to show ADCC activity while the aglycosylated antibody does not.
  • Example 3 Glycosylation analysis of transgenically produced adalimumab in additional animals
  • Adalimumab was transgenically produced in multiple different goats during natural lactation.
  • the glycan profiles for transgenically produced adalimumab were examined.
  • Figure 13 provides a summary of percentages of different glycan forms present in populations of transgenically produced adalimumab antibody from the nine different goats listed in Table 3.
  • Figure 14 shows a summary of the percentages of N-glycan oligosaccharides of populations of transgenically produced adalimumab antibodies from goat # 10 and goat # 1 during hormone induced lactation.
  • Figure 15 shows a summary of N-glycan oligosaccharides of populations of transgenically produced adalimumab antibodies from eight different goats, goats # 2-9.
  • the data presented in Figure 15 is summarized in Tables 4-11.
  • Table 4 N-glycan oligosaccharides isolated from adalimumab antibodies from goat # 2 day 29
  • Biological features of transgenically produced adalimumab from goat milk were compared to Adalimumab (Humira). Relative Kd, CD16-binding and FcRn binding were investigated. Furthermore, Complement Dependent Cytotoxicity (CDC) and neutralisation of TNF-a mediated cellular cytotoxicity were evaluated on membrane TNF-a transfected Jurkat cells.
  • CDC Complement Dependent Cytotoxicity
  • CDC activity showed an advantage with transgenically produced adalimumab compared to Humira antibody (196 vs 399 ng/ml),.
  • Anti CD 160 purification n° 829 10 049, used as negative control baby rabbit serum (Cederlane)
  • Membrane TNF-a transfected Jurkat cells clone 2B3 were obtained by cloning (used for Relative Kd assay and CDC)
  • TNF-a transfected Jurkat cells were incubated with 100 ⁇ of anti-TNF Alexa- 488 coupled antibodies at different concentrations (0 to 100 ⁇ /ml, final concentration) at 4°C for 30 minutes. After washing, a goat anti-human Fc gamma coupled to phycoerythrin (100 ⁇ of a dilution of 1: 100) was added at 4°C for 30 minutes. The cells were washed and mean of fluorescence intensity (MFI) studied by flow cytometry. Arbitrary Kd was calculated using PRISM software.
  • MFI fluorescence intensity
  • NK cells were isolated from peripheral blood mononuclear cells (PBMC) using the NK Cell Isolation Kit from Myltenyi then incubated with variable concentrations (0 to 83 ⁇ g/ml) of the tested antibodies simultaneously with the mouse anti-CD 16 mAb 3G8-PE used at a fixed concentration. After washing, the binding of 3G8-PE to CD 16 expressed by NK cell was evaluated by flow cytometry.
  • PBMC peripheral blood mononuclear cells
  • variable concentrations (0 to 83 ⁇ g/ml) of the tested antibodies simultaneously with the mouse anti-CD 16 mAb 3G8-PE used at a fixed concentration.
  • MFI mean fluorescence values
  • RTX-Alexa Alexa 488
  • MFI mean fluorescence values
  • Membrane TNF-cc transfected Jurkat cells (mbTNF-cc Jurkat) were incubated with increasing concentrations of anti-TNF antibodies (0 to 5000 ng/ml) in the presence of baby rabbit serum as a source of complement (dilution to 1/10). After 2 hours of incubation at 37 °C, the quantity of LDH released in the supernatant by the lysed target cells was measured (Roche Applied Sciences Cytotoxicity Detection Kit).
  • TNF-a (20ng/ml) pretreated with serial dilutions of tested antibodies (0 - 1000 ng/ml) was incubated for 18 h with L929 cells in the presence of actinomycin D (2 ⁇ ) at 37°C for 16h. Then 20 ⁇ /well of Cell titer 96® aqueous One solution Cell Proliferation Assay (MTS) was added for a further lh to determine the number of surviving cells by colorimetric assay. The plates were read at 490 nm and results (OD) were expressed as a function of antibody concentrations. The neutralizing titer expressed as the reciprocal of the antibody concentration that neutralizes 50% of TNF-a activity was calculated using PRISM software.
  • TNF-a Tumor Necrosis Factor alpha
  • Binding of anti-TNF antibodies to membrane TNF-a transfected Jurkat cells clone 2B3 is expressed as the mean of fluorescence intensity (MFI) for each antibody concentration tested (0-10 ⁇ g/ml).
  • MFI fluorescence intensity
  • Arbitrary Kd as described below does not represent the real affinity value (nM), but gives an order of comparable magnitude for the affinity of the studied antibodies.
  • IC50 values represent the antibody concentration required to induce 50% of inhibition of 3G8 binding on CD16 receptor expressed by NK cells.
  • TG-Humira Transgenically produced adalimumab
  • Humira antibody bind to CD 16 receptor with an IC50 value of 25.7 ⁇ g/ml and 56.7 ⁇ g/ml respectively.
  • IC50 antibody concentration required to induce 50% of inhibition of 3G8 binding
  • Figure 17 after modeling of the curve by the PRISM software.
  • IC 50 antibody concentration required to induce 50% of inhibition of Rituximab binding
  • Figure 18 after modeling of the curve by the PRISM software.
  • FIG. 19 The mean of two assays is presented in Figure 19 and the corresponding data are shown in Table 18.
  • the CDC activity is expressed as the percent of lysis for each antibody concentration tested (0-5000 ng/ml).
  • Figure 19 shows that transgenically produced adalimumab (TG-Humira; maximal lysis : 34%) and Humira (maximal lysis : 33%) antibodies induce a comparable lysis of mbTNF-cc Jurkat by CDC activity).
  • TNF-cc-mediated cytotoxicity in L929 cells treated with 20 ng/ml of human TNF-cc was effectively neutralized by both transgenically produced adalimumab (TG-humira) and Humira mAbs in a comparable dose dependent manner.
  • Table 20 Maximal neutralization and 50% value (antibody concentration required to achieve 50% of the Humira plateau value), corresponding to Figure 20, after sigmoid modeling of the curve by the PRISM software.
  • Table 21 Original data from each of the three experiments performed with the antibodies tested and used for designing Figure 20 with PRISM software.
  • Example 5 ADCC activity of transgenically produced adalimumab
  • ADCC activity of transgenically produced adalimumab was compared to ADCC activity of Humira.
  • Figure 21 shows that transgenically produced adalimumab demonstrated higher ADCC activity than Humira at three different concentrations: 0.5 ng/ml, 50 ng/ml and
  • NK effector cells isolated from a healthy donors NK effector cells were isolated from the peripheral blood samples from healthy donors using a negative depletion kit (Miltenyi Biotec).
  • Jurkat cells transfected with mTNF were plated in 96 well plates and incubated at 4°C with increasing concentrations of anti-TNF antibodies (0,5; 50 and 5000ng/ml). After 2 hours, the isolated NK cells were added and incubated for another 4 hours at 37 °C. Lysis of target cells induced by the tested anti-TNF antibodies was measured chromogenically by quantifying the intracellular enzyme lactate dehydrogenase (LDH) released into the supernatant by the lysed target cells (Roche). The percent lysis was calculated according to the following formula :
  • % lysis [(ER - SR) / (100 - SR)] - [(NC - SR) / (100 - SR)]
  • CD 16 binding activity of transgenically produced adalimumab was measured by a competitive assay using NK cells and compared to Humira.
  • Figure 22 presents an inhibition curve showing that transgenically produced adalimumab from nine different goats all bound to CD16 to a greater extent than Humira in NK cells.
  • Figure 23 presents IC50 values from CD 16 competitive binding assays. IC50 values were 1.5-5 x lower for transgenically produced adalimumab than for Humira.
  • CDC activity of transgenically produced adalimumab was compared to that of Humira.
  • Figure 24 presents a dose response curve showing that transgenically produced adalimumab from eight out of nine goats tested had greater CDC activity than Humira.
  • Figure 25 presents the EC50 values in ng/ml for the CDC activity assay.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Immunology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Engineering & Computer Science (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Epidemiology (AREA)
  • Mycology (AREA)
  • Microbiology (AREA)
  • Rheumatology (AREA)
  • Dermatology (AREA)
  • Endocrinology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Physical Education & Sports Medicine (AREA)
  • Orthopedic Medicine & Surgery (AREA)
  • Pain & Pain Management (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
PCT/IB2014/000692 2013-02-13 2014-02-13 Highly galactosylated anti-tnf-alpha antibodies and uses thereof Ceased WO2014125374A2 (en)

