WO2014022853A1 - Complex chromosome engineering for production of human antibodies in transgenic animals - Google Patents
Complex chromosome engineering for production of human antibodies in transgenic animals Download PDFInfo
- Publication number
- WO2014022853A1 WO2014022853A1 PCT/US2013/053618 US2013053618W WO2014022853A1 WO 2014022853 A1 WO2014022853 A1 WO 2014022853A1 US 2013053618 W US2013053618 W US 2013053618W WO 2014022853 A1 WO2014022853 A1 WO 2014022853A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- human
- ungulate
- vector
- heavy chain
- antibody heavy
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/8509—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells for producing genetically modified animals, e.g. transgenic
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
- C12N15/90—Stable introduction of foreign DNA into chromosome
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K67/00—Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
- A01K67/027—New or modified breeds of vertebrates
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K67/00—Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
- A01K67/027—New or modified breeds of vertebrates
- A01K67/0275—Genetically modified vertebrates, e.g. transgenic
- A01K67/0278—Knock-in vertebrates, e.g. humanised vertebrates
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/46—Hybrid immunoglobulins
- C07K16/461—Igs containing Ig-regions, -domains or -residues form different species
- C07K16/462—Igs containing a variable region (Fv) from one specie and a constant region (Fc) from another
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2207/00—Modified animals
- A01K2207/15—Humanized animals
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2217/00—Genetically modified animals
- A01K2217/07—Animals genetically altered by homologous recombination
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2217/00—Genetically modified animals
- A01K2217/07—Animals genetically altered by homologous recombination
- A01K2217/072—Animals genetically altered by homologous recombination maintaining or altering function, i.e. knock in
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2217/00—Genetically modified animals
- A01K2217/07—Animals genetically altered by homologous recombination
- A01K2217/075—Animals genetically altered by homologous recombination inducing loss of function, i.e. knock out
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2227/00—Animals characterised by species
- A01K2227/10—Mammal
- A01K2227/101—Bovine
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2267/00—Animals characterised by purpose
- A01K2267/01—Animal expressing industrially exogenous proteins
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/8509—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells for producing genetically modified animals, e.g. transgenic
- C12N2015/8518—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells for producing genetically modified animals, e.g. transgenic expressing industrially exogenous proteins, e.g. for pharmaceutical use, human insulin, blood factors, immunoglobulins, pseudoparticles
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/20—Pseudochromosomes, minichrosomosomes
- C12N2800/208—Pseudochromosomes, minichrosomosomes of mammalian origin, e.g. minichromosome
Definitions
- Human antibodies also known as intravenous immunoglobulin (IVIG), obtained from donated human plasma with or without immunization of specific antigens, have been used therapeutically for many years.
- IVIG intravenous immunoglobulin
- human plasma-derived IVIG has also entailed substantial challenges and restrictions, mainly due to the voluntary nature of donation from uncontrollable human populations.
- human-origin antigens such as cancer cells, due to immune tolerance in humans.
- improved systems for obtaining human antibodies are needed.
- the invention provides a human artificial chromosome (HAC) vector comprising genes encoding:
- the one or more human antibody heavy chains comprise a human IgG antibody heavy chain.
- the IgG heavy chain comprises an IgGl antibody heavy chain.
- the one or more human antibody heavy chains comprise a human IgA antibody heavy chain.
- the one or more human antibody heavy chains comprise a human IgM antibody heavy chain.
- the one or more human antibody heavy chains comprise IgGl, IgG2, IgG3, IgG4, IgAl, IgA2, IgE and IgD human antibody heavy chains.
- the HAC vector comprises a gene encoding an ungulate- derived IgM heavy chain constant region, wherein the ungulate-derived IgM heavy chain constant region is expressed as a chimera with a human IgM heavy chain variable region.
- the ungulate-derived IgM heavy chain constant region is a bovine-derived IgM heavy chain constant region.
- the one or more human antibody heavy chains comprise a human IgG antibody heavy chain, wherein a transmembrane domain and an intracellular domain of a constant region of the human IgG heavy antibody chain are replaced with a transmembrane domain and an intracellular domain of an ungulate- derived IgG antibody heavy chain constant region.
- the human IgG antibody heavy chain comprises a human IgGl antibody heavy chain.
- the ungulate-derived IgG antibody heavy chain constant region comprise a bovine-derived IgG antibody heavy chain constant region.
- the ungulate-derived class switch regulatory element comprises an ⁇ -Sy class switch regulatory element.
- the ⁇ -Sy class switch regulatory element comprises ⁇ -Syi.
- each class switch regulatory element of the genes encoding the one or more human antibody heavy chains is replaced with an ungulate-derived class switch regulatory element.
- the ungulate-derived class switch regulatory element(s) are bovine-derived class switch regulatory elements.
- the HAC vector comprises one or more genes encoding a human antibody surrogate light chain selected from the group consisting of VpreB l, VpreB3 and ⁇ 5 human antibody surrogate light chains.
- the HAC further comprises an ungulate-derived enhancer operatively linked to one or more genes encoding the one or more human antibody heavy chains.
- the enhancer comprises a 3 ⁇ enhancer.
- the present invention provides a transgenic ungulate comprising a HAC vector according to any embodiment or combination of
- the transgenic ungulate is a transgenic bovine.
- the present invention provides transgenic ungulates comprising genes integrated into its genome encoding:
- At least one class switch regulatory element of the genes encoding the one or more human antibody heavy chains is replaced with an ungulate-derived class switch regulatory element.
