WO2014089623A1 - Treatment of diseases of endothelial dysfunction and inflammation - Google Patents

Treatment of diseases of endothelial dysfunction and inflammation Download PDF

Info

Publication number
WO2014089623A1
WO2014089623A1 PCT/AU2013/001452 AU2013001452W WO2014089623A1 WO 2014089623 A1 WO2014089623 A1 WO 2014089623A1 AU 2013001452 W AU2013001452 W AU 2013001452W WO 2014089623 A1 WO2014089623 A1 WO 2014089623A1
Authority
WO
WIPO (PCT)
Prior art keywords
cells
stro
progeny
soluble factors
administered
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/AU2013/001452
Other languages
English (en)
French (fr)
Inventor
Wayne Gregory KIMPTON
Simon Reeves BAILEY
Silviu Itescu
Peter Ghosh
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Mesoblast Inc
Original Assignee
Mesoblast Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to EP13862555.3A priority Critical patent/EP2931876B1/en
Priority to CN202010796960.9A priority patent/CN111840329B/zh
Priority to HK15110737.0A priority patent/HK1210209B/en
Priority to CA2893942A priority patent/CA2893942C/en
Priority to KR1020227005920A priority patent/KR102506612B1/ko
Priority to EP19174698.1A priority patent/EP3556850A1/en
Priority to SG11201504340YA priority patent/SG11201504340YA/en
Priority to US14/650,172 priority patent/US20160175360A1/en
Priority to JP2015546770A priority patent/JP6572130B2/ja
Priority to ES13862555T priority patent/ES2742035T3/es
Priority to AU2013360024A priority patent/AU2013360024B2/en
Application filed by Mesoblast Inc filed Critical Mesoblast Inc
Priority to KR1020217004422A priority patent/KR102367981B1/ko
Priority to CN201380072732.5A priority patent/CN105358163B/zh
Priority to KR1020157017531A priority patent/KR102217962B1/ko
Publication of WO2014089623A1 publication Critical patent/WO2014089623A1/en
Priority to IL239308A priority patent/IL239308A0/en
Anticipated expiration legal-status Critical
Priority to AU2019202960A priority patent/AU2019202960B2/en
Priority to AU2021250848A priority patent/AU2021250848A1/en
Priority to US18/481,041 priority patent/US20240115618A1/en
Priority to AU2024227208A priority patent/AU2024227208A1/en
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/28Bone marrow; Haematopoietic stem cells; Mesenchymal stem cells of any origin, e.g. adipose-derived stem cells
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7028Compounds having saccharide radicals attached to non-saccharide compounds by glycosidic linkages
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00Medicinal preparations characterised by special physical form
    • A61K9/0012Galenical forms characterised by the site of application
    • A61K9/0019Injectable compositions; Intramuscular, intravenous, arterial, subcutaneous administration; Compositions to be administered through the skin in an invasive manner
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P13/00Drugs for disorders of the urinary system
    • A61P13/12Drugs for disorders of the urinary system of the kidneys
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00Drugs for disorders of the metabolism
    • A61P3/08Drugs for disorders of the metabolism for glucose homeostasis
    • A61P3/10Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • A61P37/02Immunomodulators
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • A61P9/04Inotropic agents, i.e. stimulants of cardiac contraction; Drugs for heart failure
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • A61P9/08Vasodilators for multiple indications
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • A61P9/10Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • A61P9/12Antihypertensives
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • A61P9/14Vasoprotectives; Antihaemorrhoidals; Drugs for varicose therapy; Capillary stabilisers
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06Animal cells or tissues; Human cells or tissues
    • C12N5/0602Vertebrate cells
    • C12N5/0652Cells of skeletal and connective tissues; Mesenchyme
    • C12N5/0662Stem cells
    • C12N5/0663Bone marrow mesenchymal stem cells (BM-MSC)

