WO2014043696A2 - Compositions and methods for treating amyotrophic lateral sclerosis - Google Patents
Compositions and methods for treating amyotrophic lateral sclerosis Download PDFInfo
- Publication number
- WO2014043696A2 WO2014043696A2 PCT/US2013/060153 US2013060153W WO2014043696A2 WO 2014043696 A2 WO2014043696 A2 WO 2014043696A2 US 2013060153 W US2013060153 W US 2013060153W WO 2014043696 A2 WO2014043696 A2 WO 2014043696A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- astrocytes
- expression
- patient
- compound
- gzmb
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- A61K38/177—Receptors; Cell surface antigens; Cell surface determinants
- A61K38/1774—Immunoglobulin superfamily (e.g. CD2, CD4, CD8, ICAM molecules, B7 molecules, Fc-receptors, MHC-molecules)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
- A61K31/7105—Natural ribonucleic acids, i.e. containing only riboses attached to adenine, guanine, cytosine or uracil and having 3'-5' phosphodiester links
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/04—Peptides having up to 20 amino acids in a fully defined sequence; Derivatives thereof
- A61K38/10—Peptides having 12 to 20 amino acids
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
- A61K48/005—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P21/00—Drugs for disorders of the muscular or neuromuscular system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
- C07K14/70503—Immunoglobulin superfamily
- C07K14/70539—MHC-molecules, e.g. HLA-molecules
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1137—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1138—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against receptors or cell surface proteins
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y304/00—Hydrolases acting on peptide bonds, i.e. peptidases (3.4)
- C12Y304/21—Serine endopeptidases (3.4.21)
- C12Y304/21079—Granzyme B (3.4.21.79)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering nucleic acids [NA]
Definitions
- the invention relates to compositions, kits, methods, and uses for the treatment of amyotrophic lateral sclerosis.
- the invention relates to compositions, kits, methods, and uses for the treatment of amyotrophic lateral sclerosis by decreasing the expression of a cytoplasmic granule toxin in the astrocytes of a patient, or by increasing the expression of MHC class I in motor neurons of the patient.
- Amyotrophic lateral sclerosis commonly referred to as Lou Gehrig's disease, is characterized by selective, premature degeneration and death of motor neurons in the motor cortex, brain stem and spinal cord. The loss of motor neurons causes progressive muscle paralysis ultimately leading to death from respiratory failure. Approximately 90% of all amyotrophic lateral sclerosis cases are sporadic amyotrophic lateral sclerosis, without a family history of the disease, and the other approximately 10% of cases are cases of familial amyotrophic lateral sclerosis. Despite significant efforts to identify risk factors and potential susceptibility genes, the etiology of sporadic amyotrophic lateral sclerosis remains largely unknown.
- the present inventors have discovered the mechanism underlying the acquisition of this toxic function by amyotrophic lateral sclerosis astrocytes, and have used this knowledge to develop therapies for amyotrophic lateral sclerosis.
- the pharmaceutical compositions, methods and uses, and kits described herein can be used to treat sporadic or familial amyotrophic lateral sclerosis.
- a method for treating a patient with amyotrophic lateral sclerosis by decreasing the expression of a cytoplasmic granule toxin in astrocytes of the patient comprising the step of
- composition comprising an effective amount of a compound that decreases the expression the cytoplasmic granule toxin in the astrocytes of the patient.
- nucleic acid is selected from the group consisting of an siRNA, an miRNA, and an shRNA.
- nucleic acid is an shRNA.
- composition comprises a pharmaceutically acceptable carrier, wherein the pharmaceutically acceptable carrier is a liquid carrier.
- liquid carrier is selected from the group consisting of saline, glucose, alcohols, glycols, esters, amides, and a combination thereof.
- a method for treating amyotrophic lateral sclerosis by increasing MHC class I expression in motor neurons of a patient comprising the step of
- composition comprising an effective amount of a compound that increases the expression of MHC class I in the motor neurons of the patient.
- composition further comprises a carrier, an excipient, or a diluent, or a combination thereof.
- composition comprises a pharmaceutically acceptable carrier, wherein the pharmaceutically acceptable carrier is a liquid carrier.
- liquid carrier is selected from the group consisting of saline, glucose, alcohols, glycols, esters, amides, and a combination thereof.
- a pharmaceutical composition comprising a dosage form of a compound effective to decrease the expression a cytoplasmic granule toxin in the astrocytes of a patient with amyotrophic lateral sclerosis.
- composition of clause 42 wherein the compound is selected from the group consisting of a drug, a peptide, and a nucleic acid.
- composition of clause 44 wherein the nucleic acid is selected from the group consisting of siRNA, an miRNA, and an shRNA.
- composition of clause 44 wherein the compound is an antisense RNA molecule.
- composition of clause 50 wherein the composition comprises a pharmaceutically acceptable carrier, wherein the pharmaceutically acceptable carrier is a liquid carrier.
- composition of clause 51 wherein the liquid carrier is selected from the group consisting of saline, glucose, alcohols, glycols, esters, amides, and a combination thereof.
- composition of any one of clauses 42 to 52 wherein the purity of the compound is at least 98% based on weight percent.
- composition of any one of clauses 42 to 50 or 53 to 54 in the form of a reconstitutable lyophilizate
- a pharmaceutical composition comprising a dosage form of a compound effective to increase the expression of MHC class I in the motor neurons of a patient with amyotrophic lateral sclerosis.
- composition of clause 56 wherein the compound is selected from the group consisting of a drug, a peptide, and a nucleic acid.
- composition of clause 56 wherein the compound is a nucleic acid.
- nucleic acid has the sequence of SEQ ID NO: 3.
- composition of clause 60 wherein the composition comprises a pharmaceutically acceptable carrier, wherein the pharmaceutically acceptable carrier is a liquid carrier.
- composition of clause 61 wherein the liquid carrier is selected from the group consisting of saline, glucose, alcohols, glycols, esters, amides, and a combination thereof.
- composition of any one of clauses 56 to 60 or 63 to 64 in the form of a reconstitutable lyophilizate is provided.
- parenteral dosage form is selected from the group consisting of an intradermal dosage form, a subcutaneous dosage form, an intramuscular dosage form, an intraperitoneal dosage form, an intravenous dosage form, and an intrathecal dosage form.
- kits comprising a sterile vial, the composition of any one of clauses 56 to 69, and instructions for use describing use of the composition for treating a patient with amyotrophic lateral sclerosis.
- kits of clause 74 wherein the parenteral dosage form is selected from the group consisting of an intradermal dosage form, a subcutaneous dosage form, an
- intramuscular dosage form an intraperitoneal dosage form, an intravenous dosage form, and an intrathecal dosage form.
- the pharmaceutically acceptable carrier is a liquid carrier selected from the group consisting of saline, glucose, alcohols, glycols, esters, amides, and a combination thereof.
- FIGURE 1 (A) Western blot analysis reveals perforin (PRFl) and granzyme B (GZMB) expression in spinal cord of wild type and Sodl G93A mice. (B) Expression of both PRFl and GZMB is observed in astrocytes but not in microglia. (C) Increased co-localization of PRFl and GZMB in Sodl 09 ⁇ astrocytes upon co-culture with MNs. Scale bars represent 5 ⁇ . (D) Increased co-localization of PRFl and GZMB in Sodl 093 A astrocytes upon co-culture in spinal cords from Sodl G93A mice. Scale bars represent 200 ⁇ .
- PRFl perforin
- GZMB granzyme B
- FIGURE 2 (A) PRFl and GZMB are seen in MNs as early as 24 hours upon co-culture with S0D1 G93A astrocytes. PRFl and GZMB incidence in MNs co-cultured with S0D1 G93A astrocytes gradually increase with time but remain absent in MNs co-cultured with wild- type astrocytes. PRFl is shown in red, GZMB is shown in green, Hb9-GFP is shown in blue. p ⁇ 0.001. Scale bar represents 5 ⁇ . (B) Three dimensional confocal image generated from Figure 2A shows that multimer perforin pore-like structures extend from the surface of Sodl G93A astrocytes into the cytoplasm of MNs.
- PRFl is shown in red; Hb9-GFP + is shown in green; EAAT2 is shown in blue.
- C In Sodl 09 ⁇ mice, PRFl and GZMB are commonly found. PRFl is shown in red; GZMB is shown in green; ChAT is shown in blue. Scale bars represent 50 ⁇ .
- D In Sodl G93 mice, PRFl and GZMB can be detected in MNs. PRFl is shown in red; GZMB is shown in green; ChAT is shown in blue.
- E The level of degranularization as evaluated by expression of the lysosomal-associated membrane protein, CD107A, increases with disease progression in the spinal cord of Sodl 09 ⁇ mice.
- CD107A is shown in red; EAAT2 is shown in green; ChAT is shown in blue.
- F The level of degranularization as evaluated by expression of the lysosomal-associated membrane protein, CD107A, is pronounced on astrocytes that surround MNs in Sodl 093 ⁇ mice. CD107A is shown in red; EAAT2 is shown in green; ChAT is shown in blue. Scale bars represent 200 ⁇ .
- G-H Levels of PRFl (G) and GZMB (H) found at different time points in MNs co-cultured with wild-type or S0D1 G93A astrocytes as shown in (A).
- PRFl is shown in red
- GZMB is shown in green
- Hb9-GFP is shown in blue.
- Scale bar represents 5 ⁇ .
- J Shows three dimensional images obtained with a confocal microscope showing lack of PRFl staining (red) in MNs upon co-culture with wild-type astrocytes.
- EAAT2 (blue), an astrocyte surface marker, was used to visualize astrocyte membrane; Hb9-GFP (green) was used to visualize MN. Scale bar represents 100 ⁇ .
