WO2014062036A1 - Système d'acheminement de gènes pour la transformation de plantes à l'aide de virus de plantes, et utilisation - Google Patents

Système d'acheminement de gènes pour la transformation de plantes à l'aide de virus de plantes, et utilisation Download PDF

Info

Publication number
WO2014062036A1
WO2014062036A1 PCT/KR2013/009355 KR2013009355W WO2014062036A1 WO 2014062036 A1 WO2014062036 A1 WO 2014062036A1 KR 2013009355 W KR2013009355 W KR 2013009355W WO 2014062036 A1 WO2014062036 A1 WO 2014062036A1
Authority
WO
WIPO (PCT)
Prior art keywords
plant
gene
cassette
virus
expression vector
Prior art date
Application number
PCT/KR2013/009355
Other languages
English (en)
Inventor
Hanhong BAE
Hyoun-Sub Lim
Original Assignee
Industry-Academic Cooperation Foundation, Yeungnam University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Industry-Academic Cooperation Foundation, Yeungnam University filed Critical Industry-Academic Cooperation Foundation, Yeungnam University
Publication of WO2014062036A1 publication Critical patent/WO2014062036A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
    • C12N15/8202—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by biological means, e.g. cell mediated or natural vector
    • C12N15/8203—Virus mediated transformation
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
    • C12N15/8202—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by biological means, e.g. cell mediated or natural vector
    • C12N15/8205—Agrobacterium mediated transformation
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays
    • C12Q1/6827—Hybridisation assays for detection of mutation or polymorphism
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A40/00—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
    • Y02A40/10—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in agriculture
    • Y02A40/146—Genetically Modified [GMO] plants, e.g. transgenic plants

