WO2014096394A1 - Methods and primer sets for high throughput pcr sequencing - Google Patents

Methods and primer sets for high throughput pcr sequencing Download PDF

Info

Publication number
WO2014096394A1
WO2014096394A1 PCT/EP2013/077763 EP2013077763W WO2014096394A1 WO 2014096394 A1 WO2014096394 A1 WO 2014096394A1 EP 2013077763 W EP2013077763 W EP 2013077763W WO 2014096394 A1 WO2014096394 A1 WO 2014096394A1
Authority
WO
WIPO (PCT)
Prior art keywords
sequence
seq
primers
primer
sets
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/EP2013/077763
Other languages
English (en)
French (fr)
Inventor
Julia-Marie Ritter
Volkhard Seitz
Steffen Hennig
Michael Hummel
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
HS DIAGNOMICS GmbH
Original Assignee
HS DIAGNOMICS GmbH
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by HS DIAGNOMICS GmbH filed Critical HS DIAGNOMICS GmbH
Priority to EP13814143.7A priority Critical patent/EP2935618B1/en
Priority to CA2894635A priority patent/CA2894635C/en
Priority to US14/654,537 priority patent/US10894983B2/en
Priority to DK13814143.7T priority patent/DK2935618T3/en
Priority to JP2015548650A priority patent/JP6496665B2/ja
Publication of WO2014096394A1 publication Critical patent/WO2014096394A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6869Methods for sequencing
    • C12Q1/6874Methods for sequencing involving nucleic acid arrays, e.g. sequencing by hybridisation
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844Nucleic acid amplification reactions
    • C12Q1/6848Nucleic acid amplification reactions characterised by the means for preventing contamination or increasing the specificity or sensitivity of an amplification reaction
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844Nucleic acid amplification reactions
    • C12Q1/6853Nucleic acid amplification reactions using modified primers or templates
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6869Methods for sequencing