- transgenic ungulates of this third aspect of the invention may comprise any embodiment or combination of embodiments of genes, class switch regulatory elements, and/or enhancers as described for the HACs of the first aspect of the invention, but where the genes, class switch regulatory elements, and/or enhancers are integrated into its genome.
- the present invention provides methods of producing a human antibody, comprising:
- the recovering comprises:
- the lymphocytes from the transgenic ungulate are isolated from lymph nodes of the transgenic ungulate.
- the transgenic ungulate is hyperimmunized with the target antigen.
- the invention provides compositions comprising a human antibody produced by the methods of any embodiment or combination of embodiments of the fourth aspect of the invention.
- Figure 1 shows the structure of the bovine IGLJ-IGLC gene cluster and its cluster deletion strategy.
- A Genomic organization of the bovine IGLJ-IGLC gene cluster.
- B Structure of targeting vectors and a strategy for the cluster deletion.
- the plasmid pC ⁇ CAGzeoPuro loxP DT was a first knockout (KO) vector to place a loxP site 5' outside of the IGLJ1 gene, composed of 9.9 kb and 3.1 kb genomic DNA as a long and short arm, respectively, a loxP sequence, the CAG promoter-driven zeocin-resistant gene (zeo), DT-A and promoter-less puromycin-resistant gene (puro).
- the plasmid pC ⁇ CAG loxP neoDT was a second KO vector to place another loxP site 3' outside of the IGLC5 gene, composed of 8.7 kb and 1.5 kb genomic DNA as a long and short arm, respectively, a loxP sequence, the chicken ⁇ -actin promoter-driven neomycin-resistant gene (ne ), DT-A, SV40 polyA and CAG promoter.
- the second KO vector was co- transfected with a Cre-expression plasmid to bring about the cluster deletion, which reconstitutes the CAG promoter-driven puro gene.
- Figure 2 shows the generation of male and female bovine
- TKO triple knock out, "TKO" cell lines.
- A Breeding pedigree to establish the TKO cell lines. The male cell line 6939 and female cell line 3427 were sequentially targeted to obtain IGHM ⁇ l+ IGHMLr' ⁇ and IGHM ⁇ ' ⁇ animals, respectively, for the first round of breeding, which generated both male and female
- IGHM ⁇ ! ⁇ IGHMLr l+ cell lines were subjected to the cluster deletion to generate IGHM ⁇ ⁇ IGHMLF + IGL ⁇ + animals for the second round of breeding, which led to the establishment of the male and female TKO cell lines.
- B Generation of male and female IGHM ⁇ ' ⁇ IGHMLr /+ cell lines. In the male cell line
- IGHM ⁇ I+ IGHMLF I ⁇ originated from the cell line 6939, the two IGHML1 alleles, E/ and u, and the one IGHM allele, AY, were knocked out by the targeting vectors
- each fetus was subjected to genomic PCR (AYKObsr-F2R2, ayKOhyg-F2R2, Neo-F2R2 or Puro-F2R2) to identify the genotype
- the negative PCR, R-F2 x R-Rl was done to double check the homologous recombination because it can be only amplified from the wild type allele; J481 amplified it both from the alleles A and D, showing the double peaks (T for the allele A and G for the allele D).
- Colony 27 showed only "G", demonstrating that the allele A was specifically knocked out while Colony 22 showed only "T”, demonstrating that the allele D was specifically knocked out.
- the fetal cell line, K655-1 was established, which was positive with the CLlpuro-F2R2.
- the male and female IGHM ⁇ ⁇ IGHMLF + IGL ⁇ + animals were subjected to the second round of breeding.
- Each fetus was examined by a series of genomic PCR, L001-F1 x L002 x R2 (to amplify the IGLC genes), £ ⁇ - ⁇ 1 ⁇ 2 (to amplify the IGHM or IGHML1 constant region gene), the cluster deletion-specific CAGpuro-F3R3 and ⁇ - ⁇ 14 ⁇ 14 (to amplify the targeted IGHM or IGHML1 gene).
- FIG. 3 shows the concept and construction of the KcHACA and cKSL-HACA vectors.
- A Structure of the KcHACA and cKSL-HACA vectors.
- the KcHACA vector is a derivative of the original KHAC where part of the hIGHM gene constant region, the CHI through TM domains, is bovinized with the bovine-origin sequence. Because of this modification, the KcHACA vector expresses the bovinized, chimeric IgM ⁇ cIgM (CHI) ⁇ protein on pre-B/B cell surface. Through the bovinized CHI domain, the cIgM (CHI) better pair with bovine surrogate light chain (bSLC)/light chain (bLC).
- bSLC bovine surrogate light chain
- the bovinized TM1-TM2 domains more efficiently interact with bovine Ig- ⁇ / ⁇ complex (blg- ⁇ / ⁇ ) for better pre-BCR/BCR signaling.
- the cKSL- HACA vector is composed of the three different human chromosome (hChr) fragments, hChrl4 (14D), hChr2 and hChr22 containing the entire human IGL and surrogate light chain (hVPREBl and IGLLI) loci.
- hIGHM gene constant region part of the hIGHM gene constant region, the CH2 through TM domains, is bovinized to express the cIgM (CH2) protein.
- this cIgM may preferentially pair with human surrogate light chain (hSLC, hVPREBl/hlGLLl) to mimic human pre-BCR but with the bovinized TM1-TM2 domain interacting better with blg- ⁇ / ⁇ for pre-BCR signal transduction.