Definitions

  • the present disclosure relates to a gene delivery system for transformation of a plant using a plant virus and a use thereof, and more specifically, to a cassette for plant transformation having a polypurine tract, a left border (LB), a promoter, a multiple cloning site (MCS), a terminator, a right border (RB) and a tRNA Met binding sequence; a recombinant plant expression vector having a plant virus gene, and the cassette for plant transformation inserted into a non-coding region of the plant virus gene; a recombinant plant expression vector having a plant virus gene and a reverse transcriptase gene inserted into a random position between open reading frames (ORFs) of the plant virus gene; a method for manufacturing a transgenic plant by using the recombinant plant expression vector, wherein a target gene is inserted into the cassette for plant transformation, and the recombinant plant expression vector having a reverse transcriptase gene; a transgenic plant manufactured by the above method; and a seed thereof.
  • transformation is to make express new character since continuous replication is enabled and a foreign gene is expressed by forming an independent replicable unit (replicon) by introducing the foreign gene into another cell, or integrating the foreign gene by homologous recombination into the genome of the introduced cell.
  • replicon independent replicable unit
  • methods using a gene gun (particle bombardment) and an agrobacterium have been mainly used in the past, but due to high-cost and low-efficiency of the gene gun-mediated transformation method, the method using an agrobacterium is used more.
  • the transformation method using an agrobacterium can complete a transformant by tissue culture, but this is a method whose development takes too long, and may be succeed by only skilled researchers.
  • the above methods need a tissue culture facility for completing transformants and a greenhouse facility for cultivating regeneration plants, and it is difficult to be used by common researchers in terms of the cost. Further, there are defects that it is needed to be cautious regarding fungal contamination in young plants during tissue culture, and many labors are needed to be added.
  • the plant virus-based vector is a useful tool for effectively expressing a target protein in a plant.
  • the plant virus-based expression system is more advantageous than other methods for producing a recombinant protein The reason is that it is a method, which is cheaper and easier to cultivate than tissue culture, thereby directly applicable to a plant tissue culture, and wherein a foreign gene is rapidly expressed.
  • this system is suitable for temporarily expressing a foreign gene in a plant.
  • the present inventors provide an easy and quick gene delivery system using a plant virus, as a method for replacing the pre-existing transformation methods, and therefore, provide a technique enabled for manufacturing various crops, to which crops and useful characters adaptable to climatic and environmental change are introduced.
  • Korean Patent Registration No.1122955 discloses 'methods for overexpression of foreign genes in a plant using infectious clones of soybean mosaic virus'
  • Korean Patent Publication No.2006-0013000 discloses 'a plant expression vector containing BCTV replicon'.
  • a gene delivery system for transformation of plant using a plant virus and a use thereof, as described in the present disclosure.
  • the present disclosure is designed to solve the above demands. Therefore, the present disclosure was completed by developing a gene delivery system (GDS) cassette, which includes a polypurine tract, a left border (LB), a promoter, a multiple cloning site (MCS), a terminator, a right border (RB) and a tRNA Met binding sequence, and can be inserted into a plant virus gene; and confirming that a target gene inserted into a GDS cassette is integrated into a plant chromosome and expressed by using a recombinant plant expression vector including the GDS cassette and a reverse transcriptase inserted into the plant virus gene.
  • GDS gene delivery system
  • the present disclosure provides a cassette for plant transformation including a polypurine tract, a left border (LB), a promoter, a multiple cloning site (MCS), a terminator, a right border (RB) and a tRNA Met binding sequence, in the 5' to 3' direction.
  • a cassette for plant transformation including a polypurine tract, a left border (LB), a promoter, a multiple cloning site (MCS), a terminator, a right border (RB) and a tRNA Met binding sequence, in the 5' to 3' direction.
  • the present disclosure provides a recombinant plant expression vector including a plant virus gene and the cassette for plant transformation inserted into a non-coding region of the plant virus gene.
  • the present disclosure provides a recombinant plant expression vector including a plant virus gene and. a reverse transcriptase gene inserted into a random position between open reading frames (ORFs) of the plant virus gene.
  • ORFs open reading frames
  • the present disclosure provides a method for manufacturing a transgenic plant expressing a target gene, which includes:
  • RNA transcript by cutting the recombinant plant expression vector inserted with the target gene followed by conducting in vitro transcription
  • the present disclosure provides a method for manufacturing a transgenic plant expressing a target gene, which includes:
  • the present disclosure provides a transgenic plant manufactured by the above method, and a seed thereof.
  • the GDS cassette of the present disclosure is operable in various virus genes, and therefore, it is expected to produce various transgenic plants by using viral host plants.
  • Fig. 1 shows a cassette, in which a polypurine tract, a left border (LB), a promoter, a multiple cloning site (MCS), a terminator, a right border (RB) and a tRNA Met binding sequence are inserted from 5' to 3' direction.
  • Fig. 2 shows a vector having CaMV reverse transcriptase and [polypurine tract-LB-CaMV35S-MCS-NOSterRB-t et ] cassette.
  • Fig. 3 shows a polypurine tract as a transcription initiation sequence of the synthesized CaMV reverse transcriptase and a tRNA Met binding sequence.
  • Fig. 4 shows [LB-CaMV35S-MCS-NOS te r-RB] cassette inserted between a polypurine tract and a tRNA Met binding sequence.
  • Fig. 5 shows the result confirming whether eGFP cDNA is produced or not by inoculating an agrobacterium, which is transformed with PVX, i.e., eGFP-inserted RNA virus, and pCambia:CaMV RT, into a tobacco plant.
  • PVX i.e., eGFP-inserted RNA virus
  • pCambia:CaMV RT pCambia:CaMV RT