Definitions

  • PCR amplification strategy One major source for contamination is a two-step PCR amplification strategy, which is frequently used to generate PCR libraries suitable for NGS sequencing (Baetens et al., Human Mutation 32, 1053-1062 (201 1 )).
  • the target nucleic acid sequence is amplified using specific primers flanked by a tail sequence (designated as rn a in the context of the present specification; e.g. a M13 or T7 tail).
  • a second (adaptor) primer pair amplifies the first amplificate producing the second amplificate, which can be used for sequencing.
  • nucleic acid sequences required for NGS sequencing are introduced, employing primers complementary at their 3 ' end to the tail sequence of the first amplification primers.
  • multiplexing of several samples for NGS sequencing can be performed (Baetens, ibid.) by introducing so-called barcodes or multiplex-identifiers in the middle or close to the 5 ' end of the second amplification primers.
  • An overview showing potential sources of contamination is given in the table overleaf. Fields C and D are of most relevance for the present invention.
  • a two-step amplification strategy shows a high probability for cross-contamination by carry-over of amplicons from the first PCR to the re-amplification (C) due to the high number of amplicons generated in the first amplification reaction. Furthermore, PCR products of a second amplification may contaminate other second amplification reactions (D). In the case of amplicon isolation by gel extraction or PCR-purification kits, the risk of contamination is even higher. Timepoint of contamination
  • PCR with first or second Prevention and detection amplification tail- or adaptor-specific Double contamination protection primers. (this invention)
  • Table 1 Sources of cross-contamination and its prevention in a two-step PCR setting for NGS library generation.
  • a & B Contaminations of the first amplification by PCR products derived from another first or second amplification can be prevented by the UTP/UNG system and detected by tail- or adaptor-specific primers (US5035996, also published as EP0401037, US6844155B2, US7914986B2).
  • C & D Contaminations of the second amplification by PCR products derived from another first or second amplification can be prevented and detected by the "double contamination protection" described in the present invention.
  • the objective of the present invention is to (i) avoid and/or to (ii) detect PCR-based contamination in applications employing massive parallel sequencing (NGS/HTS) techniques. This objective is attained by the subject matter of the independent claims.
  • Nucleic acid sequences are given from 5' to 3' end.
  • a sequence tract in the context used herein refers to a contiguous sequence; a sequence tract designator is a letter, optionally having a subscript or superscript, representing a sequence tract.
  • ', l ⁇ 2 , ⁇ 2 , S and S ' are examples for sequence tract designators. Where sequences are given as a sequence of sequence tract designators, such sequences are understood to be ordered similarly in 5' to 3' order.
  • a sequence tract is also called a sequence element.
  • Nucleic acid target sequences may be DNA or RNA; in case of RNA being the target sequence for amplification and sequencing, RNA is transcribed into cDNA (by reverse transcriptase) prior to amplification.
  • a "primer” in the context of the present specification refers to a single stranded DNA -or nucleic acid analogue building block- oligomer having a length between 8 and 100 nucleotides.
  • Capable of forming a hybrid in the context of the present invention relates to sequences that are able to bind selectively to their target sequence under the conditions of a PCR or sequencing reaction (for example, 10 mmol/l Tris-HCI pH 8.3; 100 mmol/l KCI; 1.5 mmol/l MgCI 2 ; 0.2 mmol/l dNTP, each; primer annealing temperature of 40°C to 68°C).
  • Such hybridizing sequences may be contiguously reverse-complimentary to the target sequence, or may comprise gaps, mismatches or additional non-matching nucleotides.
  • the minimal length for a sequence to be capable of forming a hybrid depends on its composition, with C or G nucleotides contributing more to the energy of binding than A or T/U nucleotides, and on the backbone chemistry, with some modifications such as LNA having significantly higher binding energy and thus, shorter minimal lengths, compared to DNA.
  • Nucleotide in the context of the present invention is a nucleic acid or nucleic acid analogue building block, an oligomer of which is capable of forming selective hybrids with an RNA or DNA sequence on the basis of base pairing.
  • the term nucleotides in this context includes the classic ribonucleotide building blocks adenosine, guanosine, uridine (and ribosylthymine), cytidine, and the classic deoxyribonucleotides deoxyadenosine, deoxyguanosine, thymidine, deoxyuridine and deoxycytidine.
  • nucleotides further includes analogues of nucleic acids, such as phosphorotioates, 2O-methylphosphothioat.es, peptide nucleic acids (PNA; N- (2-aminoethyl)-glycine units linked by peptide linkage, with the nucleobase attached to the alpha-carbon of the glycine) or locked nucleic acids (LNA; 2 ⁇ , 4'C methylene bridged RNA building blocks).
  • PNA peptide nucleic acids
  • LNA locked nucleic acids
  • a primer sequence as used in the context of the present specification may be composed of any of the above nucleotides, or mixtures thereof.
  • a primer sequence is composed of deoxynucleotides, with the last (from the 3' position) 1 , 2, 3 or 4 internucleotide bonds being phosporothioates.
  • the last 4, 3, 2 or 1 nucleotides (counting from the 3 ' position) are LNA nucleotide analogues.
  • the second nucleotide from the 3 ' position is a LNA nucleotide analogue.
  • the second and third nucleotide from the 3 ' position is a LNA nucleotide analogue.
  • the present invention provides guidelines for the design of three synergistically acting primer elements (designated generally as K-box with a capital "K”, subdivided into a k-box (written with a lower case "k”) for the forward primers and a k ' -box for the reverse primers respectively) which in combination greatly improves the accuracy of PCR library preparations that can be analysed by methods including, but not restricted to, next generation sequencing (NGS).
  • NGS next generation sequencing
  • the method of the invention makes use of two primer pairs.
  • the first or initial primer pair amplifies the target sequence generating a first amplificate.
  • a nested second (adaptor) primer pair amplifies the first amplificate producing the second amplificate, which can be used for sequencing.
  • the invention introduces the use of "sets" of individualized primer pairs for the first and second amplification to avoid cross- contamination, i.e. for each individual sample a different set is used.
  • a specific second primer pair is designed to only work together with a specific first primer pair within an individual set.
  • the first and second primer pairs of an individualized primer set comprise a specially designed sequence tract referred to as K-box (K). Each K-box is specific for an individual primer set.
  • the K-box of the (initial) primers for the first amplification step can comprise different elements k-
  • ' sequences enable the second primer pair to amplify the first amplificate only if the matching k-
  • Primer pairs are arranged in corresponding and matching sets. A number of sets (e.g. set 1 - 300) represent a collection. A collection with N sets will allow processing N different samples without cross-contaminations in the second amplification reactions.
  • All initial primers of the first amplification step of a collection amplify the same target sequence.
  • Different collections, amplifying different target sequences i.e. in a multiplex PCR, may be combined as a multiplex-collection. Definition of frequently used terms
  • a specific second primer pair is designed to work only together with a specific first primer pair.
  • Collection A number of sets represent a collection.
  • Multiplex collection A combination of different collections amplifying different target sequences.
  • K-box Comprises the sequence tracts k-
  • k-box K-box of the left (up-stream) first and second amplification primer k ' -box K-box of the right (down-stream) first and second amplification primer.
  • ki/ki ' K-box elements of first and second amplification primers for suppression of contaminations.
  • s/s ' K-box element present in first amplification primers to avoid a PCR bias possibly introduced by k-
  • the "prime” or apostrophe (') indicates that a sequence tract or element has a similar functional characteristic as its non-prime counterpart, but is located on a primer on the other side of the target sequence, and is understood to work in reverse direction.
  • the target nucleic acid sequences subject to amplification are described as tc-tv-tc'-
  • tc/tc' are the sequence tracts to which the forward (left) and reverse (right) primary amplification primer hybridizes, respectively
  • ty is a region of interest (the sequenced part likely to contain the variability that the sequencing seeks to elucidate) within a target nucleic acid sequence.
  • the target nucleic acid sequence elements t n and t n ' are located in 5' and 3' position, respectively, of tc-tv-tc'-
  • the target structure can also be described as tn-tc-tv-tc'-tn'-
  • a primer for use in a method or collection of primers according to the invention is composed of at least two sequence tracts.
  • a left first or initial primer used in the first round of amplification comprises (from 5' to 3' OH- end) a sequence tract m a -k-box (also designated as rn a -K) and a sequence tract Pc (Fig. 1 ).
  • Sequence tract Pc provides target specificity, while IT) a -K provides a non-target- specific sequence tract, parts or all of which can be used for hybridization of a second "adaptor" primer.
  • sequence tract m a can comprise sequence elements necessary for sequencing purposes or consist of sequences such as M13, whereas the K- box comprises the K-box elements (k-