- K Western blot analysis revealed that both primary and NPC derived S0D1 G93A astrocytes show higher level of CD 107 A expression, an indicator of degranulation of cytolytic proteins compared to wild- type astrocytes.
- L Immunofluorescence staining of MNs co-cultured with astrocytes showed that CD 107 A expression is pronounced on S0D1 G93A astrocytes surrounding MNs. CD107A is shown in red, Hb9-GFP is shown in green, EAAT2 is shown in blue. Scale bar represents 100 ⁇ .
- FIGURE 3 (A) Detection of PRFl and GZMB in MNs found in spinal cords of human ALS as assayed by 3,3'-Diaminobenzidine (DAB) immuno staining. (B) Quantification of the number of motor neurons positive for PRFl as shown in Figure 3 A. Scale bars represent 20 ⁇ . (C) Quantification of the number of motor neurons positive for GZMB as shown in Figure 3A. Scale bars represent 20 ⁇ .
- DAB 3,3'-Diaminobenzidine
- FIGURE 4 (A) Knockdown of Prfl and GzmB expression in Sodl W3A astrocytes rescues co-cultured MNs. (B) Knockdown of Prfl and GzmB expression in Sodl G93A astrocytes rescues total counts of HB9-GFP + cells. (C) Knockdown of Prfl and GzmB expression in Sodl G93A astrocytes prevents atrophy of the MN soma. (D) Knockdown of Prfl and GzmB expression in Sodl G93A astrocytes prevents shortening of neurites.
- FIGURE 5 (A) Similar to NK cells, Sodl 093 astrocytes express CD56 and CD57. Scale bars represent 100 ⁇ . (B) Similar to NK cells, Sodl 09 ⁇ astrocytes exhibit up- regulation of markers commonly associated with NK cells. (C) Sodl 09 ⁇ astrocytes express MHC class I receptors, evident from the robust expression of LY49C and LY49I in vitro.
- Sodl G93A astrocytes express MHC class I receptors, evident from the robust expression of LY49C and LY49I in vivo at disease end-stage in the spinal cord of Sodl 09 ⁇ mice.
- LY49C+I is shown in red; GFAP is shown in green.
- Scale bars represent 500 ⁇ and 200 ⁇ (inset).
- E The MHC class I receptor, KIR3DL2 is expressed in FALS and SALS astrocytes. Scale bars represent 200 ⁇ .
- FIGURE 6 (A) Time dependent down-regulation of MHC class I, evident from the intensity of H2K expression, in MNs upon co-culture with Sodl 09 ⁇ astrocytes. Scale bars represent 10 ⁇ . (B) Sodl 09 ⁇ astrocytes do not induce MHC class I down-regulation in GABAergic neurons. Scale bars represent 5 ⁇ . (C) Decreased expression of MHC class I in MNs at disease end-stage in Sodl 09 ⁇ mice. H2K is shown in red; ChAT is shown in green. Asterisks in ALS panel mark MNs. Scale bars represent 2 mm and 10 ⁇ (inset). (D)
- MHC class I Decreased expression of MHC class I in MNs at disease end- stage in spinal cord of ALS patients. MHC class I is visualized by 3,3'-Diaminobenzidine (DAB) staining. Asterisks in ALS panel mark MNs. Scale bars represent 20 ⁇ .
- E Quantification of MHC class I expression in MNs of human spinal cords shown in Figure 6D.
- F-G Overexpression of MHC class I in MN prevents cell death (see panel 6F) as evident from HB9-GFP + cell numbers (see panel 6G). Scale bars represent 100 ⁇ .
- H Sustained MHC class I expression in MNs upon co-culture with Sodl 09 ⁇ astrocytes after lentiviral transduction.
- H2K is shown in red; Hb9 is shown in green.
- MHC class I overexpression prevents atrophy of the MN soma.
- K Upon co-cultured with S0D1 G93A astrocytes, surface MHC class I staining shows reduced expression of MHC class I on MNs transduced with Lv-RFP, but sustained expression of MHC class I on MN transduced with Lv-H2K. Scale bar represents 20 ⁇ M.
- FIGURE 7 Kp7-6 concentrations that are known to be effective in the inhibition of Fas/FasL activity in cytotoxic lymphocytes, did not change S0D1 G93A astrocyte- derived toxicity towards MNs. p ⁇ 0.001.
- FIGURE 8 The median survival rates of ShRNA-prf/GFP and control mice were analyzed. Results are shown in percent survival vs. time (days).
- FIGURE 9 The hindlimb grip strength of ShRNA-prf/GFP and control mice was analyzed. Results are shown as force (g) vs. age (days).
- E-F In the presence of SODl astrocytes conditioned media, PRFl and GZMB was detected in the soma of MNs.
- G Dose dependent increase in MN survival was observed in the presence of PRFl and GZMB neutralizing antibodies added to SODl astrocyte conditioned medium.
- SODl astrocyte conditioned medium without antibody supplementation was used as the reference group for statistical analysis. Dotted lines represent 50% frequency (C, D). Scale bars, 200 ⁇ (A), 5 ⁇ (E). Error bars denote s.e.m. **P ⁇ 0.01, ****P ⁇ 0.0001. n.s, non-significant. Scr, scrambled shRNA.
- FIGURE 11 ShRNA knockdown of H2-K1 resulted in efficient down regulation of H2-K1 expression in GABAergic neurons as shown by RNA (A) and protein expression (B-C).
- D Suppression of H2-K1 in GABAergic neurons resulted in an increase incidence of PRFl and GZMB upon co-culture with SODl astrocytes.
- FIGURE 12 (A) Western blot analysis showed similar levels of human SODl upon expression of PRFl and GZMB shRNAs in SODl astrocytes. (B) Inflammatory gene array showed no overt changes in the inflammatory profile of SODl astrocytes upon knockdown of PRFl and GZMB. Heatmap represents the average fold changes of two gene arrays using samples collected independently.
- a method for treating a patient with amyotrophic lateral sclerosis by decreasing the expression of a cytoplasmic granule toxin in astrocytes of the patient comprising the step of
- composition comprising an effective amount of a compound that decreases the expression the cytoplasmic granule toxin in the astrocytes of the patient.
- nucleic acid is selected from the group consisting of an siRNA, an miRNA, and an shRNA.
- nucleic acid is an shRNA.
- composition further comprises a carrier, an excipient, or a diluent, or a combination thereof.
- the composition comprises a pharmaceutically acceptable carrier, wherein the pharmaceutically acceptable carrier is a liquid carrier.
- liquid carrier is selected from the group consisting of saline, glucose, alcohols, glycols, esters, amides, and a combination thereof.
- a method for treating amyotrophic lateral sclerosis by increasing MHC class I expression in motor neurons of a patient comprising the step of
- composition comprising an effective amount of a compound that increases the expression of MHC class I in the motor neurons of the patient.
- composition further comprises a carrier, an excipient, or a diluent, or a combination thereof.
- composition comprises a pharmaceutically acceptable carrier, wherein the pharmaceutically acceptable carrier is a liquid carrier.
- liquid carrier is selected from the group consisting of saline, glucose, alcohols, glycols, esters, amides, and a combination thereof.
- a pharmaceutical composition comprising a dosage form of a compound effective to decrease the expression a cytoplasmic granule toxin in the astrocytes of a patient with amyotrophic lateral sclerosis.
- composition of clause 42 wherein the compound is selected from the group consisting of a drug, a peptide, and a nucleic acid.
- composition of clause 43 wherein the compound is a nucleic acid.
- composition of clause 44 wherein the nucleic acid is selected from the group consisting of siRNA, an miRNA, and an shRNA. 46. The composition of clause 44 wherein the compound is an antisense RNA molecule.
- composition of clause 50 wherein the composition comprises a pharmaceutically acceptable carrier, wherein the pharmaceutically acceptable carrier is a liquid carrier.
- composition of clause 51 wherein the liquid carrier is selected from the group consisting of saline, glucose, alcohols, glycols, esters, amides, and a combination thereof.
- composition of any one of clauses 42 to 52 wherein the purity of the compound is at least 98% based on weight percent.
- composition of any one of clauses 42 to 50 or 53 to 54 in the form of a reconstitutable lyophilizate
- a pharmaceutical composition comprising a dosage form of a compound effective to increase the expression of MHC class I in the motor neurons of a patient with amyotrophic lateral sclerosis.
- composition of clause 56 wherein the compound is selected from the group consisting of a drug, a peptide, and a nucleic acid.
- composition of clause 56 wherein the compound is a nucleic acid.
- composition of clause 58 wherein the nucleic acid has the sequence of SEQ ID NO: 3.
- composition comprises a pharmaceutically acceptable carrier, wherein the pharmaceutically acceptable carrier is a liquid carrier.
- composition of clause 61 wherein the liquid carrier is selected from the group consisting of saline, glucose, alcohols, glycols, esters, amides, and a combination thereof.
- composition of any one of clauses 56 to 60 or 63 to 64 in the form of a reconstitutable lyophilizate is provided.
- parenteral dosage form is selected from the group consisting of an intradermal dosage form, a subcutaneous dosage form, an intramuscular dosage form, an intraperitoneal dosage form, an intravenous dosage form, and an intrathecal dosage form.
- kits comprising a sterile vial, the composition of any one of clauses 56 to 69, and instructions for use describing use of the composition for treating a patient with amyotrophic lateral sclerosis.
- kits of clause 74 wherein the parenteral dosage form is selected from the group consisting of an intradermal dosage form, a subcutaneous dosage form, an
- intramuscular dosage form an intraperitoneal dosage form, an intravenous dosage form, and an intrathecal dosage form.
- the pharmaceutically acceptable carrier is a liquid carrier selected from the group consisting of saline, glucose, alcohols, glycols, esters, amides, and a combination thereof.