Definitions

  • the present disclosure relates to methods for treating or preventing diseases of endothelial dysfunction or inflammation and conditions associated therewith.
  • Endothelial dysfunction is characterized by a shift of the actions of the endothelium toward reduced vasodilation, a proinflammatory state, and prothrombic properties. It is the general consensus of vascular biologists that endothelial injury with resulting dysfunction is the initiating event in atherosclerosis (Ross Nature 3(52:801-9, 1993) and plays an important role in the ischemic manifestations of coronary disease. Endothelial dysfunction also precedes the physical presence of atherosclerosis (Reddy et al, J Am Coll Cardiol 23 :833-843, 1994). It is also associated with most forms of cardiovascular disease (such as hypertension, coronary artery disease, chronic heart failure and peripheral artery disease), complications of diabetes (such as nephropathy) and chronic renal failure.
  • cardiovascular disease such as hypertension, coronary artery disease, chronic heart failure and peripheral artery disease
  • complications of diabetes such as nephropathy
  • Mechanisms that participate in the reduced vasodilatory responses in endothelial dysfunction include reduced nitric oxide generation, oxidative excess, and reduced production of hyperpolarizing factor. Upregulation of adhesion molecules, generation of chemokines such as macrophage chemoattractant peptide- 1, and production of plasminogen activator inhibitor- 1 participate in the inflammatory response and contribute to a prothrombic state.
  • Vasoactive peptides such as angiotensin II and endothelin-1; the accumulation of asymmetric dimethylarginine, an endogenous nitric oxide inhibitor; hypercholesterolemia; hyperhomocysteinemia; altered insulin signaling; and hyperglycemia can contribute to these different mechanisms.
  • an excess of angiotensin II is observed in conditions associated with endothelial dysfunction.
  • Angiotensin II is considered a competitive inhibitor of angiotensin I, with angiotenisin I being involved in inhibiting thickening of the endothelium, promoting endothelial survival, stabilization of supporting perivascular cells and inhibition of endothelial permeability. Excessive levels of angiotensin II inhibit these beneficial effects.
  • Endothelial dysfunction is also an important early event in the pathogenesis of atherosclerosis, contributing to plaque initiation and progression.
  • Endothelial dysfunction is also a major contributor to the effects of inflammatory diseases such as sepsis.
  • the pathogenesis of sepsis is a result of a complex network of events.
  • Components of the Gram-negative bacterial cell wall (endotoxins) are the predominant (though not exclusive) species responsible for the initiation of sepsis.
  • Endotoxins in addition to other bacterial molecules trigger a generalized response that involves both cellular and humoral pathways with the generation of pro- and anti-inflammatory mediators.
  • mediators include cytokines, coagulation factors, adhesion molecules, myocardial depressant substances and heat shock proteins.
  • the endothelium is a major target of sepsis-induced events and endothelial cell damage and dysfunction accounts for much of the pathology of septic shock.
  • Vascular endothelial cells are among the first cells in the body that come into contact with circulating bacterial molecules. Endothelial cells possess mechanisms that recognize structural patterns of bacterial pathogens and subsequently initiate the expression of inflammatory mediators.
  • An approach for treatment of endothelial dysfunction is to address the components in the disease process that trigger dysfunction of the endothelium. For example, decrease of homocysteine levels in hyperhomocysteinemia by supplementation with folic acid can improve endothelial dysfunction.
  • L-Arginine and tetrahydrobiopterin, as well as tetrahydrobiopterin mimetics, may improve endothelial function via increased nitric oxide bioavailability.
  • some studies have not found L-arginine administration to improve endothelial dysfunction.
  • statins have proven to have beneficial effects on endothelial dysfunction, which may be the result in part of lipid lowering but also of their pleiotropic antiinflammatory effects.
  • statins are associated with muscle pain and rhabdomyolysis (which can lead to kidney failure and death), muscle weakness, neuropathy and memory loss.
  • statins have a relatively short half life and require regular dosing to provide a therapeutic benefit.
  • atorvastatin has an effective half life of about 20-30 hours and is considered a long-acting statin.
  • Peroxisome proliferator-activated receptor- ⁇ agonists have also been shown to ameliorate endothelial dysfunction. However, the potential benefits of these compounds should be carefully assessed against the safety concerns related to this class of compounds on fluid retention and congestive heart failure as well as the possible enhanced cardiovascular risk.
  • the inventors showed that administering STRO-1 expressing mesenchymal progenitor cells (MPCs) or progeny thereof systemically (e.g., intravenously) to animals suffering from endothelial dysfunction increased coronary artery response to endothelium-specific dilators (bradykinin and carbachol) but not to the smooth muscle dilator sodium nitroprusside.
  • MPCs or progeny thereof increased maximal response to the endothelium-specific dilators, which is an indication of reduced endothelial dysfunction compared to results in animals which were not treated with the MPCs or progeny.
  • the present disclosure provides a method for treating or preventing a disease of vascular endothelial dysfunction or inflammation in a subject, the method comprising systemically administering to the subject a population of cells enriched for STRO-l + cells and/or progeny thereof and/or soluble factors derived therefrom.
  • the subject suffers from a condition caused by endothelial dysfunction.
  • the endothelial dysfunction is within a blood vessel, e.g., is vascular endothelial dysfunction.
  • the condition caused by endothelial dysfunction is selected from the group consisting of sepsis, hypertension, coronary artery disease, chronic heart failure and peripheral artery disease, nephropathy and chronic renal failure.
  • the condition caused by endothelial dysfunction is nephropathy.
  • the present disclosure provides a method for treating or preventing nephropathy in a subject, the method comprising systemically administering to the subject a population of cells enriched for STRO-l + cells and/or progeny thereof and/or soluble factors derived therefrom.
  • the nephropathy is diabetic nephrapothy.
  • the present disclosure provides a method for treating or preventing diabetic nephropathy in a subject, the method comprising systemically administering to the subject a population of cells enriched for STRO-l + cells and/or progeny thereof and/or soluble factors derived therefrom.
  • the condition is atherosclerosis.
  • the present disclosure provides a method for treating or preventing atherosclerosis in a subject, the method comprising systemically administering to the subject a population of cells enriched for STRO-l + cells and/or progeny thereof and/or soluble factors derived therefrom.
  • the disease is a disease of inflammation.
  • the disease of inflammation may be a systemic inflammatory response syndrome, such as sepsis, septic shock or a sepsis-like condition.
  • the condition is sepsis or septic shock.
  • the present disclosure provides a method for treating or preventing sepsis or septic shock in a subject, the method comprising systemically administering to the subject a population of cells enriched for STRO-l + cells and/or progeny thereof and/or soluble factors derived therefrom.
  • the sepsis, septic shock or a sepsis-like condition may be caused by a virus, fungus, protozoan or bacterium.
  • the method comprises administering a population of cells enriched for STRO-l bright cells and/or progeny thereof and/or soluble factors derived therefrom.
  • the population enriched for STRO-l + cells and/or progeny thereof and/or soluble factors derived therefrom are administered intravenously.
  • the inventors have shown that STRO-l + cells and/or progeny thereof administered systemically can improve endothelial dysfunction.
  • the disclosure contemplates administration of the STRO-l + cells and/or progeny thereof at a site remote from a site of endothelial dysfunction in a subject.
  • the STRO-l + cells and/or progeny thereof and/or soluble factors derived therefrom are administered in an amount sufficient to reduce IL-6, TNFa and/or IL-17 in a subject.
  • the method of the disclosure prevents endothelial dysfunction.
  • the STRO-l + cells and/or progeny thereof and/or soluble factors derived therefrom are administered in an amount sufficient to increase levels of angiopoietin I in a subject, e.g., in the endothelium of a subject.
  • levels of angiopoietin II are increased in subjects suffering from endothelial dysfunction.
  • STRO-l + MPCs and/or progeny thereof secrete angiopoietin II and reason that this will assist in treating the endothelial dysfunction.
  • the STRO-l + cells and/or progeny thereof and/or soluble factors derived therefrom are administered in an amount sufficient to enhance dilation of endothelium (e.g., vascular endothelium) in a subject (e.g., in response to an endothelial dilator such as bradykinin or carbachol).
  • endothelium e.g., vascular endothelium
  • an endothelial dilator such as bradykinin or carbachol
  • the STRO-l + cells and/or progeny thereof and/or soluble factors derived therefrom are administered in an amount sufficient to enhance dilation of endothelium (e.g., vascular endothelium) without enhancing dilation of smooth muscle (e.g., vascular smooth muscle) in a subject (e.g., in response to a smooth muscle dilator such as sodium nitroprusside).
  • endothelium e.g., vascular endothelium
  • smooth muscle e.g., vascular smooth muscle
  • Exemplary dosages of the cells include between 0.1 x 10 6 to 5 x 10 6 STRO-l + cells and/or progeny thereof per kilogram.
  • the method comprises administering between 0.3 x 10 6 to 2 x 10 6 STRO-l + cells and/or progeny thereof per kilogram.
  • the cells are administered at a dose of between about 0.3xl0 6 cells/kg to about 4xl0 6 cells/kg, such as between about 0.3xl0 6 cells/kg to about 2xl0 6 cells/kg.
  • One form of the method involves administering a low dose of STRO-l + cells and/or progeny thereof.
  • a low dose is, for example, between 0.1 x 10 5 to about 0.5 x 10 6 STRO-l + cells/kg, such as about 0.3 x 10 6 STRO-l + cells/kg.
  • a high dose of cells is administered to the subject.
  • Exemplary dosages include at least about 1.5 x 10 6 cells/kg.
  • a high dose comprises between about 1.5 x 10 6 to about 4xl0 6 cells/kg.
  • a high dose comprises about 1.5 x 10 6 or about 2 x 10 6 cells/kg.
  • the cells are administered at a constant body dose, i.e., irrespective of the body weight of the subject.
  • the cells are administered at a dose of about 100 million to 300 million cells irrespective of the weight of the subject.
  • the cells are administered at a dose of about 100 million to 200 million cells irrespective of the weight of the subject.
  • the cells are administered at a dose of about 100 million cells irrespective of the weight of the subject.
  • the cells are administered at a dose of about 150 million cells irrespective of the weight of the subject.
  • the cells are administered at a dose of about 200 million cells irrespective of the weight of the patient. In one example, the cells are administered at a dose of about 300 million cells irrespective of the weight of the patient.
  • the STRO-l + cells and/or progeny thereof and/or soluble factors derived therefrom are administered in combination with a polysulfated polysaccharide.
  • polysulfated polysaccharide is pentosan polysulfate
  • PPS PPS
  • the PPS is a sodium salt of PPS (NaPPS) or a calcium salt of PPS (CaPPS).
  • the salt of PPS is NaPPS.
  • the concentration of the PPS is dependent on the number of STRO- cells and/or progeny thereof and/or soluble factors derived therefrom, in the composition.
  • the concentration of the PPS is about 5ng/ml/million cells- lOmg/ml/million cells or 500ng/ml/million cells - lOmg/ml/million cells,
  • the amount of PPS is between about lmg-lOOmg/75 million cells, for example, about 25-75mg/75 million cells, e.g., about 75mg/75 million cells (e.g., lmg/million cells).
  • the concentration of PPS is about 500ng, ⁇ g, 2 ⁇ g, 2.5 ⁇ 3 ⁇ 4 5 ⁇ ⁇ , 10 ⁇ ⁇ , 15 ⁇ ⁇ , 20 ⁇ ⁇ , 30 ⁇ ⁇ , 40 ⁇ ⁇ , 50 ⁇ ⁇ , 60 ⁇ ⁇ , 70 ⁇ ⁇ , 80 ⁇ ⁇ , 90 ⁇ ⁇ , 100 ⁇ ⁇ , 150 ⁇ ⁇ , 200 ⁇ ⁇ , 250 ⁇ ⁇ , 300 ⁇ ⁇ , 350 ⁇ ⁇ , 400 ⁇ ⁇ , 450 ⁇ ⁇ , 500 ⁇ ⁇ , 550 ⁇ ⁇ , 600 ⁇ ⁇ , 650 ⁇ ⁇ , 700 ⁇ ⁇ , 750 ⁇ ⁇ , 800 ⁇ ⁇ , 850 ⁇ ⁇ , 900 ⁇ ⁇ , 950 ⁇ ⁇ , 1000 ⁇ ⁇ , 1050 ⁇ ⁇ , 1100 ⁇ ⁇ , 1150 ⁇ ⁇ , 1200 ⁇ ⁇ , 1250 ⁇ ⁇ , 1300 ⁇
  • the total amount of PPS administered is about 1 to lOOmg.
  • the total amount of PPS administered is about 75mg.
  • the PPS may be administered in an amount such as to produce a concentration of the PPS of 0.01 to 100 micrograms/ml of composition to be administered to the subject, for example 0.1 to 50 micrograms per ml of composition, 0.1 to 50 micrograms per ml of composition, 0.1 to 10 micrograms per ml of composition, 1 to 10 micrograms per ml of composition, 2 to 8 micrograms per ml of composition, 4 to 6 micrograms per ml of composition, or 4, 5, or 6 micrograms per ml of composition.
  • the population enriched for STRO-l + cells and/or progeny thereof and/or soluble factors derived therefrom are administered, with or without PPS, once weekly or less often, such as, once every four weeks or less often.
  • the present disclosure also contemplates numerous administrations of the cells and/or soluble factors.
  • a method can involve administering the cells and monitoring the subject to determine when one or more symptoms of endothelial dysfunction occurs or recurs and administering a further dose of the cells and/or soluble factors.
  • Suitable methods for assessing symptoms of endothelial dysfunction will be apparent to the skilled artisan and/or described herein.
  • cells and/or soluble factors are administered on a fixed schedule, e.g., once each week or fortnight or three weeks or four weeks or five weeks or six weeks or longer.
  • the population enriched for STRO-l + cells and/or progeny cells are autogeneic or allogeneic and/or the soluble factors can be derived from autogeneic or allogeneic cells.
  • the population enriched for STRO-l + cells and/or progeny cells have been culture expanded prior to administration and/or prior to obtaining the soluble factors.
  • the population enriched for STRO-l + cells are STRO-l bnght , and/or express tissue non-specific alkaline phosphatase (TNAP) and/or the progeny cells and/or soluble factors are derived from STRO-l + cells that are STRO-l bnght and/or express TNAP.
  • TNAP tissue non-specific alkaline phosphatase
  • the STRO-l + cells and/or progeny cells thereof and/or soluble factors derived therefrom are administered in the form of a composition comprising said STRO-1 cells and/or progeny cells thereof and/or soluble factors derived therefrom and a carrier and/or excipient.
  • the subject is a mammal, e.g., a primate, such as a human.
  • the subject is a non-human animal (e.g., a non-human mammal), such as a domesticated mammal, e.g., a dog or a cat or a horse or a cow or a sheep.
  • the present disclosure additionally provides a population of cells enriched for
  • STRO- cells and/or progeny thereof and/or soluble factors derived therefrom optionally, in combination with PPS for use in the treatment or prevention of endothelial dysfunction or a condition caused by endothelial dysfunction in a subject.
  • the present disclosure additionally provides for use of a population of cells enriched for STRO-l + cells and/or progeny thereof and/or soluble factors derived therefrom, optionally, in combination with PPS in the manufacture of a medicament for treating or preventing endothelial dysfunction or a condition caused by endothelial dysfunction in a subject.
  • BMMNC Human bone marrow morphonuclear cells
  • the vertical and horizontal lines were set to the reactivity levels of ⁇ 1.0% mean fluorescence obtained with the isotype-matched control antibodies, 1B5 (IgG) and 1A6.12 (IgM) treated under the same conditions.
  • the results demonstrate that a minor population of STRO- i n s ht ce ii s co-expressed TNAP (upper right quadrant) while the remaining STRO-l + cells failed to react with the STRO-3 mAb.
  • FIG. 1 Gene expression profile of STRO-l bright or STRO-l dim progeny of cultured and expanded STRO-l bnght MPC.
  • Single cell suspensions of ex vivo expanded bone marrow MPC were prepared by trypsin/EDTA treatment. Cells were stained with the STRO-1 antibody which was subsequently revealed by incubation with goat-anti murine IgM-fluorescein isothiocyanate.
  • Total cellular RNA was prepared from purified populations of STRO-l ⁇ or STRO-l bright expressing cells, following fluorescence activated cell sorting (A). Using RNAzolB extraction method, and standard procedures, total RNA was isolated from each subpopulation and used as a template for cDNA synthesis.
  • Figure 4 is a series of graphical representations showing expression of CD146, CXCL12 and Angiopoietin 1 in stromal cells and primary long term cultures.
  • A FACS analysis of stromal cell lines HS5 and HS27a for CD146 (MCAM) along with isotype controls.
  • B FACS analysis of a primary LTC at first passage for CD146 along with isotype control. The primary LTCs were sorted to CD146 M and CD146 10 populations by FACS-aided flow-sorting. Approximate gates for hi and lo populations are also indicated.
  • Figure 5 shows mean + SEM for IL-10 levels (ng/ml) in the plasma of treated and untreated sheep over a two week period following induction of endothelial dysfunction by administration of collagen.
  • Figure 6 shows mean + SEM for fibrinogen levels (g/L) in the plasma of treated and untreated sheep over a two week period following induction of endothelial dysfunction by administration of collagen.
  • Figure 7 shows mean + SEM for Actin A levels (pg/ml) in the plasma of treated and untreated sheep over a two week period following induction of endothelial dysfunction by administration of collagen.
  • Figure 8 shows mean + SEM for C-reactive protein levels (mg/L) in the plasma of treated and untreated sheep over a two week period following induction of endothelial dysfunction by administration of collagen.
  • Figure 9 shows the percentage change in C-reactive protein levels in the plasma of treated and untreated sheep over a two week period following induction of endothelial dysfunction by administration of collagen.
  • Figure 10 is a series of graphical representations showing percentage relaxation of sheep coronary arteries (A and C) or digital arteries (B and D) following contraction with endothelin-1 and subsequent relaxation with bradykinin (A), carbachol (C) or sodium nitroprusside (B and D) from sheep administered MPCs ("treated") or saline (“controls").
  • Figure 11 is a graphical representation showing mean + SD for peak ILIO levels
  • Figure 12 is a graphical representation showing mean + SEM for the change in fibrinogen levels (g/L) in the plasma, relative to baseline, of MPC ⁇ PPS treated and untreated sheep over a two week period following induction of endothelial dysfunction by administration of collagen.
  • Figure 13 is a graphical representation showing mean + SEM for Actin A levels (pg/ml) in the plasma of MPC ⁇ PPS treated and untreated sheep over a two week period following induction of endothelial dysfunction by administration of collagen.
  • Figure 14 is a graphical representation showing the mean + SEM of the change in C-reactive protein levels in the plasma, relative to baseline, of MPC ⁇ PPS treated and untreated sheep over a two week period following induction of endothelial dysfunction by administration of collagen.
  • Figure 15 is a series of graphical representations showing percentage relaxation of sheep coronary arteries (A and C) or digital arteries (B and D) following contraction with endothelin-1 and subsequent relaxation with bradykinin (A), carbachol (C) or sodium nitroprusside (B and D) from sheep administered MPC ⁇ PPS ("treated") or saline ("controls").
  • composition of matter, group of steps or group of compositions of matter shall be taken to encompass one and a plurality (i.e. one or more) of those steps, compositions of matter, groups of steps or group of compositions of matter.
  • the term "derived from” shall be taken to indicate that a specified integer may be obtained from a particular source albeit not necessarily directly from that source.
  • this term shall be taken to mean one or more factors, e.g., proteins, peptides, carbohydrates, etc, produced during in vitro culturing of stem cells and/or progeny cells thereof.
  • endothelial dysfunction will be understood to mean a state (e.g., a systemic state) in a subject which is characterized by an imbalance between vasodilating and vasoconstricting substances and/or which is characterized by a shift in the action of endothelium toward reduced vasodilation and/or a proinflammatory state and/or and prothrombic properties.
  • a state e.g., a systemic state
  • condition caused by endothelial dysfunction will be understood to mean any medical condition in which endothelial dysfunction plays a pathological role.
  • the condition is a vascular condition.
  • cardiovascular disease such as hypertension, coronary artery disease, chronic heart failure and peripheral artery disease
  • nephropathy a vascular complication of diabetes
  • chronic renal failure a vascular complication of diabetes
  • nephropathy will be understood to mean a condition characterized by damage to the kidney and includes non-inflammatory nephropathy (nephrosis) and inflammatory nephropathy (nephritis).
  • nephropathy causes of nephropathy include deposition of the IgA antibodies in the glomerulus, administration of analgesics, xanthine oxidase deficiency, and/or long-term exposure to lead or its salts.
  • Chronic conditions that can produce nephropathy include systemic lupus erythematosus (SLE), diabetes mellitus or high blood pressure (hypertension), which lead to diabetic nephropathy and hypertensive nephropathy, respectively.