- hSLC human surrogate light chain
- hVPREBl/hlGLLl human surrogate light chain
- CH2D4 DT40 clone
- CH2D4 DT40 clone
- Figure 4 shows the characterization of the KHAC, CKSL-HACA and KcHAC IGHM ⁇ ⁇ IGHML1 ⁇ ⁇ double knockout (DKO) calves.
- A Representative flow cytometry analysis of peripheral blood monocytes (PBMCs) from a series of HAC/DKO calves at newborn stage. For IgM detection, anti-hlgM or anti-blgM antibody was used for the KHAC and cKSL-HACA/DKO calves or for the KcHAC/DKO calves, respectively. From left to right panels, PBMCs were stained for IgM alone,
- IgM/bCD21, IgM/blg , IgM/blgK and IgM/hlgK Each bold number represents percentages of cells in Ql (IgM alone) or Q2 (IgM/bCD21, IgM/blg , IgM/blgK and IgM/hlgK). NA; not applicable (because, at that time, the anti-blgK antibody was not available).
- B,C Serum concentrations of (B) total hlgG ⁇ g/ml) and (C) fully hlgG/hlgK ⁇ g/ml) in a series of HAC/DKO calves at 5-6 months of age.
- n number of animals analyzed for each genotype. For each genotype, values of minimum, first quartile, median, third quartile and maximum were calculated and plotted in each graph. The values of calf 468 were indicated in dashed circle.
- D,E Serum
- D fully hlgG/hlgK (%)/total hlgG
- E hIgGl/hIgG2 ratio in a series of HAC/DKO calves at 5-6 months of age.
- n number of animals analyzed for each genotype. For each genotype, values of minimum, first quartile, median, third quartile and maximum were calculated and plotted in the left graph.
- Figure 5 shows the construction of the isHAC (isKcHACA) and istHAC.
- the hI y i-hS y i class switch regulatory element was bovinized to build the isHAC or isKcHACA vector, respectively.
- the istHAC vector is a derivative of the isHAC vector where the IGHGl gene
- transmembrane/cytoplasmic domains were also bovinized.
- Figure 6 shows the characterization of the isHAC/TKO, istHAC/TKO and isKcHACA/TKO calves.
- A Lack of the bIGL expression in the HAC/TKO calves.
- PBMCs from five KcHACA/TKO calves (Calf 1-5) at newborn stage were subjected to RT-PCR to confirm the lack of the bIGL expression.
- the primer pairs, blgL-Ld-F lx blgL-C-R and L003-F2 x L004-R2 are to amplify the VJ-rearranged bIGL and constant region IGLC (bC%) genes, respectively.
- the primer pair, blgK-FR is to amplify the VJ-rearranged bIGK gene.
- N negative control
- P positive control.
- B Representative flow cytometry analysis of PBMCs from a series of HAC/TKO calves at newborn stage. For IgM detection, anti-hlgM or anti-blgM antibody was used for the isHAC, istHAC and cKSL-HACA/TKO calves or for the isKcHACA and KcHACA/TKO calves, respectively. From left to right panels, PBMCs were stained for IgM alone,
- IgM/bCD21, IgM/blg , IgM/blgK and IgM/hlgK Each bold number represents percentages of cells in Ql (IgM alone) or Q2 (IgM/bCD21, IgM/blg , IgM/blgK and IgM/hlgK).
- C Box- whisker plots of serum concentrations of total hlgG (g/1) in a series of HAC/TKO and HAC/DKO calves at 5-6 months of age.
- calf 468 was indicated with an arrow. For each genotype, values of min, first quartile, median, third quartile and max were calculated and plotted in each graph.
- F Panel shows 95 % family-wise confidence level in each pair comparison.
- G Box-whisker plots of serum fully hlgG/hlgK (%)/total hlgG in a series of HAC/TKO and HAC/DKO calves at 5-6 months of age. Dots represent outliers.
- the value of calf 468 was indicated with an arrow. For each genotype, values of min, first quartile, median, third quartile and max were calculated and plotted in each graph.
- values of min, first quartile, median, third quartile and max were calculated and plotted in the left graph.
- J Panel shows 95 % family -wise confidence level in each pair comparison in difference in proportions of hlgGl-dominancy.
- a separated panel labeled as "V1D0" is flow cytometry result of the human carcinoma cells stained with serum of the istHAC/TKO calf 2 at day 0 after VI (V1D0), where serum dilution factor is 1 : 1280.
- FIG. 7 shows comparative genomic hybridization (CGH) analysis on fibroblasts derived from the KRAC/IGHM ⁇ ⁇ IGHML 1 ⁇ ⁇ (DKO) fetuses and calf 468. More extensive analysis of calf 468 using CGH analysis on the KHAC vector present in the cell line that generated calf 468 showed some distinct structural alteration.
- A254-2 is the fetal fibroblast cell line that generated calf 468.
- A254-2, G827-1, K439-1 and K439-2 were generated through independent MMCT events of the KHAC vector from the CHO cell line KC1-1 to DKO cell lines. DNA from the fetal cell line K439-1 was used as a reference. Only A254-2 and the calf 468 showed the distinct CGH pattern around the 3 ⁇ ⁇ 2 region on the hChrl4 (dashed circle).
- Figure 8 shows DNA sequence alignment between the bovine IGLJ2-IGLC2 and IGLJ3-IGLC3 genes.
- A Intron DNA sequence alignment between the bovine IGLJ2-IGLC2 and IGLJ3-IGLC3 genes.