  • Fig. 6 shows the result confirming whether CaMV reverse transcriptase and a cassette gene is inserted or not by inoculating a vector, in which the CaMV reverse transcriptase is inserted between P1 and HC-Pro of SMV, and a SMV infectious clone inserted with [polypurine tract-LB-CaMV35S-MCS-NOSter-RB-tMet] cassette, into a plant.
  • Fig. 7 shows the result confirming that eGFP is expressed in Arabidopsis thalian by [polypurine tract-LB-CaMV35S-eGFP-NOS te rRB-t et ] cassette and CaMV reverse transcriptase inserted into alternanthera mosaic virus (AltMV) gene.
  • the present disclosure provides a cassette for plant transformation including a polypurine tract, a left border (LB), a promoter, a multiple cloning site (MCS), a terminator, a right border (RB) and a tRNA Met binding sequence from 5' to 3' direction.
  • a cassette for plant transformation including a polypurine tract, a left border (LB), a promoter, a multiple cloning site (MCS), a terminator, a right border (RB) and a tRNA Met binding sequence from 5' to 3' direction.
  • the cassette for plant transformation of the present disclosure refers to a DNA set to enable the expression of a protein desired to be expressed by transforming a plant
  • the cassette used in the present disclosure includes a DNA sequence consisting of a polypurine tract, a left border (LB), a promoter, a multiple cloning site (MCS) for target gene insertion, a terminator, a right border (RB) and a tRNA Met binding sequence.
  • the MCS is operably linked to the promoter.
  • the term "operably linked” refers to a functional connection between a promoter sequence and a target gene, which is inserted in a MCS controlled by the promoter sequence.
  • the operably linked promoter controls the expression of a polypeptide encoded by a target gene.
  • the polypurine tract is a ubiquitous nucleotide sequence appeared at some region of a genomic DNA, wherein purine bases are aligned at one DNA strand, and pyrimidine bases are aligned at the other DNA strand.
  • the polypurine tract reacts with a reverse transcriptase, thereby working as a transcription initiation sequence.
  • the polypurine tract may consist of the nucleotide sequence of SEQ ID NO. 1 , but not limited thereto. Further, homologues of the nucleotide sequence may be included within the scope of the present disclosure.
  • the homologues are nucleotide sequences, whose nucleotide sequence may be changed, but which have similar functional characteristics with the nucleotide sequence of SEQ ID NO. 1.
  • the genes may include a nucleotide sequence having sequence homology of at least 70%, more specifically, at least 80%, still more specifically, at least 90%, and most specifically, at least 95% with the nucleotide sequence of SEQ ID NO. 1 , respectively.
  • the "% of sequence homology" for a polynucleotide may be confirmed by comparing two nucleotide sequences that are optimally arranged with a region to be compared.
  • a part of the polynucleotide sequence in a region to be compared may include an addition or a deletion (i.e., gap) compared to a reference sequence (without any addition or deletion) relative to the optimized arrangement of the two sequences.
  • the Left border (LB) and the Right border (RB) used in the cassette for plant transformation of the present disclosure are located at the front/rear of MCS, where a target gene may be inserted, and make the target gene to be integrated to a plant genome.
  • the LB may consist of the nucleotide sequence of SEQ ID NO. 4, but not limited thereto, and homologues of the nucleotide sequence may be included within the scope of the present disclosure.
  • the RB may consist of the nucleotide sequence of SEQ ID NO. 5, but not limited thereto, and homologues of the nucleotide sequence may be included within the scope of the present disclosure.
  • the MCS indicates a DNA fragment having restriction sites, which are recognized by various restriction enzymes and cut, and therefore, it may be possible to insert a target gene into the MCS site, which is recognized and cut by a certain restriction enzyme.
  • the MCS may be any MCS known to those skilled in the art of the present disclosure, without limitation, and for example, it may be a DNA fragment including restriction enzyme sites of Mlu ⁇ , BamH ⁇ and Nhe ⁇ , but not limited thereto. It is also possible to add restriction enzyme sites, which may be commonly used in the art, other than the tree types of restriction enzyme sites described above to the MCS.
  • a restriction enzyme site which does not exist in a plant virus gene, may be used.
  • the sequences of the plant virus genes are different each other, and therefore, restriction enzyme sites in the MCS to be used may vary depending on the type of the plant virus.
  • the promoter may be a promoter suitable for transformation, and for example, CaMV 35S promoter, actin promoter, ubiquitin promoter, pEMU promoter, MAS promoter, histone promoter or Clp promoter, but not limited thereto.
  • the term “promoter” refers to a region of DNA located upstream of a structure gene, and it corresponds to a DNA molecule to which an RNA polymerase binds to initiate transcription.
  • plant promoter refers to a promoter that may initiate transcription in a plant cell.
  • the term “constitutive promoter” refers to a promoter that is active under most environmental conditions and cell growth or differentiation state. Since selection of a transformant may be made for various tissues at various stages, the constitutive promoter may be preferred for the present disclosure. Thus, selection possibility is not limited by the constitutive promoter.
  • the terminator may be any typical terminator, for example, nopalin synthase (NOS), rice a-amylase RAmyl A terminator, a terminator for Octopine gene of Agrobacterium tumefaciens, phaseoline terminator, rrnB1/B2 terminator of E. Coli and the like, but not limited thereto.
  • NOS nopalin synthase
  • rice a-amylase RAmyl A terminator a terminator for Octopine gene of Agrobacterium tumefaciens
  • phaseoline terminator phaseoline terminator
  • rrnB1/B2 terminator of E. Coli and the like but not limited thereto.
  • the necessity of terminator it is generally known that the terminator region may increase reliability and efficiency of gene transcription in plant cells. Therefore, the use of a terminator is highly preferable in view of the context of the present disclosure.
  • the tRNA Met binding sequence plays a role of a primer for a reverse transcriptase, thereby enabling cDNA synthesis by the reverse transcriptase.