  • the left adaptor (second) primer comprises distinct sequence tracts, designated 3
  • _ and 3p confer functional features for high throughput sequencing, e.g. template sequences for sequencing primers and/or for attachment of the amplificate to a solid surface such as a slide or a bead.
  • 3p can consist of a sequence such as M13.
  • the sequence tract a « comprises k-
  • the reverse or right primers, of both the initial and adaptor primers comprise sequence tracts of similar characteristics, designated m a ' -k ' -box (also designated as IT) a -K') and Pc' for the right initial (first) primer.
  • the right adaptor (second) primer comprises the sequence tracts ai_' and QP'-QK (Fig. 1 ).
  • _ and 3p are used for sequencing purposes, such as, by way of non- limiting example, sequencing primer hybridization sites and/or solid support attachment sites.
  • Methods for high-throughput sequencing are well known in the art and include so called "Nlumina" bridge PCR-sequencing methods, shown inter alia in US201 1045541 A1 , US2005100900A1 , US2002055100A1 ; pyrosequencing, shown inter alia in US6,274,320, US 7,244,567, US 7,264,929; US 7,323,305 and US 7,575,865; "2 base encoding" technology (US4883750, US5750341 ) and others. Further relevant methods for high- throughput sequencing and applications are described in the following manuscripts:
  • the primers of the invention provide particular sequence elements (K-boxes), which greatly reduce the likelihood that such contaminations occur and enable the recognition of amplicon contaminations within the sequencing results.
  • K-box elements are designated k-i, k-i', l ⁇ 2, ⁇ 2 , S and S', and are selected by bioinformatics methods as one single K-box, the selection being made not to perform mismatches with the 3 ' ends of the primers employed.
  • the three K-box elements are outlined in the following in detail separately:
  • ' sequences are designed to prevent contamination from previous amplification reactions.
  • the forward primer of the first PCR is composed of (i) a target- specific proportion Pc, (ii) and the K-box sequence element k-i, which is specific for each primer set and (iii) and a sequence element IT) a .
  • the reverse primer of the first PCR is composed in the same way but in reverse-complement fashion.
  • a specific ki and/or ki ' element is used for a particular reaction and is varied when the amplification reaction is performed repeatedly.
  • a routine diagnostic amplification reaction e.g. the analysis of T-cell receptor beta (TCRB) rearrangements or the analysis of cancer genes
  • primers using different ki / ki ' elements may be used for each individual experiment until all variations of ki and k-i' have been consumed.
  • the 3' end of the second (or adaptor) primer is chosen to hybridize to ki or k-i', respectively, along the entire length of ki (or k-i').
  • pairs of first and second primers are formed, where the "left" adaptor primer hybridizes to sequence tract ki that was generated by the "left” initial primer, and the "right” adaptor primer hybridizes to the sequence tract k-i ' that was generated by the "right” initial primer.
  • the adaptor primer will hybridize not necessarily only to the tract generated by ki (or k-
  • first (initial) and second (adaptor) primers with a k-
  • second PCR of sample 2 with PCR products derived from the primary PCR of sample 1
  • mismatch between the ki and/or ki ' element of the PCR product of sample 1 and the different ki and/or ki ' elements of the sample 2 primers will prevent the amplification of the contaminating material.
  • Both, ki and k-i' can be of 1 , 2, 3, 4, 5, 6, 7, 8, 9 or more bases in length.
  • a further K-box element is a sequence element k2 or ⁇ i2 , comprised in the sequence tract rn a -K or m a -K', respectively, of the initial primer, but not in the corresponding sequence tract in the second amplification (adaptor) primer (Fig. 2).
  • k2 and ⁇ i2 are characteristic of the initial primer only.
  • the k2 (or k2') element is downstream (towards the 3' end) from the ki (or k-i') sequence element (Fig. 2).
  • ki and k-i' lead to suppression of contaminations
  • the k2/k2' sequences are designed to detect contamination from previous amplification reactions. Therefore, as in the case of ki (or k-i'), the presence of k2 (or k2') in specific variation (Examples are provided in Table 20) over a plurality of primer sets used at different times or for different samples in the same routine setting helps to detect contaminations and synergistically control the contamination suppression efficacy of ki / k-i'.
  • the K-box elements S/S' prevent a possible PCR bias dependent on k-
  • S separates the target-specific left initial primer sequence Pc from the sequence tracts l ⁇ 2 and/or k-
  • S' separates the target-specific right initial primer sequence Pc ' from ⁇ i2 and/or ki ' (see Fig. 3-4).
  • /ki ' and k2/k2 ' vary among different primers used in subsequent amplifications, some variations of k2/k2' and/or k-
  • the target sequence-matching tract of the initial primer would be longer for some targets than for others, leading to PCR bias resulting from higher annealing temperatures.
  • a set within a multiplex collection addresses different target sequences for use in a multiplex PCR, but carries the same ki (and k-
  • different annealing temperatures might introduce a PCR bias that may significantly skew any quantitative interpretation of the results.
  • a short (1 , 2, 3 or 4 nucleotides) separator sequence S (S') is introduced into the k/k ' sequence tract, immediately upstream of the Pc pc ' sequence tract, i.e., at the 3' terminal end of k/k ' .
  • S and S' are thus designed to prevent a hybrid formation with the template (target) sequence t n /t n ' adjacent to the primer-hybridizing sequence tract tc/tc', as outlined in Fig. 3-4.
  • the three K-box elements work synergistically to achieve the overall goal of preventing PCR-based contamination in applications employing NGS/HTS techniques.
  • k2/k2' elements are only present in the first amplification primers an eventual contamination can still be identified in the second amplification product. Thus, k2/k2' elements determine and therefore control the contamination suppression efficiency of k-
  • S/S' is the K-box family member that solves the problem of a possible PCR bias dependent on k-
  • all three K-box elements together must be designed bioinformatically as one unit and optimized not to form hybrids (e.g. more than 6 bp match within 10 bp) that might lead to mispriming with any primer sequence but especially at the 3 ' ends of the primers employed.
  • a method for amplifying a target nucleic acid sequence tc- -tc' comprised within a sequence tract t n -tc-tv-tc'-tn' comprising conducting a plurality of polymerase chain reaction (PCR) amplification reactions.
  • PCR polymerase chain reaction
  • the invention is directed toward a method of repeatedly amplifying or sequencing the same target sequence (albeit in variation that may occur within a sequence tract of interest designated ty).
  • Each reaction comprises two PCR amplification steps: a first amplification step, in which a target nucleic acid sequence is amplified using a first ("initial") primer pair, and includes the reactants known to the skilled artisan as necessary for conducting a PCR reaction, i.e. nucleoside triphosphates (ATP, GTP, TTP, CTP), a suitable buffer and thermostable polymerase such as Taq polymerase.
  • a first amplification step in which a target nucleic acid sequence is amplified using a first (“initial") primer pair, and includes the reactants known to the skilled artisan as necessary for conducting a PCR reaction, i.e. nucleoside triphosphates (ATP, GTP, TTP, CTP), a suitable buffer and thermostable polymerase such as Taq polymerase.
  • This initial primer pair is composed of a left (forward) first (“initial") PCR primer having a sequence IT) a - K-pc composed of two sequence elements m a -K and Pc in 5'-3' orientation, and a right (reverse) initial primer having a sequence IT) a -K'-pc', similarly oriented from 5' to 3'.
  • the product of the first amplification set is a first amplificate, comprising the target nucleic acid sequence flanked on either side by sequence tracts m a -K and m a -K', respectively (Fig. 1 ).
  • sequence tc- -tc' constitutes the amplified region of the target, whereas the short sequence elements t n and t n ' are flanking regions that define the selection of sequence elements S and S' in the primer set.
  • the method of the invention further comprises a second PCR amplification step, whereby a first amplificate is re-amplified using a second ("adaptor") primer pair composed of a left (forward) second (“adaptor") PCR primer having a sequence 3
  • a second amplificate a second amplificate (Fig.
  • Pc displays the same sequence as the target sequence element tc >
  • Pc' is the reverse complimentary sequence to tc'.
  • Pc and Pc' are the target-specific primer sequences that hybridize to the target and effect amplification.
  • Pc and Pc' each independently from one another are 8 to 40 nucleotides in length.
  • ITI a -K comprises a k-box with the sequence element k-
  • IT) a - K' comprises a k ' -box with a sequence element k ⁇
  • ' each independently from one another are a sequence 2, 3, 4, 5, 6, 7, 8 or 9 nucleotides in length, ki and k-
  • a first primer pair and a second primer pair with identical ki and k-i ' form a set.
  • ki and k-i ' are the sequence elements that individualize different primer sets from one another, ki and k-i ' match the first "initial" and the second "adaptor" PCR primer pairs to one another within a set.
  • ki and k-i ' of the first initial primer pair correspond to the sequence elements 3k (k-
  • m a -K comprises a sequence element S on its 3' terminus and m a -K' comprises a sequence element s' on its 3' terminus.
  • S and S' are mismatch sequences selected not to form a continuous hybrid sequence with sequence element t n and t n ' and S and S' are independently 1 , 2, 3, 4 or 5 nucleotides in length.
  • the effect of this element is to avoid an inadvertent rise of the annealing temperature of Pc and Pc' on the target in some primers dependent on ITI a -K and/or ITI a -K ' sequences. This element helps to avoid PCR bias (Fig. 3-4).