Priority Applications (15)

Application Number Priority Date Filing Date Title
CA2900909A CA2900909A1 (en) 2013-02-13 2014-02-13 Highly galactosylated anti-tnf-.alpha. antibodies and uses thereof
EP19194946.0A EP3594231A1 (en) 2013-02-13 2014-02-13 Highly galactosylated anti-tnf-alpha antibodies and uses thereof
JP2015557532A JP2016508515A (ja) 2013-02-13 2014-02-13 高ガラクトシル化抗TNF−α抗体およびその使用
EP19194945.2A EP3594230A1 (en) 2013-02-13 2014-02-13 Highly galactosylated anti-tnf-alpha antibodies and uses thereof
MX2015010427A MX2015010427A (es) 2013-02-13 2014-02-13 Anticuerpos anti-tnf-alfa altamente galactosilados y sus usos.
BR112015019341A BR112015019341A2 (pt) 2013-02-13 2014-02-13 Anticorpo anti-tnf-alfa, composição que compreende o anticorpo, método para produzir uma população de anticorpos, células epiteliais da glândula mamária, mamífero não humano transgênico, e, composição de anticorpo anti-tnf monoclonal
EP14731999.0A EP2956480B1 (en) 2013-02-13 2014-02-13 Highly galactosylated anti-tnf-alpha antibodies and uses thereof
ES14731999T ES2755181T3 (es) 2013-02-13 2014-02-13 Anticuerpos anti-TNF-alfa altamente galactosilados y usos de los mismos
AU2014217561A AU2014217561B2 (en) 2013-02-13 2014-02-13 Highly galactosylated anti-TNF-alpha antibodies and uses thereof
CN201480020371.4A CN105308068A (zh) 2013-02-13 2014-02-13 高度半乳糖基化的抗TNF-α抗体及其用途
US14/767,117 US10174110B2 (en) 2013-02-13 2014-02-13 Highly galactosylated anti-TNF-α antibodies and uses thereof
KR1020157025005A KR20160002713A (ko) 2013-02-13 2014-02-13 고도로 갈락토실화된 항-tnf-알파 항체 및 이의 용도
IL240443A IL240443A0 (en) 2013-02-13 2015-08-09 Antibodies against tnf-a with a high level of galactosylation and their uses
US16/192,273 US20190309058A1 (en) 2013-02-13 2018-11-15 Highly galactosylated anti-tnf-alpha antibodies and uses thereof
US16/192,214 US20190309057A1 (en) 2013-02-13 2018-11-15 Highly galactosylated anti-tnf-alpha antibodies and uses thereof

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201361764475P 2013-02-13 2013-02-13
US61/764,475 2013-02-13

Related Child Applications (3)

Application Number Title Priority Date Filing Date
US14/767,117 A-371-Of-International US10174110B2 (en) 2013-02-13 2014-02-13 Highly galactosylated anti-TNF-α antibodies and uses thereof
US16/192,273 Continuation US20190309058A1 (en) 2013-02-13 2018-11-15 Highly galactosylated anti-tnf-alpha antibodies and uses thereof
US16/192,214 Continuation US20190309057A1 (en) 2013-02-13 2018-11-15 Highly galactosylated anti-tnf-alpha antibodies and uses thereof

Publications (2)

Publication Number Publication Date
WO2014125374A2 true WO2014125374A2 (en) 2014-08-21
WO2014125374A3 WO2014125374A3 (en) 2014-12-31

Family

ID=50980321

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/IB2014/000692 Ceased WO2014125374A2 (en) 2013-02-13 2014-02-13 Highly galactosylated anti-tnf-alpha antibodies and uses thereof

Country Status (14)

Country Link
US (3) US10174110B2 (enExample)
EP (3) EP3594230A1 (enExample)
JP (2) JP2016508515A (enExample)
KR (1) KR20160002713A (enExample)
CN (1) CN105308068A (enExample)
AR (1) AR094780A1 (enExample)
AU (1) AU2014217561B2 (enExample)
BR (1) BR112015019341A2 (enExample)
CA (1) CA2900909A1 (enExample)
ES (1) ES2755181T3 (enExample)
IL (1) IL240443A0 (enExample)
MX (1) MX2015010427A (enExample)
TW (1) TW201506041A (enExample)
WO (1) WO2014125374A2 (enExample)

Cited By (22)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2956485A2 (en) * 2013-02-13 2015-12-23 Laboratoire Français du Fractionnement et des Biotechnologies Highly galactosylated anti-her2 antibodies and uses thereof
WO2015193622A1 (fr) * 2014-06-18 2015-12-23 Laboratoire Francais Du Fractionnement Et Des Biotechnologies Composition orale d'anticorps anti-tnfalpha
US9365645B1 (en) 2011-04-27 2016-06-14 Abbvie, Inc. Methods for controlling the galactosylation profile of recombinantly-expressed proteins
WO2016156752A1 (fr) 2015-04-02 2016-10-06 Laboratoire Francais Du Fractionnement Et Des Biotechnologies Procédé de purification d'une protéine recombinante thérapeutique à partir d'un lait transgénique
US9499616B2 (en) 2013-10-18 2016-11-22 Abbvie Inc. Modulated lysine variant species compositions and methods for producing and using the same
US9499614B2 (en) 2013-03-14 2016-11-22 Abbvie Inc. Methods for modulating protein glycosylation profiles of recombinant protein therapeutics using monosaccharides and oligosaccharides
US9505833B2 (en) 2012-04-20 2016-11-29 Abbvie Inc. Human antibodies that bind human TNF-alpha and methods of preparing the same
US9512214B2 (en) 2012-09-02 2016-12-06 Abbvie, Inc. Methods to control protein heterogeneity
US9522953B2 (en) 2013-10-18 2016-12-20 Abbvie, Inc. Low acidic species compositions and methods for producing and using the same
US9550826B2 (en) 2013-11-15 2017-01-24 Abbvie Inc. Glycoengineered binding protein compositions
US9598667B2 (en) 2013-10-04 2017-03-21 Abbvie Inc. Use of metal ions for modulation of protein glycosylation profiles of recombinant proteins
US9683033B2 (en) 2012-04-20 2017-06-20 Abbvie, Inc. Cell culture methods to reduce acidic species
US9688752B2 (en) 2013-10-18 2017-06-27 Abbvie Inc. Low acidic species compositions and methods for producing and using the same using displacement chromatography
US9708400B2 (en) 2012-04-20 2017-07-18 Abbvie, Inc. Methods to modulate lysine variant distribution
US9708399B2 (en) 2013-03-14 2017-07-18 Abbvie, Inc. Protein purification using displacement chromatography
EP3257866A1 (en) * 2016-06-17 2017-12-20 Academisch Medisch Centrum Modified anti-tnf antibody and use thereof in the treatment of ibd
WO2018019900A1 (fr) 2016-07-29 2018-02-01 Laboratoire Francais Du Fractionnement Et Des Biotechnologies Composition orale d'anticorps anti-tnf alpha
US10174110B2 (en) 2013-02-13 2019-01-08 Laboratoire Français Du Fractionnement Et Des Biotechnologies Highly galactosylated anti-TNF-α antibodies and uses thereof
EP3581203A1 (en) * 2018-06-11 2019-12-18 Laboratoire Français du Fractionnement et des Biotechnologies Antibodies with increased activity in the digestive tract
CN116903738A (zh) * 2022-08-02 2023-10-20 北京绿竹生物技术股份有限公司 一种低甘露糖型抗人肿瘤坏死因子-α单抗及其用途
US12247076B2 (en) 2015-07-06 2025-03-11 Laboratoire Français Du Fractionnement Et Des Biotechnologies Use of modified Fc fragments in immunotherapy
WO2025264860A2 (en) 2024-06-18 2025-12-26 Yale University Methods of treating post-covid airway disease