  • the tRNA Met binding sequence may consist of the nucleotide sequence of SEQ ID NO. 2, but it may be the sequence, which may work as a primer for a reverse transcriptase, without limitation. Further, homologues of the nucleotide sequence may be included within the scope of the present disclosure.
  • the cassette for plant transformation may be the cassette shown in FIG. 1 , but not limited thereto.
  • the cassette for plant transformation may consist of the nucleotide sequence of SEQ ID NO. 3, but not limited thereto. Further, homologues of the nucleotide sequence may be included within the scope of the present disclosure.
  • the present disclosure provides a recombinant plant expression vector including a plant virus gene and the cassette for plant transformation inserted into a non-coding region of the plant virus gene.
  • the recombinant plant expression vector of the present disclosure including the cassette for plant transformation may further include a reverse transcriptase gene, which is inserted into a random position between open reading frames (ORFs) of the plant virus gene.
  • ORFs open reading frames
  • the present disclosure provides a recombinant plant expression vector including a plant virus gene and the reverse transcriptase gene, inserted into a random position between open reading frames (ORFs) of the plant virus gene.
  • ORFs open reading frames
  • the non-coding region of the plant virus gene, where the cassette for plant transformation is inserted is a region excluding a transcription regulation region, and specifically, it may be a 3' non-coding region, but not limited thereto.
  • the random position between ORFs of the plant virus, where the reverse transcriptase gene is inserted does not affect to the expression of viral proteins, and it is a region, where the reverse transcriptase may be expressed. Specifically, it may be located between a protease 1 (P1) coding gene and a virus infection specific donor (helper component/protease; HC-Pro) coding gene of a plant virus, but not limited thereto.
  • P1 protease 1
  • HC-Pro virus infection specific donor
  • the specific recombinant plant expression vector of the present disclosure may include a vector having a plant virus gene inserted with the cassette for plant transformation and a vector having the same plant virus gene inserted with a reverse transcriptase separately, or it may include a plant virus gene, the cassette for plant transformation inserted into a non-coding region of a plant virus gene and a reverse transcriptase gene inserted into a random position between ORFs of the plant virus gene in one vector.
  • the plant virus may be any plant virus, which may be infected into a host plant and proliferate therein, without limitation. Namely, the kind of the plant virus may differ depending on each host plant. Specifically, the plant virus may be soybean mosaic virus (SMV), or potato virus X (PVX) or alternanthera mosaic virus (AltMV) belongs to potexvirus, but not limited thereto.
  • recombinant indicates a cell which replicates a heterogeneous nucleotide or expresses the nucleotide, a peptide, a heterogeneous peptide, or a protein encoded by a heterogeneous nucleotide.
  • a recombinant cell may express a gene or a gene fragment in a form of a sense or antisense, which is not found in natural state of cell.
  • a recombinant cell can express a gene that is found in the natural state, but the gene may be modified and re-introduced into the cell by an artificial means.
  • the cassette for plant transformation or a reverse transcriptase gene sequence may be inserted into a recombinant vector.
  • vector is used herein to refer DNA fragment(s) and nucleotide molecules that are delivered to a cell.
  • the vector may replicate DNA, and be independently reproduced in a host cell.
  • delivery system and the term “vector” are often interchangeably used.
  • the recombinant vector indicates bacterial plasmid, phage, yeast plasmid, plant cell virus, mammalian cell viral vector, or other vectors. In general, random plasmid and vector may be used if they may be replicated and stabilized in a host.
  • An important characteristic of the expression vector is having an origin of replication, a promoter, a marker gene and a translation control element.
  • the expression vector which includes each sequence and proper transcription/translation regulation signal of the cassette for plant transformation or the reverse transcriptase gene, may be constructed by a method known to those skilled in the art.
  • the method may include in vitro recombinant DNA technique, DNA synthesis technique, in vivo recombination technique and the like.
  • the DNA sequence may be effectively linked to a proper promoter in the expression vector, in order to lead mRNA synthesis.
  • the expression vector may include a ribosome binding site and a transcription terminator as a translation initiation site.
  • a specific example of the recombinant vector of the present disclosure may be Ti-plasmid vector which may transfer a part of itself, i.e., so-called T-region, to a plant cell when the vector is present in an appropriate host such as Agrobacterium tumefaciens.
  • Other types of the Ti-plasmid vector are currently used for transferring a hybrid DNA sequence to a plant cell or protoplasts that may produce a new plant by appropriately inserting hybrid DNA into a plant genome.
  • Another specific form of the Ti-plasmid vector is a so-called binary vector which has been disclosed in EP 0 120 516 B 1 and U.S. Pat. No. 4,940,838.
  • the binary vector which may be used in the present disclosure, may be any binary vector including a RB and LB of a T-DNA, which may transform a plant when existing with the Ti plasmid of agrobacterium tumefaciens, and specifically, it may be pBI101 (Cat#: 6018-1 , clontech, USA), pBIN19 (Genbank Accession No. U09365), pBI121 , pCAMBIA vector and the like, which is often used in the art.
  • CaMV double-stranded plant virus
  • a single-stranded virus for example, a viral vectors, which may be derived from Gemini virus and the like, for example, a non-complete plant viral vector.
  • Use of the vector may be especially advantageous when it is difficult to properly transform a plant host.
  • the promoter may be a promoter suitable for in vitro transcription or transformation, and specifically, it may be T7 promoter, SP6 promoter, CaMV 35S promoter, actin promoter, ubiquitin promoter, pEMU promoter, MAS promoter, histone promoter or Clp promoter, more specifically, T7 promoter, SP6 promoter or CaMV 35S promoter, but not limited thereto.