- JL2-CL2 SEQ ID NO: 147) and "JO- CO” (SEQ ID NO: 148) corresponds to intronic sequence of the IGLJ2-IGLC2 and IGLJ3-IGLC3 genes, respectively.
- B 3'UTR DNA sequence alignment between the bovine IGLC2 and IGLC3 genes.
- Figure 9 shows the deduced structure of the bovine IGH gene cluster on the bChr21.
- a BAC clone 22 '-A 16 seemed to contain part of the IGH variable region and the IGHML1 through the C yl region.
- a BAC clone 517-B22 appeared to cover the IGHM through the C a region.
- a BAC clone 382-F 19 is likely to include the C y2 through the 3 ⁇ ⁇ region.
- the size of the three BAC clones contig is estimated to be around 380 kb in length.
- Figure 10 shows genotyping of the IGHM ⁇ ⁇ IGHML1 ⁇ ⁇ IGL ⁇ ⁇ (TKO) cell lines.
- the negative PCR ⁇ - ⁇ 2 ⁇ 2
- BC ⁇ KO-F14R14 was implemented.
- the negative PCR L001-F x L002-R, was done to confirm the absence of the IGLC genes.
- the positive PCR, CAGpuro-F3R3, specific to the cluster deletion was carried out.
- Figure 11 shows the amino acid sequence alignment of human, bovine and mouse
- IgM human SEQ ID NO: 151, bovine SEQ ID NO: 152 and mouse SEQ ID NO: 153
- B VpreBl
- human SEQ ID NO: 154 human SEQ ID NO: 155 and mouse SEQ ID NO: 156
- C ⁇ 5 (human SEQ ID NO: 157, bovine SEQ ID NO: 158 and mouse SEQ ID NO: 159)
- D Ig-a (human SEQ ID NO: 160, bovine SEQ ID NO: 161 and mouse SEQ ID NO: 162)
- E Ig- ⁇ (human SEQ ID NO: 163, bovine SEQ ID NO: 164 and mouse SEQ ID NO: 165) among human, bovine and mouse.
- Each percentage shows homology, h, human, b, bovine, m; mouse. Shaded amino acid depicts a different one from human.
- Figure 12 shows genotyping of the cKSL-HACA and KcHACA vector, and characterization of the cKSL-HACA/DKO calves.
- A Extensive genomic PCR for genotyping of the cKSL-HACA vector. Location of each genomic PCR primer pair is depicted in relation to the cKSL-HACA vector structure.
- B Extensive genomic PCR for genotyping of the KcHACA vector. Location of each genomic PCR primer pair is depicted in relation to the KcHACA vector structure.
- C CGH analysis on the CHO clones containing either the cKSL-HACA, KcHACA or KcHAC vector.
- the cKSL-HACA containing CHO clones (cKSLDC6, 15, 23) were compared with the KC1-1 containing the KHAC and the KCF4 containing the KcHAC vector. There was no apparent structural difference among all the HACs, except for potential some amplification of DNA around the 3 ⁇ ⁇ 2 region (dashed circled) unique to the SC20-based HACs, KHAC and KcHAC. DNA from cKSLDC15 was used as a reference.
- the lower panel shows CGH pattern among three different CHO clones containing the KcHACA vector, where DNA from KCDC 1 was used as a reference. There was no apparent structural difference of the KcHACA among the three cell lines.
- Figure 13 shows the alignment of the sequence relevant to IgGl class switch regulation and secretion between bovine and human.
- A Alignment of DNA sequence of the I y i (human Igamma 1 SEQ ID NO: 166, bovine Igamma 1 SEQ ID NO: 167), l (2 (human Igamma 2 SEQ ID NO: 168, bovine Igamma2 SEQ ID NO: 169) and ⁇ ⁇ 3 (human Igamma 3 SEQ ID NO: 170, bovine Igamma3 SEQ ID NO: 171) ECS (evolutionary conserved sequence) elements between human and bovine. Shaded nucleotide base depicts a different one from the human ⁇ ⁇ 1 sequence.
- Binding sites of KB3 (kappa B3), KB4 (kappa B4), KB5 (kappa B5), ISRE (interferon stimulated response element), C- EBP (CCAAT-enhancer binding protein), BSAP (B-cell lineage specific activator protein) and GAS (Gamma interferon activation site) are indicated by line rectangle.
- B Dot plot alignment between the human and bovine S yl sequence.
- C Amino acid sequence alignment of the IgGl transmembrane/cytoplasmic domains between human (SEQ ID NO: 172) and bovine (SEQ ID NO: 173). Shaded amino acid depicts a different one from human.
- Figure 14 shows serum concentrations of fully hlgG/hlgK (g/L) in a series of HAC/TKO calves at 5-6 months of age. n, number of animals analyzed for each genotype. For each genotype, individual value was plotted, based on the TKO cell line used.
- Figure 15 shows serum fully hlgG/blgK (%)/total hlgG in a series of HAC/TKO and HAC/DKO calves at 5-6 months of age. n, number of animals analyzed for each genotype. For each genotype, values of min, first quartile, median, third quartile and max were calculated and plotted in the left graph.
- Figure 16 shows anti-human carcinoma hlgG/hlgK response in a series of HAC/TKO and HAC/DKO calves, following two times vaccinations (V2) of human oral squamous cell carcinoma. Percentages of hlgG/hlgK-double positive human carcinoma cells was plotted from each animal immunized, at day 9-10 after V2 at indicated serum dilution factors.
- Figure 17 shows construction of 14D vector.