Families Citing this family (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8164343B2 (en) 2003-09-05 2012-04-24 Midtronics, Inc. Method and apparatus for measuring a parameter of a vehicle electrical system
ES2811526T3 (es) 2010-12-30 2021-03-12 Lab Francais Du Fractionnement Glicoles como agentes de inactivación de patógenos
US10034921B2 (en) 2013-02-13 2018-07-31 Laboratoire Français Du Fractionnement Et Des Biotechnologies Proteins with modified glycosylation and methods of production thereof
EP3016729B1 (fr) 2013-07-05 2020-03-25 Laboratoire Francais du Fractionnement et des Biotechnologies Societe Anonyme Matrice de chromatographie d'affinité
AU2014332442B2 (en) * 2013-08-26 2019-12-19 Biontech Research And Development, Inc. Nucleic acids encoding human antibodies to Sialyl-Lewis
SG11201700446XA (en) 2014-07-21 2017-02-27 Glykos Finland Oy Production of glycoproteins with mammalian-like n-glycans in filamentous fungi
WO2024124177A2 (en) * 2022-12-09 2024-06-13 Xentria, Inc. Methods of treating sarcoidosis with a tnf-α antibody and associated compositions and methods
AU2024334289A1 (en) 2023-08-25 2026-04-09 Proteologix Us Inc. Anti-il-13 multispecific antibody constructs and uses thereof

Citations (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5545807A (en) 1988-10-12 1996-08-13 The Babraham Institute Production of antibodies from transgenic animals
US5545806A (en) 1990-08-29 1996-08-13 Genpharm International, Inc. Ransgenic non-human animals for producing heterologous antibodies
US5591669A (en) 1988-12-05 1997-01-07 Genpharm International, Inc. Transgenic mice depleted in a mature lymphocytic cell-type
US5598369A (en) 1994-06-28 1997-01-28 Advanced Micro Devices, Inc. Flash EEPROM array with floating substrate erase operation
US5945577A (en) 1997-01-10 1999-08-31 University Of Massachusetts As Represented By Its Amherst Campus Cloning using donor nuclei from proliferating somatic cells
US6090382A (en) 1996-02-09 2000-07-18 Basf Aktiengesellschaft Human antibodies that bind human TNFα
US6150584A (en) 1990-01-12 2000-11-21 Abgenix, Inc. Human antibodies derived from immunized xenomice
WO2003002609A2 (en) 2001-06-28 2003-01-09 Domantis Limited Dual-specific ligand and its use
US20060057638A1 (en) 2004-04-15 2006-03-16 Massachusetts Institute Of Technology Methods and products related to the improved analysis of carbohydrates
WO2006040153A2 (en) 2004-10-13 2006-04-20 Ablynx N.V. Single domain camelide anti -amyloid beta antibodies and polypeptides comprising the same for the treatment and diagnosis of degenarative neural diseases such as alzheimer's disease
US20060127950A1 (en) 2004-04-15 2006-06-15 Massachusetts Institute Of Technology Methods and products related to the improved analysis of carbohydrates
WO2006122786A2 (en) 2005-05-18 2006-11-23 Ablynx Nv Improved nanobodies™ against tumor necrosis factor-alpha
US20080118501A1 (en) 2005-10-21 2008-05-22 Gtc Biotherapeutics, Inc. Antibodies with enhanced antibody-dependent cellular cytotoxicity activity, methods of their production and use
US7928064B2 (en) 1995-02-21 2011-04-19 Gtc Biotherapeutics, Inc. Transgenically produced antithrombin III