  • the terminator may be any typical terminator increasing a reliability and an efficiency of gene transcription in plant cells, for example, nopalin synthase (NOS), rice a-amylase RAmyl A terminator, a terminator for Octopine gene of Agrobacterium tumefaciens, phaseoline terminator, rrnB1/B2 terminator of E.Coli and the like, but not limited thereto.
  • NOS nopalin synthase
  • rice a-amylase RAmyl A terminator a terminator for Octopine gene of Agrobacterium tumefaciens
  • phaseoline terminator phaseoline terminator
  • rrnB1/B2 terminator of E.Coli and the like, but not limited thereto.
  • the recombinant vector may include at least one selection marker.
  • the marker is a nucleotide sequence having a property which allows a selection based on a common chemical method, and it may be any kind of gene that may be used for distinguishing transformed cells from non-transformed cells.
  • it may be a gene resistant to herbicide such as glyphosate and phosphinotricin, and a gene resistant to antibiotics such as kanamycin, hygromycin, chloramphenicol, G418 and bleomycin, but not limited thereto.
  • the present disclosure provides a method for manufacturing a transgenic plant expressing a target gene, which includes:
  • RNA transcript by cutting the target gene-inserted recombinant plant expression vector followed by conducting in vitro transcription; a step of inoculating the RNA transcript into a plant;
  • the in vitro transcription for manufacturing the RNA transcript may use, for example, T7 RNA polymerase, but not limited thereto.
  • the present disclosure provides a method for manufacturing a transgenic plant expressing a target gene, which includes:
  • the target gene which may be introduced into the vector of the present disclosure.
  • a reporter gene, enhanced green fluorescent protein (eGFP) gene is used instead of the target gene.
  • the GFP may be observed through green fluorescence by long wavelength UV irradiation, and therefore, it may be very useful for confirming the transformed plant.
  • the method for manufacturing a transgenic plant of the present disclosure may be a method for transforming a vector including a plant virus gene inserted with the cassette for plant transformation and a vector including the same plant virus gene inserted with a reverse transcriptase, respectively, or a method for transforming one vector including a plant virus gene, the cassette for plant transformation inserted into a non-coding region of the plant virus gene and a reverse transcriptase gene inserted into a random position between ORFs of the plant virus gene.
  • a target gene to be expressed is inserted into a MCS of the recombinant plant expression vector, the target gene- inserted recombinant plant expression vector is cut, in vitro transcription is conducted to prepare a RNA transcript, and then the RNA transcript is inoculated into a plant.
  • the recombinant plant expression vector including a plant virus gene, and a reverse transcriptase gene inserted into a random position between open reading frames (ORFs) of the plant virus gene is transformed into an agrobacterium, the transformed agrobacterium is inoculated into the RNA transcript-inoculated plant, and thereby, the produced reverse transcriptase synthesizes cDNA by using a tRNA Met binding sequence existing in the RNA transcript as a primer.
  • the synthesized cDNA includes a LB and a RB. Accordingly, the LB and the RB insert a sequence containing the target gene between the LB and the RB into a chromosome of a plant, and thereby, the target gene may be transformed into the plant.
  • the reverse transcriptase gene may be included in a separate recombinant plant expression vector, and may be also inserted into the recombinant plant expression vector inserted with the cassette for plant transformation of the present disclosure.
  • the method transforming a plant by using the recombinant plant expression vector of the present disclosure includes a step of inserting a target gene to be expressed into a MCS of the recombinant plant expression vector, a step of transforming an agrobacterium with the target gene-inserted recombinant plant expression vector, and a step of inoculating the transformed agrobacterium into a plant.
  • the plant virus may be a plant virus, which may infect a host plant and proliferate therein, and specifically, it may be any plant virus, which may infect a plant to be transformed and proliferate therein, without limitation. Specifically, it may be soybean mosaic virus (SMV), or potato virus X (PVX) or alternanthera mosaic virus (AltMV) belongs to potexvirus, but not limited thereto.
  • SMV soybean mosaic virus
  • PVX potato virus X
  • AltMV alternanthera mosaic virus
  • the method for manufacturing a transgenic plant of the present disclosure may be conducted by inoculating an agrobacterium including the RNA transcript of the target gene-inserted cassette for plant transformation and the reverse transcriptase gene-inserted recombinant plant expression vector, into a mature plant, or by inoculating an agrobacterium including the recombinant plant expression vector, to which the reverse transcriptase gene- and the target gene-inserted cassette for plant transformation is inserted, into a mature plant.
  • this method does not need tissue culture of a plant cell, and therefore, it does not need a step of regenerating a transformed plant from the plant cell.
  • the present disclosure provides a transgenic plant manufactured by the above method and a seed thereof.
  • the plant may be a dicotyledon or a monocotyledon, and it may be any host plant, to which a plant virus may infect, and in which the virus may proliferate, without limitation.
  • the plant may be: food crops selected from the group consisting of rice, wheat, barley, corn, soybean, potato, red bean, oats and millet; vegetable crops selected from the group consisting of Arabidopsis thalian, Chinese cabbage, radish, pepper, strawberry, tomato, water melon, cucumber, cabbage, oriental melon, pumpkin, Welsh onion, onion and carrot; specialty crops selected from the group consisting of ginseng, tobacco, cotton, sesame, sugarcane, sugar beet, perilla, peanut and canola; fruit trees selected from the group consisting of apple tree, pear tree, jujube tree, peach, kiwi, grape, tangerine, persimmon, plum, apricot and banana; flowering plants selected from the group consisting of
  • GDS vectors are manufactured by using reverse transcriptases of soybean mosaic virus (SMV) for bean transformation, and potexvirus (PVX), alternanthera mosaic virus (AltMV) and cauliflower mosaic virus (CaMV) for vegetable transformation.
  • SMV soybean mosaic virus
  • PVX potexvirus
  • AltMV alternanthera mosaic virus
  • CaMV cauliflower mosaic virus