- a method for treating a patient with amyotrophic lateral sclerosis by decreasing the expression of a cytoplasmic granule toxin in astrocytes of the patient comprises the step of administering to the patient a composition comprising an effective amount of a compound that decreases the expression of the cytoplasmic granule toxin in the astrocytes of the patient.
- the cytoplasmic granule toxin is not SOD1.
- the cytoplasmic granule toxin is a non- antioxidant cytoplasmic granule toxin.
- a method for treating amyotrophic lateral sclerosis by increasing MHC class I expression in motor neurons of a patient comprises the step of administering to the patient a composition comprising an effective amount of a compound that increases the expression of MHC class I in the motor neurons of the patient.
- the decreased expression of the cytoplasmic granule toxin in astrocytes of the patient, or the increased expression of MHC class I in motor neurons of the patient results in an effect on motor neurons of the patient selected from, but not limited to, the group consisting of an increase in the number of motor neurons, a decrease in soma atrophy, and an increase in neurite length after administration of the compound.
- the motor neurons may be in the motor cortex, brain stem, or spinal cord of the patient, or combinations thereof.
- a pharmaceutical composition comprising a dosage form of a compound effective to decrease the expression of a cytoplasmic granule toxin in the astrocytes of a patient with amyotrophic lateral sclerosis.
- a pharmaceutical composition comprising a dosage form of a compound effective to increase the expression of MHC class I in the motor neurons of a patient with amyotrophic lateral sclerosis. Kits comprising these pharmaceutical compositions are also provided.
- uses of these pharmaceutical compositions for the manufacture of a medicament for treating amyotrophic lateral sclerosis are provided.
- these pharmaceutical compositions are provided, for use in treating amyotrophic lateral sclerosis.
- the methods, kits, uses, and pharmaceutical compositions described herein can be used to treat either sporadic or familial amyotrophic lateral sclerosis, and can be used for both human clinical medicine and veterinary medicine.
- the compounds described herein that can be used to treat sporadic or familial amyotrophic lateral sclerosis are compounds that are effective to decrease the expression, or reduce the activity, of a cytoplasmic granule toxin in the astrocytes of a patient with amyotrophic lateral sclerosis.
- the compounds described herein that can be used to treat sporadic or familial amyotrophic lateral sclerosis are compounds that are effective to increase the expression of MHC class I in the motor neurons of a patient with amyotrophic lateral sclerosis.
- the compounds are selected from the group consisting of drugs, peptides, and nucleic acids, or combinations thereof.
- a cytoplasmic granule toxin that is targeted can be any astrocyte cytoplasmic granule toxin that is toxic to motor neurons, including but not limited to, perforins (e.g., perforin 1) and granzymes (e.g., granzyme B). In one embodiment, the granzyme is not granzyme A.
- Expression or activity of perforins and granzymes can be reduced, for example, by treatment of a patient with a drug, peptide, or nucleic acid, or a combination thereof, that reduces the expression or the activity of a cytoplasmic granule toxin in the astrocytes of a patient with amyotrophic lateral sclerosis.
- a drug, peptide, or nucleic acid, or a combination thereof that reduces the expression or the activity of a cytoplasmic granule toxin in the astrocytes of a patient with amyotrophic lateral sclerosis.
- compounds that reduce activity of a cytoplasmic granule toxin, such as perforin include Ca 2+ -complexing agents.
- expression a cytoplasmic granule toxin in the astrocytes of a patient with amyotrophic lateral sclerosis can be reduced by treatment of the patient with a pharmaceutical composition comprising a nucleic acid such as an antisense RNA molecule, an siRNA, an shRNA, or an miRNA that inhibits expression of a cytoplasmic granule toxin, such as a perforin or a granzyme.
- a nucleic acid such as an antisense RNA molecule, an siRNA, an shRNA, or an miRNA that inhibits expression of a cytoplasmic granule toxin, such as a perforin or a granzyme.
- Inhibitors of perforin expression or activity also include concanamycin A (vacuolar type H(+)-ATPase (V-ATPase) inhibitors), bafilomycin Al (vacuolar type H(+)- ATPase (V-ATPase) inhibitors), destruxin E (vacuolar type H(+)-ATPase (V-ATPase) inhibitors), prodigiosin 25-C (vacuolar type H(+)-ATPase (V-ATPase) inhibitors, cytochalasin D (an inhibitor of actin polymerization), antimycin A and oligomycin A (respiratory inhibitors), calphostin C (protein kinase inhibitor), herbimycin A (protein kinase inhibitor), K252a (protein kinase inhibitor), staurosporine (protein kinase inhibitor).
- concanamycin A vacuum type H(+)-ATPase (V-ATPase) inhibitors
- Apolipoprotein B perforin inhibitor protein in human serum
- Suramin and glycosaminoglycans (abolishes binding of LDL to its receptor to inhibit the lytic activities of perforin).
- Inhibitors of granzyme B expression also include Granzyme B Inhibitor I (Z-AAD-CMK , C19H24C1N307 , A weak inhibitor of the human and murine granzyme B), Granzyme B Inhibitor II (Ac-IETD-CHO, C21H34N4O10, A potent, reversible inhibitor of granzyme B and caspase-8), Granzyme B Inhibitor II Cell permeable (Ac- AAVALLPAVLLALLAP-IETD-CHO, C95H162N20O26, A potent, cell-permeable, and reversible inhibitor of caspase-8 and Granzyme B), Granzyme B Inhibitor III (Z- IE(OMe)TD(OMe)-FMK, C30H43FN4O11, A potent, cell-permeable, and irreversible inhibitor of caspase-8 and granzyme B), Granzyme B Inhibitor IV (Ac-IEPD-CHO,
- exemplary of such RNA molecules are the nucleic acids with SEQ ID NO: 1 and SEQ ID NO: 2 shown by the present inventors to efficiently ablate expression of perforin 1 or granzyme B, respectively, in S0D1 G93A astrocytes or in astrocytes derived from familial or sporadic amyotrophic lateral sclerosis patients, resulting in effective suppression of motor neuron toxicity in motor neurons exposed to the astrocytes (see Example 4).
- the compounds described herein that can be used to treat amyotrophic lateral sclerosis are compounds that are effective to increase the expression of MHC class I in the motor neurons of a patient with amyotrophic lateral sclerosis.
- the compounds are selected from the group consisting of drugs, peptides, and nucleic acids, or combinations thereof.
- the nucleic acid with SEQ ID NO: 3, encoding the histocompatibility complex H2K, shown herein to cause sustained expression of MHC class I in motor neurons, protecting motor neurons from the toxic effects of S0D1 G93A astrocytes (see Example 6), can be used to treat amyotrophic lateral sclerosis.
- compositions comprising a purified nucleic acid comprising, or consisting of, a sequence of SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3 (see Table 1).
- a purified nucleic acid is also provided comprising a complement of SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3, or a sequence that hybridizes under highly stringent conditions to a complement of a sequence consisting of SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3.
- “highly stringent conditions” means hybridization at 65 °C in 5X SSPE and 50% formamide, and washing at 65 °C in 0.5X SSPE. Conditions for high, low, and moderately stringent
- hybridization are described in Sambrook et al., "Molecular Cloning: A Laboratory Manual”, 3rd Edition, Cold Spring Harbor Laboratory Press, (2001), incorporated herein by reference. In some illustrative aspects, hybridization occurs along the full-length of the nucleic acid.
- the invention encompasses isolated or substantially purified nucleic acids.
- An "isolated” or “purified” nucleic acid molecule is substantially free of chemical precursors or other chemicals when chemically synthesized, or is substantially free of cellular material if made by recombinant DNA techniques.
- the nucleic acids for use in the methods, compositions, and kits described herein may be double- stranded (e.g., antisense RNAs) or single-stranded, but the nucleic acids are typically single- stranded.
- nucleic acids for use in the methods, uses, pharmaceutical compositions, and kits described herein can be modified by substitution, deletion, truncation, and/or can be fused with other nucleic acid molecules wherein the resulting nucleic acids hybridize specifically under highly stringent conditions to the complements of nucleic acids of SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3, and wherein the modified nucleic acids are useful in the methods or uses described herein.
- Derivatives can also be made such as phosphorothioate,
- nucleic acid molecules are provided having about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, or about 99% homology to SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3.
- Determination of percent identity or similarity between sequences can be done, for example, by using the GAP program (Genetics Computer Group, software; now available via Accelrys on http://www.accelrys.com), and alignments can be done using, for example, the ClustalW algorithm (VNTI software, InforMax Inc.).
- a sequence database can be searched using the nucleic acid sequence of interest. Algorithms for database searching are typically based on the BLAST software (Altschul et al., 1990).
- the percent identity can be determined along the full-length of the nucleic acid.
- nucleic acids described herein such as nucleic acids of SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3, or fragments thereof, are well- known in the art and include chemical syntheses. Such techniques are described in Sambrook et al., “Molecular Cloning: A Laboratory Manual”, 3rd Edition, Cold Spring Harbor Laboratory Press, (2001), incorporated herein by reference. Nucleic acids for use in the methods described herein can be made commercially. Techniques for purifying or isolating the nucleic acids described herein are well-known in the art. Such techniques are described in Sambrook et al., “Molecular Cloning: A Laboratory Manual”, 3rd Edition, Cold Spring Harbor Laboratory Press, (2001), incorporated herein by reference.
- the compounds described herein for ablating expression of perforins or granzymes in astrocytes or inducing expression of MHC class I in motor neurons may be administered as a formulation in association with one or more pharmaceutically acceptable carriers.
- the carriers can be excipients. The choice of carrier will to a large extent depend on factors such as the particular mode of administration, the effect of the carrier on solubility and stability, and the nature of the dosage form.