Family Cites Families (169)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4399216A (en) 1980-02-25 1983-08-16 The Trustees Of Columbia University Processes for inserting DNA into eucaryotic cells and for producing proteinaceous materials
GB8308235D0 (en) 1983-03-25 1983-05-05 Celltech Ltd Polypeptides
US4816567A (en) 1983-04-08 1989-03-28 Genentech, Inc. Recombinant immunoglobin preparations
US6727405B1 (en) 1986-04-09 2004-04-27 Genzyme Corporation Transgenic animals secreting desired proteins into milk
DE122007000007I2 (de) 1986-04-09 2010-12-30 Genzyme Corp Genetisch transformierte Tiere, die ein gewünschtes Protein in Milch absondern
US5366894A (en) 1986-06-30 1994-11-22 Pharmaceutical Proteins Limited Peptide production
GB8615942D0 (en) 1986-06-30 1986-08-06 Animal & Food Research Council Peptide production
AU7879987A (en) 1986-08-28 1988-03-24 Immunex Corp. Expression of heterologous proteins by transgenic lactating mammals
US4946778A (en) 1987-09-21 1990-08-07 Genex Corporation Single polypeptide chain binding molecules
EP0832981A1 (en) 1987-02-17 1998-04-01 Pharming B.V. DNA sequences to target proteins to the mammary gland for efficient secretion
US5750172A (en) 1987-06-23 1998-05-12 Pharming B.V. Transgenic non human mammal milk
US4873316A (en) 1987-06-23 1989-10-10 Biogen, Inc. Isolation of exogenous recombinant proteins from the milk of transgenic mammals
US5202238A (en) 1987-10-27 1993-04-13 Oncogen Production of chimeric antibodies by homologous recombination
AU4128089A (en) 1988-09-15 1990-03-22 Rorer International (Overseas) Inc. Monoclonal antibodies specific to human epidermal growth factor receptor and therapeutic methods employing same
GB8826446D0 (en) 1988-11-11 1988-12-14 Agricultural & Food Res Peptide production
US5633076A (en) 1989-12-01 1997-05-27 Pharming Bv Method of producing a transgenic bovine or transgenic bovine embryo
CA2351200A1 (en) 1989-12-01 1991-06-13 Gene Pharming Europe Bv Production of recombinant polypeptides by bovine species and transgenic methods
DE4000939A1 (de) 1990-01-15 1991-07-18 Brem Gottfried Prof Dr Dr Verfahren zur antikoerpergewinnung
ATE158021T1 (de) 1990-08-29 1997-09-15 Genpharm Int Produktion und nützung nicht-menschliche transgentiere zur produktion heterologe antikörper
WO1993012227A1 (en) 1991-12-17 1993-06-24 Genpharm International, Inc. Transgenic non-human animals capable of producing heterologous antibodies
DE4028800A1 (de) 1990-09-11 1992-03-12 Behringwerke Ag Gentechnische sialylierung von glykoproteinen
US5648253A (en) 1990-12-20 1997-07-15 Tsi Corporation Inhibitor-resistant urokinase
US5831141A (en) 1991-01-11 1998-11-03 United States Of America As Represented By The Department Of Health And Human Services Expression of a heterologous polypeptide in mammary tissue of transgenic non-human mammals using a long whey acidic protein promoter
US5965789A (en) 1991-01-11 1999-10-12 American Red Cross Engineering protein posttranslational modification by PACE/furin in transgenic non-human mammals
EP0591219B1 (en) 1991-01-11 2001-12-19 American Red Cross Expression of active human protein c in mammary tissue of transgenic animals
EP0597010A4 (en) 1991-07-31 1996-12-27 Rhone Poulenc Rorer Int Transgenic protein production.
US6448469B1 (en) 1991-10-02 2002-09-10 Genzyme Corporation Production of membrane proteins in the milk of transgenic nonhuman mammals
US5714350A (en) 1992-03-09 1998-02-03 Protein Design Labs, Inc. Increasing antibody affinity by altering glycosylation in the immunoglobulin variable region
WO1994019935A1 (en) 1993-03-09 1994-09-15 Genzyme Corporation Isolation of components of interest from milk
DE4326665C2 (de) 1993-08-09 1995-07-13 Biotest Pharma Gmbh Verfahren zur Sterilfiltration von Milch
US5827690A (en) 1993-12-20 1998-10-27 Genzyme Transgenics Corporatiion Transgenic production of antibodies in milk
US5639940A (en) 1994-03-03 1997-06-17 Pharmaceutical Proteins Ltd. Production of fibrinogen in transgenic animals
AU692841B2 (en) 1994-03-09 1998-06-18 Abbott Laboratories Transgenic animals producing oligosaccharides and glycoconjugates
US5750176A (en) 1994-03-09 1998-05-12 Abbott Laboratories Transgenic non-human mammal milk comprising 2'-fucosyl-lactose
WO1995024494A1 (en) 1994-03-09 1995-09-14 Abbott Laboratories Humanized milk
US6204431B1 (en) 1994-03-09 2001-03-20 Abbott Laboratories Transgenic non-human mammals expressing heterologous glycosyltransferase DNA sequences produce oligosaccharides and glycoproteins in their milk
US5780009A (en) 1995-01-20 1998-07-14 Nexia Biotechnologies, Inc. Direct gene transfer into the ruminant mammary gland
US6118045A (en) 1995-08-02 2000-09-12 Pharming B.V. Lysosomal proteins produced in the milk of transgenic animals
GB9517780D0 (en) 1995-08-31 1995-11-01 Roslin Inst Edinburgh Biological manipulation
MX336813B (es) * 1996-02-09 2016-02-02 Abbvie Biotechnology Ltd Anticuerpos humanos que ligan el tnfa humano.
US6268487B1 (en) 1996-05-13 2001-07-31 Genzyme Transgenics Corporation Purification of biologically active peptides from milk
EP0849275A1 (en) 1996-09-26 1998-06-24 Rijksuniversiteit te Leiden Mannosylated peptides
US6271436B1 (en) 1996-10-11 2001-08-07 The Texas A & M University System Cells and methods for the generation of transgenic pigs
US6063905A (en) 1997-01-07 2000-05-16 Board Of Regents, The University Of Texas System Recombinant human IGA-J. chain dimer
CA2281949A1 (en) 1997-02-25 1998-08-27 Genzyme Transgenics Corporation Transgenically produced non-secreted proteins
EP0977837A1 (en) 1997-04-03 2000-02-09 Universite Laval Transgenic expression in genital tract and sexual accessory glands
US6616927B2 (en) 1997-05-29 2003-09-09 Agresearch Limited Processes for production of immunoglobulin A in milk
US6210736B1 (en) 1997-06-17 2001-04-03 Genzyme Transgenics Corporation Transgenically produced prolactin
EP1025244A2 (en) 1997-10-20 2000-08-09 Genzyme Transgenics Corporation NOVEL MODIFIED MSP-1 NUCLEIC ACID SEQUENCES AND METHODS FOR INCREASING mRNA LEVELS AND PROTEIN EXPRESSION IN CELL SYSTEMS
DK1071700T3 (da) 1998-04-20 2010-06-07 Glycart Biotechnology Ag Glykosylerings-modifikation af antistoffer til forbedring af antistofafhængig cellulær cytotoksicitet
US20050181482A1 (en) 2004-02-12 2005-08-18 Meade Harry M. Method for the production of an erythropoietin analog-human IgG fusion proteins in transgenic mammal milk
DE69933216T2 (de) 1998-06-15 2007-09-20 GTC Biotherapeutics, Inc., Framingham Erythropoietin-analog-menschliches serum-albumin fusionsprotein
US20030005468A1 (en) 1998-06-19 2003-01-02 Meade Harry M. Methods and vectors for improving nucleic acid expression
US20040117863A1 (en) 1998-09-18 2004-06-17 Edge Michael D. Transgenically produced fusion proteins
US6580017B1 (en) 1998-11-02 2003-06-17 Genzyme Transgenics Corporation Methods of reconstructed goat embryo transfer
EP1818397A1 (en) 1998-11-02 2007-08-15 Trustees Of Tufts College Methods for cloning animals
US20030177513A1 (en) 1998-11-02 2003-09-18 Yann Echelard Transgenic and cloned mammals
NZ511299A (en) 1998-11-19 2003-02-28 Ppl Therapeutics Scotland Ltd Stabilisation of milk from transgenic animals through expression of a serine proteinase inhibitor and optionally fibrinogen in the mammary gland
US7208576B2 (en) 1999-01-06 2007-04-24 Merrimack Pharmaceuticals, Inc. Non-glycosylated human alpha-fetoprotein, methods of production, and uses thereof
EP1162934A4 (en) 1999-02-22 2005-01-26 Eric F Bernstein COMPOSITIONS AND METHODS FOR PREVENTING PHOTOVAGENING
EP1194570A1 (en) 1999-06-23 2002-04-10 PPL Therapeutics (Scotland) Limited Fusion proteins incorporating lysozyme
HUP0203537A2 (hu) 1999-10-14 2003-02-28 Genzyme Transgenics Corporation Célmolekula transzgénikus állatban történő előállítására és tisztítására szolgáló eljárások
US7414170B2 (en) 1999-11-19 2008-08-19 Kirin Beer Kabushiki Kaisha Transgenic bovines capable of human antibody production
US7067713B2 (en) 2000-01-31 2006-06-27 Pharming Intellectual Property B.V. C1 Inhibitor produced in the milk of transgenic non-human mammals
US20060272036A1 (en) 2000-02-03 2006-11-30 Lennart Hammarstrom Ruminant mhc class-i-like fc receptors
FR2807767B1 (fr) 2000-04-12 2005-01-14 Lab Francais Du Fractionnement Anticorps monoclonaux anti-d
NZ522971A (en) 2000-05-05 2005-02-25 Gtc Biotherapeutics Inc Transgenically produced decorin in the mammary gland of a transgenic animal
US20030046716A1 (en) 2000-06-19 2003-03-06 Yann Echelard Transgenically produced platelet derived growth factor
ES2252261T3 (es) 2000-06-28 2006-05-16 Glycofi, Inc. Metodos para producir glicoproteinas modificadas.
US6924412B1 (en) 2000-07-21 2005-08-02 Arriwan Holding B.V. Means and methods for raising antibody concentration in compartments of the body of a non-human animal
NZ523911A (en) 2000-08-10 2005-03-24 Gtc Biotherapeutics Inc Cryopreservation of sperm
CA2424977C (en) 2000-10-06 2008-03-18 Kyowa Hakko Kogyo Co., Ltd. Process for purifying antibody
US20040226053A1 (en) 2000-10-13 2004-11-11 Meade Harry M. Methods of producing a target molecule in a transgenic animal and purification of the target molecule
KR20030074693A (ko) 2000-12-28 2003-09-19 알투스 바이올로직스 인코포레이티드 전항체 및 이의 단편의 결정과 이의 제조 및 사용 방법
JP2004536081A (ja) 2001-06-13 2004-12-02 トーラス エイチエスエイ エルエルシー ヒト血清アルブミンの精製
NZ571596A (en) 2001-08-03 2010-11-26 Glycart Biotechnology Ag Antibody glycosylation variants having increased antibody-dependent cellular cytotoxicity
US7651686B2 (en) 2001-10-09 2010-01-26 Mayo Foundation For Medical Education And Research Enhancement of immune responses by 4-1bb-binding agents
ES2411007T3 (es) 2001-10-10 2013-07-04 Novo Nordisk A/S Remodelación y glicoconjugación de péptidos
US7053202B2 (en) 2001-10-19 2006-05-30 Millennium Pharmaceuticals, Inc. Immunoglobulin DNA cassette molecules, monobody constructs, methods of production, and methods of use therefor
CA2463879C (en) 2001-10-25 2012-12-04 Genentech, Inc. Glycoprotein compositions
US20060253913A1 (en) 2001-12-21 2006-11-09 Yue-Jin Huang Production of hSA-linked butyrylcholinesterases in transgenic mammals
EP1463802A1 (en) 2002-01-11 2004-10-06 GTC Biotherapeutics, Inc. Method and system for fusion and activation following nuclear transfer in reconstructed embryos
US20040133931A1 (en) 2003-01-08 2004-07-08 Gavin William G. Method and system for fusion and activation following nuclear transfer in reconstructed embryos
US20040132101A1 (en) 2002-09-27 2004-07-08 Xencor Optimized Fc variants and methods for their generation
JP2005528095A (ja) 2002-04-01 2005-09-22 ジーティーシー バイオセラピューティックス インコーポレイテッド 哺乳類種における核移植に使用するための細胞株を選択する方法
CA2480790A1 (en) 2002-04-01 2003-10-16 Kazunori Murakami Use of antithrombin iii in treating acute lung injury
US20040109847A1 (en) 2002-07-15 2004-06-10 Lieping Chen Treatment and prophylaxis with 4-1BB-binding agents
EP1534065A4 (en) 2002-08-01 2005-11-09 Gtc Biotherapeutics Inc PROCESS FOR THE SELECTION OF CELLS FOR CELL CORE TRANSFER IN SOMATIC CELLS