  • Sequence tract 3 ⁇ -3 « hybridizes to a contiguous sequence on sequence element IT) a -K, and 3 ⁇ '-3 ⁇ ' hybridizes to a contiguous sequence on sequence element ITI a -K'.
  • 3 ⁇ -3 « (and its analogue 3 ⁇ '-3 ⁇ ') is the sequence tract on the 3' terminal end of the adaptor primer that recognizes the initial primer.
  • rn a -K and m a -K' can be of any length that fits their general purpose, but will generally be within the usual length of a primer target sequence, i.e. m a -K and m a -K' will be generally each independently from one another a sequence 10 to 40 nucleotides in length, in certain embodiments from about 15 to 30 nucleotides in length.
  • _ and and also 3p and 3p ' independently from one another can be any sequence that fits the general purpose of providing a sequence useful for sequencing the second amplificate, for example by providing a sequencing primer annealing target and/or a sequence for attaching the second amplificate to a chip or bead or any other surface-bound structure as may be useful in NGS/HTS sequencing.
  • ty is a variable region within said target nucleic acid sequence.
  • a particular set of primers for each one of said plurality of amplification reactions is provided, for each of which the sequence of one of ki and k-i ' is different from the sequence of any other ki and k-
  • no particular sequence of ki and/or ki ' occurs more than once in any set.
  • a L and a L ' are 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65 or 70 nucleotides in length.
  • Pc and Pc' each independently from one another are 8, 10, 12, 14, 16, 18, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 32, 34, 36, 38 or 40 nucleotides in length.
  • m a -K comprises a 3'-terminal sequence k-
  • m a -K' comprises a 3'-terminal sequence k ⁇
  • m a -K comprises a sequence element k2 3'-terminal to sequence element k-i
  • m a -K' comprises a sequence element ⁇ i2 3'-terminal to sequence element k-
  • k2 and ⁇ i2 each independently from one another are 2, 3, 4, 5, 6 or 7 nucleotides in length.
  • k2 and k2' serve to individualize the first primer pair of the set from other first (initial) primers.
  • k2 and k2' have no complementary sequence elements on the second ("adaptor") primers.
  • the second primers ki and k-i ' have complementary sequences to the first primers within one primer set.
  • the primer set uses all three elements k-
  • m a -K comprises a 3'-terminal sequence k ⁇
  • m a -K' comprises a 3'- terminal sequence k ⁇
  • m a -K comprises a 3'-terminal sequence k ⁇
  • m a -K' comprises a 3'-terminal sequence k ⁇
  • K comprises a 3'-terminal sequence k ⁇
  • K' comprises a 3'-terminal sequence k ⁇
  • ' each independently from one another are a sequence 2 to 9 nucleotides in length
  • - k2 and k2' each independently from one another are a sequence 2 to 7 nucleotides in length;
  • S and S' are mismatch sequences selected not to form a continuous hybrid sequence with sequence element t n and t n ' _ and S and S' are independently 1 , 2, 3, 4 or 5 nucleotides in length,
  • 3k is the same sequence as sequence element ki and a «' is the same sequence as sequence element k-i ',
  • 3k and a «' are selected not to hybridize to k2 and k2', respectively; 3 ⁇ -3 ⁇ hybridizes to a contiguous sequence on rn a -K and 3 ⁇ '-3 ⁇ ' hybridizes to a contiguous sequence on rn a -K'
  • Pc, Pc', rn a -K and ITI a -K' each independently from one another are a sequence 10 to 40 nucleotides in length, and 3 ⁇ _ and independently from one another can be any sequence.
  • ' each independently from one another are a sequence 5, 6, 7, 8 or 9 nucleotides in length
  • S and S' are each independently 2, 3, or 4 nucleotides in length
  • /or l ⁇ 2 and ⁇ i2 each independently from one another are a sequence 2, 3, 4, 5 or 6 nucleotides in length.
  • each ki is different from of any other ki and each k-
  • the sets of primers comprise a left (forward) initial primer comprising a sequence element Pc selected from any one of SEQ ID NO 001 to SEQ ID NO 045 and a right (reverse) initial primer comprising a sequence element Pc' selected from any one of SEQ ID NO 046 to SEQ ID NO 058; and/or - a left (forward) initial primer comprising a sequence element Pc selected from any one of SEQ ID NO 189 to SEQ ID NO 232 and a right (reverse) initial primer comprising a sequence element Pc' selected from any one of SEQ ID NO 233 to SEQ ID NO 246; and/or
  • a left (forward) adaptor primer comprising a sequence element 3 ⁇ _-3p selected from any one of SEQ ID NO 1 18 to SEQ ID NO 149 and a right (reverse) adaptor primer comprising a sequence element m a selected from any one of SEQ ID NO 150 to SEQ ID NO 182.
  • ' and/or l ⁇ 2 and ⁇ i2 are selected not to hybridize to the sequence elements t n and t n ' adjacent to the amplified sequence tract.
  • ki and k-i' and k2 and k2' are separate and distinct from a primer sequence directed toward target amplification. All k-box components solely and exclusively have the purpose of distinguishing the primer set, and thus preventing erroneous amplification of amplicon contaminations, as set forth above.
  • the left initial primer, the right initial primer, the left adaptor primer and/or the right adaptor primer are characterized by one or several nuclease resistant nucleotide(s) or nuclease resistant internucleosidic bond(s) on or near (at position 1 , 2, 3 and /or 4 counting from) the 3' terminus of the primers.
  • the 3' end of the primer is protected against 3' exonuclease digestion by providing bonds that inhibit or resist the exonuclease activity.
  • the nuclease resistant internucleosidic bond is a phosphorothioate bond.
  • the nuclease resistant nucleotide is a 2-O-methylated ribonucleotide.
  • the nuclease resistant nucleotide is an LNA building block (a 2 ⁇ , 4'C-methylene bridged RNA building block).
  • the nuclease resistant nucleotide is a 2-F-deoxyribonucleotide.
  • the nuclease resistant nucleotide is a 2-propyne-deoxyribonucleotide.
  • the nuclease resistant nucleotide or nuclease resistant internucleosidic bond is the last internucleosidic bond counting from the 3' terminus of said primer(s). In some embodiments, the nuclease resistant nucleotide or nuclease resistant internucleosidic bond is located on position -1 , -2, -3, and/or -4 counting from the 3' terminus of said primer(s).
  • the nuclease resistant nucleotide or nuclease resistant internucleosidic bond are located at position - 1 and - 2, in some embodiments at position -1 and -2 and - 3, or in some embodiments at position -1 and -2 and - 3 and -4.
  • a method for sequencing a target sequence tc- -tc' comprised within a sequence tract t n -tc-tv-tc'-tn' comprising the steps of a. amplifying said target sequence by a method as outlined above in any of the aspects and embodiments provided, and b. sequencing said second amplificate including sequence elements m a -K and/or m a -K', yielding a set of readout sequences.
  • the method for sequencing a target sequence further comprises the steps of c. aligning each member of said set of readout sequences to sequence element IT) a - K and/or ITI a -K' comprised in said initial primer, respectively, and d. assigning a value of 0 or 1 as a measure of contamination to each sequence of said set of readout sequences (e.g. the results of NGS sequencing of one sample), wherein complete alignment of a member of said set of readout sequences (i.e.
  • a particular readout sequence) to said sequence element IT) a -K or IT) a -K' corresponds to the value of 0 (signifying no contamination for that particular set member), and incomplete alignment of a member of said set of readout sequences to said sequence element m a -K or m a -K' corresponds to 1 (signifying that this particular read was caused by a contamination);
  • step d resulting in a value sum, and dividing said value sum by the total number of reads; and / or
  • the set of readout sequences consists of 10.000 sequences, for 32 of which the sequence tract corresponding to m a -K or ITI a -K' does not align with the particular sequence expected (chosen) for the particular run, then a percentage of contamination of 32/10.000, resulting in 0,0032 or 0,32% is computed.
  • the method for sequencing a target sequence includes a step of validation or quality control, wherein all sequences obtained are checked for the presence of identifier sequences l ⁇ 2, ⁇ 2 and/or k-i, ki' (ki, ki' can be relevant as identifier of the first amplification reaction, since k-i, k-i' of the second amplification primer can be partially degraded in the second PCR by proof reading polymerases as outlined in detail in the proof of principle examples).
  • Unexpected identifier sequences, or unexpected combinations thereof, are regarded as contamination.
  • the method comprises the steps of providing a set of primers for each sample of said plurality of samples, each set of primers comprising a pair of initial PCR primers comprising a left initial PCR primer having a sequence ITI a -K-pc and a right initial primer having a sequence and rn a -K'-pc', and a pair of adaptor PCR primers comprising a left adaptor PCR primer having a sequence 3
  • each set of primers of said collection comprises i. a pair of initial PCR primers comprising a left (forward) initial PCR primer having a
  • sequence ITI a -K-pc and a right (reverse) initial primer having a sequence and m a -K'- Pc ⁇ and
  • a pair of adaptor PCR primers comprising a left adaptor PCR primer having a
  • Pc is the same sequence as sequence element tc and Pc' is the reverse
  • K comprises a sequence element ki and a 3'-terminal sequence element S
  • K' comprises a sequence element k-
  • S and S' are mismatch sequences selected not to form a continuous
  • hybrid sequence with sequence element t n and t n ' , and S and S' are each independently 1 , 2, 3, 4 or 5 nucleotides in length, 3k is the same sequence as sequence element ki and a «' is the same sequence as sequence element k-i',
  • 3 ⁇ -3 « hybridizes to a contiguous sequence on rn a -K and 3 ⁇ '-3 ⁇ ' hybridizes to a contiguous sequence on rn a -K'