  • a double-strand is formed by treating synthetic oligomers, Poly-P- Top (SEQ ID NO. 6) and Poly-P-Bottom (SEQ ID NO. 7), at 95°C for 5 min followed by maintaining at room temperature for 10 min, and after adding Nco ⁇ sites (nullified) to the 5' and 3' ends, inserted into the Nco ⁇ site of pUC-ALMCS vector.
  • the inserted nucleotide sequence is confirmed, and it is named pUC-AI-RT-ln (FIG. 3).
  • CaMV reverse transcriptase is amplified with pGD-RT-Mlul-F (SEQ ID NO. 8) and pGD-RT-Xmal-R (SEQ ID NO. 9) primers, and then cloned into a pCAMBIA binary vector, thereby pCambia:CaMV RT is produced.
  • eGFP is amplified with eGFP-BamHI-F (SEQ ID NO. 10) and eGFP-Mlul-R (SEQ ID NO. 11), inserted between the polypurine tract and the tRNA Met binding sequence of pUC-AI-RT-lnrine tract, and then cloned into a potexvirus, PVX (FIG. 5).
  • the PVX the eGFP-inserted RNA virus
  • an agrobacterium transformed with pCambia:CaMV RT is inoculated thereinto by agroinfiltration method.
  • DNA is extracted from a plant, all RNA is removed with RNase, and then PCR is conducted by using the eGFP primers.
  • the eGFP is amplified at the DNA extracted from the plant, treated with the eGFP-inserted PVX and the pCambia:CaMV RT, but it is not amplified at a control group not treated with the pCambia:CaMV RT (FIG.
  • the eGFP is transcribed as only RNA, but the eGFP, inserted between the polypurine tract as a CaMV reverse transcriptase transcription initiation sequence and the tRNA Met binding sequence, is converted to cDNA by means of the CaMV reverse transcriptase. It is confirmed that the polypurine tract synthesized through the above process is a structure enabling reverse transcription.
  • Example 2 Manufacture of Cassette for Plant Transformation and Vector After confirming that the CaMV reverse transcriptase is reacted with the polypurine tract, a vector including the cassette, in which a left border (LB), CaMV35S promoter, a multiple cloning site (MCS), NOS terminator and a right border (RB) [LB-CaMV35S-MCS-NOSter-RB] sequences are inserted between the polypurine tract and the tRNA Met binding sequence, is manufactured.
  • LB left border
  • MCS multiple cloning site
  • NOS terminator NOS terminator
  • RB right border
  • a GDS vector designed for inserting a target gene, which is converted to cDNA by using a plant virus delivering a target gene to a nucleus of a plant cell and CaMV reverse transcriptase, into a chromosome of a plant cell is produced by inserting the LB (TGGTGGCAGGATATATTGTGGTGTAAACAA: SEQ ID NO. 4) and the RB (GTAAACCTAAGAGAAAAGAGCGTTAT: SEQ ID NO. 5) sequences at the front/rear of the MCS for cloning the target gene, respectively. Further, for the stable expression of the target gene, the CaMV35S promoter and the NOS terminator sequences are added (FIG. 1).
  • a region from the LB to the RB of the binary vector is amplified by using Mlu-F-LB (SEQ ID NO. 12) and Nhel-R-RB (SEQ ID NO. 13) primers, and it is cloned to pUC-AI-RT-ln (FIG. 3) to produce pUC-LB-MCS-RB (FIG. 4).
  • MCS Mlu-F-LB
  • Nhel-R-RB SEQ ID NO. 13
  • the produced GDS vector includes the cassette, to which the polypurine tract as a CaMV reverse transcriptase transcription initiation sequence, LB, CaMV35S promoter, MCS, NOS terminator, RB and tRNA Met binding sequence working as a primer of the CaMV reverse transcriptase [polypurine tract-LB-CaMV35S-MCS- NOS t er-RB-t Met ] are inserted (FIG. 1 ).
  • the cassette sequence is in the size of about 1.3 kb, and is manufactured for being inserted to potexvirus or alternanthera mosaic virus (AltMV) and the like as well as soybean mosaic virus (SMV), so as to be applied to various crops.
  • a SMV GDS vector is manufactured by using a SMV infectious clone.
  • the CaMV reverse transcriptase is amplified with SMV-Mlul-F- RT (SEQ ID NO. 14) and SMV-Mlul-R-RT (SEQ ID NO. 15) primers.
  • SMV-Mlul-F- RT SEQ ID NO. 14
  • SMV-Mlul-R-RT SEQ ID NO. 15
  • RNA virus produces polyprotein, and the polyprotein is converted to a functional protein after the virus protease cut the polyprotein, a SMV protease recognition amino acid, Threonine-Arginine sequence is involved to the CaMV reverse transcriptase inserted between the P1 and the HC-Pro.
  • the [polypurine tract-LB-CaMV35S-MCS-NOS te rRB-t Met ] cassette is amplified with SMV-LB-Xbal-F (SEQ ID NO. 16) and SMV-RB-Xbal-R (SEQ ID NO. 17) primers, inserted at the Xba ⁇ site of the 3' non-coding region of the SMV, and then cloned into a pTOP V2 vector.
  • the CaMV35S promoter of the pTOP V2 vector is removed, and replaced with a T7 promoter (SMV-LB-MCS-RB, FIG. 2).
  • the manufactured SMV-CaMV-RT and SMV-LB-MCS-RB are inoculated to Jack cultivar in the forms of plasmid DNA and RNA transcript, respectively, and then the viral symptom and the expression of the inserted gene are confirmed (FIG. 6). This proves that a reverse transcriptase is expressed in a virus, and it also proves that the LB-CaMV35S-MCS-NOSter-RB is operable in a plant virus.
  • Example 4 Manufacture of GDS Vector for Arabidopsis thalian Using AltMV
  • Arabidopsis thalian a GDS vector, wherein the [polypurine tract-LB-CaMV35S-MCS-NOSter-RB- tMet] cassette is inserted into alternanthera mosaic virus (AltMV) gene (GenBank No.
  • GQ 179646 using various vegetables as a host plant, is manufactured.
  • the [polypurine tract-LB-CaMV35S-MCS-NOSter-RB-tMet] cassette sequence is amplified with AltMV-LB-Ncol (SEQ ID NO. 18) and AltMV-RB-Ncol
  • eGFP is amplified with LB-eGFP-Xhol-F (SEQ ID NO. 20) and RB-eGFP-BamHI-R (SEQ ID NO. 21) primers, and then cloned to the Xho ⁇ and BamHl sites of the MCS to manufacture pUC-LB-eGFP-RB finally.
  • LB-eGFP-RB is amplified with AltMV-LB- Mlul-F (SEQ ID NO. 22) and AltMV-RB-Ncol (SEQ ID NO. 23) primers, and then cloned to the Nco ⁇ and Mlu ⁇ sites of pGD-AltMV-MCS.
  • AltMV-LB- Mlul-F SEQ ID NO. 22
  • AltMV-RB-Ncol SEQ ID NO. 23
  • RNA transcript is inoculated into Arabidopsis thalian. Two weeks later, the CaMV RT is expressed in a leaf, where symptoms are appeared, by agroinfiltration method.
  • the eGFP expression in the Arabidopsis thalian leaf is confirmed by using a fluorescence microscope (FIG. 7). This result proves that the [polypurine tract-LB-CaMV35S-MCS-NOSter-RB-tMet] cassette is inserted to a chromosome of a cell of the Arabidopsis thalian leaf.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Chemical & Material Sciences (AREA)
  • Biotechnology (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Cell Biology (AREA)
  • Plant Pathology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Immunology (AREA)
  • Analytical Chemistry (AREA)
  • Virology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)