- compositions suitable for the delivery of the compound, or additional therapeutic agents to be administered with the compound, and methods for their preparation will be readily apparent to those skilled in the art. Such compositions and methods for their preparation may be found, for example, in Remington: The Science & Practice of Pharmacy, 21st Edition (Lippincott Williams & Wilkins, 2005), incorporated herein by reference.
- a pharmaceutically acceptable carrier may be selected from any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, and combinations thereof, that are physiologically compatible.
- the carrier is suitable for parenteral administration.
- Pharmaceutically acceptable carriers include sterile aqueous solutions or dispersions, and sterile powders for the preparation of sterile injectable solutions or dispersions. Supplementary active compounds can also be incorporated into the pharmaceutical compositions of the invention.
- liquid formulations may include suspensions and solutions.
- Such formulations may comprise a carrier, for example, water, ethanol, polyethylene glycol, propylene glycol, methylcellulose, or a suitable oil, and one or more emulsifying agents and/or suspending agents.
- Liquid formulations may also be prepared by the reconstitution of a solid, such as a lyophilizate.
- the lyophilizate can be a reconstitutable lyophilizate.
- an aqueous suspension may contain the active materials in admixture with appropriate excipients.
- excipients are suspending agents, for example, sodium carboxymethylcellulose, methylcellulose, hydroxypropylmethylcellulose, sodium alginate, polyvinylpyrrolidone, gum tragacanth and gum acacia; dispersing or wetting agents which may be a naturally-occurring phosphatide, for example, lecithin; a condensation product of an alkylene oxide with a fatty acid, for example, polyoxyethylene stearate; a condensation product of ethylene oxide with a long chain aliphatic alcohol, for example, heptadecaethyleneoxycetanol; a condensation product of ethylene oxide with a partial ester derived from fatty acids and a hexitol such as polyoxyethylene sorbitol monooleate; or a condensation product of ethylene oxide with a partial ester derived from fatty acids and hexitol
- the aqueous suspensions may also contain one or more preservatives, for example, ascorbic acid, ethyl, n-propyl, or p- hydroxybenzoate; or one or more coloring agents.
- preservatives for example, ascorbic acid, ethyl, n-propyl, or p- hydroxybenzoate
- coloring agents for example, ascorbic acid, ethyl, n-propyl, or p- hydroxybenzoate
- isotonic agents for example, sugars, polyalcohols such as mannitol, sorbitol, or sodium chloride can be included in the pharmaceutical composition.
- the excipient comprises a buffer.
- the pH of the buffer is about 5.0 to about 8.0.
- the buffer may be any acceptable buffer for the indicated pH range and physiological compatibility.
- a buffer may additionally act as a stabilizer.
- the buffer comprises an ascorbate, sorbate, formate, lactate, fumarate, tartrate, glutamate, acetate, citrate, gluconate, histidine, malate, phosphate or succinate buffer.
- a compound i.e., a drug, a peptide, or a nucleic acid
- additional therapeutic agent as described herein, may be administered directly into the blood stream, into muscle, or into an internal organ.
- Suitable routes for parenteral administration include intravenous, intraarterial, intraperitoneal, intrathecal, epidural, intracerebroventricular, intrasternal, intracranial, intramuscular, and subcutaneous delivery.
- Suitable means for parenteral administration include needle (including microneedle) injectors, needle-free injectors and infusion techniques.
- parenteral dosage forms include aqueous solutions of the active agent, in an isotonic saline, glucose (e.g., 5% glucose solutions), or other well-known pharmaceutically acceptable liquid carriers such as liquid alcohols, glycols, esters, and amides.
- Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent which delays absorption, for example, monostearate salts and gelatin.
- kits comprising the pharmaceutical composition described herein.
- a kit comprising a sterile vial, the pharmaceutical composition of any one of the preceding embodiments, and instructions for use describing use of the composition for treating a patient with amyotrophic lateral sclerosis is described.
- kit of the preceding embodiment wherein the compound or the composition is in the form of a reconstitutable lyophlizate is described.
- any of the preceding kit embodiments wherein the dose of the compound in the pharmaceutical composition is in the range of 1 to 5 g/kg is described.
- any of the preceding kit embodiments wherein the dose of the compound in the pharmaceutical composition is in the range of 1 to 3 g/kg is described.
- the kit of any of the preceding kit embodiments is described wherein the purity of the compound is at least 90% based on weight percent. In another embodiment, the kit of any of the preceding embodiments is described wherein the purity of the compound is at least 95% based on weight percent. In another embodiment, the kit of any of the preceding kit embodiments is described wherein the purity of the compound is at least 98% based on weight percent. In another embodiment, the kit of any of the preceding kit embodiments is described wherein the purity of the compound is at least 99% based on weight percent.
- the kit of any of the preceding kit embodiments is described wherein the compound or the composition is in a parenteral dosage form.
- the parenteral dosage form can be selected from the group consisting of an intradermal dosage form, a subcutaneous dosage form, an intramuscular dosage form, an intraperitoneal dosage form, an intravenous dosage form, and an intrathecal dosage form.
- the kit can comprise the composition and the composition can further comprise a
- the pharmaceutically acceptable carrier can be a liquid carrier selected from the group consisting of saline, glucose, alcohols, glycols, esters, amides, and a combination thereof.
- any effective regimen for administering the compound can be used.
- the compound can be administered as a single dose, or can be divided and
- a staggered regimen for example, one to five days per week can be used as an alternative to daily treatment, and for the purpose of the pharmaceutical compositions, kits, methods, and uses described herein, such intermittent or staggered daily regimen is considered to be equivalent to every day treatment and is
- the patient is treated with multiple injections of the compound to eliminate the disease state (i.e., amyotrophic lateral sclerosis) or to reduce or stabilize the symptoms of disease.
- the patient is injected multiple times (preferably about 2 up to about 50 times), for example, at 12-72 hour intervals or at 48-72 hour intervals. Additional injections of the compound can be administered to the patient at an interval of days or months after the initial injections(s), and the additional injections can prevent recurrence of the disease or can prevent an increase in the severity of the symptoms of disease.
- the unitary daily dosage of the compound can vary significantly depending on the patient condition, the disease state being treated, the purity of the compound and its route of administration and tissue distribution, and the possibility of co-usage of other therapeutic treatments.
- the effective amount to be administered to a patient is based on body surface area, mass, and physician assessment of patient condition. Effective doses can range, for example, from about 1 ng/kg to about 1 mg/kg, from about 1 ⁇ g/kg to about 500 ⁇ g/kg, and from about 1 ⁇ g/kg to about 100 ⁇ g/kg. These doses are based on an average patient weight of about 70 kg, and the kg are kg of patient body weight (mass).
- the compound or pharmaceutical composition is in a multidose form.
- the compound or pharmaceutical composition is a single dose form (i.e., a unit dose form or a dosage unit).
- the compound can be administered in a dose of from about 1.0 ng/kg to about 1000 ⁇ g/kg, from about 10 ng/kg to about 1000 ⁇ g/kg, from about 50 ng/kg to about 1000 g/kg, from about 100 ng/kg to about 1000 g/kg, from about 500 ng/kg to about 1000 g/kg, from about 1 ng/kg to about 500 g/kg, from about 1 ng/kg to about 100 g/kg, from about 1 g/kg to about 50 g/kg, from about 1 g/kg to about 10 g/kg, from about 5 ⁇ g/kg to about 500 ⁇ g/kg, from about 10 ⁇ g/kg to about 100 ⁇ g/kg, from about 20 ⁇ g/kg to about 200 g/kg, from about 10 g/kg to about 500 g/kg, or from about 50 g/kg to about 500 ⁇ g/kg.
- the total dose may be administered in single or divided doses and may, at the physician's discretion, fall outside of the typical range given herein. These dosages are based on an average patient weight of about 70 kg and the "kg" are kilograms of patient body weight. The physician will readily be able to determine doses for subjects whose weight falls outside this range, such as infants and the elderly.
- the compound can be administered at a dose of from about 1 ⁇ g/m 2 to about 500 mg/m 2 , from about 1 ⁇ g/m 2 to about 300 mg/m 2 , or from about 100 ⁇ g/m 2 to about 200 mg/m 2.
- the compound can be administered at a dose of from about 1 mg/m 2 to about 500 mg/m 2 , from about 1 mg/m 2 to about 300 mg/m 2 , from about 1 mg/m 2 to about 200 mg/m 2 , from about 1 mg/m 2 to about 100 mg/m 2 , from about 1 mg/m 2 to about 50 mg/m 2 , or from about 1 mg/m 2 to about 600 mg/m 2.
- the total dose may be administered in single or divided doses and may, at the physician's discretion, fall outside of the typical range given herein. These dosages are based on m of body surface area.
- the pharmaceutical compositions and/or dosage forms of the compound for administration are prepared from compounds with a purity of at least about 90%, or about 95%, or about 96%, or about 97%, or about 98%, or about 99%, or about 99.5%.
- pharmaceutical compositions and or dosage forms of the compound for administration are prepared from compounds with a purity of at least 90%, or 95%, or 96%, or 97%, or 98%, or 99%, or 99.5%.
- the purity of the compound may be measured using any conventional technique, including various chromatography or spectroscopic techniques, such as high pressure or high performance liquid chromatography, nuclear magnetic resonance spectroscopy, TLC, UV absorbance spectroscopy, fluorescence spectroscopy, and the like.
- purity determinations may be based on weight percentage, mole percentage, and the like. In addition, purity determinations may be based on the absence or substantial absence of certain predetermined components. It is also to be understood that purity determinations are applicable to solutions of the compounds and pharmaceutical compositions prepared by the methods described herein. In those instances, purity measurements, including weight percentage and mole percentage measurements, are related to the components of the solution exclusive of the solvent.