  • diabetic nephropathy also known as Kimmelstiel-Wilson syndrome, or nodular diabetic glomerulosclerosis and intercapillary glomerulonephritis
  • the term "diabetic nephropathy” will be understood to refer to a progressive kidney condition caused by angiopathy of capillaries in the kidney glomeruli. It is characterized by nephrotic syndrome and diffuse glomerulosclerosis.
  • the first laboratory abnormality generally detected in this condition is a positive microalbuminuria test.
  • the diagnosis is suspected when a routine urinalysis of a person with diabetes shows too much protein in the urine (proteinuria).
  • the urinalysis may also show glucose in the urine, especially if blood glucose is poorly controlled.
  • Serum creatinine may increase as kidney damage progresses.
  • a kidney biopsy can be used to confirm diagnosis, although it is not always necessary if the case is straightforward, with a documented progression of proteinuria over time and presence of diabetic retinopathy on examination of the retina of the eyes.
  • SIRS systemic inflammatory response syndrome
  • SIRS immunosensis
  • An infection that leads to sepsis may be caused by e.g. a virus, a fungus, a protozoan or a bacterium.
  • septic shock refers to sepsis with hypotension despite adequate resuscitation with fluids (refractory hypotension), along with the presence of perfusion abnormalities (see e.g. Nystrom (1998) Journal of Antimicrobial Chemotherapy, 41, Suppl. A, 1-7).
  • serpsis-like condition refers to a state in which a patient presents with symptoms similar to sepsis or septic shock but where the cascade of inflammatory mediators and/or the change in haemodynamic parameters are not primarily or initially caused by an infectious agent. For example, sepsis-like conditions may be seen in a patient with acute or chronic liver failure (see Wasmuth H E, et al. J Hepatol.
  • the term "effective amount” shall be taken to mean a sufficient quantity of stem cells and/or progeny cells thereof and/or soluble factors derived therefrom to achieve a significant increase in vascular dilation (e.g., in the presence of an endothelial dilator such as bradykinin or carbachol) in a subject and/or an increase in the level of angiopoietin I in the endothelium in a subject or in a tissue or region thereof a tissue of the subject (e.g., a region of endothelium that is dysfunctioning).
  • This term does not mean that the "effective amount” be tested for these effects each and every time, rather the amount can be established in a preliminary study and based on the results of those studies it can be assumed that the amount will have the same effect in most subjects.
  • the term "therapeutically effective amount” shall be taken to mean a sufficient quantity of stem cells and/or progeny cells thereof and/or soluble factors derived therefrom to treat a condition caused by endothelial dysfunction or a symptom thereof or a clinical sign thereof.
  • prophylactically effective amount shall be taken to mean a sufficient quantity of stem cells and/or progeny cells thereof and/or soluble factors derived therefrom to prevent or inhibit or delay the onset of a condition caused by endothelial dysfunction or a symptom thereof or a clinical sign thereof.
  • the term "low dose” shall be understood to mean an amount of stem cells and/or progeny thereof less than lxlO 6 , yet still sufficient to be an "effective amount” as defined herein and/or a “therapeutically effective amount” and/or a “prophylactically effective amount” as defined herein.
  • a low dose comprises 0.5 x 10 6 or fewer cells, or 0.4 x 10 6 or fewer cells or 0.3 xlO 6 or fewer cells or 0.1 x 10 6 or fewer cells.
  • the term “high dose” shall be understood to more than 1.5xl0 6 cells/kg.
  • a dose comprises between about 1.5 x 10 6 and about 4xl0 6 cells/kg.
  • a high dose comprises about 1.5 x 10 6 or about 2 x 10 6 /kg.
  • treat or “treatment” or “treating” shall be understood to mean administering a therapeutically effective amount of soluble factors and/or cells and reducing or inhibiting symptom(s) of a condition caused by endothelial dysfunction such that the subject is no longer clinically diagnosed with the condition or such that the level or severity of the condition is reduced.
  • prevent or “preventing” or “prevention” shall be taken to mean administering a prophylactically effective amount of soluble factors and/or cells and stopping or hindering or delaying the development or progression of a condition caused by endothelial dysfunction.
  • soluble factors shall be taken to mean any molecule, e.g., protein, peptide, glycoprotein, glycopeptide, lipoprotein, lipopeptide, carbohydrate, etc. produced by stem cells and/or progeny thereof that are water soluble. Such soluble factors may be intracellular and/or secreted by a cell. Such soluble factors may be a complex mixture (e.g., supernatant) and/or a fraction thereof and/or may be a purified factor. In one example of the present disclosure soluble factors are or are contained within supernatant. Accordingly, any example herein directed to administration of one or more soluble factors shall be taken to apply mutatis mutandis to the administration of supernatant.
  • the term "supernatant" refers to the non-cellular material produced following the in vitro culturing of stem cells and/or progeny thereof in a suitable medium, for example liquid medium.
  • the supernatant is produced by culturing the cells in the medium under suitable conditions and time, followed by removing the cellular material by a process such as centrifugation.
  • the supernatant may or may not have been subjected to further purification steps before administration.
  • the supernatant comprises less than 10 5 , for example less than 10 4 , such as less than 10 3 , e.g., no live cells.
  • normal or healthy individual shall be taken to mean a subject that does not have endothelial dysfunction as assessed by any method known in the art and/or described herein. In one example, a "normal or healthy individual” does not suffer from any of the symptoms of a condition caused by endothelial dysfunction. Endothelial Dysfunction
  • a common parameter assessed when testing endothelial function is endothelium-dependent vasodilation. In coronary arteries, this is performed angiographically by Doppler flow measurements, assessing the effect of endothelium- dependent agonists, mainly acetylcholine (Schachinger et al, Circulation 101: 1899- 1906, 2000).
  • the cold pressor test with measurement of coronary perfusion by positron emission tomography scanning can also be used as a measure of endothelial function (Gokce et al, Am Coll Cardiol 41: 1769-1775, 2003).
  • a noninvasive technique consists of inducing increased shear stress during reactive hyperemia to assess flow-mediated vasodilation of the brachial artery by ultrasound (Celermajer et al, Lancet 340: 1111-1115, 1992).
  • markers of endothelial dysfunction include soluble forms of ICAM-1, VCAM-1, and E-selectin, which can be assessed in plasma.
  • Microalbuminuria has been considered for some time an expression of endothelial dysfunction. Microalbuminuria in most pathologic conditions seems to be a disorder of the capillary wall in the glomerulus with transcapillary escape of albumin. In diabetes, endothelial dysfunction has been correlated with microalbuminuria and may precede its development. Microalbuminuria has also been shown to correlate with markers of endothelial dysfunction.
  • dipyridamole can be obtained to calculate coronary flow reserve. Because the increase in myocardial flow is related to adenosine-induced increases and flow-mediated vasodilation, it is in part a measure of endothelial function. This technique is noninvasive and has the advantage of the potential for multiple tests per patient.
  • venous occlusion plethysmography reflects resistance vessel function in the forearm.
  • stem cell refers to self-renewing cells that are capable of giving rise to phenotypically and genotypically identical daughters as well as at least one other final cell type (e.g., terminally differentiated cells).
  • stem cells includes totipotential, pluripotential and multipotential cells, as well as progenitor and/or precursor cells derived from the differentiation thereof.
  • the stem cell may be an adult or embryonic stem cell or may be an induced pluripotent stem (iPS).
  • totipotent cell or “totipotential cell” refers to a cell that is able to form a complete embryo (e.g., a blastocyst).
  • pluripotent cell refers to a cell that has complete differentiation versatility, i.e., the capacity to grow into any of the mammalian body's approximately 260 cell types.
  • a pluripotent cell can be self- renewing, and can remain dormant or quiescent within a tissue.
  • multipotential cell or “multipotent cell” we mean a cell which is capable of giving rise to any of several mature cell types. As used herein, this phrase encompasses adult or embryonic stem cells and progenitor cells, such as mesenchymal precursor cells (MPC) and multipotential progeny of these cells. Unlike a pluripotent cell, a multipotent cell does not have the capacity to form all of the cell types.
  • MPC mesenchymal precursor cells
  • progenitor cell refers to a cell that is committed to differentiate into a specific type of cell or to form a specific type of tissue.
  • STRO-l + multipotential cells shall be taken to mean STRO-l + and/or TNAP + progenitor cells capable of forming multipotential cell colonies.
  • STRO-l + multipotential cells are cells found in bone marrow, blood, dental pulp cells, adipose tissue, skin, spleen, pancreas, brain, kidney, liver, heart, retina, brain, hair follicles, intestine, lung, lymph node, thymus, bone, ligament, tendon, skeletal muscle, dermis, and periosteum; and are capable of differentiating into germ lines such as mesoderm and/or endoderm and/or ectoderm.
  • STRO-l + multipotential cells are capable of differentiating into a large number of cell types including, but not limited to, adipose, osseous, cartilaginous, elastic, muscular, and fibrous connective tissues.
  • STRO-l + multipotential cells are non-hematopoietic progenitor cells which divide to yield daughter cells that are either stem cells or are precursor cells which in time will irreversibly differentiate to yield a phenotypic cell.
  • the STRO-l + cells are enriched from a sample obtained from a subject, e.g., a subject to be treated or a related subject or an unrelated subject (whether of the same species or different).
  • a subject e.g., a subject to be treated or a related subject or an unrelated subject (whether of the same species or different).
  • the terms "enriched”, “enrichment” or variations thereof are used herein to describe a population of cells in which the proportion of one particular cell type or the proportion of a number of particular cell types is increased when compared with an untreated population of the cells (e.g., cells in their native environment).
  • a population enriched for STRO-l + cells comprises at least about 0.1% or 0.5% or 1% or 2% or 5% or 10% or 15% or 20% or 25% or 30% or 50% or 75%) STRO-l + cells.
  • the term "population of cells enriched for STRO-l + cells” will be taken to provide explicit support for the term “population of cells comprising X% STRO-l + cells", wherein X% is a percentage as recited herein.
  • the STRO-l + cells can, in some examples, form clonogenic colonies, e.g. CFU-F (fibroblasts) or a subset thereof (e.g., 50% or 60% or 70% or 70% or 90% or 95%) can have this activity.
  • the population of cells is enriched from a cell preparation comprising STRO-l + cells in a selectable form.
  • the term "selectable form" will be understood to mean that the cells express a marker (e.g., a cell surface marker) permitting selection of the STRO-l + cells.
  • the marker can be STRO-1, but need not be.
  • cells e.g., MPCs
  • an indication that cells are STRO-1 does not mean that the cells are selected by STRO-1 expression.
  • the cells are selected based on at least STRO-3 expression, e.g., they are STRO-3 + (TNAP + ).
  • STRO-l + cells can be selected from or isolated from or enriched from a large variety of sources. That said, in some examples, these terms provide support for selection from any tissue comprising STRO-l + cells (e.g., MPCs) or vascularized tissue or tissue comprising pericytes (e.g., STRO-l + pericytes) or any one or more of the tissues recited herein.
  • tissue comprising STRO-l + cells e.g., MPCs
  • pericytes e.g., STRO-l + pericytes
  • the cells used in the present disclosure express one or more markers individually or collectively selected from the group consisting of TNAP + , VCAM-1 + , THY-1 + , STRO-2 + , STRO-4 + (HSP-90P), CD45 + , CD146 + , 3G5 + or any combination thereof.
  • the STRO-l + cells are STRO-l bright (syn. STRO-l bri ).
  • the Stro-l bn cells are preferentially enriched relative to STRO-l' 11111 or STRO- rtermediate cells.
  • the STRO-l bnght cells are additionally one or more of TNAP + , VCAM-1 + , THY-1 + ' STRO-2 + , STRO-4 + (HSP-90P) a + .
  • the cells are selected for one or more of the foregoing markers and/or shown to express one or more of the foregoing markers.
  • a cell shown to express a marker need not be specifically tested, rather previously enriched or isolated cells can be tested and subsequently used, isolated or enriched cells can be reasonably assumed to also express the same marker.
  • the mesenchymal precursor cells are perivascular mesenchymal precursor cells as defined in WO 2004/85630.
  • the mesenchymal precursor cells express a marker of a perivascular cell, e.g., the cells are STRO-l + or STRO-l bright and/or 3G5 + .
  • the cells are or were previously or are progeny of cells that were isolated from vascularized tissue or organs or parts thereof.
  • a cell that is referred to as being "positive" for a given marker it may express either a low (lo or dim) or a high (bright, bri) level of that marker depending on the degree to which the marker is present on the cell surface, where the terms relate to intensity of fluorescence or other marker used in the sorting process of the cells.
  • lo or dim or dull
  • bri will be understood in the context of the marker used on a particular cell population being sorted.
  • a cell that is referred to as being "negative” for a given marker is not necessarily completely absent from that cell. This term means that the marker is expressed at a relatively very low level by that cell, and that it generates a very low signal when detectably labeled or is undetectable above background levels, e.g., levels detected using an isotype control antibody.
  • “bright”, when used herein, refers to a marker on a cell surface that generates a relatively high signal when detectably labeled. Whilst not wishing to be limited by theory, it is proposed that "bright" cells express more of the target marker protein (for example the antigen recognized by STRO-1) than other cells in the sample. For instance, STRO-l bn cells produce a greater fluorescent signal, when labeled with a FITC-conjugated STRO-1 antibody as determined by fluorescence activated cell sorting (FACS) analysis, than non-bright cells (STRO-1 dull/dim ). In one example, "bright" cells constitute at least about 0.1% of the most brightly labeled bone marrow mononuclear cells contained in the starting sample.
  • FACS fluorescence activated cell sorting
  • "bright" cells constitute at least about 0.1%, at least about 0.5%, at least about 1%, at least about 1.5%, or at least about 2%, of the most brightly labeled bone marrow mononuclear cells contained in the starting sample.
  • STRO-l bnght cells have 2 log magnitude higher expression of STRO-1 surface expression relative to "background", namely cells that are STRO-1 " .
  • STRO-l dim and/or S TRO-l intermediate cells have less than 2 log magnitude higher expression of STRO-1 surface expression, typically about 1 log or less than "background”.
  • TNAP tissue non-specific alkaline phosphatase
  • LAP liver isoform
  • BAP bone isoform
  • KAP kidney isoform
  • the TNAP is BAP.
  • TNAP as used herein refers to a molecule which can bind the STRO-3 antibody produced by the hybridoma cell line deposited with ATCC on 19 December 2005 under the provisions of the Budapest Treaty under deposit accession number PTA-7282.
  • the STRO-l + cells are capable of giving rise to clonogenic CFU-F.
  • a significant proportion of the STRO-l + multipotential cells are capable of differentiation into at least two different germ lines.
  • the lineages to which the multipotential cells may be committed include bone precursor cells; hepatocyte progenitors, which are multipotent for bile duct epithelial cells and hepatocytes; neural restricted cells, which can generate glial cell precursors that progress to oligodendrocytes and astrocytes; neuronal precursors that progress to neurons; precursors for cardiac muscle and cardiomyocytes, glucose-responsive insulin secreting pancreatic beta cell lines.
  • lineages include, but are not limited to, odontoblasts, dentin-producing cells and chondrocytes, and precursor cells of the following: retinal pigment epithelial cells, fibroblasts, skin cells such as keratinocytes, dendritic cells, hair follicle cells, renal duct epithelial cells, smooth and skeletal muscle cells, testicular progenitors, vascular endothelial cells, tendon, ligament, cartilage, adipocyte, fibroblast, marrow stroma, cardiac muscle, smooth muscle, skeletal muscle, pericyte, vascular, epithelial, glial, neuronal, astrocyte and oligodendrocyte cells.
  • the STRO-l + cells are not capable of giving rise, upon culturing, to hematopoietic cells.
  • the cells are taken from the subject to be treated, cultured in vitro using standard techniques and used to obtain supernatant or soluble factors or expanded cells for administration to the subject as an autologous or allogeneic composition.
  • cells of one or more of the established human cell lines are used.
  • cells of a non-human animal or if the patient is not a human, from another species are used.
  • the present disclosure also contemplates use of supernatant or soluble factors obtained or derived from STRO-l + cells and/or progeny cells thereof (the latter also being referred to as expanded cells) which are produced from in vitro culture.
  • Expanded cells of the disclosure may have a wide variety of phenotypes depending on the culture conditions (including the number and/or type of stimulatory factors in the culture medium), the number of passages and the like.
  • the progeny cells are obtained after about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, or about 10 passages from the parental population.
  • the progeny cells may be obtained after any number of passages from the parental population.
  • the progeny cells may be obtained by culturing in any suitable medium.
  • Media may be solid, liquid, gaseous or a mixture of phases and materials.
  • Media include liquid growth media as well as liquid media that do not sustain cell growth.
  • Media also include gelatinous media such as agar, agarose, gelatin and collagen matrices.
  • Exemplary gaseous media include the gaseous phase that cells growing on a petri dish or other solid or semisolid support are exposed to.
  • the term “medium” also refers to material that is intended for use in a cell culture, even if it has not yet been contacted with cells.
  • a nutrient rich liquid prepared for bacterial culture is a medium.
  • a powder mixture that when mixed with water or other liquid becomes suitable for cell culture may be termed a "powdered medium".
  • progeny cells useful for the methods of the disclosure are obtained by isolating TNAP + STRO-l + cells from bone marrow using magnetic beads labeled with the STRO-3 antibody, and then culture expanding the isolated cells (see Gronthos et al. Blood 85: 929-940, 1995 for an example of suitable culturing conditions).
  • such expanded cells can be TNAP " , CC9 + , HLA class I + , HLA class II " , CD 14 " , CD 19 “ , CD3 “ , CD 1 la c “ , CD31 “ , CD86 “ , CD34 “ and/or CD80 “ .
  • cells of these phenotypes may predominate in the expended cell population it does not mean that there is a minor proportion of the cells that do not have this phenotype(s) (for example, a small percentage of the expanded cells may be CC9 " ).
  • expanded cells still have the capacity to differentiate into different cell types.
  • an expended cell population used to obtain supernatant or soluble factors, or cells per se comprises cells wherein at least 25%, for example at least 50%, of the cells are CC9 + .
  • an expanded cell population used to obtain supernatant or soluble factors, or cells per se comprises cells wherein at least 40%, for example at least 45%, of the cells are STRO-l + .
  • markers collectively or individually selected from the group consisting of LFA-3, THY-1, VCAM-1, ICAM-1, PECAM-1, P-selectin, L-selectin, 3G5, CD49a/CD49b/CD29, CD49c/CD
  • the progeny cells are Multipotential Expanded STRO-l + Multipotential cells Progeny (MEMPs) as defined and/or described in WO 2006/032092.
  • MEMPs Multipotential Expanded STRO-l + Multipotential cells Progeny
  • Methods for preparing enriched populations of STRO-l + multipotential cells from which progeny may be derived are described in WO 01/04268 and WO 2004/085630.
  • STRO-l + multipotential cells will rarely be present as an absolutely pure preparation and will generally be present with other cells that are tissue specific committed cells (TSCCs).
  • TSCCs tissue specific committed cells
  • WO 01/04268 refers to harvesting such cells from bone marrow at purity levels of about 0.1% to 90%.
  • the population comprising MPCs from which progeny are derived may be directly harvested from a tissue source, or alternatively it may be a population that has already been expanded ex vivo.
  • the progeny may be obtained from a harvested, unexpanded, population of substantially purified STRO-l + multipotential cells, comprising at least about 0.1, 1, 5, 10, 20, 30, 40, 50, 60, 70, 80 or 95% of total cells of the population in which they are present.
  • This level may be achieved, for example, by selecting for cells that are positive for at least one marker individually or collectively selected from the group consisting of TNAP, STRO-4 (HSP-90P), STRO-l bright , 3G5 + , VCAM-1, THY-1, CD146 and STRO-2.