  • - Pc, Pc', rn a -K and rn a -K' each independently from one another are a sequence 10 to 40 nucleotides in length, and 3 ⁇ _ and independently from one another can be any sequence.
  • K comprises a 3'-terminal sequence k ⁇
  • K' comprises a 3'- terminal sequence k ⁇
  • all sequence elements 3p are the same and all sequence elements 3p' are the same for a collection.
  • a set of primers according to the invention (and intended for use in a method of the invention) comprises:
  • - a left (forward) initial primer comprising a sequence element Pc selected from any one of SEQ ID NO 001 to SEQ ID NO 045 and a right (reverse) initial primer comprising a sequence element p c ' selected from any one of SEQ ID NO 046 to SEQ ID NO 058; and/or - a left (forward) initial primer comprising a sequence element Pc selected from any one of SEQ ID NO 189 to SEQ ID NO 232 and a right (reverse) initial primer comprising a sequence element p c ' selected from any one of SEQ ID NO 233 to SEQ ID NO 246; and/or
  • a left (forward) adaptor primer comprising a sequence element 3 ⁇ _-3p selected from any one of SEQ ID NO 1 18 to SEQ ID NO 149 and a right (reverse) adaptor primer comprising a sequence element m a selected from any one of SEQ ID NO 150 to SEQ
  • each set adheres to the definition given for the previously defined aspect of the invention (a set of primers according to the invention), and wherein for all sets of primers comprised within said collection, all sequence elements Pc are the same and all sequence elements Pc' are the same.
  • each set of primers is characterized by a different combination of ki and k-
  • each set of primers has a unique K1/K1 ' combination.
  • each set of primers is characterized by a different combination of k-
  • the collection of sets of primers according to the invention comprise 4, 8, 16, 24, 32, 40, 48, 56, 64, 72, 80, 160, 200, 256 or 1024 different sets of primers.
  • a multiplex-collection comprising a plurality of collections of sets of primers according to the invention, whereby each collection is characterized by a different combination of Pc and Pc'.
  • a multiplex set within a multiplex collection is defined as a multiplex collection member (primer library member).
  • a multiplex set is a plurality of sets of primers for employment in a method of the invention, wherein the plurality is characterized in that each member set differs from any other member set in their combination of Pc and Pc', but for all member sets, ki and k-i' (and, where applicable, k2 and k2') are the same.
  • the multiplex collection members can thus be used together, within the same multiplex PCR, and different multiplex collection members (discriminated by different K-boxes) will be used in repeated PCR/sequencing rounds.
  • T- cell receptor beta (TCRB) gene rearrangements a PCR-based analysis of T- cell receptor beta (TCRB) gene rearrangements was performed.
  • TCR T- cell receptor beta
  • the use of a two-step PCR strategy for TCR analyses has the advantage that the initial PCR with gene-specific TCR primers requires only a few PCR cycles minimizing PCR- generated bias, and thereafter the first amplificate is amplified evenly with the adaptor specific primers by a further PCR step.
  • different adaptors suitable for different NGS platforms can be added by the second PCR.
  • sequences for the target-binding tract of left (Pc) initial primer are those given as SEQ ID NO 001 -045, and right (Pc ) initial primer sequences are those given as SEQ ID NO 046-058.
  • sequences for the target-binding tract of left (Pc) initial primer are those given as SEQ ID NO 189-232
  • right (Pc ) initial primer sequences are those given as SEQ ID NO 233-246.
  • the primers given as SEQ ID NO 001 -058 and as SEQ ID NO 189-246 were optimized in two aspects: 1 ) to have a similar annealing temperature and 2) to minimize self priming.
  • Fig. 1 shows the primers, target and first and second amplificate of the method of the invention, wherein the sequence tract ITI a -K comprises a sequence element ki and the sequence tract ITI a -K ' comprises a sequence element k-i ' .
  • Reverse complementary sequence tracts are underlined.
  • Fig. 2 shows the primers, target and first and second amplificate of the method of the invention, wherein the sequence tract ITI a -K, in addition to k-
  • Fig. 3 shows the primers, target and first and second amplificate of the method of the invention, wherein the sequence tract ITI a -K, in addition to ki and l ⁇ 2 comprises a sequence element S and the sequence tract m a -K ' , in addition to k ⁇
  • Reverse complementary sequence tracts are underlined.
  • Fig. 4 shows the primers, target and first and second amplificate of the method of the invention, wherein the sequence tract ITI a -K, in addition to k-
  • Reverse complementary sequence tracts are underlined.
  • ' (with a lower case k) are together also termed Ki with a capital letter and k2/k2' sequence tracts are thereafter also termed K2. Furthermore, S-
  • the "prime” or apostrophe (') indicates that a sequence tract or element has a similar functional characteristic as its non-prime counterpart, but is located on a primer on the other side of the target sequence.
  • Example 1 Proof of principle experiments for function.
  • PCR products of the first amplification were defined as a 100% contamination and were used as template for the second amplification.
  • effects on contamination suppression (i) employing polymerases with and without proofreading activity and (ii) primers with and without phosphorothioate bonds or LNAs were analysed.
  • PCR was performed using a DNA thermal cycler (PE 9700, Perkin Elmer, Rodgau, Germany).
  • PE 9700 Perkin Elmer, Rodgau, Germany
  • the initial primers used for the first round of amplification comprised in order from 5' to 3' end a sequence tract rn a -K and a sequence tract Pc (Fig. 1 ).
  • Sequence tract Pc provided target specificity
  • m a -K provided a non-target-specific sequence tract, parts or all of which can be used for hybridization of a second "adaptor" primer.
  • the left initial PCR primers had a sequence m a -K-pc with the matching sequence Pc to the V-4 segment (SEQ 183; TTATTCCTTCACCTACACACCCTGC), whereas the right initial primers which had the sequence and m a -K'-pc' with the matching sequence Pc' (SEQ ID NO 184; AGCACTGTCAGCCGGGTGCCTGG) to the J-2.1 segment.
  • the 3' end of the k-box of forward initial primers had the sequence element S with the two nucleotides "GG", whereas the 3' end of the k'-box of the initial reverse primer had a sequence element s' with two nucleotides "TA”. Furthermore, the k-box of the forward initial primers had a sequence element IT) a (SEQ ID NO 185; CGCTCTTCCGATCT) on the 5' end and the k'-box of the initial reverse primers had a sequence element m a ' (SEQ ID NO 186; TGCTCTTCCGATCT) on the 5' end (See Fig. 3 for the overview of the sequence tract names).
  • Table 2 k-box and k ' -box element sequences are listed as present in 5 ' -3 ' orientation of the forward or reverse primers.
  • First amplification steps were performed in a final volume of 50 ⁇ with final concentrations of 1 x PCR Buffer containing 3 mM MgCI 2 , 0.2 mM of each dNTP, 1 .0 ⁇ forward primer and 1.0 ⁇ reverse primer and 1 unit AmpliTaq Gold DNA Polymerase (Applied Biosystems, Foster City, CA, USA) and the following cycling conditions: 1 cycle at 95°C for 15 min, 34 cycles at 95°C for 30 s, 65°C for 45 s and 72°C for 45 sec respectively, and a final 10 min elongation step at 72°C.
  • Primary PCR products were purified using the QIAquick PCR Purification Kit (Qiagen, Hilden, Germany) according to the manufacturer's instructions. DNA concentration was determined via the Qubit® 1 .0 Fluorometer (Invitrogen, Darmstadt, Germany). As template for the second amplification 500 pg from the purified first amplification product was used.
  • a pair of adaptor PCR primers comprising a left adaptor PCR primer having a sequence 3
  • the left adaptor primers had the sequence element 3 ⁇ _-3p (SEQ ID NO 187) whereas the right adaptor primers had the sequence element 3 ⁇ _'-3p' (SEQ ID NO 188).
  • ' (listed in Table 2).
  • Ki mismatches of the second amplification primer can be removed at the 3 ' end by the 3 ' -5 ' exonuclease-activity of a proofreading polymerase during the second amplification
  • the second amplification steps were performed (i) with a proofreading polymerase (Phusion High-Fidelity DNA Polymerase (Finnzymes, Espoo, Finland)) or (ii) a polymerase without proofreading activity (AmpliTaq Gold).
  • a proofreading polymerase Phusion High-Fidelity DNA Polymerase (Finnzymes, Espoo, Finland)
  • a polymerase without proofreading activity AmpliTaq Gold
  • the second amplification step was performed in a final volume of 50 ⁇ including final concentrations of 1 x Phusion HF Buffer with 1 .5 mM MgCI_2, 0.05 mM of each dNTP, 1.0 ⁇ forward primer, 1 .0 ⁇ reverse primer and 1 unit Phusion High-Fidelity DNA Polymerase.
  • the following thermal cycling conditions were used for the second amplification: 1 cycle at 98°C for 30 s, 12 cycles at 98°C for 10 s, 58°C for 30 s and 72°C for 30s respectively, and a final 5 min elongation at 72°C.
  • the second amplification step was performed in a final volume of 50 ⁇ with final concentrations of 1 x PCR Buffer, 3 mM MgCI 2 , 0.2 mM of each dNTP, 1.0 ⁇ forward primer and 1.0 ⁇ reverse primer and 1 unit AmpliTaq Gold DNA Polymerase.
  • the following thermal cycling conditions were used for the second amplification: 1 cycle at 95°C for 15 min, 23 cycles at 98°C for 10 s, 54°C for 30 s and 72°C for 30 s, respectively, and a final 5 min elongation step at 72°C.
  • PCR products were analysed on a 6% acrylamide gels and Tif files were produced with Biorad Geldoc 2000 (Munchen, Germany) using default conditions. PCR bands were further quantified with the FusionCapt Advance software (Vilber Lourmat, Eberhardzell, Germany).
  • NTC no template control
  • iv the background gate.
  • SDN standard derivation
  • Table 3 Effect of the number of Ki mismatches (1 and 2 bp) on contamination suppression employing second amplification primers with 3, 2, 1 and 0 phosphorothioate (PT) bonds at their 3 ' end and proofreading polymerase.