US20040092719A1 (en) 2002-09-17 2004-05-13 Eszter Birck-Wilson Isolation of immunoglobulin molecules that lack inter-heavy chain disulfide bonds
JP2006513170A (ja) 2002-11-18 2006-04-20 トーラス エイチエスエイ エルエルシー 酸および塩基から溶液を連続的に自動混合する方法
US7087719B2 (en) 2002-11-19 2006-08-08 Gtc Biotherapeutics, Inc. Method for the crystallization of human serum albumin
US20040101939A1 (en) * 2002-11-22 2004-05-27 Santora Ling C. Method for reducing or preventing modification of a polypeptide in solution
CA2506629A1 (en) 2002-11-27 2004-06-17 Gtc Biotherapeutics, Inc. Modified antibodies stably produced in milk and methods of producing same
EP1578192A4 (en) 2002-12-10 2006-03-29 Gtc Biotherapeutics Inc METHOD AND SYSTEM FOR USING APPROPRIATED CORE TRANSFEREMBRYOES AS CELL DISPENSERS FOR AN ADDITIONAL NUCLEAR TRANSFER
CA2512729C (en) 2003-01-09 2014-09-16 Macrogenics, Inc. Identification and engineering of antibodies with variant fc regions and methods of using same
AU2003261387A1 (en) 2003-02-24 2004-09-17 Gtc Biotherapeutics, Inc. Methods of tangential flow filtration and an apparatus therefore
AU2004266159A1 (en) 2003-08-22 2005-03-03 Biogen Idec Ma Inc. Improved antibodies having altered effector function and methods for making the same
CA2537273A1 (en) 2003-09-05 2005-03-17 Gtc Biotherapeutics, Inc. Method for the production of fusion proteins in transgenic mammal milk
JP2007505604A (ja) 2003-09-15 2007-03-15 ジーティーシー バイオセラピューティクス, インコーポレイティド トランスジェニック動物の乳汁におけるドミナントネガティブ膜貫通型レセプターの発現
FR2861080B1 (fr) 2003-10-20 2006-02-17 Lab Francais Du Fractionnement Anticorps presentant un taux de fucose et de galactose optimise
US9296820B2 (en) 2003-11-05 2016-03-29 Roche Glycart Ag Polynucleotides encoding anti-CD20 antigen binding molecules with increased Fc receptor binding affinity and effector function
US20050169908A1 (en) 2004-01-23 2005-08-04 Kazunori Murakami Use of aerosolized antithrombin to treat acute lung injury
US20050186608A1 (en) 2004-02-19 2005-08-25 Olsen Byron V. Method for the production of transgenic proteins useful in the treatment of obesity and diabetes
US20050192226A1 (en) 2004-02-20 2005-09-01 Perenlei Enkhbaatar Method of preventing fibrin clots in pulmonary tissue through the use of aerosolized anticoagulants
US20050197496A1 (en) 2004-03-04 2005-09-08 Gtc Biotherapeutics, Inc. Methods of protein fractionation using high performance tangential flow filtration
US7667089B2 (en) 2004-04-09 2010-02-23 National Chung Hsing University Transgenic mammal secreting B-domain deleted human FVII in its milk
US20050245444A1 (en) 2004-04-30 2005-11-03 Yann Echelard Method of using recombinant human antithrombin for neurocognitive disorders
JP2008515772A (ja) 2004-07-21 2008-05-15 グライコフィ, インコーポレイテッド Gal2GlcNAc2Man3GlcNAc2グリコフォームを支配的に含む免疫グロブリン
US20060123500A1 (en) 2004-12-07 2006-06-08 Gtc Biotherapeutics, Inc. Methods of prescreening cells for nuclear transfer procedures
US20060121004A1 (en) 2004-12-07 2006-06-08 Yann Echelard Methods of reducing the incidence of rejection in tissue transplantation through the use of recombinant human antithrombin
US20060130159A1 (en) 2004-12-09 2006-06-15 Nick Masiello Method of purifying recombinant MSP 1-42 derived from Plasmodium falciparum
US20060168671A1 (en) 2005-01-21 2006-07-27 Gavin William G Injection of caprine sperm factor (cSF), phospholipase C zeta (PLCzeta) and adenophostin A as alternative methods of activation during nuclear transfer in the caprine species
US20080019905A9 (en) 2005-02-18 2008-01-24 Strome Scott E Method of using an anti-CD137 antibody as an agent for radioimmunotherapy or radioimmunodetection
EP2399935A3 (en) 2005-02-15 2012-02-22 GTC Biotherapeutics, Inc. An anti-CD137 antibody as an agent in the treatment of cancer and glycosylation variants thereof
WO2006088464A2 (en) 2005-02-15 2006-08-24 Gtc Biotherapeutics, Inc. A method of using an anti-cd137 antibody as an agent for radioimmunotherapy or radioimmunodetection
US20060182744A1 (en) 2005-02-15 2006-08-17 Strome Scott E Anti-CD137 antibody as an agent in the treatment of cancer and glycosylation variants thereof
US20060286548A1 (en) 2005-06-16 2006-12-21 Gregory Liposky Method of making recombinant human antibodies for use in biosensor technology
PT1896071E (pt) * 2005-06-30 2015-07-09 Janssen Biotech Inc Métodos e composições com melhorias na atividade terapêutica
MX2008000985A (es) * 2005-07-21 2008-04-07 Abbott Lab Expresion de gen multiple que incluye construcciones y metodos sorf (cuadro de lectura abierta simple) con poliproteinas, pro-proteinas y proteolisis.
WO2007014244A2 (en) 2005-07-25 2007-02-01 Gtc Biotherapeutics, Inc. Method of purifying recombinant human antithrombin to enhance the viral and prion safety profile
EP1937305A4 (en) 2005-09-09 2008-10-08 Glycofi Inc IMMUNOGLOBULIN CONTAINING PRESENTLY A MAN7GLCNAC2, MAN8GLCNAC2 GLYCOFORM
SI1945665T1 (sl) 2005-10-21 2012-03-30 Genzyme Corp Terapevtska sredstva na osnovi protiteles s povečano ADCC aktivnostjo
MY155286A (en) 2005-12-12 2015-09-30 Hoffmann La Roche Antibodies against amyloid beta 4 with glycosylated in the variable region
US7531632B2 (en) 2006-02-16 2009-05-12 Gtc Biotherapeutics, Inc. Clarification of transgenic milk using depth filtration
US8007790B2 (en) 2006-04-03 2011-08-30 Stowers Institute For Medical Research Methods for treating polycystic kidney disease (PKD) or other cyst forming diseases
US7846724B2 (en) 2006-04-11 2010-12-07 Hoffmann-La Roche Inc. Method for selecting CHO cell for production of glycosylated antibodies
CN101460522B (zh) 2006-04-11 2014-07-23 弗·哈夫曼-拉罗切有限公司 糖基化抗体
US8173860B2 (en) 2006-04-21 2012-05-08 Gtc Biotherapeutics, Inc. Non-human transgenic mammal expressing a human FcRn on its mammary gland cells and expressing a transgenic protein-human Fc-domain fusion
FR2901707B1 (fr) 2006-05-31 2017-09-29 Lab Francais Du Fractionnement Composition de facteur vii recombinant ou transgenique, chaque molecule de facteur vii possedant deux sites de n-glycosylation a motifs glycanniques definis
WO2007146847A2 (en) 2006-06-09 2007-12-21 University Of Maryland, Baltimore Glycosylation engineered antibody therapy
FR2904558B1 (fr) 2006-08-01 2008-10-17 Lab Francais Du Fractionnement "composition de facteur vii recombinant ou transgenique, presentant majoritairement des formes glycanniques biantennees, bisialylees et non fucosylees"
EP3539981A1 (en) * 2006-09-10 2019-09-18 Glycotope GmbH Use of human cells of myeloid leukaemia origin for expression of antibodies
CN101588817B (zh) 2006-09-10 2013-06-12 葛莱高托普有限公司 骨髓白血病来源的细胞在抗体表达中的用途
US20100247570A1 (en) 2006-11-13 2010-09-30 Procell Corporation High Mannose Glycoprotein Epitopes
MX2009007139A (es) 2006-12-28 2009-10-08 Centocor Ortho Biotech Inc Metodos y vectores para generar inmunoglobulinas no sialiladas.
WO2008101177A2 (en) 2007-02-16 2008-08-21 University Of Virginia Patent Foundation Ige antibodies to chimeric or humanized igg therapeutic monoclonal antibodies as a screening test for anaphylaxis
EP1985633A1 (en) 2007-04-26 2008-10-29 LFB Biotechnologies Kit of parts for the treatment of cancer or infectious diseases
ES2623925T3 (es) 2007-05-30 2017-07-12 Postech Academy-Industry- Foundation Proteínas de fusión de inmunoglobulina
US20090228999A1 (en) 2007-06-13 2009-09-10 Sterrenbeld Biotechnologie North America, Inc. Process of Making Transgenic Mammals That Produce Exogenous Proteins in Milk and Transgenic Mammals Produced Thereby
EP2725035A1 (en) * 2007-10-02 2014-04-30 Avaxia Biologics, Inc. Antibody therapy for use in the digestive tract
EP2225276B1 (en) * 2007-12-31 2014-04-23 Bayer Intellectual Property GmbH Antibodies to tnf alpha
CN101932231A (zh) 2008-01-07 2010-12-29 辛那杰瓦生物制药股份有限公司 禽类的糖基化
EP2279003A4 (en) 2008-05-01 2013-04-03 Gtc Biotherapeutics Inc ANTI-CD137 ANTIBODY AS A MEANS FOR THE TREATMENT OF INFLAMMATORY DISEASES
KR20110084196A (ko) 2008-09-26 2011-07-21 유레카 쎄라퓨틱스, 인코포레이티드 다양한 글리코실화 패턴을 가진 세포계 및 단백질
US20100178292A1 (en) 2009-01-12 2010-07-15 The Board Of Trustees Of The Leland Stanford Junior University Cryptic glycan markers and applications thereof
US20110082083A1 (en) 2009-04-10 2011-04-07 Gtc Biotherapeutics, Inc. Formulations of liquid stable antithrombin
SG176202A1 (en) 2009-05-28 2011-12-29 Glaxo Group Ltd Combination of a tnf-alpha antagonist and a vegf antagonist for use in the treatment or prevention of diseases of the eye.
ES2811526T3 (es) 2010-12-30 2021-03-12 Lab Francais Du Fractionnement Glicoles como agentes de inactivación de patógenos
WO2012105699A1 (ja) 2011-02-03 2012-08-09 株式会社イーベック 補体依存性生物活性の高い抗体の産生法
EP2729164A4 (en) 2011-07-07 2015-05-06 Lfb Usa Inc FORMULATIONS STABILIZING PROTEINS
CN104168913A (zh) 2011-08-10 2014-11-26 法国化学与生物科技实验室 高半乳糖基化抗体
KR101454316B1 (ko) 2011-08-17 2014-10-27 한화케미칼 주식회사 활성형 TNFR-Fc 융합 단백질을 제조하는 방법
US20130302274A1 (en) 2011-11-25 2013-11-14 Roche Glycart Ag Combination therapy
EP2793936A4 (en) 2011-12-19 2015-05-27 Lfb Usa Inc RECOMBINANT HUMAN ALPHA-1-ANTITRYPINE FOR THE TREATMENT OF INFLAMMATORY DISEASES
TW201400499A (zh) 2012-03-12 2014-01-01 Revo Biolog Inc 抗凝血酶用於治療妊娠毒血症之用途
US20150175678A1 (en) 2012-06-15 2015-06-25 Beth Israel Deaconess Medical Center, Inc. IgA CD4i ANTIBODIES AND METHODS OF TREATMENT USING SAME
EP2879697A4 (en) 2012-08-03 2016-01-20 Lfb Usa Inc USE OF ANTITHROMBIN IN OXYGENATION OF EXTRACORPOREAL MEMBRANE
EP2895511A4 (en) 2012-09-10 2016-04-13 Lfb Usa Inc USE OF ANTIBODIES FOR THE TREATMENT OF HIV INFECTIONS AND FOR THE SUPPRESSION OF TRANSMISSION OF HIV
CN105358577A (zh) 2013-02-13 2016-02-24 法国化学与生物科技实验室 具有经修饰的糖基化的西妥昔单抗及其用途
WO2014125377A2 (en) 2013-02-13 2014-08-21 Laboratoire Francais Du Fractionnement Et Des Biotechnologies Highly galactosylated anti-her2 antibodies and uses thereof
US10034921B2 (en) 2013-02-13 2018-07-31 Laboratoire Français Du Fractionnement Et Des Biotechnologies Proteins with modified glycosylation and methods of production thereof
EP3594230A1 (en) 2013-02-13 2020-01-15 Laboratoire Français du Fractionnement et des Biotechnologies Highly galactosylated anti-tnf-alpha antibodies and uses thereof
FR3005576B1 (fr) 2013-05-15 2015-06-19 Lab Francais Du Fractionnement Procede d'inactivation d'une proteine prion
EP3016729B1 (fr) 2013-07-05 2020-03-25 Laboratoire Francais du Fractionnement et des Biotechnologies Societe Anonyme Matrice de chromatographie d'affinité
FR3015484A1 (fr) 2013-12-20 2015-06-26 Lab Francais Du Fractionnement Proteines recombinantes possedant une activite de facteur h
CN105828603A (zh) 2013-12-24 2016-08-03 Lfb美国股份有限公司 肝素的转基因生产
KR20170040132A (ko) 2014-06-02 2017-04-12 라보라토이레 프란카이즈 듀 프락티온네먼트 에트 데스 바이오테크놀로지스 Fc 단편의 제조
FR3022462B1 (fr) 2014-06-18 2018-04-27 Laboratoire Francais Du Fractionnement Et Des Biotechnologies Composition orale d'anticorps anti-tnfalpha
US20160158676A1 (en) 2014-12-01 2016-06-09 Laboratoire Français Du Fractionnement Et Des Biotechnologies Method and apparatus for manipulating components of a filtration system