- the compound or the pharmaceutical composition is provided in a sterile container (e.g., a vial) or package, for example, an ampoule or a sealed vial.
- the methods, pharmaceutical compositions, uses, and kits, described herein include the following examples.
- the examples further illustrate additional features of the various embodiments of the invention described herein.
- the examples are illustrative and are not to be construed as limiting other embodiments of the invention described herein.
- other variations of the examples are included in the various embodiments of the invention described herein.
- ALS astrocytes express and show increased co-localization of the cytoplasmic granule toxins perforin and granzyme.
- Cytoplasmic granule toxins of the granule exocytosis pathway comprise perforin
- PRFl granzyme B
- GZMB granzyme B
- the present example analyzed if cytolytic compounds of the granule cell death pathway are expressed in cells of the spinal cord. As shown in Figure 1A, both PRFl and GZMB protein were readily detected in spinal cords of wild type and S0D1 G93A mice (an accepted animal model for amyotrophic lateral sclerosis
- ALS ALS
- RNA analysis revealed expression of both Prfl and Gzmb in astrocytes, but lack of Prfl in microglia. Expression of Prfl and Gzmb was found in the spinal cords of both wild-type and S0D1 G93A mice (see Figure 1G).
- human post-mortem NPC derived astrocytes from controls and ALS patients exhibited expression of PRF1 and GZMB (see Figure IE), including ALS patient-derived astrocytes with known capacity to convey toxicity to MNs. Similar to astrocytes from
- astrocytes in the spinal cords of ALS patients contained PRF1 and GZMB in patterns consistent with cytoplasmic granules, while both proteins were virtually absent in unaffected controls (see Figure IF).
- this example demonstrates that murine and human astrocytes contain the cytolytic proteins PRF1 and GZMB in a subcellular localization pattern consistent with an active granule cell death pathway.
- Example 2 ALS astrocytes release perforin and granzvme B into motor neurons.
- This example investigated whether S0D1 G93A astrocytes have the ability to release PRF1 and GZMB into MNs by using an in vitro culture system to demonstrate the toxicity of astrocytes towards co-cultured MNs.
- MNs were derived from mES cells expressing GFP under the control of the motor-neuron specific HB9 promoter, permitting visual distinction of MNs and astrocytes in co-cultures.
- cytosolic and membrane-associated PRF1 and GZMB protein were visualized as early as 24 hours after plating, while MNs co-cultured with wild type astrocytes did not exhibit any signal at this time point.
- Non-ALS control astrocytes overexpressing SODl mutations release PRF1 and GZMB into motor neurons.
- PRFl and GZMB remain absent in MNs co-cultured with non-ALS control astrocytes after 120 hours of culture (see Figure 21).
- Perforin-mediated transfer of GZMB from effector to target cells is believed to involve the formation pore-resembling structures in the membrane of the target cell.
- S0D1 G93A astrocytes and MNs using confocal microscopy technology with three-dimensional imaging capability was examined.
- PRFl-staining co-localized with pore-like structures in the intercellular space between S0D1 G93A astrocytes and the targeted MNs.
- such structures were absent.
- PRFl and GZMB were present within MNs of S0D1 G93A but not in wild type mice, thus confirming the findings in vivo (see Figures 2C and 2D).
- Three dimensional images were obtained with a confocal microscope showing lack of PRFl staining in MNs upon co-culture with wild-type astrocytes (see Figure 2J).
- Example 3 Perforin and granzvme B are specifically found in motor neurons of human ALS spinal cords.
- Example 4 ALS astrocytes utilize perforin and granzvme B to kill motor neurons.
- the functional significance of the PRF1/GZMB pathway in ALS astrocyte-mediated MN toxicity was determined.
- shRNAs that were capable of efficiently ablating expression of Prfl and Gzmb in astrocytes were identified. Ablation of Prfl and Gzmb expression in S0D1 G93A astrocytes resulted in an almost complete protection of MNs during co- culture (see Figures 4A and B). This protective effect manifested in a larger number of surviving MNs (see Figure 4B), less soma atrophy (see Figure 4C), and increased neuritic length (see Figure 4D). The specificity of this protective effect was confirmed by unaltered MN-directed toxicity of S0D1 G93A astrocytes treated with a scrambled shRNA control, resulting in death of 80% of MNs within 20 hours of co-culture.
- Example 5 ALS astrocytes display NK-like cell properties.
- ALS astrocytes have adopted a functional property of NK cells.
- this example evaluated the expression levels of a large series of NK cell associated markers in ALS astrocytes.
- S0D1 G93A astrocytes expressed robust levels of two prototypical NK markers, CD56 and CD57, which are minimally expressed in wild type astrocytes (see Figure 5A).
- NK cells have evolved specific mechanisms to effectively mediate host defense mechanisms against viral infection that require the ability to identify infected from uninfected cells.
- MHC major histocompatibility complex
- HSV Herpes Simplex Virus
- KIR3DL2 a MHC class I inhibitory receptor was expressed specifically and highly in all FALS and SALS astrocyte lines evaluated but not in normal control cells (see Figure 5F). Immunostaining confirmed high levels of KIR3DL2 in astrocytes within the spinal cord of ALS patients but not of healthy controls. These results suggest that ALS astrocytes not only activate the perforin/granzyme cell death pathway similar to NK cells, but also adopt many other NK cell properties including expression of MHC class I inhibitory receptors.
- MHC class I inhibitory receptors expressed on the surface of ALS astrocytes may mediate an NK-cell like interaction with target cells, with reduced presentation of MHC class I by MNs triggering ALS astrocyte toxicity.
- levels of MHC class I receptors on the surface of MNs were monitored upon co-culture with astrocytes. While MNs cultured on top of wild type astrocytes sustained robust MHC class I expression for over 120 hours, MNs co- cultured with S0D1 G93A astrocytes exhibited a rapid and marked decrease of MHC class I antigen (see Figure 6A). This reduction was significant at 24 hours and became more marked with longer time in co-culture, with lowest MHC class I expression at 120 hours of co-culture (see Figure 6A). Of note, the decrease in MHC class I expression on MN co-cultured with S0D1 G93A astrocytes inversely correlated to the observed increase in the levels of PRF1/GZMB within MNs (see Figure 2A).
- ALS astrocytes exert toxicity predominantly towards MNs but not towards other neuronal cell types such as GABA-ergic neurons
- the levels of MHC class I on the surface of GABAergic neurons were evaluated.
- MHC class I antigen levels in GABAergic neurons remained constant during extended co- cultured with wild type and S0D1 G93A astrocytes (see Figure 6B).
- MHC class I staining revealed widespread and substantial reduction of MHC class I expression in MNs only in the spinal cord of ALS patients or S0D1 G93A mice, but not in normal tissues (see Figures 6C and 6D). Dramatic down-regulation of MHC class I in MNs was detected similarly in spinal cord samples of FALS and SALS patients, with absence of MHC class I receptors in 80 to 100% of MNs across samples (see Figure 6E).
- MNs should be spared if MHC class I expression could be sustained.
- H2K histocompatibility complex
- Kp7-6 was analyzed to determine whether Kp7-6 blocks astrocyte toxicity to MNs. Kp7-6 specifically antagonizes Fas/FasL- mediated apoptosis. Kp7-6 was added to S0D1 G93A astrocytes 24 hours prior to MNs co-culture and maintained in the co-cultures at all times. Kp7-6 concentrations that are known to be effective in the inhibition of Fas/FasL activity in cytotoxic lymphocytes, did not change S0D1 G93A astrocyte-derived toxicity towards MNs (see Figure 7) p ⁇ 0.001.
- mice that expressed mutant SOD1 were obtained from Jackson Laboratories (Bar Harbor, ME). Animals were housed under light/dark (12: 12 hour) cycle with food and water ad libitum. At each generation, SOD1 transgene copy number and SOD1 protein expression levels were verified by PCR and western blot analysis respectively. All procedures were performed in accordance with the NIH Guidelines and approved by the Nationalwide Children's Research Institutional Animal Care and Use Committee.
- Astrocytes were isolated from 110-130 days of age S0D1 G93A and wild-type B6SJL mice. Astrocyte cultures were prepared as previously described with minor
- spinal cords were enzymatically dissociated to single cells with a mixture of Papain (2.5 U/ml; Worthington Biochemical, Lakewood, NJ), Dispase grade II (1 U/ml; Boehringer Mannheim Corporation, Indianapolis, IN) and Dnase I (250 U/ml;
- DMEM/F12 In vitro gen, Carlsbad, CA
- FBS fetal bovine serum
- N2 supplement Invitrogen
- astrocytes preparations were tested for the presence of cytotoxic T-lymphocytes (CTLs) and natural killer (NK) cells and found to be devoid of these cells types.
- Microglia were isolated from 110-130 days of age S0D1 G93A and wild-type B6SJL mice following protocols previously described. Briefly, whole spinal cords were homogenized in Hank's Balanced Salt Solution (HBSS), pH 7.4. The resulting homogenates were passed through a 70 ⁇ nylon cell strainer and centrifuged at 400 xg for 6 minutes. Supernatants were removed and cell pellets were resuspended in 70% isotonic Percoll (GE Healthcare, Waukesha, WI) at room temperature. A discontinuous Percoll density gradient was set up as follows: 70%, 50%, 35%, and 0% isotonic Percoll.
- HBSS Hank's Balanced Salt Solution
- microglia preparations were tested for the presence of CTLs and NK cells and found to be devoid of these cells types.