  • PT phosphorothioate
  • Table 5 the mean of all NTCs was 10.0 (SDN: 3.7) and the mean of background was 9.1 (SDN: 1 .0).
  • Table 5 and 6 show that in a setting with a proofreading polymerase employed in second amplification and 3 phosphorothioate bonds at the 3 ' end of the k-box and k ' -box of the second amplification primers Ki mismatches of 4 bp (mean 9.6, SDN 1 .3) and 6 bp (mean 9.1 , SDN 2.3) lead to complete suppression of contaminations comparable to NTCs and background.
  • Table 7 Effect of the number of Ki mismatches (1 and 2 bp total length) on contamination suppression employing second amplification primers without phosphorothioate bonds and a polymerase without proofreading activity.
  • Table 7 and 8 show that also in a setting with a polymerase without proofreading activity and second amplification primers without phosphorothioate bonds at the 3 ' end of the k-box and k ' -box contamination suppression increases with an increasing number of Ki mismatches.
  • Each of these primers had a 5 ' S sequence of two nucleotides in length (For the SEQ I D NO 189-193, 195, 197, 198, 201 -21 1 , 213-221 , 223-229, 231 , 233-241 and 243-246 the S sequence was "GG”, for the SEQ I D NO 194, 200 and 230, the S sequence was "TG”, for the SEQ I D NO 196, 199, 212, 222, 242 the S sequence was "GT”, for the SEQ ID NO 232 the S sequence was "TT”. The orientation of these S sequences is in 5 ' - 3 ' direction of the primer.
  • the k-box of the forward initial primers had the tail sequence element m a (SEQ I D NO 247 GCTCTTCCGATCT) on their 5' end and the k'-box of the initial reverse primers had a sequence element IT) a ' (SEQ I D NO 247; GCTCTTCCGATCT) on their 5' end.
  • Second amplification primers were employed (i) with 2 phosphorothioate bonds at their 3 ' end and in another experiment with (ii) an LNA at the second position from the 3 ' end.
  • Three primer sets (Set 1 -3) were used with the set specific Ki and K 2 sequences given in Table 9. Name ki sequence k2 sequence ki sequence k2 sequence
  • Table 9 k-box and k ' -box element sequences are listed as present in 5 ' -3 ' orientation of the forward or reverse primers.
  • the first PCRs with AmpliTaq-Gold
  • second PCRs with the proofreading Phusion High- Fidelity DNA Polymerase
  • the PCR results were quantified with the FusionCapt Advance software as described above.
  • Table 10 1 A summary statistics of Table 10 is provided in Table 1 1 . These results show, that in a Ki match situation the contamination is amplified, whereas in the Ki mismatch situation the contamination is not amplified (being comparable to background, considering the SDN).
  • k2 is located at the 3 ' -end of the sequence element ki and
  • ⁇ i2 is a sequence element located at the 3'-end of the sequence element k-i' (Fig. 2-3).
  • K2 serves to individualize the first primer pair of the set and have no complementary sequence elements on the second ("adaptor") primers.
  • K2 sequences are designed to detect contamination from previous amplification reactions and therefore control the suppression efficiency of K-
  • k2/k2' elements can be seen as a valuable safe lock mechanism to detect contaminations, complementing the already significant contribution of k-
  • the first "Tube Nr. 1 " amplification was regarded to be a "100% contamination" ("Tube Nr.1 " primary amplification product) of "Tube Nr. 2" second amplification. Therefore, a second amplification was performed with “Tube Nr. 2" second amplification primers and the “Tube Nr. 1 " first amplification product as template. In the gel analysis of the resulting second amplification PCR product there was a PCR product detectable, since due to the only 1 bp long ki mismatch this "Tube Nr. 1 " contamination was not completely suppressed during second amplification (with "Tube Nr. 2" second amplification primers). This PCR product was sequenced.
  • the Sanger sequencing demonstrated the k2/k2' function to detect contamination.
  • polymerase with or without proofreading polymerase can be used in second amplification.
  • k2/k2' elements help to understand and control the function of k-
  • Another important result of this experiment is that if proofreading polymerase is employed, unexpected k-
  • a feature that improves on the performance of the above elements ki (and k-i ') and l ⁇ 2 (and 2 ) is the introduction of short separator sequences S and S' (Fig. 3-4).
  • S separates the constant initial primer sequence Pc from the sequence tracts ki and k2 and
  • S' separates the constant initial primer sequence Pc ' from k-
  • ' and k2/k2 ' vary among different primers used in subsequent reactions, it may well be that some variations of k-
  • the first amplification was performed as described above with 100 ng template DNA from the T-cell lymphoma cell line Peer and the following cycle conditions. 1 cycle at 95°C for 15 min, 29 cycles at 95°C for 30 s, 68 °C for 45 s and 72°C for 45 sec respectively, and a final 10 min elongation at 72°C.
  • the first amplification PCR primers had a sequence IT) a K-pc with the matching sequence Pc to the V-4 segment (SEQ ID NO 248; ACCTACACACCCTGC), whereas the right first amplification primers which had the sequence and IT) a K'-pc' had the matching sequence Pc' (SEQ ID NO 249; AGCCGGGTGCCTGG) to the J-2.1 segment.
  • the k-box of the left first amplification primers had a sequence element m a (SEQ ID NO 250; CGCTCTTCCGATCT) on the 5' terminus and the k'-box of the right first amplification primers had a sequence element m a ' (SEQ ID NO 251 ; TGCTCTTCCGATCT) on the 5' terminus.
  • Table 12 Overview of S sequences and 6 bp K-box sequences. Some of the K-box sequences have a full-match to the V-4 segment and J-2.1 segment to simulate an incidentally matched K-box to the template sequence.
  • V the first letter “V” or “J” stands for the V- or J- TCR Primer in which the respective K-box is comprised
  • KM stands for K-box match to template sequence
  • KMM stand for K-box mismatch to template sequence
  • S1-3 gives the length of a separator sequence S (1 -3 nucleotides).
  • V V- or J- TCR Primer in which the respective K-box is comprised
  • KM stands for K-box match to template sequence
  • KMM stand for K-box mismatch to template sequence
  • S1 -3 gives the length of a separator sequence S (1 -3 nucleotides).
  • Table 13 shows that S sequences lead to a similar amplification despite of coincidentally template matching k-box and k ' -box sequences.
  • Table 13 line 6 the amplification (Vol. %) with primers harbouring a S sequence of 3 bp length and template matching k-box and k ' -box sequences have a mean of 18.4 (SDN 4.5) which is comparable to the amplification without template matching k-box and k ' -box sequences in Table 13 line 3 with a mean of 17.6 (SDN 5.1 ).
  • Example 4 Contamination suppression by Ki and detection by K? employing a JCR , multiplex collection and NGS analysis
  • the first amplificate mix used as template for second amplification comprised 50% tonsillar amplificate (Set1 ), 25% Jurkat amplificate (Set1 ) and 25% Karpas299 amplificate (Set1 ).
  • the second amplification primers were from Set1 .
  • the amplificate mix was used as template for second amplification comprised 50% tonsillar amplificate (Set1 ), 25% Jurkat amplificate (Set2) and 25% Karpas299 amplificate (Set3).
  • the second amplification primers were from Set1 .
  • Table 14 Experimental design to analyse contamination suppression by Ki and detection by K 2 employing a TCF ⁇ multiplex-collection and NGS analysis. For each of the 4 samples an individual standard lllumina barcodes was introduced into the amplification product by the right second amplification primer to allow NGS multiplexing.
  • Table 15 NGS results of contamination suppression analysis described in Table 14.
  • the Set information of the related reads refers always to the triplet (Tonsil/cell line 1/cell line 2).
  • suitable ki and k-i' sequences they were designed in a way to (a) optimally avoid cross-hybridization between all ki and k-
  • Each of the Tables 16-19 consists of an equal number of ki and k-i ' sequences for the forward and reverse primers and a specific length (4, 5,r 6, 7 or 8 nucleotides).
  • features a)-c) were established by comparing all potential ki and k-i ' sequences of one specific length (4, 5, 6, 7 or 8 bp) against each other and excluded all those which were reverse-complements to any other ki and k-i ' sequences of this specific length.
  • the design algorithm compared in a further step all ki and k-
  • ' sequences are given in Tables 16-19. It is understood that this are examples and that other optimized K ⁇
  • the K-boxes are designed as one unit being selected to form a minimum of cross-hybridization with the 3 ' ends of the primes employed.
  • Table 16 Optimized ki and k-
  • segment side A can be employed in the right primers and B in the left primers.
  • segment side B can be employed in the right primers and A in the left primers.
  • Table 17 Optimized ki and k-
  • segment side A can be employed in the right primers and B in the left primers.
  • segment side B can be employed in the right primers and A in the left primers.
  • Table 18 Optimized ki and k-
  • segment side A can be employed in the right primers and B in the left primers.
  • segment side B can be employed in the right primers and A in the left primers.
  • Table 19 Optimized ki and ki ' sequence of 7 and 8 nucleotide (nt) length.
  • segment side A can be employed in the right primers and B in the left primers.
  • segment side B can be employed in the right primers and A in the left primers.
  • Table 20 Examples for k2 and k2 sequence of 3 bp length.
  • segment side A can be employed in the right primers and B in the left primers.
  • segment side B can be employed in the right primers and A in the left primers.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Immunology (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Biophysics (AREA)
  • Analytical Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
PCT/EP2013/077763 2012-12-23 2013-12-20 Methods and primer sets for high throughput pcr sequencing Ceased WO2014096394A1 (en)