- A A flow of the 14D vector construction. The first lox51 1 was integrated at the AL512355 on the intact hChrl4 to generate 1355-2. Then, the second lox51 1 was placed at the AL391156 to generate 1156-10. Cre introduction brought about a big DNA deletion on the chromosome to generate D8. 14D1 was built by integrating the loxP at RNR2 locus. Subsequently, the cIgM (CHI) or cIgM (CH2) bovinization generated CH1D2 or CH2D4, which was used for the KcHACA or cKSL-HACA vector construction, respectively.
- B Detailed strategy of the 14D vector construction.
- the targeting vector A flow of the 14D vector construction. The first lox51 1 was integrated at the AL512355 on the intact hChrl4 to generate 1355-2. Then, the second lox51 1 was placed at the AL391156 to generate 1156-10. Cre introduction brought about
- pSC355CAG lox511 hisDDT consists of 8.2 kb and 2.0 kb genomic DNA as a long and short arm, respectively, CAG promoter, lox51 1, SV40 polyA signal, the chicken ⁇ -actin promoter-driven hisD gene and DT-A gene, which was used to integrate the lox511 sequence at the AL512355, -300 kb centromeric to the IGHA2 locus.
- Another targeting vector pl4CEN(FR)hygpuro lox511 DT is composed of 8.2 kb and 1.8 kb genomic DNA as a long and short arm, respectively, the promoter-less puro gene, lox511, chicken ⁇ -actin promoter-driven hyg gene and DT-A gene, which was used to integrate the lox51 1 sequence at the AL391156. Cre introduction induced the big DNA deletion ( ⁇ 85 Mb) between the two lox511 sites to generate the 14D. As a result of the big deletion, the CAG promoter-driven puro gene was reconstituted and selected by puromycin. Puromycin-resistant cells were subjected to genomic PCR, CAGpuro- F3R3, to confirm the deletion at molecular level.
- the cells were also sensitive to hygromycin B or histidinol due to the deletion.
- C The IgM bovinization for the CHID and CH2D.
- the bovinization vector pCHlCAGzeo(R)DT(F) comprises 7.4 kb and 1.7 kb human genomic DNA as a long and short arm, respectively, 6 kb of the bovine IGHM constant region genomic DNA covering the CHI through TM2 domains where the floxed, CAG promoter-driven zeo gene cassette was integrated between the CH4 and TM1 intron, and DT-A gene. After the homologous recombination, part of the hIGHM constant region, the CH 1 through TM2 domains, was bovinized on the CHID.
- Another bovinization vector pCH2CAGzeoDT(F) contains 7.2 kb and 1.7 kb human genomic DNA as a long and short arm, respectively, 5.4 kb of the bovine IGHM constant region genomic DNA covering the CH2 through TM2 domains where the floxed, CAG promoter-driven zeo gene cassette was integrated between the CH4 and TM1 intron, and DT-A gene. After the homologous recombination, part oihIGHM constant region, the CH2 through TM2 domains, was bovinized on the CH2D. (D) Genotyping of each targeting event.
- SC355KO-F2R2 was used as a positive PCR specific to the homologous recombination along with the negative PCR, 355N-FR, which was prohibited by the presence of KO cassette.
- 14CENKO-F3R3 was used as a positive PCR specific to the homologous recombination along with the negative PCR, 14CEN(N)-F2R2, which was prohibited by the presence of KO cassette.
- cHAC- F3F3 was used as a positive PCR specific to the homologous recombination along with CHI 5'-FR and cHAC 3'-FR to check the junction sequences between the human and bovine sequence.
- CH2D modification ⁇ e.g., clgM (CH2) bovinization ⁇
- cHAC-F3F3 was used as a positive PCR specific to the homologous recombination along with CH2 5'-FR and cHAC 3'-FR to check the junction sequences between the human and bovine sequence.
- E Human COT-1 FISH between the intact hChrl4 and the shortened hChrl4 fragment.
- Figure 18 shows modification of the hChr2 fragment.
- A Generation of clone KZ7. The clone KTLI was transfected with the targeting vector pTELCAGzeoCD8A to replace the puro cassette with zeo cassette. The targeted event was confirmed by genomic PCR, CD8AKO-F2R2.
- B Truncation of the hChr2 fragment to generate clone K53. The clone KTLI was transfected with the targeting vector
- pTEL'hisDpuro lox2272 F9R9 composed of 7.4 kb of genomic DNA as a homologous arm, promoter-less puro gene, lox2272, the chicken ⁇ -actin promoter-driven hisD gene and human telomeric repeat sequence (TEL), to truncate the hChr2 fragment and to integrate the lox2272 at the AC104134.
- Figure 19 shows modification of the hChr22 fragment.
- A Generation of clone STL54. The intact hChr22 retained in a clone 52-18 was truncated at the AP000350 by the targeted truncating vector pTELCAGzeoSLFR to generate ST13. Subsequently, the lox2272 sequence was integrated at the AP000553 by the targeting vector p553CAG lox2272 bsrDT to generate STL54.
- the truncating vector pTELCAGzeoSLFR consists of 7.4 kb genomic DNA as a homologous arm, the CAG promoter-driven zeo gene and human telomeric repeat sequence (TEL). After the homologous recombination, the hChr22 was truncated at the AP000350.
- C Integration of the lox2272 site at the AP000553.
- the targeting vector p553CAG lox2272 bsrDT comprises 6.9 kb and 2.8 kb genomic DNA as a long and short arm, CAG promoter, lox2272, SV40 polyA signal, the chicken ⁇ -actin promoter- driven bsr gene and DT-A gene.