  • MEMPS can be distinguished from freshly harvested STRO-l + multipotential cells in that they are positive for the marker STRO-l bn and negative for the marker Alkaline phosphatase (ALP). In contrast, freshly isolated STRO-l + multipotential cells are positive for both STRO-l bn and ALP. In one example of the present disclosure, at least 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 95% of the administered cells have the phenotype STRO-l bri , ALP " . In a further example the MEMPS are positive for one or more of the markers Ki67, CD44 and/or CD49c/CD29, VLA-3, ⁇ 3 ⁇ 1. In yet a further example the MEMPs do not exhibit TERT activity and/or are negative for the marker CD 18.
  • the STRO-l + cell starting population may be derived from any one or more tissue types set out in WO 01/04268 or WO 2004/085630, namely bone marrow, dental pulp cells, adipose tissue and skin, or perhaps more broadly from adipose tissue, teeth, dental pulp, skin, liver, kidney, heart, retina, brain, hair follicles, intestine, lung, spleen, lymph node, thymus, pancreas, bone, ligament, bone marrow, tendon and skeletal muscle.
  • tissue types set out in WO 01/04268 or WO 2004/085630, namely bone marrow, dental pulp cells, adipose tissue and skin, or perhaps more broadly from adipose tissue, teeth, dental pulp, skin, liver, kidney, heart, retina, brain, hair follicles, intestine, lung, spleen, lymph node, thymus, pancreas, bone, ligament, bone marrow, tendon and
  • separation of cells carrying any given cell surface marker can be effected by a number of different methods, however, some exemplary methods rely upon binding a binding agent (e.g., an antibody or antigen binding fragment thereof) to the marker concerned followed by a separation of those that exhibit binding, being either high level binding, or low level binding or no binding.
  • a binding agent e.g., an antibody or antigen binding fragment thereof
  • the most convenient binding agents are antibodies or antibody-based molecules, for example monoclonal antibodies or based on monoclonal antibodies (e.g., proteins comprising antigen binding fragments thereof) because of the specificity of these latter agents.
  • Antibodies can be used for both steps, however other agents might also be used, thus ligands for these markers may also be employed to enrich for cells carrying them, or lacking them.
  • the antibodies or ligands may be attached to a solid support to allow for a crude separation.
  • the separation techniques maximize the retention of viability of the fraction to be collected.
  • Various techniques of different efficacy may be employed to obtain relatively crude separations. The particular technique employed will depend upon efficiency of separation, associated cytotoxicity, ease and speed of performance, and necessity for sophisticated equipment and/or technical skill.
  • Procedures for separation may include, but are not limited to, magnetic separation, using antibody-coated magnetic beads, affinity chromatography and "panning" with antibody attached to a solid matrix.
  • Techniques providing accurate separation include but are not limited to FACS. Methods for performing FACS will be apparent to the skilled artisan.
  • Antibodies against each of the markers described herein are commercially available (e.g., monoclonal antibodies against STRO-1 are commercially available from R&D Systems, USA), available from ATCC or other depositary organization and/or can be produced using art recognized techniques.
  • the method for isolating STRO-1 + cells comprises a first step being a solid phase sorting step utilizing for example magnetic activated cell sorting (MACS) recognizing high level expression of STRO-1.
  • a second sorting step can then follow, should that be desired, to result in a higher level of precursor cell expression as described in patent specification WO 01/14268. This second sorting step might involve the use of two or more markers.
  • the method obtaining STRO-l + cells might also include the harvesting of a source of the cells before the first enrichment step using known techniques.
  • tissue will be surgically removed.
  • Cells comprising the source tissue will then be separated into a so called single cells suspension. This separation may be achieved by physical and or enzymatic means.
  • a suitable STRO-1 + cell population may be cultured or expanded by any suitable means to obtain MEMPs.
  • the cells are taken from the subject to be treated, cultured in vitro using standard techniques and used to obtain supernatant or soluble factors or expanded cells for administration to the subject as an autologous or allogeneic composition.
  • cells of one or more of the established human cell lines are used to obtain the supernatant or soluble factors.
  • cells of a non-human animal or if the patient is not a human, from another species are used to obtain supernatant or soluble factors.
  • Methods and uses of the present disclosure can be practiced using cells from any non-human animal species, including but not limited to non-human primate cells, ungulate, canine, feline, lagomorph, rodent, avian, and fish cells.
  • Primate cells with which the disclosure may be performed include but are not limited to cells of chimpanzees, baboons, cynomolgus monkeys, and any other New or Old World monkeys.
  • Ungulate cells with which the disclosure may be performed include but are not limited to cells of bovines, porcines, ovines, caprines, equines, buffalo and bison.
  • Rodent cells with which the disclosure may be performed include but are not limited to mouse, rat, guinea pig, hamster and gerbil cells. Examples of lagomorph species with which the disclosure may be performed include domesticated rabbits, jack rabbits, hares, cottontails, snowshoe rabbits, and pikas.
  • Chickens ⁇ Gallus gallus are an example of an avian species with which the disclosure may be performed.
  • the cells are human cells.
  • Cells useful for the methods of the disclosure may be stored before use, or before obtaining the supernatant or soluble factors.
  • Methods and protocols for preserving and storing of eukaryotic cells, and in particular mammalian cells are known in the art (cf, for example, Pollard, J. W. and Walker, J. M. (1997) Basic Cell Culture Protocols, Second Edition, Humana Press, Totowa, N.J.; Freshney, R. I. (2000) Culture of Animal Cells, Fourth Edition, Wiley-Liss, Hoboken, N.J.).
  • Any method maintaining the biological activity of the isolated stem cells such as mesenchymal stem/progenitor cells, or progeny thereof, may be utilized in connection with the present disclosure.
  • the cells are maintained and stored by using cryo- preservation. Polysulfated polysaccharides
  • Polysulfated polysaccharides may be any naturally occurring or semi- synthetic/synthetic polysulfated polysaccharide or a biologically active fragment thereof that contains two or more sugar rings or carbohydrate structures to which one or more sulfate ester groups are covalently attached as exemplified by heparin and pentosan polysulfate.
  • the STRO-l + cells and/or progeny thereof and/or soluble factors derived therefrom are administered in combination with a polysulfated polysaccharide.
  • the polysulfated polysaccharide is PPS and pharmaceutically acceptable salts thereof.
  • the PPS is isolated from beechwood hemicellulose (Fagus silvatica) with a linear xylan (pentosan) backbone of pentosan polysulfate contains on average one 4-O-methyl-glucuronate side chain linked to the 2-position on every tenth xylose (pentose) ring.
  • pentosan polysulfate and pharmaceutically acceptable salts thereof has the following structure:
  • the particular complexing ions may be selected from the group consisting of the alkali metals, e. g. Na + , and K + , alkaline earth metals, e. g.Ca 2+ , Zn 2+ , Mg 2+ , Ba 2+ , as well as Ag + , Au + , Pb 2+ , Cu 2+ , Au 2+ , Pd 2+ , Pd 4+ , Pt 4+ , Pt 2+ , trivalent metal ions, and quaternary ammonium compound complexes.
  • the alkali metals e. g. Na + , and K +
  • alkaline earth metals e. g.Ca 2+ , Zn 2+ , Mg 2+ , Ba 2+
  • trivalent metal ions
  • Examples of the latter compounds are pyridinium chloride, tetraalkyl ammonium chloride, choline chloride, cetylpyridinium chloride, N-cetyl-N, N, N- trialkylammonium chloride or their derivatives.
  • the complexing ion is sodium, i.e., the PPS is NaPPS.
  • the NaPPS is SP54, manufactured by Bene Pharmachem, Germany.
  • the PPS improves the viability of progenitor cells, enhance the cryopreservation of progenitor cells, regulate the proliferation of progenitor cells and/or regulate the differentiation of progenitor cells.
  • the stem cells and/or progeny cells thereof are genetically modified, e.g., to express and/or secrete a protein of interest.
  • the cells are engineered to express a protein useful in the treatment of endothelial dysfunction, e.g.,
  • Angiopoietin I or nitric oxide synthase e.g., eNOS or iNOS.
  • a nucleic acid that is to be expressed in a cell is operably-linked to a promoter for inducing expression in the cell.
  • the nucleic acid is linked to a promoter operable in a variety of cells of a subject, such as, for example, a viral promoter, e.g., a CMV promoter (e.g., a CMV-IE promoter) or a SV-40 promoter.
  • a viral promoter e.g., a CMV promoter (e.g., a CMV-IE promoter) or a SV-40 promoter.
  • the nucleic acid is provided in the form of an expression construct.
  • expression construct refers to a nucleic acid that has the ability to confer expression on a nucleic acid (e.g. a reporter gene and/or a counter-selectable reporter gene) to which it is operably connected, in a cell.
  • an expression construct may comprise or be a plasmid, bacteriophage, phagemid, cosmid, virus sub-genomic or genomic fragment, or other nucleic acid capable of maintaining and/or replicating heterologous DNA in an expressible format.
  • each of the components of the expression construct is amplified from a suitable template nucleic acid using, for example, PCR and subsequently cloned into a suitable expression construct, such as for example, a plasmid or a phagemid.
  • an expression vector suitable for the method of the present disclosure in a mammalian cell is, for example, a vector of the pcDNA vector suite supplied by Invitrogen, a vector of the pCI vector suite (Promega), a vector of the pCMV vector suite (Clontech), a pM vector (Clontech), a pSI vector (Promega), a VP 16 vector (Clontech) or a vector of the pcDNA vector suite (Invitrogen).
  • Means for introducing the isolated nucleic acid molecule or a gene construct comprising same into a cell for expression are known to those skilled in the art. The technique used for a given organism depends on the known successful techniques. Means for introducing recombinant DNA into cells include microinjection, transfection mediated by DEAE-dextran, transfection mediated by liposomes such as by using lipofectamine (Gibco, MD, USA) and/or cellfectin (Gibco, MD, USA), PEG-mediated DNA uptake, electroporation and microparticle bombardment such as by using DNA- coated tungsten or gold particles (Agracetus Inc., WI, USA) amongst others.
  • an expression construct of the disclosure is a viral vector.
  • Suitable viral vectors are known in the art and commercially available.
  • Conventional viral-based systems for the delivery of a nucleic acid and integration of that nucleic acid into a host cell genome include, for example, a retroviral vector, a lentiviral vector or an adeno- associated viral vector.
  • an adenoviral vector is useful for introducing a nucleic acid that remains episomal into a host cell.
  • Viral vectors are an efficient and versatile method of gene transfer in target cells and tissues. Additionally, high transduction efficiencies have been observed in many different cell types and target tissues.
  • a retroviral vector generally comprises cis-acting long terminal repeats (LTRs) with packaging capacity for up to 6-10 kb of foreign sequence.
  • LTRs long terminal repeats
  • the minimum cis-acting LTRs are sufficient for replication and packaging of a vector, which is then used to integrate the expression construct into the target cell to provide long term expression.
  • Widely used retroviral vectors include those based upon murine leukemia virus (MuLV), gibbon ape leukemia virus (GaLV), simian immunodeficiency virus (SrV), human immunodeficiency virus (HIV), and combinations thereof (see, e.g., Buchscher et al, J Virol. 5(5:2731-2739 (1992); Johann et al, J.
  • Virol (55: 1635-1640 (1992); Sommerfelt et al, Virol 76:58-59 (1990); Wilson et al, J. Virol 63:274-2318 (1989); Miller et al, J. Virol 65:2220-2224 (1991); PCT/US94/05700; Miller and Rosman BioTechniques 7:980-990, 1989; Miller, A. D. Human Gene Therapy 7:5-14, 1990; Scarpa et al Virology 75:849-852, 1991; Burns et al Proc. Natl Acad. Sci USA 90:8033-8037, 1993).
  • AAV vectors can be readily constructed using techniques known in the art. See, e.g., U.S. Pat. Nos. 5,173,414 and 5,139,941; International Publication Nos. WO 92/01070 and WO 93/03769; Lebkowski et al. Molec. Cell. Biol. 5:3988-3996, 1988; Vincent et al. (1990) Vaccines 90 (Cold Spring Harbor Laboratory Press);Carter Current Opinion in Biotechnology 5:533-539, 1992; Muzyczka. Current Topics in Microbiol, and Immunol.
  • Additional viral vectors useful for delivering an expression construct of the disclosure include, for example, those derived from the pox family of viruses, such as vaccinia virus and avian poxvirus or an alphavirus or a conjugate virus vector (e.g. that described in Fisher-Hoch et al, Proc. Natl Acad. Sci. USA 56:317-321, 1989).
  • exemplary in vitro models include: • Culturing endothelial cells in high glucose medium, which results in suppression of proliferation, increased expression of adhesion molecules and increased apoptosis; and
  • a rat hypertension model produced using goldblatt techniques such as 2-kidney 1- clip model and 1 -kidney 1-clip model, which have been demonstrated to increase arterial blood pressure, total peripheral resistance (TPR) and decrease endothelium dependent relaxation to acetylcholine (Ach) (Share et al, Clin. Exp. Hypertens., 4: 1261-1270, 2982; Sventek et al, Hypertensive, 27: 49-55, 1996).
  • STRO-l + cells and/or progeny cells thereof are administered in the form of a composition.
  • a composition comprises a pharmaceutically acceptable carrier and/or excipient.
  • carrier and “excipient” refer to compositions of matter that are conventionally used in the art to facilitate the storage, administration, and/or the biological activity of an active compound (see, e.g., Remington's Pharmaceutical Sciences, 16th Ed., Mac Publishing Company (1980)).
  • a carrier may also reduce any undesirable side effects of the active compound.
  • a suitable carrier is, for example, stable, e.g., incapable of reacting with other ingredients in the carrier. In one example, the carrier does not produce significant local or systemic adverse effects in recipients at the dosages and concentrations employed for treatment.
  • Suitable carriers for the present disclosure include those conventionally used, e.g., water, saline, aqueous dextrose, lactose, Ringer's solution, a buffered solution, hyaluronan and glycols are exemplary liquid carriers, particularly (when isotonic) for solutions.
  • Suitable pharmaceutical carriers and excipients include starch, cellulose, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, magnesium stearate, sodium stearate, glycerol monostearate, sodium chloride, glycerol, propylene glycol, water, ethanol, and the like.
  • a carrier is a media composition, e.g., in which a cell is grown or suspended.
  • a media composition does not induce any adverse effects in a subject to whom it is administered.
  • Exemplary carriers and excipients do not adversely affect the viability of a cell and/or the ability of a cell to reduce, prevent or delay inflammatory joint disease.
  • the carrier or excipient provides a buffering activity to maintain the cells and/or soluble factors at a suitable pH to thereby exert a biological activity
  • the carrier or excipient is phosphate buffered saline (PBS).
  • PBS represents an attractive carrier or excipient because it interacts with cells and factors minimally and permits rapid release of the cells and factors, in such a case, the composition of the invention may be produced as a liquid for direct application to the blood stream or into a tissue or a region surrounding or adjacent to a tissue, e.g., by injection.
  • STRO-r cells and/or progeny cells thereof can also be incorporated or embedded within scaffolds that are recipient-compatible and which degrade into products that are not harmful to the recipient. These scaffolds provide support and protection for cells that are to be transplanted into the recipient subjects. Natural and/or synthetic biodegradable scaffolds are examples of such scaffolds.
  • scaffolds include, but are not limited to biological, degradable scaffolds.
  • Natural biodegradable scaffolds include collagen, fibronectin, and laminin scaffolds.
  • Suitable synthetic material for a cell transplantation scaffold should be able to support extensive cell growth and cell function. Such scaffolds may also be resorbable.
  • Suitable scaffolds include polyglycolic acid scaffolds, e.g., as described by Vacanti, et al. J. Fed. Surg. 23:3-9 1988; Cima, et al. Biotechnol. Bioeng. 35: 145 1991; Vacanti, et al. Plast. Reconstr. Surg. 55:753-9 1991; or synthetic polymers such as polyanhydrides, polyorthoesters, and polylactic acid.
  • the cells may be administered in a gel scaffold (such as Gelfoam from Upjohn Company.
  • a gel scaffold such as Gelfoam from Upjohn Company.
  • the cellular compositions useful for methods described herein may be administered alone or as admixtures with other cells.
  • Cells that may be administered in conjunction with the compositions of the present invention include, but are not limited to, other multipotent or pluripotent cells or stem cells, or bone marrow cells.
  • the cells of different types may be admixed with a composition of the invention immediately or shortly prior to administration, or they may be co-cultured together for a period of time prior to administration.
  • the composition comprises an effective amount or a therapeutically or prophylactically effective amount of cells.
  • the composition comprises about lxlO 5 STRO-l + cells/kg to about lxlO 7 STRO-l + cells/kg or about lxlO 6 STRO-l + cells/kg to about 5xl0 6 STRO-l + cells/kg.
  • the exact amount of cells to be administered is dependent upon a variety of factors, including the age, weight, and sex of the patient, and the extent and severity of the inflammatory joint disease
  • a low dose of cells is administered to the subject.
  • Exemplary dosages include between about 0.1 x 10 4 to about 0.5 x 10 6 cells per kg, for example, between about 0.1 x 10 5 to about 0.5 x 10 6 cells per kg, such as, between about 0.5 x
  • 10 6 cells per kg e.g., about 0.2 x 10 6 or 0.3 x 10 6 or 0.4 x 10 6 cells per kg.
  • a high dose of cells is administered to the subject.
  • Exemplary dosages include at least about 1.5 x 10 6 cells/kg.
  • a high dose comprises between about 1.5 x 10 6 to about 6xl0 6 cells/kg, such as between about 1.5 x 10 6 to about 5xl0 6 cells/kg, for example, between about 1.5 x 10 6 to about 4xl0 6 cells/kg, for example, between about 1.5 x 10 6 to about 3xl0 6 cells/kg.
  • a high dose comprises about 1.5 x 10 6 or about 2 x 10 6 cells/kg.
  • the cells are administered as a total cell number dose irrespective of the patient's weight.
  • the cells are administered at a dose of between about 100 million to 300 million cells irrespective of the weight of the patient.
  • the cells are administered at a dose of between about 100 million to 200 million cells irrespective of the weight of the patient.
  • the cells are administered at a dose of about 100 million cells irrespective of the weight of the patient.
  • the cells are administered at a dose of about 150 million cells irrespective of the weight of the patient.
  • the cells are administered at a dose of about 200 million cells irrespective of the weight of the patient.
  • the cells are administered at a dose of about 300 million cells irrespective of the weight of the patient.
  • cells are contained within a chamber that does not permit the cells to exit into a subject's circulation, however that permits factors secreted by the cells to enter the circulation.
  • soluble factors may be administered to a subject by permitting the cells to secrete the factors into the subject's circulation.
  • Such a chamber may equally be implanted at a site in a subject to increase local levels of the soluble factors, e.g., implanted in or near a pancreas.
  • the cells may be encapsulated in a capsule that is permeable to nutrients and oxygen required by the cell and therapeutic factors the cell is yet impermeable to immune humoral factors and cells.
  • the encapsulant is hypoallergenic, is easily and stably situated in a target tissue, and provides added protection to the implanted structure.
  • STRO-l + cell-derived and/or progeny cell-derived supernatant or soluble factors are administered in the form of a composition, e.g., comprising a suitable carrier and/or excipient.
  • a suitable carrier and/or excipient e.g., the carrier or excipient does not adversely affect the biological effect of the soluble factors or supernatant.
  • the composition comprises a composition of matter to stabilize a soluble factor or a component of supernatant, e.g., a protease inhibitor.
  • a protease inhibitor is not included in an amount sufficient to have an adverse effect on a subject.
  • compositions comprising STRO-l + cell-derived and/or progeny cell-derived supernatant or soluble factors may be prepared as appropriate liquid suspensions, e.g., in culture medium or in a stable carrier or a buffer solution, e.g., phosphate buffered saline. Suitable carriers are described herein above.
  • suspensions comprising STRO-l + cell-derived and/or progeny cell-derived supernatant or soluble factors are oily suspensions for injection.
  • Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil; or synthetic fatty acid esters, such as ethyl oleate or triglycerides; or liposomes.
  • Suspensions to be used for injection may also contain substances which increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol, or dextran.
  • the suspension may also contain suitable stabilizers or agents which increase the solubility of the compounds to allow for the preparation of highly concentrated solutions.