Patent Citations (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5545807A (en) 1988-10-12 1996-08-13 The Babraham Institute Production of antibodies from transgenic animals
US5591669A (en) 1988-12-05 1997-01-07 Genpharm International, Inc. Transgenic mice depleted in a mature lymphocytic cell-type
US6150584A (en) 1990-01-12 2000-11-21 Abgenix, Inc. Human antibodies derived from immunized xenomice
US5545806A (en) 1990-08-29 1996-08-13 Genpharm International, Inc. Ransgenic non-human animals for producing heterologous antibodies
US5598369A (en) 1994-06-28 1997-01-28 Advanced Micro Devices, Inc. Flash EEPROM array with floating substrate erase operation
US7928064B2 (en) 1995-02-21 2011-04-19 Gtc Biotherapeutics, Inc. Transgenically produced antithrombin III
US6090382A (en) 1996-02-09 2000-07-18 Basf Aktiengesellschaft Human antibodies that bind human TNFα
US5945577A (en) 1997-01-10 1999-08-31 University Of Massachusetts As Represented By Its Amherst Campus Cloning using donor nuclei from proliferating somatic cells
WO2003002609A2 (en) 2001-06-28 2003-01-09 Domantis Limited Dual-specific ligand and its use
US20060057638A1 (en) 2004-04-15 2006-03-16 Massachusetts Institute Of Technology Methods and products related to the improved analysis of carbohydrates
US20060127950A1 (en) 2004-04-15 2006-06-15 Massachusetts Institute Of Technology Methods and products related to the improved analysis of carbohydrates
WO2006040153A2 (en) 2004-10-13 2006-04-20 Ablynx N.V. Single domain camelide anti -amyloid beta antibodies and polypeptides comprising the same for the treatment and diagnosis of degenarative neural diseases such as alzheimer's disease
WO2006122786A2 (en) 2005-05-18 2006-11-23 Ablynx Nv Improved nanobodies™ against tumor necrosis factor-alpha
US20080118501A1 (en) 2005-10-21 2008-05-22 Gtc Biotherapeutics, Inc. Antibodies with enhanced antibody-dependent cellular cytotoxicity activity, methods of their production and use