- NPCs were isolated from the spinal cords of S0D1 G93A and wild- type B6SJL mice according to methods previously described. Briefly, spinal cords were enzymatically dissociated to single cells with a mixture of Papain (2.5 U/ml; Worthington Biochemical), Dispase grade II (1 U/ml; Boehringer Mannheim Corporation) and Dnase I (250 U/ml;
- NPCs were grown in growth medium (DMEM/F12, Invitrogen), with 1% N2 supplement (Invitrogen), 20 ng/ml of fibroblast growth factor-2 (FGF-2, Peprotech, Rocky Hill, NJ) and 20 ng/ml of endothelial growth factor (EGF, Peprotech). Proliferating clusters of cells attached to the plates started to appear in about 10 to 15 days. At 70-80% confluence, cells were passaged onto polyornithine-laminin (P/L)- coated plates, In these proliferation conditions, we confirmed that mouse NPCs cultures were absent of astrocytes, microglia, CTLs and NK cells contaminants. Once cultures were established, NPCs from wild- type and S0D1 G93A mice were used to differentiate astrocytes for the experiments described in the manuscript. NPC-derived astrocytes were obtained
- the cell pellet was resuspended in DMEM/F12 (Invitrogen) with 10% FBS (Invitrogen), passed through a 70 ⁇ filter and centrifuged.
- the cell pellet was resuspended in DMEM/F12 (Invitrogen) with 10% FBS (Invitrogen) and combined 1: 1 with Percoll (GE Healthcare).
- the cell/Percoll mixture was centrifuged at 20,000 xg for 30 min at 20 °C and the low buoyancy fraction (10 ml) above the red blood cell layer was collected.
- NPCs were washed and resuspended in NPC medium containing DMEM/F12 (Invitrogen) supplemented with 10% FBS (Invitrogen), 10% BIT9500 (Stem Cell Technologies), 1% N2 supplement (Invitrogen), 20 ng/ml of FGF-2 (Peprotech), 20 ng/ml of EGF (Peprotech) and 20 ng/ml of PDGF-AB (Peprotech).
- NPCs were cultured on fibronectin (Chemicon) coated plates and after 24 hours, the media was replaced with serum- free NPC medium. Half of the medium was subsequently replaced every 2 days. NPCs were passaged when 60-70% confluence was reached in about 3 to 4 weeks.
- NPCs cultures were absent of astrocytes, microglia, CTLs and NK cells contaminants.
- astrocytes differentiation was induced by withdrawal of growth factors and by supplementing the medium with 10% FBS (Invitrogen). In these conditions, astrocytes were readily generated and could be maintained for over 20 passages. Astrocytes were maintained on laminin-coated plates with media change every 3 days and passaging when cultures reached 80% confluence. A summary of the demographic information associated with NPC derived astrocytes is shown in Table 4.
- mES cells Mouse embryonic stem cells (mES cells) that express green fluorescent protein (GFP) driven by the Hb9 promoter (HBG3 cells) were used. ES cells were cultured on top of inactivated mouse fibroblasts (Millipore, Billerica, MA). MN differentiation was induced by plating 1-2 x 10 6 mES cells per 10 cm dish in the presence of 2 ⁇ retinoic acid (Sigma- Aldrich) and 2 ⁇ purmorphamine (Calbiochem, Billerica, MA). After 5 days of
- embryonic bodies were dissociated and sorted based on levels of GFP using a FACSVantage/DiVa sorter (BD Biosciences, Rockville, MD).
- Mouse NPCs were induced to differentiate into GABAergic neurons by supplementing growth medium with 0.1% FBS (Invitrogen), retinoic acid (1 ⁇ , Sigma- Aldrich), and forskolin (5 ⁇ , Sigma- Aldrich). Media were changed every day. Cultures were allowed to differentiate for 7 days prior to be used for experiments.
- astrocytes were plated at the density of 40,000 cells per well at 96-well plates coated with laminin. After 48 hours, FACS sorted GFP + MNs were plated on top of the astrocyte monolayer at a density of 2,000 cells per well.
- Co-culture was performed in MN media composed of DMEM/F12 (Invitrogen) supplemented with 5% horse serum (Equitech Bio, Kerrville, TX), 2% N2 supplement (Invitrogen), 2% B27 supplement (Invitrogen), 10 ng/ml of GDNF (Invitrogen), 10 ng/ml BDNF (Invitrogen) ,10 ng/ml CNTF (Invitrogen). Half of media was replaced every other day, with addition of fresh growth factors.
- astrocytes were plated at a density of 10,000 cells per well in 96-well plates coated with laminin.
- GFP + MNs were seeded on top of the astrocytes at a density of 10,000 cells per well.
- RT First Strand Kit Qiagen
- transcripts were amplified using the following gene-specific primers: prfl-F: 5'-
- KIRs human killer-cell immunoglobulin-like receptor transcripts
- Natural killer cells markers were assayed in S0D1 G93A and wild-type derived astrocytes by quantitative RT-PCR taking advantage of the Mouse Natural Killer Cell 96 StellARay (Lonza, Hopkinton, MA).
- This StellARay measures the expression of genes concerning many aspects of NK cell biology, including cell surface receptors, ligands, signaling molecules, adhesion molecules, mediators of cytotoxicity, cytokines and cytokine receptors.
- Quantitative RT-PCR reactions were performed in duplicate using RT 2 Real-Time SYBR Green/Rox PCR Master Mix (Qiagen) on an ABI Prism 7000 (Applied biosystems, Carlsband, CA).
- Example 17 Immunocvtochemistry Immunofluorescence staining used to visualize various antigens in cells, mouse spinal cord or paraffin embedded human spinal cords samples was performed with antibodies and respective dilutions listed in Table 2. For most antigens, samples were first incubated for 1 hour at room temperature in TBS containing 0.1% triton-X and 10% donkey serum, followed by incubation with the primary antibody for 48-72 hours at 4°C. Labeling with secondary antibodies conjugated to various fluorochromes was performed for 2 hours at room temperature. Detection of PRF1 and GZMB in paraffin embedded human tissue was achieved with biotinylated secondary antibodies, using the ABC and VectorRed Kit protocols (Vector
- Clones TRCN0000077206 CCACTCCAAGGTAGCCAATTT
- TRCN0000032742 CTATGGATATAAGGATGGTT
- GGCACTACCCGATCTATTACA GGCACTACCCGATCTATTACA
- GZMB GACCGATACTCGCGATATATT
- Viral supernatant was collected every 24 hours for the next 96 hours and viral particles were pelleted by ultra-centrifugation at 50,000 xg for 2 hours. Viral particles were aliquoted and stored frozen at -80 °C until used. Prior to addition to astrocytes, viral titer was obtained using Quick-titer lentivirus quantification kit follow manufacture's directions (CellBiolabs Inc, San Diego, CA, USA). H2K cDNA (Mm24845) was purchased from Genecopia (Rockville, MD) and delivered to MNs via lentiviral vectors delivery. H2K cDNA was cloned under the CMV promoter. RFP expression was also obtained by the presence of an IRES in the lentiviral construct.
- Motor neurons were first infected with lenti-H2K with 20 viral particles per motor neuron. H2K expression was allowed to occur for 48 prior to astrocyte plating. Astrocyte- motor neuron co-cultures were followed for an additional 120 hours. Assay was performed by plating on a 96 well with 20,000 and 60,000 motor neurons and astrocytes, respectively.
- sequences from the RNAi Consortium lentiviral shRNA library (TRC-Mml.O and TRC-Hsl.O) were screened and purchased from Thermo Scientific (Waltham, MA, USA). The following sequences were screened:
- TRCN0000077203 CATGC ATAGAGAGGCCACTA
- TRCN0000077204 GCCC ATTTGGTGGTAAGC AAT
- TRCN0000077205 CATGC ATAGAGAGGCCACTA
- TRCN0000007938 (CC A AC AC A ATTCTTCTTCC A A) ;
- TRCN0000007939 (GCCT ATGTG A AGCTCTTCTTT) ; TRCN0000007940
- TRCN0000007941 TGCCGCTTCTACAGTTTCCAT
- TRCN0000007942 ACCTGAATCATGGCCACCTAA
- TRCN0000032740 (CG AGTTTCTT ATCCTGG AT A A) ; TRCN0000032741
- TRCN0000032742 (CCTATGGATATAAGGATGGTT); TRCN0000032743 (CAGACTATAATCCTAAGACAT) Human: TRCN0000006445 (CGAATCTGACTTACGCCATTA); TRCN0000006446 (GCTT ATCTT ATG ATCTGGG AT) ; TRCN0000006447
- TRCN0000077206 CCACTCCAAGGTAGCCAATTT
- TRCN0000007942 ACCTGAATCATGGCCACCTAA
- ShRNA sequences were delivered via viral vectors that were produced by CaCl 2 transient transfection of 293 cells and concentrated by ultracentrifugation. Astrocytes were infected over a 24 hour period using 20 viral particles per cell. ShRNAs were allowed to be expressed in astrocytes for 96 hours prior to motor neuron co-culture.
- wild-type astrocytes were plated on laminin- coated transwell (Corning, Lowell, MA) using MN media. After 24 hours, sorted GFP + MNs were plated on a separate laminin-coated 96 well plate in media conditioned by wild-type astrocytes. 4 hours later, a transwell containing wild- type astrocytes was transferred into MN plate after verification that all MNs were fully attached and were starting to show neuritic extensions. One day later, transwell of wild- type astrocytes was removed and MNs were infected with lenti virus (40 viral particles per MN) encoding H2K cDNA expression construct. 12 hours post-infection, co-culture with wild-type astrocytes by transwell was resumed. After 72 hours, transwell was removed and co-culture experiments initiated.