Abstract

L'invention concerne un système d'acheminement de gènes pour la transformation de plantes à l'aide de virus de plantes, et l'utilisation de celui-ci. Il est possible de transformer une plante facilement et rapidement sans culture de tissus en utilisant un vecteur d'expression recombinant de plante selon a présente invention, qui comprend une cassette GDS et une transcriptase inverse insérées dans un gène de virus de plante. La cassette GDS de la présente invention peut en outre fonctionner dans différents gènes de virus, et il est ainsi possible de produire des transformants de diverses plantes hôtes pouvant être infectées par virus.
PCT/KR2013/009355 2012-10-19 2013-10-18 Système d'acheminement de gènes pour la transformation de plantes à l'aide de virus de plantes, et utilisation WO2014062036A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020120116415A KR101554678B1 (ko) 2012-10-19 2012-10-19 식물 바이러스를 이용한 식물체 형질전환을 위한 유전자 전달 시스템 및 이의 용도
KR10-2012-0116415 2012-10-19

Publications (1)

Publication Number Publication Date
WO2014062036A1 true WO2014062036A1 (fr) 2014-04-24

Family

ID=50488519

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2013/009355 WO2014062036A1 (fr) 2012-10-19 2013-10-18 Système d'acheminement de gènes pour la transformation de plantes à l'aide de virus de plantes, et utilisation

Country Status (2)

Country Link
KR (1) KR101554678B1 (fr)
WO (1) WO2014062036A1 (fr)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112011552A (zh) * 2020-08-27 2020-12-01 鲁东大学 微型月季次生发育关键基因RhSND2的克隆及表达载体的构建方法
US11180770B2 (en) 2017-03-07 2021-11-23 BASF Agricultural Solutions Seed US LLC HPPD variants and methods of use
US11371056B2 (en) 2017-03-07 2022-06-28 BASF Agricultural Solutions Seed US LLC HPPD variants and methods of use
US11926817B2 (en) 2019-08-09 2024-03-12 Nutcracker Therapeutics, Inc. Microfluidic apparatus and methods of use thereof
US12060562B2 (en) 2017-05-31 2024-08-13 University Of Tsukuba Protein expression system in plant cell and use thereof