Non-Patent Citations (22)

* Cited by examiner, † Cited by third party
Title
ABUCHOWSKI; DAVIS: "Enzymes as Drugs", 1981, WILEY-INTERSCIENCE, article "Soluble Polymer-Enzyme Adducts", pages: 367 - 383
ANTHONY ET AL.: "Identification of a receptor required for the anti-inflammatory activity of IVIG", PNAS, vol. 105, 2008, pages 19571 - 19578
BIRD ET AL., SCIENCE, vol. 242, 1988, pages 423 - 426
CLARK ET AL., BIOTECHNOLOGY, vol. 7, 1989, pages 487 - 492
DITULLIO, BIOTECHNOLOGY, vol. 10, 1992, pages 74 - 77
GORTON ET AL., BIOTECHNOLOGY, vol. 5, 1987, pages 1183 - 1187
HOLLIGER, P. ET AL., PROC. NATL. ACAD. SCI. USA, vol. 90, 1993, pages 6444 - 6448
HUSTON ET AL., PROC. NATL. ACAD. SCI. USA, vol. 85, 1988, pages 5879 - 5883
J. GODING: "Monoclonal Antibodies: Principles and Practice", 1983, ACADEMIC PRESS, pages: 98 - 118
KABAT ET AL.: "Sequences of Proteins of Immunological Interest", 1991, NATIONAL INSTITUTES OF HEALTH
LANGER, SCIENCE, vol. 249, 1990, pages 1527 - 1533
LEWIN: "Genes IV", 1990, OXFORD UNIVERSITY PRESS
NEWMARK ET AL., J. APPL. BIOCHEM., vol. 4, 1982, pages 185 - 189
POIJAK, R.J. ET AL., STRUCTURE, vol. 2, 1994, pages 1121 - 1123
POLLOCK ET AL., JOURNAL OF IMMUNOLOGICAL METHODS, vol. 231, no. 1-2, 10 December 1999 (1999-12-10), pages 147 - 157
REFF M. E., BLOOD, vol. 83, 1994, pages 435
ROITT ET AL.: "Immunology", 1989, GOWER MEDICAL PUBLISHING
SAMBROOK ET AL.: "Molecular Cloning: A Laboratory Manual", 1989, COLD SPRING HARBOR LABORATORY PRESS
SELGRATH ET AL., THERIOGENOLOGY, 1990, pages 1195 - 1205
SOULIER ET AL., FEBS LETTS, vol. 297, 1992, pages 13
WALDMANN, SCIENCE, vol. 252, 1991, pages 1657
WARD ET AL., NATURE, vol. 341, 1989, pages 544 - 546