- 553KO-F3R3 was used as a positive PCR specific to the homologous recombination along with the negative PCR, 553-F4R4, which was prohibited by the presence of KO cassette.
- Figure 20 shows construction of the SLKH fragment.
- A A flow of generation of the SLKH fragment.
- the two DT40 clones K53 and STL54 were subjected to whole cell fusion to generate a DT40 hybrid clone SLK2.
- the Cre recombinase was introduced to induce the chromosome translocation between the two hChr fragments that built the SLKH fragment.
- the CAG promoter-driven puro gene was reconstituted and selected by puromycin. Furthermore, the occurrence of translocation was confirmed by genomic PCR,
- Figure 21 shows occurrence of the chromosome inversion on the CH2D.
- a leaky recombination between the loxP at the RNR2 locus and the lox511 at the deletion junction site AP3911561 AP512355 caused the inversion that also reconstituted the CAG promoter-driven GFP gene, leading to the higher GFP expression than the PGK promoter-driven GFP gene from the cKSL-HACA vector.
- the inversion was confirmed by genomic PCR, STOPpuro-F2R2 and GFP2 x CAGpuro-F3.
- Figure 22 shows construction of the isHAC and isKcHACA vectors.
- the bovinizing vector pCClBAC-isHAC is a BAC-based one (backbone is pCClBAC vector), consisting of 10.5 kb and 2 kb of genomic DNA as a long and short arm, respectively, 9.7 kb of the bovine genomic DNA covering the bovine I yl -S yl and its surrounding region to replace the human corresponding 6.8 kb of I yl -S yl region, the chicken ⁇ -actin promoter-driven neo gene flanked by FRT sequence and DT-A gene.
- the neo cassette is removed by FLP introduction.
- the 2 kb oiAfe l-Bam HI fragment and 10.5 kb ⁇ l-Hpa I fragment for a short arm and long arm were obtained from clone hlO and clone hl 8/h20, respectively, derived from ⁇ phage genomic library constructed from CHO cells containing the KHAC by screening using a probe around the human I yl -S yl region.
- the 9.7 kb fragment (5' end through Bsu361) was obtained from clone b42 derived from the ⁇ phage bovine genomic library.
- Extensive genomic PCR for genotyping of the isHAC vector Location of each genomic PCR primer pair is depicted in relation to the isHAC vector structure.
- F CGH analysis among three different CHO clones containing the isHAC vector. DNA from isCl-133 was used as a reference. There was no apparent structural difference of the isHAC among the three cell lines.
- G Extensive genomic PCR for genotyping of the isKcHACA vector. Location of each genomic PCR primer pair is depicted in relation to the isKcHACA vector structure.
- H CGH analysis among three different CHO clones containing the isKcHACA vector. DNA from isKCDC15-8 was used as a reference. There was no apparent structural difference of the isKcHACA among the three cell lines.
- Figure 23 shows construction of the istHAC vector.
- a flow of the istHAC vector construction The attP sequence is integrated at 5' side of the hl y i exon 1 and 3 ' side of the hIGHGl TM2 by the targeting vectors phI y iFRTCAGattPhisDDT and ph y iTMNeoattPDT, respectively.
- the replacement vector pBAC-istHAC is introduced with the ⁇ 031 recombinase to bring about the attP/attB recombination to replace the flanked region.
- the successful replacement causes the CAG promoter- driven DsRed gene to be reconstituted to provide red fluorescence for sorting.
- the targeting vector ph Y iTMNeoattPDT consists of 6.3 kb and 1.2 kb of genomic DNA as a long and short arm, the chicken ⁇ - actin promoter-driven neo gene, attP and DT-A gene.
- hglTMneoattP-F l/Rl was used as a positive PCR specific to the homologous recombination along with the negative PCRs, hIgGl-F25/R23 and hglTMneg-F3/R3, which were prohibited by the presence of KO cassette.
- hIgGlTM-dig-Fl/R2 followed by Sma I or Age I digestion, was employed to check structural integrity of the corresponding region.
- C Integration of the attP sequence at 5' side of the hl y i exon 1.
- the targeting vector phI y iFRTCAGattPhisDDT comprises 9.6 kb and 1.8 kb of genomic DNA as a long and short arm, the chicken ⁇ - actin promoter-driven hisD gene, attP, CAG promoter, FRT and DT-A gene.
- hglFRTCAGattPhisD-Fl/Rl was used as a positive PCR specific to the homologous recombination along with the negative PCR, iscontl-Fl x hlgGl-RlO, which was prohibited by the presence of KO cassette.
- D The big DNA replacement mediated by attP-attB recombination.
- the replacement vector pBACistHAC is made of 18.1 kb of the chimeric genomic DNA (the bI yl -bS yl + the hIGHGl CHI through CH3 + bIGHGl TM1-TM2), the promoter-less DsRed, FRT and two flanking attB sequences.
- the DNA replacement by the ⁇ 031 expression was confirmed by DsRed expression and genomic PCR, CAGDsRed-F2/R2 and WgGl-3 '-SeqF3 x hIgGl-R15, to check generation of the attR and attL, respectively.
- E Genotyping after the FLP -FRT deletion of the DsRed cassette.
- F Extensive genomic PCR for genotyping of the istHAC vector. Location of each genomic PCR primer pair is depicted in relation to the istHAC vector structure.
- G CGH analysis among three different CHO clones containing the istHAC vector. DNA from istCl-6 was used as a reference. There was no apparent structural difference of the istHAC among the three cell lines.