- laminin- coated transwell Corning, Lowell, MA
- sorted GFP + MNs were plated on a separate laminin-coated 96 well plate in media
- Crude protein cell lysates were obtained using the Tissue Protein Extracting Reagent (Pierce, Rockford, IL) following manufacture recommendations. Per lane, 20 ⁇ g of protein was loaded onto a NuPAGE 4-12% Bis-Tris gel (Invitrogen). Proteins were separated by electrophoresis at 150 V for 1 hour and then transferred to an Invitrolon PVDF membrane (Invitrogen). The membrane was blocked in 5% nonfat milk, 0.1% Tween-20 in TBS for 1 hour, followed by overnight incubation with primary antibodies. Bound primary antibody was detected by horseradish peroxidase conjugated secondary antibody (Jackson ImmunoResearch, West Grove, PA) followed by chemiluminescence using ECLTM Western Blotting Detection Reagents (GE Healthcare).
- AAV9 virus was produced encoding an shRNA or scrambled shRNA for Perforin and delivered into the tail vein of SOD G93A animals at a titer of 3 x 10 11 DNase Resistant Particles/ml at 3 weeks of age. Animals were monitored daily and assessed for ability to right themselves. A "death event” was entered when animals could no longer "right” themselves within 30 seconds after the animal was placed on its back. "Death event” classification was performed by 2 individuals who were blinded to treatment at the time of assessment. Testing of hindlimb grip strength was performed using a grip strength meter and testing weekly.
- mice are allowed to hold on to the platform with their rear legs and the animals are pulled until they let go of the platform and the maximal force generated is recorded.
- SODl G93A mice treated with shRNA for Perforin exhibited increased percent survival over time and increased hind limb grip strength versus controls.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Biomedical Technology (AREA)
- Epidemiology (AREA)
- Biochemistry (AREA)
- Immunology (AREA)
- Biotechnology (AREA)
- Wood Science & Technology (AREA)
- General Engineering & Computer Science (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Gastroenterology & Hepatology (AREA)
- Biophysics (AREA)
- Cell Biology (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Toxicology (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Virology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Neurology (AREA)
- Orthopedic Medicine & Surgery (AREA)
- Physical Education & Sports Medicine (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
Priority Applications (5)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US14/428,765 US9539307B2 (en) | 2012-09-17 | 2013-09-17 | Compositions and methods for treating amyotrophic lateral sclerosis |
| AU2013315007A AU2013315007A1 (en) | 2012-09-17 | 2013-09-17 | Compositions and methods for treating amyotrophic lateral sclerosis |
| JP2015532145A JP2015529685A (ja) | 2012-09-17 | 2013-09-17 | 筋萎縮性側索硬化症の処置のための組成物および方法 |
| EP13837504.3A EP2895606A4 (en) | 2012-09-17 | 2013-09-17 | COMPOSITIONS AND METHOD FOR THE TREATMENT OF AMYOTROPHER LATERAL SCLEROSIS (ALS) |
| CA2885216A CA2885216A1 (en) | 2012-09-17 | 2013-09-17 | Compositions and methods for treating amyotrophic lateral sclerosis |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201261702030P | 2012-09-17 | 2012-09-17 | |
| US61/702,030 | 2012-09-17 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2014043696A2 true WO2014043696A2 (en) | 2014-03-20 |
| WO2014043696A3 WO2014043696A3 (en) | 2014-06-19 |
Family
ID=50278875
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2013/060153 Ceased WO2014043696A2 (en) | 2012-09-17 | 2013-09-17 | Compositions and methods for treating amyotrophic lateral sclerosis |
Country Status (6)
| Country | Link |
|---|---|
| US (1) | US9539307B2 (cg-RX-API-DMAC7.html) |
| EP (1) | EP2895606A4 (cg-RX-API-DMAC7.html) |
| JP (1) | JP2015529685A (cg-RX-API-DMAC7.html) |
| AU (1) | AU2013315007A1 (cg-RX-API-DMAC7.html) |
| CA (1) | CA2885216A1 (cg-RX-API-DMAC7.html) |
| WO (1) | WO2014043696A2 (cg-RX-API-DMAC7.html) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2016122943A3 (en) * | 2015-01-26 | 2016-09-22 | The Research Institute At Nationwide Children's Hospital | Compounds, compositions, and methods for using hla-f |
Families Citing this family (15)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US8524220B1 (en) | 2010-02-09 | 2013-09-03 | David Gordon Bermudes | Protease inhibitor: protease sensitivity expression system composition and methods improving the therapeutic activity and specificity of proteins delivered by bacteria |
| US8771669B1 (en) | 2010-02-09 | 2014-07-08 | David Gordon Bermudes | Immunization and/or treatment of parasites and infectious agents by live bacteria |
| US9597379B1 (en) | 2010-02-09 | 2017-03-21 | David Gordon Bermudes | Protease inhibitor combination with therapeutic proteins including antibodies |
| US9737592B1 (en) | 2014-02-14 | 2017-08-22 | David Gordon Bermudes | Topical and orally administered protease inhibitors and bacterial vectors for the treatment of disorders and methods of treatment |
| WO2016077687A1 (en) | 2014-11-14 | 2016-05-19 | Voyager Therapeutics, Inc. | Compositions and methods of treating amyotrophic lateral sclerosis (als) |
| KR20230145206A (ko) | 2014-11-14 | 2023-10-17 | 보이저 테라퓨틱스, 인크. | 조절성 폴리뉴클레오티드 |
| US10676723B2 (en) | 2015-05-11 | 2020-06-09 | David Gordon Bermudes | Chimeric protein toxins for expression by therapeutic bacteria |
| KR20190006952A (ko) * | 2016-03-31 | 2019-01-21 | 라이언 티씨알 피티이. 리미티드 | 외인성 바이러스-특이적 t 세포 수용체 (tcr)를 발현하는 비-활성화된 t 세포 |
| KR20240056729A (ko) | 2016-05-18 | 2024-04-30 | 보이저 테라퓨틱스, 인크. | 조절성 폴리뉴클레오티드 |
| US11129906B1 (en) | 2016-12-07 | 2021-09-28 | David Gordon Bermudes | Chimeric protein toxins for expression by therapeutic bacteria |
| US11180535B1 (en) | 2016-12-07 | 2021-11-23 | David Gordon Bermudes | Saccharide binding, tumor penetration, and cytotoxic antitumor chimeric peptides from therapeutic bacteria |
| JP2020518258A (ja) | 2017-05-05 | 2020-06-25 | ボイジャー セラピューティクス インコーポレイテッドVoyager Therapeutics,Inc. | 筋萎縮性側索硬化症(als)治療組成物および方法 |
| TW202413649A (zh) | 2017-10-16 | 2024-04-01 | 美商航海家醫療公司 | 肌萎縮性脊髓側索硬化症(als)之治療 |
| EP3697908A1 (en) | 2017-10-16 | 2020-08-26 | Voyager Therapeutics, Inc. | Treatment of amyotrophic lateral sclerosis (als) |
| US12285437B2 (en) | 2019-10-30 | 2025-04-29 | The Research Foundation For The State University Of New York | Reversing the undesirable pH-profile of doxorubicin via activation of a disubstituted maleamic acid prodrug at tumor acidity |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20040009479A1 (en) | 2001-06-08 | 2004-01-15 | Jay Wohlgemuth | Methods and compositions for diagnosing or monitoring auto immune and chronic inflammatory diseases |
| US6723315B1 (en) | 1996-09-13 | 2004-04-20 | Aventis Pharma S.A. | Method for treating amyotrophic lateral sclerosis |
| US20100152053A1 (en) | 2006-04-26 | 2010-06-17 | Sirs-Lab Gmbh | Method for in vitro monitoring of postoperative changes following liver transplantation |
| US20120177605A1 (en) | 2008-12-19 | 2012-07-12 | Nationwide Children's Hospital Inc. | Delivery of Polynucleotides Across the Blood-Brain-Barrier Using Recombinant AAV9 |
Family Cites Families (34)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5173414A (en) | 1990-10-30 | 1992-12-22 | Applied Immune Sciences, Inc. | Production of recombinant adeno-associated virus vectors |
| PT728214E (pt) | 1993-11-09 | 2004-11-30 | Ohio Med College | Linhas celulares estaveis capazes de expressar o gene de replicacao do virus adeno-associado |
| WO1995013365A1 (en) | 1993-11-09 | 1995-05-18 | Targeted Genetics Corporation | Generation of high titers of recombinant aav vectors |
| US5658785A (en) | 1994-06-06 | 1997-08-19 | Children's Hospital, Inc. | Adeno-associated virus materials and methods |
| US5856152A (en) | 1994-10-28 | 1999-01-05 | The Trustees Of The University Of Pennsylvania | Hybrid adenovirus-AAV vector and methods of use therefor |
| CA2207927A1 (en) | 1994-12-06 | 1996-06-13 | Targeted Genetics Corporation | Packaging cell lines for generation of high titers of recombinant aav vectors |
| FR2737730B1 (fr) | 1995-08-10 | 1997-09-05 | Pasteur Merieux Serums Vacc | Procede de purification de virus par chromatographie |
| WO1997008298A1 (en) | 1995-08-30 | 1997-03-06 | Genzyme Corporation | Chromatographic purification of adenovirus and aav |
| US6632670B1 (en) | 1995-09-08 | 2003-10-14 | Genzyme Corporation | AAV vectors for gene therapy |
| US5910434A (en) | 1995-12-15 | 1999-06-08 | Systemix, Inc. | Method for obtaining retroviral packaging cell lines producing high transducing efficiency retroviral supernatant |