  • Sterile injectable solutions can be prepared by incorporating the supernatant or soluble factors in the required amount in an appropriate solvent with one or a combination of ingredients described above, as required, followed by filtered sterilization.
  • dispersions are prepared by incorporating the supernatant or soluble factors into a sterile vehicle that contains a basic dispersion medium and the required other ingredients from those enumerated above.
  • exemplary methods of preparation are vacuum drying and freeze-drying which yields a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.
  • the supernatant or soluble factors may be formulated with one or more additional compounds that enhance its solubility.
  • compositions typically should be sterile and stable under the conditions of manufacture and storage.
  • the composition can be formulated as a solution, microemulsion, liposome, or other ordered structure.
  • the carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), and suitable mixtures thereof.
  • the proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants.
  • isotonic agents for example, sugars, polyalcohols such as mannitol, sorbitol, or sodium chloride in the composition.
  • Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent which delays absorption, for example, monostearate salts and gelatin.
  • the soluble factors may be administered in a time release formulation, for example in a composition which includes a slow release polymer.
  • the active compounds can be prepared with carriers that will protect the compound against rapid release, such as a controlled release formulation, including implants and microencapsulated delivery systems.
  • Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, polylactic acid and polylactic, polyglycolic copolymers (PLG). Many methods for the preparation of such formulations are patented or generally known to those skilled in the art.
  • the supernatant or soluble factors may be administered in combination with an appropriate matrix, for instance, to provide slow release of the soluble factors. Additional Components of Compositions
  • the STRO-l + cell-derived supernatant or soluble factors, STRO-l + cells or progeny thereof may be administered with other beneficial drugs or biological molecules (growth factors, trophic factors).
  • beneficial drugs or biological molecules growth factors, trophic factors
  • they may be administered together in a single pharmaceutical composition, or in separate pharmaceutical compositions, simultaneously or sequentially with the other agents (either before or after administration of the other agents).
  • Bioactive factors which may be co-administered include anti-apoptotic agents (e.g., EPO, EPO mimetibody, TPO, IGF-I and IGF-II, HGF, caspase inhibitors); anti-inflammatory agents (e.g., p38 MAPK inhibitors, TGF-beta inhibitors, statins, IL-6 and IL-1 inhibitors, PEMTROLAST, TRANILAST, REMICADE, SIROLFMUS, and NSAIDs (non-steroidal antiinflammatory drugs; e.g., TEPOXALF , TOLMETF , SUPROFEN); immunosupressive/immunomodulatory agents (e.g., calcineurin inhibitors, such as cyclosporin ⁇ tacrolimus; mTOR inhibitors (e.g., SIROLFMUS, EVEROLIMUS); anti- proliferatives (e.g., azathioprine, mycophenolate mofetil); cortic
  • the STRO-l + cell-derived supernatant or soluble factors, STRO- 1 + cells or progeny thereof are administered with a compound useful for treating endothelial dysfunction, such as an angiotensin converting enzyme inhibitor, peroxisome proliferator- activated receptor-activators (insulin sensitizers, e.g., the glitazones pioglitazone and rosiglitazone) and peroxisome proliferator-activated receptor- activators (fibrates, e.g., feno fibrate), antioxidants (e.g., ascorbic acid or vitamin E) or hormone replacement therapy.
  • a compound useful for treating endothelial dysfunction such as an angiotensin converting enzyme inhibitor, peroxisome proliferator- activated receptor-activators (insulin sensitizers, e.g., the glitazones pioglitazone and rosiglitazone) and peroxisome proliferator-activated receptor- activ
  • a composition as described herein according to any example additionally comprises a factor that induces or enhances differentiation of a progenitor cell into a vascular cell.
  • exemplary factors include, vascular endothelial growth factor (VEGF), platelet derived growth factor (PDGF; e.g., PDGF-BB), and FGF.
  • a composition as described herein according to any example additionally comprises a tissue specific committed cell (TSCC).
  • TSCC tissue specific committed cell
  • International Patent Application No. PCT/AU2005/001445 demonstrates that administration of a TSCC and a STRO-l + cells can lead to enhanced proliferation of the TSCC.
  • the TSCC is a vascular cell.
  • Administration of such a composition to a subject may lead to increased production of vasculature, e.g., leading to increased nutrients being delivered to the affected tissue.
  • the present disclosure also provides medical devices for use or when used in a method as described herein according to any example.
  • the present disclosure provides a syringe or catheter or other suitable delivery device comprising STRO- cells and/or progeny cells thereof and/or soluble factors therefrom and/or a composition as described herein according to any example.
  • the syringe or catheter is packaged with instructions for use in a method as described herein according to any example.
  • the present disclosure provides an implant comprising STRO-1 cells and/or progeny cells thereof and/or soluble factors therefrom and/or a composition as described herein according to any example.
  • the implant is packaged with instructions for use in a method as described herein according to any example.
  • Suitable implants may be formed with a scaffold, e.g., as described herein above and STRO-l + cells and/or progeny cells thereof and/or soluble factors therefrom.
  • the STRO-l + cell-derived supernatant or soluble factors, STRO-l + cells or progeny thereof may be surgically implanted, injected, delivered (e.g., by way of a catheter or syringe), or otherwise administered systemically.
  • the STRO-1 + cell-derived supernatant or soluble factors, STRO- 1 + cells or progeny thereof is/are delivered to the blood stream of a subject.
  • the STRO-l + cell-derived supernatant or soluble factors, STRO-l + cells or progeny thereof are delivered parenterally.
  • routes of parenteral administration include, but are not limited to, intraperitoneal, intraventricular, intracerebroventricular, intrathecal, intra-arterial, intranodal or intravenous.
  • the STRO-l + cell-derived supernatant or soluble factors, STRO-l + cells or progeny thereof are delivered intra-arterially, into an aorta, into an atrium or ventricle of the heart or into a blood vessel, e.g., intravenously.
  • aorta into an atrium or ventricle of the heart
  • a blood vessel e.g., intravenously.
  • cells can be administered to the left atrium or ventricle to avoid complications that may arise from rapid delivery of cells to the lungs.
  • the STRO-l + cell-derived supernatant or soluble factors, STRO- 1 + cells or progeny thereof are injected into the site of delivery, e.g., using a syringe or through a catheter or a central line.
  • an administration regimen for a therapeutic formulation depends on several factors, including the serum or tissue turnover rate of the entity, the level of symptoms, and the immunogenicity of the entity. For example, an administration regimen maximizes the amount of therapeutic compound delivered to the patient consistent with an acceptable level of side effects. Accordingly, the amount of formulation delivered depends in part on the particular entity and the severity of the condition being treated.
  • STRO-l + cell-derived supernatant or soluble factors, STRO-l + cells or progeny thereof are delivered as a single bolus dose.
  • STRO-l + cell-derived supernatant or soluble factors, STRO-l + cells or progeny thereof are administered by continuous infusion, or by doses at intervals of, e.g., one day, one week, or 1-7 times per week.
  • An exemplary dose protocol is one involving the maximal dose or dose frequency that avoids significant undesirable side effects.
  • a total weekly dose depends on the type and activity of the compound being used. Determination of the appropriate dose is made by a clinician, e.g., using parameters or factors known or suspected in the art to affect treatment or predicted to affect treatment. Generally, the dose begins with an amount somewhat less than the optimum dose and is increased by small increments thereafter until the desired or optimum effect is achieved relative to any negative side effects.
  • Important diagnostic measures include those of symptoms of diabetes.
  • the cells are administered weekly, fortnightly, once every three weeks or once every four weeks.
  • the STRO-l + cells and/or progeny cells thereof and/or soluble factors derived therefrom are administered following diagnosis of the disorder, e.g., using standard methods known in the art and/or described herein.
  • Bone marrow is harvested from healthy normal adult volunteers (20-35 years old). Briefly, 40 ml of BM is aspirated from the posterior iliac crest into lithium- heparin anticoagulant-containing tubes.
  • BMMNC are prepared by density gradient separation using LymphoprepTM
  • HHF Hank's balanced salt solution
  • FCS fetal calf serum
  • STRO-3 + (or TNAP + ) cells were subsequently isolated by magnetic activated cell sorting as previously described (Gronthos et al. (2003) Journal of Cell Science 116: 1827-1835; Gronthos, S. and Simmons, P.J. (1995) Blood 85: 929-940). Briefly, approximately 1-3 x 10 8 BMMNC are incubated in blocking buffer, consisting of 10% (v/v) normal rabbit serum in HHF for 20 minutes on ice. The cells are incubated with 200 ⁇ 1 of a l( ⁇ g/ml solution of STRO-3 mAb in blocking buffer for 1 hour on ice. The cells are subsequently washed twice in HHF by centrifugation at 400 x g.
  • STRO-3 (IgGl) is a different isotype to that of STRO-1 (IgM)
  • the ability of STRO-3 to identify clonogenic CFU-F was assessed by two-color FACS analysis based on its co-expression with STRO-l + cells isolated using the MACS procedure ( Figure 1).
  • the dot plot histogram represents 5 x 10 4 events collected as listmode data.
  • the vertical and horizontal lines were set to the reactivity levels of ⁇ 1.0% mean fluorescence obtained with the isotype-matched control antibodies, 1B5 (IgG) and 1A6.12 (IgM) treated under the same conditions.
  • Table 1 Enrichment of human bone marrow cells by dual-color FACS analysis based on the co-expression of the cell surface markers STRO-1 and TNAP (refer to Figure 1).
  • FACS sorted cells were cultured under standard clonogenic conditions in alpha MEM supplemented with 20% FCS.
  • RNA Total cellular RNA was prepared from either 2 x 10 6 STRO-l bright or STRO-1 dul1 sorted primary cells, chondrocyte pellets and other induced cultures and lysed using RNAzolB extraction method (Biotecx Lab. Inc., Houston, TX), according to the manufacturer's recommendations. RNA isolated from each subpopulation was then used as a template for cDNA synthesis, prepared using a first-strand cDNA synthesis kit (Pharmacia Biotech, Uppsala, Sweden). The expression of various transcripts was assessed by PCR amplification, using a standard protocol as described previously (Gronthos et al., J. Bone andMin. Res. 7 ⁇ :48-57, 1999). Primer sets used in this study are shown in Table 2. Following amplification, each reaction mixture was analyzed by 1.5% agarose gel electrophoresis, and visualized by ethidium bromide staining. RNA integrity was assessed by the expression of GAPDH.
  • RNA STAT- 60 system TEL-TEST
  • First-strand synthesize was performed using the SMART cDNA synthesis kit (Clontech Laboratories).
  • the resultant mRNA/single- stranded cDNA hybrid was amplified by long-distance PCR (Advantage 2 PCR kit; Clontech) using specific primer sites at the 3' and 5' prime ends formed during the initial RT process according to the manufacturer's specifications.
  • 2 aliquots were used to ligate different specific adaptor oligonucleotides using the Clontech PCR-Select cDNA Subtraction Kit.
  • Two rounds of subtractive hybridization were performed using STRO-l bright (tester) and STRO-l du11 (driver) cDNA, and vice versa, according to the manufacturer's protocol. This procedure was also performed in reverse using STRO-l du11 tester cDNA hybridized against STRO-l bright driver cDNA.
  • STRO-l bright - subtracted cDNA was used to construct replicate low-density microarray filters comprising 200 randomly selected bacterial clones transformed with the STRO-l bnght subtracted cDNAs ligated into a T/A cloning vector. The microarrays were subsequently probed with either [ 32 P] dCTP-labeled STRO-l bright or STRO-l du11 subtracted cDNA ( Figure 3B-C). Differential screening identified a total of 44 clones, which were highly differentially expressed between the STRO-l du11 and STRO-l bright subpopulations.
  • GCTGGACTCCTACTGTAAGGG (SEQ ID NO: 4)
  • CAGTTCAGTGATCGTACAGGTGC (SEQ ID NO: 6)
  • TNF-a TCAGATCATCTTCTCGAACC (SEQ ID NO: 9) 361
  • CAGATAGATGGGCTCATACC (SEQ ID NO: 10)
  • CTCTAAACTGGAGTGGTCAGGGCT SEQ ID NO: 29
  • Table 3 Summary of the Relative Gene Expression in STRO-l Bngllt and STRO-l DuU populations. A list of genes which displayed measurable and differential expression between the STRO-l Bnght and STRO-l DuU populations as determined by reverse transcription-PCR are presented . Values represent the relative gene expression with reference to the house-keeping gene, GAPDH.
  • single cell suspensions of ex vivo expanded cells derived bone marrow MPC were prepared by trypsin/EDTA detachment and subsequently incubated with the STRO-1 antibody in combination with antibodies identifying a wide range of cell lineage- associated markers.
  • STRO-1 was identified using a goat anti -murine IgM-fluorescein isothiocyanate while all other markers were identified using either a goat anti-mouse or anti-rabbit IgG- phycoerythrin.
  • cell preparations were first labeled with the STRO-1 antibody, fixed with cold 70% ethanol to permeabilize the cellular membrane and then incubated with intracellular antigen-specific antibodies.
  • Isotype matched control antibodies were used under identical conditions. Dual-colour flow cytometric analysis was performed using a COULTER EPICS flow cytometer and list mode data collected. The dot plots represent 5,000 listmode events indicating the level of fluorescence intensity for each lineage cell marker (y-axis) and STRO-1 (x-axis). The vertical and horizontal quadrants were established with reference to the isotype matched negative control antibodies.
  • Table 4 Summary of the Relative Protein Expression in STRO-l Bright and STRO-l Du11 populations. A list of proteins which displayed differential expression between the STRO-l Bn and STRO-l Du11 populations as determined by flow cytometry are presented. Values represent the relative mean fluorescence intensity of staining.
  • Example 4 Stromal cells express Angiotensin I
  • Human stromal cell lines HS5 and HS27A were grown in RPMI-1640 supplemented with 10% Fetal Calf Serum (FCS) and Penicillin (100 U/ml and streptomycin (100 ⁇ g/mL).
  • Primary stromal fibroblasts were cultured from bone marrow mononuclear cells (BMMNC) as previously described (Pillai et al, Blood 107: 3520-3526, 2006). Cells were stained with FITC-conjugated anti-CD 146 antibody (Ebiosciences, San Diego, CA) as well as appropriate isotype control for analysis as well as cell sorting in to CD146hi and CD 146 lo populations on a FACS Aria cell sorter (BD Biosciences, San Jose, CA).
  • RNA was prepared using the miR Easy kit (Qiagen, Valencia, CA) per manufacturer's instructions; on-column DNAse digestion was performed to eliminate contamination with genomic DNA. mRNA levels were quantitated by SYBR-GREEN based quantitative Real Time-Polymerase Chain Reaction (qRT-PCR) on cDNA generated by reverse transcription.
  • miR Easy kit Qiagen, Valencia, CA
  • qRT-PCR quantitative Real Time-Polymerase Chain Reaction
  • the HS27a stromal cell line seemed to share similar functional and transcriptional profiles with those reported for the CD146 M stromal precursors. Thus, the expression of CD14 on this cell line was assessed. Flow-cytometric analysis of CD146 was performed on HS27a and HS5 cells and showed that CD146 was expressed strongly by HS27a, whereas HS5 did not ( Figure 4A). CD146 expression was also assessed in 9 primary cultures, established from normal bone marrow. The cultures which were analyzed within the first two to three passages demonstrated variable proportions of CD146 M cells (6 to 40%), an example of which is shown in Figure 4B. The CD146 M and CD146 10 cells from primary cultures were then evaluated for expression of two genes, CXCL12 and Angiopoietin I. As shown in Figures 3C and 3D, the CD146 M population has significantly higher expression of both CXCL12 and Angiopoietin I when compared to CD146 10 cells.
  • stromal precurscor cells that express high levels of CD146 e.g., STRO-1 expressing MPCs also express Angiopoitin I.
  • Example 5 MPCs treat or prevent endothelial dysfunction
  • BColl-II Bovine type II collagen
  • lmL emulsion of Freund's complete adjuvant
  • BColl-II 5 mg
  • 1 mL emulsion of Freund's complete adjuvant
  • BColl-II 5 mg
  • 100 ⁇ g of BColl-II in 0.5 mL isotonic saline was injected intra-articularly into the left hock joint to promote an acute arthritis accompanied by systemic inflammation.
  • Tissues were collected and stored in ice-cold modified Krebs-Henseleit solution (KHS).
  • KHS ice-cold modified Krebs-Henseleit solution
  • Second order branches of the left descending coronary artery were dissected free from the surrounding tissue under a dissecting microscope (Stemi 2000 stereomicroscope, Carl Zeiss, Gottengen, Germany) a length prepared for vasomotor functional study using the Mulvany-Halpern wire myograph (Danish Myo Technologies, Denmark). Briefly, vessel segments were mounted between two parallel stainless steel wires (40 ⁇ diameter) attached to the jaws of the wire myograph.
  • Ovine digital arteries were obtained from the left forelimb of the same sheep, lmm segments were taken from the first branch of the palmar digital artery, and mounted in the wire myograph as described above.
  • the modified KHS used has the following composition (mM): NaCl 118, KC1
  • the preparations were placed in a chamber containing 5 ml of KHS, maintained at 37 °C and aerated with 95% 0 2 and 5% C0 2 . After an equilibration period of 15 min, when the vessel segments become normalized according to the methods developed by Mulvany and Halpern Circulation Res. 41: 19-26, 1977, and the optimal internal circumference was determined during the normalization procedure. Resting tension was applied to the blood vessels according to their normalized internal circumference, corresponding to 13.3 kPa (100 mmHg) with an adjustment factor of 0.9. After the resting tension was established, vessels were submitted to an extra equilibration period of 30 min in KHS followed by a contractile response to a standard depolarizing Krebs solution (DKS; 118 mM KC1).
  • DKS depolarizing Krebs solution
  • Coronary arteries bradykinin and sodium nitroprusside -induced relaxation of arteries pre-constricted with endothelin-1
  • Digital arteries carbachol and sodium nitroprusside -induced relaxation of arteries pre-constricted with 5-HT
  • IL-10 is an inflammatory cytokine which promotes circulating levels of neutrophils and helps limits their pro-inflammatory state. This in turn serves to enhance treatment of systemic infection diseases such as sepsis.
  • the single dose of MPCs was also effective in reducing plasma fibrinogen, Activin A and C-reactive protein relative to untreated sheep ( Figures 6 - 9).
  • Fibrinogen, Activin A and C-reactive protein are all markers of sepsis and their reduction in plasma levels is indicative of reduced symptoms of sepsis following administration of the MPCs.
  • Sheep treated with MPCs demonstrated a significantly higher maximal response to carbachol or bradykinin when compared to untreated sheep (p ⁇ 0.05) ( Figures 10A and 10B).
  • This pre-clinical study demonstrated that MPCs when given intravenously are able to attenuate the development of systemic endothelial dysfunction.
  • Example 6 MPCs in combination with PPS induces anti-inflammatory effects
  • BColl-II Bovine type II collagen
  • Ovine digital and coronary arteries were obtained as detailed above. Furthermore, isometric tension recording, data analysis and digital and coronary artery function analysis was conducted as described above.
  • IL-10 is an inflammatory cytokine which promotes circulating levels of neutrophils and helps limits their proinflammatory state. This in turn serves to enhance treatment of systemic infection diseases such as sepsis.
  • Sheep treated with MPCs plus PPS demonstrated a significantly higher maximal response of coronary arteries to bradykinin when compared to sheep treated with PPS alone (p ⁇ 0.05) ( Figures 15 A), indicating a direct beneficial effect on the vascular endothelium.
  • Sheep treated with MPCs plus PPS demonstrated an improvement in the maximum endothelium-dependent relaxation response in digital arteries to carbachol compared to sheep treated with PPS alone (Figure 15B).
  • There was no significant difference in the response of coronary or digital arteries from the two groups to sodium nitroprusside (Figures 15C and 15D) indicating that vascular smooth muscle function was unaffected by treatment.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Biomedical Technology (AREA)
  • Developmental Biology & Embryology (AREA)
  • Immunology (AREA)
  • Cardiology (AREA)
  • Cell Biology (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Hematology (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Epidemiology (AREA)
  • Rheumatology (AREA)
  • Virology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Urology & Nephrology (AREA)
  • Diabetes (AREA)
  • Hospice & Palliative Care (AREA)
  • Vascular Medicine (AREA)
  • Dermatology (AREA)
  • Molecular Biology (AREA)
  • Emergency Medicine (AREA)
  • Endocrinology (AREA)
PCT/AU2013/001452 2012-12-12 2013-12-12 Treatment of diseases of endothelial dysfunction and inflammation Ceased WO2014089623A1 (en)