- Figure 24 shows probe design for CGH, based on the deduced cKSL-HACA vector sequence.
- hChrl4 hChr2 and hChr22 fragment sequence
- Figure 25 shows model of interspecies-incompatibilities at two levels in Tc bovine B cells.
- protein-protein interaction such as pre-BCR/BCR structure (e.g. pairing between human IgM and bovine surrogate/orthodox light chain, interaction between human IgM/IgGl and bovine Ig- ⁇ / ⁇ ).
- DNA-protein interaction such as between human Iyl-Syl DNA sequence and bovine
- cytokine/activator- induced bovine DNA binding proteins The former is addressed by KcHAC(A) and cKSL-HACA (also by isHAC, istHAC and isKcHACA). The latter is addressed by isHAC, istHAC and isKcHACA.
- Figure 26 shows an analysis of ⁇ -Syl region of bovine (SEQ ID NO: 182), horse (SEQ ID NO: 185) and porcine (SEQ ID NO: 186).
- SEQ ID NO: 182 Comparison between bovine and porcine Iyl-Syl indicates some homology between bovine and porcine ⁇ regions (oval), with a potential ECS circled in (B).
- B Comparison between bovine and horse ⁇ -Syl indicates some homology between bovine and horse ⁇ regions
- Figure 27 shows that ECS of the ⁇ region is well conserved.
- A Multiple sequence alignment of ECS of ⁇ in human (SEQ ID NO: 166), bovine (SEQ ID NO: 187), pig (SEQ ID NO: 189) and horse (SEQ ID NO: 188).
- B Multiple sequence alignment of ECS of ⁇ in ungulates.
- Figure 28 shows a multiple sequence alignment of IgM in ungulates. Sheep (SEQ ID NO: 174), bovine (SEQ ID NO: 152), pig (SEQ ID NO: 175) and horse (SEQ ID NO: 176).
- Figure 29 shows the bovinization of HAC with bovine Ig heavy chain 3 ' enhancer.
- A Conservation of structure among human, bovine and mouse 3 ' E-alpha enhancers.
- B Indicates region containing bovine 3 ⁇ that was used for bovinization of 3 'Ealphal on HAC.
- C Bovine genomic fragment used for bovinization of 3 ' alpha 1 on HAC.
- D Demonstrates the construction of mu-HAC.
- E Structural integrity of HAC was confirmed after attP/attB recombination.
- Figure 30 shows a multiple sequence alignment of IgGl amino acid sequences in ungulates and human. Bovine (SEQ ID NO: 196), horse (SEQ ID NO: 197), pig (SEQ ID NO: 198) and human (SEQ ID NO: 199).
- Figure 31 shows the human-bovine chimeric IgM (CH2-TM2 bovinized IgM) - dgM(CH2) sequence (SEQ ID NO: 200).
- the invention provides a human artificial chromosome (HAC) vector comprising genes encoding:
- At least one class switch regulatory element of the genes encoding the one or more human antibody heavy chains is replaced with an ungulate-derived class switch regulatory element.
- the HAC vectors of the invention can be used, for example, for large-scale production of fully human antibodies by transgenic animals, as described for the methods of the invention. As shown in the examples that follow, the HAC vectors can be used to produce unexpectedly high levels of antigen-specific polyclonal antibodies in ungulates, relative to previous HACs.
- the term "HAC vector” means a vector which comprises at least a human chromosome-derived centromere sequence, a telomere sequence, and a replication origin, and may contain any other sequences as desired for a given application.
- the HAC vector exists independently from a host cell chromosome the nucleus. Any suitable methods can be used to prepare HAC vectors and to insert nucleic acids of interest into the HAC, including but not limited to those described in the examples that follow.
- the HAC vector is a double stranded DNA vector, as is known to those of skill in the art.
- the HAC vector of the present invention comprises one or more genes encoding a human antibody heavy chain. Any human antibody heavy chain or combinations of human antibody heavy chains in combination may be encoded by one or more nucleic acids on the HAC. In various embodiments, 1, 2, 3, 4, 5, 6, 7, 8, or all 9 of human antibody heavy chains IgM, IgGl, IgG2, IgG3, IgG4, IgAl, IgA2, IgE and IgD may be encoded on the HAC in one or more copies. In one embodiment, the HAC comprises a human IgM antibody heavy chain encoding gene, alone or in combinations with 1, 2, 3, 4, 5, 6, 7, or the other 8 human antibody chain encoding genes.
- the HAC comprises a gene encoding at least a human IgGl antibody heavy chain; in this embodiment, it is further preferred that the HAC comprises a gene encoding a human IgM antibody heavy chain or a gene encoding a human IgM antibody heavy chain that has been chimerized to encode an ungulate-derived IgM heavy chain constant region (such as a bovine heavy chain constant region).
- the HAC comprises a gene encoding at least a human IgA antibody heavy chain; in this embodiment, it is further preferred that the HAC comprises a gene encoding a human IgM antibody heavy chain or a gene encoding a human IgM antibody heavy chain that has been chimerized to encode an ungulate-derived IgM heavy chain constant region (such as a bovine heavy chain constant region).
- the HAC comprises genes encoding all 9 antibody heavy chains, and more preferably where the gene encoding a human IgM antibody heavy chain has been chimerized to encode an ungulate-derived IgM heavy chain constant region.
- the HAC may comprise a portion of human chromosome 14 that encodes the human antibody heavy chains.