| JP2001500497A (ja) | 1996-09-06 | 2001-01-16 | トラステイーズ・オブ・ザ・ユニバーシテイ・オブ・ペンシルベニア | 組換えアデノ随伴ウイルスに指図される遺伝子治療の方法 |
| CN1181298A (zh) | 1996-10-28 | 1998-05-13 | 赵幼仪 | 开关型程控快速活扳手 |
| DK1009808T3 (da) | 1997-09-05 | 2013-01-21 | Genzyme Corp | Fremgangsmåder til generering af hjælper-frie præparater af rekombinante aav-vektorer med høj titer |
| US6566118B1 (en) | 1997-09-05 | 2003-05-20 | Targeted Genetics Corporation | Methods for generating high titer helper-free preparations of released recombinant AAV vectors |
| US6258595B1 (en) | 1999-03-18 | 2001-07-10 | The Trustees Of The University Of Pennsylvania | Compositions and methods for helper-free production of recombinant adeno-associated viruses |
| US7056502B2 (en) | 2000-04-28 | 2006-06-06 | The Trustees Of The University Of Pennsylvania | Recombinant aav vectors with AAV5 capsids and AAV5 vectors pseudotyped in heterologous capsids |
| EA005921B1 (ru) | 2000-08-07 | 2005-08-25 | Женсет | Ген и белок, ассоциированные с шизофренией |
| US20050019915A1 (en) | 2001-06-21 | 2005-01-27 | Bennett C. Frank | Antisense modulation of superoxide dismutase 1, soluble expression |
| US9233131B2 (en) | 2003-06-30 | 2016-01-12 | The Regents Of The University Of California | Mutant adeno-associated virus virions and methods of use thereof |
| US9441244B2 (en) | 2003-06-30 | 2016-09-13 | The Regents Of The University Of California | Mutant adeno-associated virus virions and methods of use thereof |
| WO2005096781A2 (en) | 2004-04-06 | 2005-10-20 | University Of Massachusetts | Methods and compositions for treating gain-of-function disorders using rna interference |
| WO2006066203A2 (en) | 2004-12-16 | 2006-06-22 | Alsgen, Llc | Small interfering rna (sirna) molecules for modulating superoxide dismutase (sod) |
| EP2019143A1 (en) | 2007-07-23 | 2009-01-28 | Genethon | CNS gene delivery using peripheral administration of AAV vectors |
| EP2058401A1 (en) | 2007-10-05 | 2009-05-13 | Genethon | Widespread gene delivery to motor neurons using peripheral injection of AAV vectors |
| CA2715289C (en) | 2008-02-11 | 2019-12-24 | Rxi Pharmaceuticals Corporation | Modified rnai polynucleotides and uses thereof |
| US20110053861A1 (en) | 2008-03-12 | 2011-03-03 | Intradigm Corporation | Compositions comprising nuclear factor-kappa b (nf-kb) sirna and methods of use |
| EP2561073B1 (en) | 2010-04-23 | 2016-08-24 | University of Massachusetts | Cns targeting aav vectors and methods of use thereof |
| KR101235256B1 (ko) * | 2010-09-13 | 2013-02-21 | 서울대학교산학협력단 | miRNA를 타겟으로 한 신경퇴행성 질환 치료 |
| WO2012058220A2 (en) | 2010-10-26 | 2012-05-03 | University Of Massachusetts | Anti-sod1 antibodies and uses thereof |
| US20130344081A1 (en) | 2011-03-07 | 2013-12-26 | The University Of Tokushima | Method of treating amyotrophic lateral sclerosis |
| US9434928B2 (en) | 2011-11-23 | 2016-09-06 | Nationwide Children's Hospital, Inc. | Recombinant adeno-associated virus delivery of alpha-sarcoglycan polynucleotides |
| MX367100B (es) | 2012-02-17 | 2019-08-05 | The Children´S Hospital Of Philadelphia | Composiciones del vector aav y metodos para su transferencia genetica a celulas, organos y tejidos. |
| EP2901515B1 (en) | 2012-09-28 | 2019-05-22 | Cabot Corporation | Method of making active material compositions comprising high surface area carbonaceous materials |
| KR102121086B1 (ko) | 2012-11-01 | 2020-06-09 | 팩터 바이오사이언스 인크. | 세포에서 단백질을 발현시키는 방법들과 생성물들 |
-
2013
- 2013-09-17 US US14/428,765 patent/US9539307B2/en active Active
- 2013-09-17 EP EP13837504.3A patent/EP2895606A4/en not_active Withdrawn
- 2013-09-17 CA CA2885216A patent/CA2885216A1/en not_active Abandoned
- 2013-09-17 WO PCT/US2013/060153 patent/WO2014043696A2/en not_active Ceased
- 2013-09-17 JP JP2015532145A patent/JP2015529685A/ja active Pending
- 2013-09-17 AU AU2013315007A patent/AU2013315007A1/en not_active Abandoned
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6723315B1 (en) | 1996-09-13 | 2004-04-20 | Aventis Pharma S.A. | Method for treating amyotrophic lateral sclerosis |
| US20040009479A1 (en) | 2001-06-08 | 2004-01-15 | Jay Wohlgemuth | Methods and compositions for diagnosing or monitoring auto immune and chronic inflammatory diseases |
| US20100152053A1 (en) | 2006-04-26 | 2010-06-17 | Sirs-Lab Gmbh | Method for in vitro monitoring of postoperative changes following liver transplantation |
| US20120177605A1 (en) | 2008-12-19 | 2012-07-12 | Nationwide Children's Hospital Inc. | Delivery of Polynucleotides Across the Blood-Brain-Barrier Using Recombinant AAV9 |
Non-Patent Citations (6)
| Title |
|---|
| C.-A. LEWIS ET AL., NEUROL. RES. INT., vol. 23, 2012, pages 5197 - 8 |
| GASQUE ET AL., J. EXP MED., vol. 187, no. 4, 1998, pages 451 - 60 |
| HAIDET-PHILLIPS, NATURE BIOTECHNOL., vol. 29, 2011, pages 824 - 8 |
| ILZECKA, CLIN. BIOCHEM., vol. 44, 2011, pages 650 - 53 |
| MARCHETTO ET AL., CELL STEM CELL, vol. 2, 2008, pages 649 - 57 |
| See also references of EP2895606A4 |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2016122943A3 (en) * | 2015-01-26 | 2016-09-22 | The Research Institute At Nationwide Children's Hospital | Compounds, compositions, and methods for using hla-f |
Also Published As
| Publication number | Publication date |
|---|---|
| US20150231207A1 (en) | 2015-08-20 |
| CA2885216A1 (en) | 2014-03-20 |
| JP2015529685A (ja) | 2015-10-08 |
| EP2895606A2 (en) | 2015-07-22 |
| AU2013315007A1 (en) | 2015-04-09 |
| WO2014043696A3 (en) | 2014-06-19 |
| US9539307B2 (en) | 2017-01-10 |
| EP2895606A4 (en) | 2016-07-06 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US9539307B2 (en) | Compositions and methods for treating amyotrophic lateral sclerosis | |
| Luoni et al. | Whole brain delivery of an instability-prone Mecp2 transgene improves behavioral and molecular pathological defects in mouse models of Rett syndrome | |
| Zhou et al. | Tat-NTS peptide protects neurons against cerebral ischemia-reperfusion injury via ANXA1 SUMOylation in microglia | |
| US9725719B2 (en) | Compositions and methods for inhibiting NF-κB and SOD-1 to treat amyotrophic lateral sclerosis | |
| EP2841067A2 (en) | A drug screening platform for rett syndrome | |
| EP3638304B1 (en) | Engineered oncolytic zika virus for use in the treatment of cancer | |
| US20240108758A1 (en) | Compounds, compositions, and methods for using hla-f | |
| JP2018517660A (ja) | 周皮細胞長鎖非コーディングrna | |
| US10550388B2 (en) | Targeting pleiotrophin signaling to limit high-grade glioma invasion | |
| KR20200136939A (ko) | 천식 또는 알레르기성 질환을 치료하는 방법 | |
| EP1278537B1 (en) | Compositions for stimulating nervous system regeneration and repair by regulating arginase i and polyamine synthesis | |
| EP2904009B1 (en) | Compounds for treating the remyelination blockade in diseases associated with the expression of herv-w envelope protein | |
| CN113056560B (zh) | 能够实现反馈的合成基因、靶点种子匹配盒及其应用 | |
| CA2626361C (en) | Pharmaceutical compositions and diagnostic methods for inflammatory skin diseases, disorders or conditions | |
| JP7716987B2 (ja) | Tert活性化療法を伴う方法および組成物 | |
| US8618113B2 (en) | Treatment for demyelinating disease | |
| KR101785155B1 (ko) | Tim-3을 표적으로 하는 뇌손상 질환 치료용 조성물 및 이의 스크리닝 방법 | |
| JP6653054B2 (ja) | Tim−3をターゲットとする脳損傷疾患治療用組成物及びこのスクリーニング方法 | |
| US10876116B2 (en) | Anti-ARID3a treatments for inflammatory disorders | |
| Clarke | Investigating stress responses in models of Amyotrophic Lateral Sclerosis | |
| EP4642913A2 (en) | Splice-switching oligonucleotides for treating syngap1-associated disorders | |
| WO2025015328A2 (en) | Increasing nfe2l1 activity or expression as therapy for eye disorders | |
| WO2023077133A2 (en) | Controlling homeostatic regulatory circuitry in hypothalamus | |
| JP2024542196A (ja) | 黄斑変性症を処置するための材料及び方法 | |
| WO2025097185A1 (en) | Compositions and methods for preventing microbial-mediated disease |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 13837504 Country of ref document: EP Kind code of ref document: A2 |
|
| ENP | Entry into the national phase |
Ref document number: 2885216 Country of ref document: CA |
|
| ENP | Entry into the national phase |
Ref document number: 2015532145 Country of ref document: JP Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 14428765 Country of ref document: US |
|
| ENP | Entry into the national phase |
Ref document number: 2013315007 Country of ref document: AU Date of ref document: 20130917 Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2013837504 Country of ref document: EP |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 13837504 Country of ref document: EP Kind code of ref document: A2 |