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5850023A (en) * 1992-11-30 1998-12-15 Monsanto Company Modified plant viral replicase genes
US20050048652A1 (en) * 2003-08-19 2005-03-03 Iowa State University Research Foundation, Inc. Retroelement vector system for amplification and delivery of nucleotide sequences in plants
WO2005087926A2 (fr) * 2004-03-05 2005-09-22 Benitec, Inc. Cassettes d'expression de promoteurs multiples assurant l'apport simultane d'agents arni
WO2010045002A2 (fr) * 2008-09-26 2010-04-22 Tocagen Inc. Vecteurs de thérapie génique et cytosines déaminases
EP2036984B1 (fr) * 2002-07-26 2012-02-22 BASF Plant Science GmbH Reversion de l'effet sélectif négatif d'un protéin de marquage comme procédure de sélection

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB9621680D0 (en) 1996-10-17 1996-12-11 Oxford Biomedica Ltd Lentiviral vectors

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5850023A (en) * 1992-11-30 1998-12-15 Monsanto Company Modified plant viral replicase genes
EP2036984B1 (fr) * 2002-07-26 2012-02-22 BASF Plant Science GmbH Reversion de l'effet sélectif négatif d'un protéin de marquage comme procédure de sélection
US20050048652A1 (en) * 2003-08-19 2005-03-03 Iowa State University Research Foundation, Inc. Retroelement vector system for amplification and delivery of nucleotide sequences in plants
WO2005087926A2 (fr) * 2004-03-05 2005-09-22 Benitec, Inc. Cassettes d'expression de promoteurs multiples assurant l'apport simultane d'agents arni
WO2010045002A2 (fr) * 2008-09-26 2010-04-22 Tocagen Inc. Vecteurs de thérapie génique et cytosines déaminases

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11180770B2 (en) 2017-03-07 2021-11-23 BASF Agricultural Solutions Seed US LLC HPPD variants and methods of use
US11371056B2 (en) 2017-03-07 2022-06-28 BASF Agricultural Solutions Seed US LLC HPPD variants and methods of use
US12060562B2 (en) 2017-05-31 2024-08-13 University Of Tsukuba Protein expression system in plant cell and use thereof
US11926817B2 (en) 2019-08-09 2024-03-12 Nutcracker Therapeutics, Inc. Microfluidic apparatus and methods of use thereof
CN112011552A (zh) * 2020-08-27 2020-12-01 鲁东大学 微型月季次生发育关键基因RhSND2的克隆及表达载体的构建方法

Also Published As

Publication number Publication date
KR20140050262A (ko) 2014-04-29
KR101554678B1 (ko) 2015-09-21

Similar Documents

Publication Publication Date Title
CN110452291B (zh) 铁皮石斛胚胎发育晚期丰富蛋白DoLEA43在促进植物愈伤组织形成中的应用
WO2014062036A1 (fr) Système d'acheminement de gènes pour la transformation de plantes à l'aide de virus de plantes, et utilisation
US10041086B2 (en) Method for production of transgenic cotton plants
AU2010211450B2 (en) Plant transformation using DNA minicircles
US20090210969A1 (en) Antiporter gene from porteresia coarctata for conferring stress tolerance
US12077767B2 (en) Altering thermoresponsive growth in plants via genome editing of phytochrome interacting factor 4 (PIF4) regulatory elements
US10626406B2 (en) Method for plant improvement
CN105713079A (zh) 蛋白质及其相关生物材料在提高植物产量中的应用
JP6202832B2 (ja) 高い種子収量性を有する環境ストレス耐性植物及びその作製方法
CN115960954A (zh) Rna干扰载体及其在诱导双子叶植物基因沉默中的应用
EP3144381A1 (fr) Procédé de préparation d'agrobacterium et de plante transgénique à l'aide de cet agrobacterium
CA3157615A1 (fr) Elements regulateurs a base de glycine et leurs utilisations
CN107177602B (zh) 与植物耐旱相关的NtDR1基因及其应用
US20050048652A1 (en) Retroelement vector system for amplification and delivery of nucleotide sequences in plants
CA2359356A1 (fr) Systeme de mise au silence de l'expression et ses differentes utilisations
KR100927803B1 (ko) 식물 형질전환체를 선별하기 위한 마커로서 ｇｐｔ 유전자
KR102583332B1 (ko) 셀룰로오스 합성 유전자 Solyc07g043390이 과발현된 토마토 황화잎말림 바이러스병에 대한 내성이 증진된 형질전환 식물체
WO2024106203A1 (fr) Système d'amplification d'adn dans une cellule végétale
CN102146410A (zh) 一种启动子BgIosP526及其制备方法和用途
KR102025257B1 (ko) 벼 유래의 v p 유전자의 수확량 및 환경 스트레스 조절자로서의 용도
JP4474542B2 (ja) 構成的発現プロモーター
JP4505628B2 (ja) 葉特異的発現活性を有するプロモーター
KR101478113B1 (ko) 콩에서 유용 유전자의 기능 분석을 위한 ｓｙｃｍｖ 유래의 재조합 ｖｉｇｓ 벡터 및 이의 용도
CN102146405B (zh) 一种启动子BgIosP529及其制备方法和用途
US20050268351A1 (en) Modulation of storage organs

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 13847230

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 13847230

Country of ref document: EP

Kind code of ref document: A1