Priority Applications (5)

Application Number Priority Date Filing Date Title
EP13814143.7A EP2935618B1 (en) 2012-12-23 2013-12-20 Methods and primer sets for high throughput pcr sequencing
CA2894635A CA2894635C (en) 2012-12-23 2013-12-20 Methods and primer sets for high throughput pcr sequencing
US14/654,537 US10894983B2 (en) 2012-12-23 2013-12-20 Methods and primer sets for high throughput PCR sequencing
DK13814143.7T DK2935618T3 (en) 2012-12-23 2013-12-20 Methods and primer sets for high throughput PCR sequencing
JP2015548650A JP6496665B2 (ja) 2012-12-23 2013-12-20 ハイスループットpcrシーケンシングのための方法及びプライマーのセット

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
EP12199315.8 2012-12-23
EP12199315 2012-12-23
EP13175199.2 2013-07-04
EP13175199.2A EP2746405B1 (en) 2012-12-23 2013-07-04 Methods and primer sets for high throughput PCR sequencing

Publications (1)

Publication Number Publication Date
WO2014096394A1 true WO2014096394A1 (en) 2014-06-26

Family

ID=47504728

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2013/077763 Ceased WO2014096394A1 (en) 2012-12-23 2013-12-20 Methods and primer sets for high throughput pcr sequencing

Country Status (6)

Country Link
US (1) US10894983B2 (https=)
EP (2) EP2746405B1 (https=)
JP (1) JP6496665B2 (https=)
CA (1) CA2894635C (https=)
DK (1) DK2935618T3 (https=)
WO (1) WO2014096394A1 (https=)

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2016195382A1 (ko) * 2015-06-01 2016-12-08 연세대학교 산학협력단 바코드 서열을 포함하는 어댑터를 이용한 차세대 염기서열 분석 방법
WO2016176654A3 (en) * 2015-04-29 2016-12-15 The Regents Of The University Of California COMPOSITIONS AND METHODS FOR CONSTRUCTING STRAND SPECIFIC cDNA LIBRARIES
WO2018057846A1 (en) * 2016-09-22 2018-03-29 Sigma-Aldrich Co, Llc Single primer to dual primer amplicon switching
EP3372683A1 (en) 2015-08-10 2018-09-12 HS Diagnomics GmbH Method for providing tumor-specific t cells und use thereof
WO2020165283A1 (en) 2019-02-12 2020-08-20 Therycell Gmbh Reverse immunosuppression
WO2023006450A2 (en) 2021-07-15 2023-02-02 Hs Diagnomics Gmbh Identification of common tumor-specific t cell receptors and antigens
WO2023232785A1 (en) 2022-05-30 2023-12-07 Hs Diagnomics Gmbh Common tumor-specific t cell receptors

Families Citing this family (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104562214A (zh) * 2014-12-26 2015-04-29 上海派森诺生物科技有限公司 一种基于ⅱb型限制性内切酶酶切的简化基因组建库方法
CN105256379A (zh) * 2015-11-23 2016-01-20 武汉大学 一种新的基因组简化甲基化测序文库的制备方法
US10633651B2 (en) * 2017-07-10 2020-04-28 Agilent Technologies, Inc. Assay methods and compositions for detecting contamination of nucleic acid identifiers
IT201900024159A1 (it) * 2019-12-16 2021-06-16 Menarini Silicon Biosystems Spa Metodo e kit per amplificazione totale del genoma e analisi di molecole bersaglio in un campione biologico
WO2022202728A1 (ja) * 2021-03-26 2022-09-29 富士フイルム株式会社 プライマー対、塩基配列変異の判定方法及び塩基配列の変異判定用キット
CN115961002B (zh) * 2022-11-08 2025-11-25 浙江绍兴鼎晶生物医药科技股份有限公司 一种基于循环肿瘤dna的突变基因检测方法及其应用
CN120548357A (zh) * 2022-11-21 2025-08-26 百奥赛科生物科技有限公司 目标核酸序列的高通量扩增

Citations (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4883750A (en) 1984-12-13 1989-11-28 Applied Biosystems, Inc. Detection of specific sequences in nucleic acids
WO1991015601A1 (en) * 1990-04-05 1991-10-17 The United States Of America, As Represented By The Secretary, U.S. Department Of Commerce Modified rna template-specific polymerase chain reaction
US5750341A (en) 1995-04-17 1998-05-12 Lynx Therapeutics, Inc. DNA sequencing by parallel oligonucleotide extensions
WO1999020798A1 (en) * 1997-10-23 1999-04-29 Exact Laboratories, Inc. Methods for detecting contamination in molecular diagnostics using pcr
US6274320B1 (en) 1999-09-16 2001-08-14 Curagen Corporation Method of sequencing a nucleic acid
US20020055100A1 (en) 1997-04-01 2002-05-09 Kawashima Eric H. Method of nucleic acid sequencing
US20050100900A1 (en) 1997-04-01 2005-05-12 Manteia Sa Method of nucleic acid amplification
US7244567B2 (en) 2003-01-29 2007-07-17 454 Life Sciences Corporation Double ended sequencing
US7264929B2 (en) 1999-09-16 2007-09-04 454 Life Sciences Corporation Method of sequencing a nucleic acid
US7575865B2 (en) 2003-01-29 2009-08-18 454 Life Sciences Corporation Methods of amplifying and sequencing nucleic acids

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8361712B2 (en) * 2007-12-17 2013-01-29 General Electric Company Contamination-free reagents for nucleic acid amplification
US8748103B2 (en) * 2008-11-07 2014-06-10 Sequenta, Inc. Monitoring health and disease status using clonotype profiles
EP2364368B1 (en) * 2008-11-07 2014-01-15 Sequenta, Inc. Methods of monitoring conditions by sequence analysis
US9080210B2 (en) * 2010-06-09 2015-07-14 Keygene N.V. High throughput screening using combinatorial sequence barcodes