Priority Applications (19)

Application Number Priority Date Filing Date Title
AU2013360024A AU2013360024B2 (en) 2012-12-12 2013-12-12 Treatment of diseases of endothelial dysfunction and inflammation
HK15110737.0A HK1210209B (en) 2012-12-12 2013-12-12 Treatment of diseases of endothelial dysfunction and inflammation
CA2893942A CA2893942C (en) 2012-12-12 2013-12-12 Treatment of diseases of endothelial dysfunction and inflammation
KR1020227005920A KR102506612B1 (ko) 2012-12-12 2013-12-12 내피 기능장애 및 염증 질환의 치료
EP19174698.1A EP3556850A1 (en) 2012-12-12 2013-12-12 Treatment of diseases of endothelial dysfunction and inflammation
SG11201504340YA SG11201504340YA (en) 2012-12-12 2013-12-12 Treatment of diseases of endothelial dysfunction and inflammation
KR1020217004422A KR102367981B1 (ko) 2012-12-12 2013-12-12 내피 기능장애 및 염증 질환의 치료
CN202010796960.9A CN111840329B (zh) 2012-12-12 2013-12-12 内皮功能障碍和炎症的疾病的治疗
ES13862555T ES2742035T3 (es) 2012-12-12 2013-12-12 Tratamiento de las enfermedades de la disfunción y la inflamación endotelial
EP13862555.3A EP2931876B1 (en) 2012-12-12 2013-12-12 Treatment of diseases of endothelial dysfunction and inflammation
JP2015546770A JP6572130B2 (ja) 2012-12-12 2013-12-12 内皮機能不全及び炎症の疾患の治療
US14/650,172 US20160175360A1 (en) 2012-12-12 2013-12-12 Treatment of diseases of endothelial dysfunction and inflammation
CN201380072732.5A CN105358163B (zh) 2012-12-12 2013-12-12 内皮功能障碍和炎症的疾病的治疗
KR1020157017531A KR102217962B1 (ko) 2012-12-12 2013-12-12 내피 기능장애 및 염증 질환의 치료
IL239308A IL239308A0 (en) 2012-12-12 2015-06-09 Treatment of diseases of endothelial dysfunction and inflammation
AU2019202960A AU2019202960B2 (en) 2012-12-12 2019-04-29 Treatment of diseases of endothelial dysfunction and inflammation
AU2021250848A AU2021250848A1 (en) 2012-12-12 2021-10-12 Treatment of diseases of endothelial dysfunction and inflammation
US18/481,041 US20240115618A1 (en) 2012-12-12 2023-10-04 Treatment of diseases of endothelial dysfunction and inflammation
AU2024227208A AU2024227208A1 (en) 2012-12-12 2024-10-10 Treatment of diseases of endothelial dysfunction and inflammation