Cited By (25)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9365645B1 (en) 2011-04-27 2016-06-14 Abbvie, Inc. Methods for controlling the galactosylation profile of recombinantly-expressed proteins
US9957318B2 (en) 2012-04-20 2018-05-01 Abbvie Inc. Protein purification methods to reduce acidic species
US9505833B2 (en) 2012-04-20 2016-11-29 Abbvie Inc. Human antibodies that bind human TNF-alpha and methods of preparing the same
US9708400B2 (en) 2012-04-20 2017-07-18 Abbvie, Inc. Methods to modulate lysine variant distribution
US9683033B2 (en) 2012-04-20 2017-06-20 Abbvie, Inc. Cell culture methods to reduce acidic species
US9512214B2 (en) 2012-09-02 2016-12-06 Abbvie, Inc. Methods to control protein heterogeneity
US10174110B2 (en) 2013-02-13 2019-01-08 Laboratoire Français Du Fractionnement Et Des Biotechnologies Highly galactosylated anti-TNF-α antibodies and uses thereof
EP2956485A2 (en) * 2013-02-13 2015-12-23 Laboratoire Français du Fractionnement et des Biotechnologies Highly galactosylated anti-her2 antibodies and uses thereof
US9499614B2 (en) 2013-03-14 2016-11-22 Abbvie Inc. Methods for modulating protein glycosylation profiles of recombinant protein therapeutics using monosaccharides and oligosaccharides
US9708399B2 (en) 2013-03-14 2017-07-18 Abbvie, Inc. Protein purification using displacement chromatography
US9598667B2 (en) 2013-10-04 2017-03-21 Abbvie Inc. Use of metal ions for modulation of protein glycosylation profiles of recombinant proteins
US9499616B2 (en) 2013-10-18 2016-11-22 Abbvie Inc. Modulated lysine variant species compositions and methods for producing and using the same
US9522953B2 (en) 2013-10-18 2016-12-20 Abbvie, Inc. Low acidic species compositions and methods for producing and using the same
US9688752B2 (en) 2013-10-18 2017-06-27 Abbvie Inc. Low acidic species compositions and methods for producing and using the same using displacement chromatography
US9550826B2 (en) 2013-11-15 2017-01-24 Abbvie Inc. Glycoengineered binding protein compositions
WO2015193622A1 (fr) * 2014-06-18 2015-12-23 Laboratoire Francais Du Fractionnement Et Des Biotechnologies Composition orale d'anticorps anti-tnfalpha
FR3022462A1 (fr) * 2014-06-18 2015-12-25 Lab Francais Du Fractionnement Composition orale d'anticorps anti-tnfalpha
WO2016156752A1 (fr) 2015-04-02 2016-10-06 Laboratoire Francais Du Fractionnement Et Des Biotechnologies Procédé de purification d'une protéine recombinante thérapeutique à partir d'un lait transgénique
US12247076B2 (en) 2015-07-06 2025-03-11 Laboratoire Français Du Fractionnement Et Des Biotechnologies Use of modified Fc fragments in immunotherapy
EP3257866A1 (en) * 2016-06-17 2017-12-20 Academisch Medisch Centrum Modified anti-tnf antibody and use thereof in the treatment of ibd
WO2018019900A1 (fr) 2016-07-29 2018-02-01 Laboratoire Francais Du Fractionnement Et Des Biotechnologies Composition orale d'anticorps anti-tnf alpha
EP3581203A1 (en) * 2018-06-11 2019-12-18 Laboratoire Français du Fractionnement et des Biotechnologies Antibodies with increased activity in the digestive tract
WO2019238603A1 (en) * 2018-06-11 2019-12-19 Laboratoire Francais Du Fractionnement Et Des Biotechnologies Antibodies with increased activity in the digestive tract
CN116903738A (zh) * 2022-08-02 2023-10-20 北京绿竹生物技术股份有限公司 一种低甘露糖型抗人肿瘤坏死因子-α单抗及其用途
WO2025264860A2 (en) 2024-06-18 2025-12-26 Yale University Methods of treating post-covid airway disease

Also Published As

Publication number Publication date
BR112015019341A2 (pt) 2017-08-22
WO2014125374A3 (en) 2014-12-31
EP2956480B1 (en) 2019-09-04
TW201506041A (zh) 2015-02-16
EP3594230A1 (en) 2020-01-15
AR094780A1 (es) 2015-08-26
EP2956480A2 (en) 2015-12-23
ES2755181T3 (es) 2020-04-21
US20190309057A1 (en) 2019-10-10
JP2020073550A (ja) 2020-05-14
EP3594231A1 (en) 2020-01-15
IL240443A0 (en) 2015-09-24
JP2016508515A (ja) 2016-03-22
US20190309058A1 (en) 2019-10-10
AU2014217561B2 (en) 2018-11-15
KR20160002713A (ko) 2016-01-08
US20150368334A1 (en) 2015-12-24
MX2015010427A (es) 2016-03-17
US10174110B2 (en) 2019-01-08
AU2014217561A1 (en) 2015-08-27
CN105308068A (zh) 2016-02-03
CA2900909A1 (en) 2014-08-21

Similar Documents

Publication Publication Date Title
US10174110B2 (en) Highly galactosylated anti-TNF-α antibodies and uses thereof
JP2020125286A (ja) 高ガラクトシル化抗her2抗体およびその使用
EP2956484B1 (en) Cetuximab with modified glycosylation and uses thereof
TR201807750T4 (tr) Anti-TIM-3 antikoru.
WO2012176779A1 (ja) 抗erbB3抗体
KR20170040132A (ko) Fc 단편의 제조
AU2025230675A1 (en) Variants with Fc fragment having an increased affinity for FcRn and an increased affinity for at least one receptor of the Fc fragment
CN115397990A (zh) 抗体组合物
JP4368800B2 (ja) サイトカイン産生誘導抗体

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 201480020371.4

Country of ref document: CN

WWE Wipo information: entry into national phase

Ref document number: 240443

Country of ref document: IL

ENP Entry into the national phase

Ref document number: 2900909

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 14767117

Country of ref document: US

ENP Entry into the national phase

Ref document number: 2015557532

Country of ref document: JP

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: MX/A/2015/010427

Country of ref document: MX

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112015019341

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 2014217561

Country of ref document: AU

Date of ref document: 20140213

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 20157025005

Country of ref document: KR

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 2014731999

Country of ref document: EP

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 14731999

Country of ref document: EP

Kind code of ref document: A2

ENP Entry into the national phase

Ref document number: 112015019341

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20150812