Patent Citations (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4883750A (en) 1984-12-13 1989-11-28 Applied Biosystems, Inc. Detection of specific sequences in nucleic acids
WO1991015601A1 (en) * 1990-04-05 1991-10-17 The United States Of America, As Represented By The Secretary, U.S. Department Of Commerce Modified rna template-specific polymerase chain reaction
US5750341A (en) 1995-04-17 1998-05-12 Lynx Therapeutics, Inc. DNA sequencing by parallel oligonucleotide extensions
US20020055100A1 (en) 1997-04-01 2002-05-09 Kawashima Eric H. Method of nucleic acid sequencing
US20050100900A1 (en) 1997-04-01 2005-05-12 Manteia Sa Method of nucleic acid amplification
US20110045541A1 (en) 1997-04-01 2011-02-24 Illumina Cambridge, Ltd. Method of nucleic acid amplification
WO1999020798A1 (en) * 1997-10-23 1999-04-29 Exact Laboratories, Inc. Methods for detecting contamination in molecular diagnostics using pcr
US6274320B1 (en) 1999-09-16 2001-08-14 Curagen Corporation Method of sequencing a nucleic acid
US7264929B2 (en) 1999-09-16 2007-09-04 454 Life Sciences Corporation Method of sequencing a nucleic acid
US7244567B2 (en) 2003-01-29 2007-07-17 454 Life Sciences Corporation Double ended sequencing
US7323305B2 (en) 2003-01-29 2008-01-29 454 Life Sciences Corporation Methods of amplifying and sequencing nucleic acids
US7575865B2 (en) 2003-01-29 2009-08-18 454 Life Sciences Corporation Methods of amplifying and sequencing nucleic acids

Non-Patent Citations (11)

* Cited by examiner, † Cited by third party
Title
ADAM LEVY/ AMPLION LTD: "Two-temperature tagged (2T-TA) PCR for elimination of false positives due to amplicon contamination", RESEARCH DISCLOSURE, MASON PUBLICATIONS, HAMPSHIRE, GB, vol. 499, no. 7, 14 October 2005 (2005-10-14), XP007135635, ISSN: 0374-4353 *
BAETENS ET AL., HUMAN MUTATION, vol. 32, 2011, pages 1053 - 1062
ELECTROPHORESIS, vol. 34, no. 4, February 2013 (2013-02-01), pages 619
GROSSMANN ET AL.: "Robustness of Amplicon Deep Sequencing Underlines Its Utility in Clinical Applications", J MOL DIAGN., 14 May 2013 (2013-05-14), pages 1525 - 1578
HAQUE ET AL.: "Solid-State and Biological Nanopore for Real-Time Sensing of Single Chemical and Sequencing of DNA", NANO TODAY, vol. 8, no. 1, February 2013 (2013-02-01), pages 56 - 74
KOHLMANN A ET AL.: "Integration of next-generation sequencing into clinical practice: are we there yet?", SEMIN ONCOL., vol. 39, no. 1, February 2012 (2012-02-01), pages 26 - 36
KOHLMANN ET AL.: "Next-generation sequencing - feasibility and practicality in haematology", BR J HAEMATOL., vol. 160, no. 6, 7 January 2013 (2013-01-07), pages 736 - 53
LIU ET AL.: "Comparison of next-generation sequencing systems", J BIOMED BIOTECHNOL. 2012, 2012, pages 251364
MACHTELD BAETENS ET AL: "Applying massive parallel sequencing to molecular diagnosis of Marfan and Loeys-Dietz syndromes", HUMAN MUTATION, vol. 32, no. 9, 20 September 2011 (2011-09-20), pages 1053 - 1062, XP055075059, ISSN: 1059-7794, DOI: 10.1002/humu.21525 *
MERRIMAN ET AL.: "Progress in ion torrent semiconductor chip based sequencing", ELECTROPHORESIS, vol. 33, no. 23, December 2012 (2012-12-01), pages 3397 - 417
THUDI M ET AL.: "Current state-of-art of sequencing technologies for plant genomics research", BRIEF FUNCT GENOMICS, vol. 11, no. 1, January 2012 (2012-01-01), pages 3 - 11

Cited By (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2016176654A3 (en) * 2015-04-29 2016-12-15 The Regents Of The University Of California COMPOSITIONS AND METHODS FOR CONSTRUCTING STRAND SPECIFIC cDNA LIBRARIES
US11279927B2 (en) 2015-04-29 2022-03-22 The Regents Of The University Of California Compositions and methods for constructing strand specific CDNA libraries
WO2016195382A1 (ko) * 2015-06-01 2016-12-08 연세대학교 산학협력단 바코드 서열을 포함하는 어댑터를 이용한 차세대 염기서열 분석 방법
EP3372683A1 (en) 2015-08-10 2018-09-12 HS Diagnomics GmbH Method for providing tumor-specific t cells und use thereof
WO2018057846A1 (en) * 2016-09-22 2018-03-29 Sigma-Aldrich Co, Llc Single primer to dual primer amplicon switching
CN109804083A (zh) * 2016-09-22 2019-05-24 西格马-奥尔德里奇有限责任公司 单引物至双引物扩增子转换
US11390913B2 (en) 2016-09-22 2022-07-19 Sigma-Aldrich Co. Llc Single primer to dual primer amplicon switching
CN109804083B (zh) * 2016-09-22 2023-11-03 西格马-奥尔德里奇有限责任公司 单引物至双引物扩增子转换
WO2020165283A1 (en) 2019-02-12 2020-08-20 Therycell Gmbh Reverse immunosuppression
WO2023006450A2 (en) 2021-07-15 2023-02-02 Hs Diagnomics Gmbh Identification of common tumor-specific t cell receptors and antigens
EP4249592A2 (en) 2021-07-15 2023-09-27 Boehringer Ingelheim International GmbH Identification of common tumor-specific t cell receptors and antigens
WO2023232785A1 (en) 2022-05-30 2023-12-07 Hs Diagnomics Gmbh Common tumor-specific t cell receptors

Also Published As

Publication number Publication date
US10894983B2 (en) 2021-01-19
US20150337368A1 (en) 2015-11-26
CA2894635A1 (en) 2014-06-26
DK2935618T3 (en) 2018-12-03
EP2935618A1 (en) 2015-10-28
EP2746405A1 (en) 2014-06-25
JP6496665B2 (ja) 2019-04-03
CA2894635C (en) 2021-03-02
EP2935618B1 (en) 2018-08-08
EP2746405B1 (en) 2015-11-04
JP2016500275A (ja) 2016-01-12

Similar Documents

Publication Publication Date Title
US10894983B2 (en) Methods and primer sets for high throughput PCR sequencing
US12264357B2 (en) Universal Sanger sequencing from next-gen sequencing amplicons
KR102343605B1 (ko) 비대립 유전자-특이적 프라이머 및 대립 유전자-특이적 블로커 올리고뉴클레오티드를 중첩하는 조성물을 사용한 대립 유전자-특이적 증폭
JP7221199B2 (ja) マルチプレックスpcrの実施方法
EP3495497B1 (en) Methods and compositions for multiplex pcr
US10253352B2 (en) Methods for determining sequence profiles
CA2468754A1 (en) Annealing control primer and its uses
JP2005511096A5 (https=)
KR20170124589A (ko) 중첩 암플리콘의 선택적 증폭
EP3914729A1 (en) Methods of nucleic acid detection and primer design
CN107406891B (zh) Pcr方法
JP7788280B2 (ja) 標的遺伝子領域の柔軟かつハイスループット配列決定
CN113122616A (zh) 扩增和确定目标核苷酸序列的方法
US20210130815A1 (en) Evaluating Genomic Variation Using Repetitive Nucleic Acid Sequences
CN116547390A (zh) 定量多重扩增子测序系统
KR101856205B1 (ko) 핵산의 대립형질 특이적 프라이머 및 이를 이용한 유전형 판별 방법
CN120700139B (zh) 核酸序列分子以及dna甲基化检测方法
HK40065933A (en) Allele-specific amplification using overlapping non-allele-specific primer and allele-specific blocker oligonucleotides
HK1244036B (en) Pcr method

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 13814143

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2894635

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 14654537

Country of ref document: US

ENP Entry into the national phase

Ref document number: 2015548650

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 2013814143

Country of ref document: EP