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201261736361P 2012-12-12 2012-12-12
US61/736,361 2012-12-12

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US14/650,172 A-371-Of-International US20160175360A1 (en) 2012-12-12 2013-12-12 Treatment of diseases of endothelial dysfunction and inflammation
US18/481,041 Continuation US20240115618A1 (en) 2012-12-12 2023-10-04 Treatment of diseases of endothelial dysfunction and inflammation

Publications (1)

Publication Number Publication Date
WO2014089623A1 true WO2014089623A1 (en) 2014-06-19

Family

ID=50933585

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/AU2013/001452 Ceased WO2014089623A1 (en) 2012-12-12 2013-12-12 Treatment of diseases of endothelial dysfunction and inflammation

Country Status (11)

Country Link
US (2) US20160175360A1 (enExample)
EP (2) EP3556850A1 (enExample)
JP (5) JP6572130B2 (enExample)
KR (3) KR102506612B1 (enExample)
CN (2) CN105358163B (enExample)
AU (4) AU2013360024B2 (enExample)
CA (1) CA2893942C (enExample)
ES (1) ES2742035T3 (enExample)
IL (1) IL239308A0 (enExample)
SG (2) SG11201504340YA (enExample)
WO (1) WO2014089623A1 (enExample)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9888679B2 (en) 2007-12-04 2018-02-13 Proteobioactives Pty Ltd Protection of progenitor cells and regulation of their differentiation

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105358163B (zh) * 2012-12-12 2020-09-11 麦瑟布莱斯特公司 内皮功能障碍和炎症的疾病的治疗
WO2022114111A1 (ja) * 2020-11-27 2022-06-02 マルホ株式会社 医薬品又は化粧品用組成物

Citations (16)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1992001070A1 (en) 1990-07-09 1992-01-23 The United States Of America, As Represented By The Secretary, U.S. Department Of Commerce High efficiency packaging of mutant adeno-associated virus using amber suppressions
US5139941A (en) 1985-10-31 1992-08-18 University Of Florida Research Foundation, Inc. AAV transduction vectors
US5173414A (en) 1990-10-30 1992-12-22 Applied Immune Sciences, Inc. Production of recombinant adeno-associated virus vectors
WO1993003769A1 (en) 1991-08-20 1993-03-04 THE UNITED STATES OF AMERICA, represented by THE SECRETARY, DEPARTEMENT OF HEALTH AND HUMAN SERVICES Adenovirus mediated transfer of genes to the gastrointestinal tract
WO2001004268A1 (en) 1999-07-07 2001-01-18 Medvet Science Pty Ltd Mesenchymal precursor cell
WO2001014268A1 (de) 1999-08-21 2001-03-01 Schott Glas Skulltiegel für das erschmelzen oder das laütern von anorganischen substanzen, insbesondere von gläsern und glaskeramiken
WO2004084921A1 (en) 2003-03-28 2004-10-07 Angioblast Systems Incorporated Perivascular mesenchymal precursor cell induced blood vessel formation
WO2006032092A1 (en) 2004-09-24 2006-03-30 Angioblast Systems, Inc. Multipotential expanded mesenchymal precursor cell progeny (memp) and uses thereof
WO2006108229A1 (en) 2005-04-12 2006-10-19 Angioblast Systems, Inc. Isolation of adult multipotential cells by tissue non-specific alkaline phosphatase
WO2006121445A2 (en) 2005-05-10 2006-11-16 United States Of America Department Of Veteran's Affairs Therapy of kidney diseases and multiorgan failure with mesenchymal stem cells and mesenchymal stem cell conditioned media
WO2010005527A1 (en) * 2008-06-30 2010-01-14 Angioblast Systems, Inc. Treatment of eye diseases and excessive neovascularization using a combined therapy
WO2010138180A2 (en) * 2009-05-26 2010-12-02 The University Of Vermont And State Agriculture College Compositions and methods for cardiac tissue repair
WO2012047733A2 (en) * 2010-09-29 2012-04-12 Aidan Research And Consulting, Llc. Treatment of acne by conditioned media
WO2012162754A1 (en) 2011-06-03 2012-12-06 Mesoblast, Inc Methods of treating or preventing neurological diseases
WO2013003899A1 (en) 2011-07-04 2013-01-10 Mesoblast, Inc Methods of treating or preventing rheumatic disease
US9405700B2 (en) 2010-11-04 2016-08-02 Sonics, Inc. Methods and apparatus for virtualization in an integrated circuit

Family Cites Families (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
ES2239801T3 (es) * 1997-04-02 2005-10-01 The Brigham And Women's Hospital, Inc. Uso de un agente para disminuir el riesgo de enfermedad cardiovascular.
US20080095749A1 (en) * 2004-03-22 2008-04-24 Sudeepta Aggarwal Mesenchymal stem cells and uses therefor
US20080260703A1 (en) * 2007-04-23 2008-10-23 Medistem Labortories Treatment of Insulin Resistance and Diabetes
AU2008334036B2 (en) * 2007-11-30 2014-05-29 New York Medical College Methods of reducing transplant rejection and cardiac allograft vasculopathy by implanting autologous stem cells
EP2227238A2 (en) * 2007-11-30 2010-09-15 New York Medical College Compositions comprising vascular and myocyte progenitor cells and methods of their use
KR101718375B1 (ko) * 2007-12-04 2017-03-22 프로테오바이오엑티브스 피티와이 엘티디 전구 세포의 보호 및 그의 분화 조절
ES2550795T3 (es) * 2008-11-20 2015-11-12 Mesoblast, Inc. Método para tratar o prevenir una disfunción pancreática
WO2011073521A1 (en) * 2009-12-15 2011-06-23 Petri Salven Methods for enriching adult-derived endothelial progenitor cells and uses thereof
EP2879682B1 (en) * 2012-08-01 2018-03-21 United Therapeutics Corporation Treatment of pulmonary arterial hypertension with mesenchymal stem cells
CN105358163B (zh) * 2012-12-12 2020-09-11 麦瑟布莱斯特公司 内皮功能障碍和炎症的疾病的治疗
EP2943069B1 (en) * 2013-01-09 2018-08-15 United Therapeutics Corporation Treatment of vasculopathy with prostacyclin and mesenchymal stem cells

Patent Citations (17)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5139941A (en) 1985-10-31 1992-08-18 University Of Florida Research Foundation, Inc. AAV transduction vectors
WO1992001070A1 (en) 1990-07-09 1992-01-23 The United States Of America, As Represented By The Secretary, U.S. Department Of Commerce High efficiency packaging of mutant adeno-associated virus using amber suppressions
US5173414A (en) 1990-10-30 1992-12-22 Applied Immune Sciences, Inc. Production of recombinant adeno-associated virus vectors
WO1993003769A1 (en) 1991-08-20 1993-03-04 THE UNITED STATES OF AMERICA, represented by THE SECRETARY, DEPARTEMENT OF HEALTH AND HUMAN SERVICES Adenovirus mediated transfer of genes to the gastrointestinal tract
WO2001004268A1 (en) 1999-07-07 2001-01-18 Medvet Science Pty Ltd Mesenchymal precursor cell
WO2001014268A1 (de) 1999-08-21 2001-03-01 Schott Glas Skulltiegel für das erschmelzen oder das laütern von anorganischen substanzen, insbesondere von gläsern und glaskeramiken
WO2004084921A1 (en) 2003-03-28 2004-10-07 Angioblast Systems Incorporated Perivascular mesenchymal precursor cell induced blood vessel formation
WO2004085630A1 (en) 2003-03-28 2004-10-07 Angioblast Systems Incorporated Perivascular mesenchymal precursor cells
WO2006032092A1 (en) 2004-09-24 2006-03-30 Angioblast Systems, Inc. Multipotential expanded mesenchymal precursor cell progeny (memp) and uses thereof
WO2006108229A1 (en) 2005-04-12 2006-10-19 Angioblast Systems, Inc. Isolation of adult multipotential cells by tissue non-specific alkaline phosphatase
WO2006121445A2 (en) 2005-05-10 2006-11-16 United States Of America Department Of Veteran's Affairs Therapy of kidney diseases and multiorgan failure with mesenchymal stem cells and mesenchymal stem cell conditioned media
WO2010005527A1 (en) * 2008-06-30 2010-01-14 Angioblast Systems, Inc. Treatment of eye diseases and excessive neovascularization using a combined therapy
WO2010138180A2 (en) * 2009-05-26 2010-12-02 The University Of Vermont And State Agriculture College Compositions and methods for cardiac tissue repair
WO2012047733A2 (en) * 2010-09-29 2012-04-12 Aidan Research And Consulting, Llc. Treatment of acne by conditioned media
US9405700B2 (en) 2010-11-04 2016-08-02 Sonics, Inc. Methods and apparatus for virtualization in an integrated circuit
WO2012162754A1 (en) 2011-06-03 2012-12-06 Mesoblast, Inc Methods of treating or preventing neurological diseases
WO2013003899A1 (en) 2011-07-04 2013-01-10 Mesoblast, Inc Methods of treating or preventing rheumatic disease

Non-Patent Citations (90)

* Cited by examiner, † Cited by third party
Title
"Animal Cell Culture: Practical Approach", 2000
"DNA Cloning: A Practical Approach", vol. I and II, 1985, IRL PRESS
"Handbook of Experimental Immunology", vol. I-IV, 1986, BLACKWELL SCIENTIFIC PUBLICATIONS
"Immobilized Cells and Enzymes: A Practical Approach", 1986, IRL PRESS
"Methods In Enzymology", ACADEMIC PRESS, INC
"Nucleic Acid Hybridization: A Practical Approach", 1985, IRL PRESS
"Oligonucleotide Synthesis: A Practical Approach", 1984, IRL PRESS
"Pharmaceutical Dosage Forms: Disperse Systems", 1990, MARCEL DEKKER
"Pharmaceutical Dosage Forms: Parenteral Medications", 1993, MARCEL DEKKER
"Pharmaceutical Dosage Forms: Tablets", 1990, MARCEL DEKKER
"Remington's Pharmaceutical Sciences", 1980, MAC PUBLISHING COMPANY
"Synthese von Peptiden in Houben-Weyls Metoden der Organischen Chemie", vol. 15, 1974, THIEME
ADRIE C ET AL., CURR OPIN CRIT CARE., vol. 10, no. 3, June 2004 (2004-06-01), pages 208 - 12
AIM ET AL., BMC CARDIOVASCULAR DISORDERS, vol. 2, 2002, pages 8
AUSUBEL ET AL.: "Current Protocols in Molecular Biology", 1987, WILEY INTERSCIENCE
BALAKUMAR ET AL., TRENDS IN MEDICAL RESEARCH, vol. 2, 2007, pages 12 - 20
BARANY, G.; MERRIFIELD, R.B.: "The Peptides", vol. 2, 1979, ACADEMIC PRESS, pages: 1 - 284
BODANSZKY, M.: "Int. J. Peptide Protein Res.", vol. 25, 1985, pages: 449 - 474
BODANSZKY, M.: "Principles of Peptide Synthesis", 1984, SPRINGER-VERLAG
BODANSZKY, M.; BODANSZKY, A.: "The Practice of Peptide Synthesis", 1984, SPRINGER-VERLAG
BONFIELD ET AL., AM J PHYSIOL LUNG CELL MOL PHYSIOL, vol. 299, 2010, pages 760 - 770
BONFIELD T. L. ET AL.: "Human mesenchymal stem cells suppress chronic airway inflammation in the murine ovalbumin asthma model", AMERICAN JOURNAL OF PHYSIOLOGY LUNG CELLULAR AND MOLECULAR PHYSIOLOGY, vol. 299, 2010, pages L760 - L770, XP055138815 *
BUCHSCHER ET AL., J VIROL., vol. 56, 1992, pages 2731 - 2739
BURNS ET AL., PROC. NATL. ACAD. SCI USA, vol. 90, 1993, pages 8033 - 8037
CARTER, CURRENT OPINION IN BIOTECHNOLOGY, vol. 5, 1992, pages 533 - 539
CELENNAJER ET AL., LANCET, vol. 340, 1992, pages 1111 - 1115
CIMA ET AL., BIOTECHNOL. BIOENG., vol. 38, 1991, pages 145
DOBRIAN ET AL., HYPERTENSIVE, vol. 37, 2001, pages 554 - 560
EBERHARDT ET AL., J CLIN INVEST, vol. 106, 2000, pages 483 - 491
FISHER-HOCH ET AL., PROC. NATL ACAD. SCI. USA, vol. 56, 1989, pages 317 - 321
FRESHNEY, R. I.: "Culture of Animal Cells", 2000, WILEY-LISS
GENNARO: "Remington: The Science and Practice of Pharmacy", 2000, LIPPINCOTT, WILLIAMS, AND WILKINS
GHOSH ET AL., ARTHRITIS RESEARCH & THERAPY, vol. 12, no. R28, 2010, pages 1 - 17
GOKCE ET AL., AM COLL CARDIOL, vol. 41, 2003, pages 1769 - 1775
GONZALEZ ET AL., ARTHRITIS & RHEUMATISM, vol. 60, 2009, pages 1006 - 1019
GONZALEZ ET AL., GASTROENTEROLOGY, vol. 136, 2009, pages 978 - 989
GOULD, CIRCULATION, vol. 89, 1994, pages 1530 - 1538
GRIFFIN M P ET AL., PEDIATR RES., vol. 53, no. 6, June 2003 (2003-06-01), pages 920 - 6
GRONTHOS ET AL., BLOOD, vol. 85, 1995, pages 929 - 940
GRONTHOS ET AL., J CELL SCI., vol. 116, 2003, pages 1827 - 1835
GRONTHOS ET AL., J. BONE AND MIN. RES., vol. 14, 1999, pages 48 - 57
GRONTHOS ET AL., JOURNAL OF CELL SCIENCE, vol. 116, 2003, pages 1827 - 1835
GRONTHOS, S.; SIMMONS, P.J., BLOOD, vol. 85, 1995, pages 929 - 940
GRONTHOS; SIMMONS, BLOOD, vol. 85, 1995, pages 929 - 940
HARDMAN ET AL.: "Goodman and Gilman's The Pharmacological Basis of Therapeutics", 2001, MCGRAW-HILL
HOKANSON ET AL., IEEE TRANS BIOMED ENG, vol. 22, 1975, pages 25 - 29
J.F. RAMALHO ORTIGAO: "The Chemistry of Peptide Synthesis", KNOWLEDGE DATABASE OF ACCESS TO VIRTUAL LABORATORY WEBSITE (INTERACTIVA, GERMANY
JIN ET AL., INTERNATIONAL ORTHOPAEDICS, vol. 36, 2012, pages 2589 - 2596
JOHANN ET AL., J. VIROL., vol. 65, 1992, pages 1635 - 1640
KOTIN, HUMAN GENE THERAPY, vol. 5, 1994, pages 793 - 801
KUNG ET AL., HYPERTENSIVE, vol. 26, 1995, pages 744 - 751
LEBKOWSKI ET AL., MOLEC. CELL. BIOL., vol. 5, 1988, pages 3988 - 3996
MERRIFIELD, R.B., J. AM. CHEM. SOC., vol. 85, 1963, pages 2149 - 2154
MILLER ET AL., J. VIROL., vol. 65, 1991, pages 2220 - 2224
MILLER, A. D., HUMAN GENE THERAPY, vol. 7, 1990, pages 5 - 14
MILLER; ROSMAN, BIOTECHNIQUES, vol. 7, 1989, pages 980 - 990
MULVANY; HALPERN, CIRCULATION RES., vol. 41, 1977, pages 19 - 26
MUZYCZKA, CURRENT TOPICS IN MICROBIOL, AND IMMUNOL., vol. 158, 1992, pages 97 - 129
NYSTROM, JOURNAL OF ANTIMICROBIAL CHEMOTHERAPY, vol. 41, no. A, 1998, pages 1 - 7
PERBAL, B., A PRACTICAL GUIDE TO MOLECULAR CLONING, 1984
PILLAI ET AL., BLOOD, vol. 107, 2006, pages 3520 - 3526
POLLARD, J. W.; WALKER, J. M.: "Basic Cell Culture Protocols", 1997, HUMANA PRESS
RAJAGOPALAN ET AL., J. CLIN. INVEST., vol. 97, 1996, pages 1916 - 1923
REDDY, JAM COLL CARDIOL, vol. 23, 1994, pages 833 - 843
ROSS, NATURE, vol. 362, 1993, pages 801 - 9
SAKAKIBARA, D.; TEICHMAN, J.; LIEN, E.; LAND FENICHEL, R.L., BIOCHEM. BIOPHYS. RES. COMMUN., vol. 73, 1976, pages 336 - 342
SAMBROOK ET AL.: "Molecular Cloning: Molecular Cloning: A Laboratory Manual", 2001, COLD SPRING HARBOR LABORATORIES
SAMBROOK; FRITSCH; MANIATIS: "Molecular Cloning: A Laboratory Manual", vol. I, II, a, 1989, COLD SPRING HARBOR LABORATORIES
SCARPA ET AL., VIROLOGY, vol. 75, 1991, pages 849 - 852
SCHACHINGER ET AL., CIRCULATION, vol. 101, 2000, pages 1899 - 1906
SHAH; SINGH, MOL. CELL. BIOCHEM., vol. 283, 2006, pages 191 - 199
SHAH; SINGH, NAUN. SCHMIE. ARCH. PHARMACOL., vol. 373, 2006, pages 221 - 229
SHARE ET AL., CLIN. EXP. HYPERTENS., vol. 4, pages 1261 - 1270,2982
SHELLING; SMITH, GENE THERAPY, vol. 7, 1994, pages 165 - 169
SOMMERFELT ET AL., VIROI., vol. 76, 1990, pages 58 - 59
SVENTEK ET AL., HYPERTENSIVE, vol. 27, 1996, pages 49 - 55
THAKRE ET AL., IND. J. PHARMACOL., vol. 32, 2000, pages 15 - 20
TSUJI E ET AL., INT J CANCER, vol. 107, no. 2, 1 November 2003 (2003-11-01), pages 303 - 8
VACANTI ET AL., J. PED. SURG., vol. 23, 1988, pages 3 - 9
VACANTI ET AL., PLAST. RECONSTR. SURG., vol. 88, 1991, pages 753 - 9
VINCENT ET AL.: "Vaccines", vol. 90, 1990, COLD SPRING HARBOR LABORATORY PRESS
WASMUTH H E ET AL., J HEPATOL., vol. 42, no. 2, February 2005 (2005-02-01), pages 195 - 201
WEINER; KOTKOSKIE: "Excipient Toxicity and Safety", 2000, MARCEL DEKKER, INC.
WILSON ET AL., J. VIRAI., vol. 63, 1989, pages 274 - 2318
YAMAZA ET AL., STEM CELL RESEARCH & THERAPY, vol. 1, no. 5, 2010, pages 1 - 10
YAMAZA T. ET AL.: "Immunomodulatory properties of stem cells from human exfoliated deciduous teeth", STEM CELL RESEARCH AND THERAPY, vol. 1, 2010, XP021070886 *
YI ET AL., ARCH PHARMA RES, vol. 35, 2012, pages 213 - 221
ZANNETTINO, A.C. ET AL., BLOOD, vol. 92, 1998, pages 2613 - 2628
ZHOU ET AL., J EXP. MED., vol. 179, 1994, pages 1867 - 1875
ZWAVELING J H ET AL., CRIT CARE MED, vol. 24, no. 5, May 1996 (1996-05-01), pages 765 - 70

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9888679B2 (en) 2007-12-04 2018-02-13 Proteobioactives Pty Ltd Protection of progenitor cells and regulation of their differentiation
US10609922B2 (en) 2007-12-04 2020-04-07 Proteobioactives Pty Ltd Protection of progenitor cells and regulation of their differentiation

Also Published As

Publication number Publication date
JP2023030116A (ja) 2023-03-07
EP2931876A4 (en) 2016-05-25
CN105358163A (zh) 2016-02-24
AU2013360024A1 (en) 2015-07-02
JP7201715B2 (ja) 2023-01-10
AU2024227208A1 (en) 2024-10-31
AU2019202960B2 (en) 2021-07-29
JP2019214571A (ja) 2019-12-19
US20240115618A1 (en) 2024-04-11
EP2931876A1 (en) 2015-10-21
CN111840329B (zh) 2024-10-15
EP3556850A1 (en) 2019-10-23
KR20210021104A (ko) 2021-02-24
HK1210209A1 (en) 2016-04-15
ES2742035T3 (es) 2020-02-12
AU2013360024B2 (en) 2019-02-28
KR20150093732A (ko) 2015-08-18
AU2019202960A1 (en) 2019-05-16
SG11201504340YA (en) 2015-07-30
IL239308A0 (en) 2015-07-30
KR20220029758A (ko) 2022-03-08
US20160175360A1 (en) 2016-06-23
AU2021250848A1 (en) 2021-11-04
EP2931876B1 (en) 2019-05-29
KR102217962B1 (ko) 2021-02-22
JP2016504311A (ja) 2016-02-12
JP6572130B2 (ja) 2019-09-04
JP2021073240A (ja) 2021-05-13
JP2024147655A (ja) 2024-10-16
CA2893942C (en) 2023-03-28
CA2893942A1 (en) 2014-06-19
JP6829288B2 (ja) 2021-02-10
SG10201705061RA (en) 2017-07-28
CN105358163B (zh) 2020-09-11
KR102506612B1 (ko) 2023-03-06
CN111840329A (zh) 2020-10-30
KR102367981B1 (ko) 2022-02-25

Similar Documents

Publication Publication Date Title
US20240115618A1 (en) Treatment of diseases of endothelial dysfunction and inflammation
CN103079578B (zh) 治疗移植物抗宿主疾病的方法
EP2709634B1 (en) Methods for treating obesity and/or metabolic syndrome
HK40014520A (en) Treatment of diseases of endothelial dysfunction and inflammation
HK1210209B (en) Treatment of diseases of endothelial dysfunction and inflammation

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 201380072732.5

Country of ref document: CN

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 13862555

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2893942

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 14650172

Country of ref document: US

WWE Wipo information: entry into national phase

Ref document number: 239308

Country of ref document: IL

ENP Entry into the national phase

Ref document number: 2015546770

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 2013862555

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 20157017531

Country of ref document: KR

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2013360024

Country of ref document: AU

Date of ref document: 20131212

Kind code of ref document: A