- variable region genes and the constant region genes of the human antibody heavy chain form a cluster and the human heavy chain locus is positioned at 14q32 on human chromosome 14.
- region of human chromosome 14 inserted in the HAC comprises the variable region and the constant region of the human antibody heavy chains from the 14q32 region of human chromosome 14.
- At least one class switch regulatory element of the human antibody heavy chain encoding nucleic acid is replaced with an ungulate-derived class switch regulatory element.
- the class switch regulatory element refers to nucleic acid which is 5' to an antibody heavy chain constant region.
- Each heavy chain constant region gene is operatively linked with (i.e.: under control of) its own switch region, which is also associated with its own I-exons.
- Class switch regulatory elements regulate class switch recombination and determine Ig heavy chain isotype. Germline transcription of each heavy chain isotype is driven by the promoter/enhancer elements located just 5' of the I-exons and those elements are cytokine or other activator-responsive.
- class switch In a simple model of class switch, the specific activators and/or cytokines induce each heavy chain isotype germline transcription from its class switch regulatory element (i.e., activator/cytokine-responsive promoter and/or enhancer). Class switch is preceded by transcription of I-exons from each Ig heavy (IGH) locus-associated switch region. As each heavy chain constant region gene is linked with its own switch region.
- class switch regulatory element i.e., activator/cytokine-responsive promoter and/or enhancer.
- Class switch is preceded by transcription of I-exons from each Ig heavy (IGH) locus-associated switch region. As each heavy chain constant region gene is linked with its own switch region.
- ungulates may be any suitable ungulate, including but not limited to bovine, pig, horse, donkey, zebra, deer, oxen, goats, sheep, and antelope.
- ungulates may be any suitable ungulate, including but not limited to bovine, pig, horse, donkey, zebra, deer, oxen, goats, sheep, and antelope.
- human heavy chain gene isotypes listed below has the following class switch regulatory elements:
- IgGl Iyl-Syl
- IgG2 Iy2-Sy2,
- IgG3 Iy3-Sy3,
- IgG4 Iy4-Sy4,
- IgAl Ial-Sal
- IgA2 Ia2-Sa2
- 1, more than 1, or all of the human antibody heavy chain genes on the HAC have their class switch regulatory element replaced with an ungulate-derived class switch regulatory element, including but not limited to ungulate ⁇ -8 ⁇ , Iy-Sy, ⁇ -Sa, or ⁇ -Se, class switch regulatory elements.
- an Iyl-Syl human class switch regulatory element for human IgGl heavy chain encoding nucleic acid on the HAC (such as that in SEQ ID NO: 183) is replaced with an ungulate Iyl-Syl class switch regulatory element.
- Exemplary ungulate Iyl-Syl class regulatory switch elements include a bovine IgGl Iyl-Syl class switch regulatory element (SEQ ID NO: 182), a horse Iyl-Syl class switch regulatory element (SEQ ID NO: 185), and a pig Iyl-Syl class switch regulatory element (SEQ ID: 186).
- SEQ ID NO: 182 bovine IgGl Iyl-Syl class switch regulatory element
- SEQ ID NO: 185 horse Iyl-Syl class switch regulatory element
- SEQ ID NO: 186 pig Iyl-Syl class switch regulatory element
- an Iy3-Sy3 human class switch regulatory element for human IgG3 heavy chain encoding nucleic acid on the HAC can be replaced with an ungulate Iyl-Syl class switch regulatory element.
- any such combination can be used in the HACs of the invention.
- the HAC comprises at least one ungulate enhancer element to replace an enhancer element associated with one or more human antibody heavy chain constant region encoding nucleic acids on the HAC.
- an enhancer element associated with one or more human antibody heavy chain constant region encoding nucleic acids on the HAC.
- Non-limiting examples of 3' Ea enhancers that can be used include 3 ⁇ , 3 ⁇ 1, and 3 ⁇ 2.
- Exemplary 3 ⁇ enhancer elements from bovine that can be used in the HACs and replace the human enhancer include, but are not limited to bovine HS3 enhancer (SEQ ID NO: 190), bovine HS12 enhancer (SEQ ID NO: 191), and bovine enhancer HS4.
- This embodiment is particularly preferred in embodiments wherein the HAC comprises the variable region and the constant region of the human antibody heavy chains from the 14q32 region of human chromosome 14.
- the HAC vectors of the present invention may comprise one or more genes encoding a human antibody light chain. Any suitable human antibody light chain- encoding genes can be used in the HAC vectors of the invention.
- the human antibody light chain includes two types of genes, i.e., the kappa/ ⁇ chain gene and the lambda/ ⁇ chain gene.
- the HAC comprises genes encoding both kappa and lambda, in one or more copies.
- the variable region and constant region of the kappa chain are positioned at 2pl 1.2-2pl2 of the human chromosome 2, and the lambda chain forms a cluster positioned at 22ql 1.2 of the human chromosome 22.
- the HAC vectors of the invention comprise a human chromosome 2 fragment containing the kappa chain gene cluster of the 2p 11.2-2p 12 region.
- the HAC vectors of the present invention comprise a human chromosome 22 fragment containing the lambda chain gene cluster of the 22ql 1.2 region.
- the HAC vector comprises at least one gene encoding a human antibody surrogate light chain.
- the gene encoding a human antibody surrogate light chain refers to a gene encoding an imaginary antibody light chain which is associated with an antibody heavy chain produced by a gene reconstitution in the human pro-B cell to constitute the pre-B cell receptor (preBCR).
- any suitable human antibody surrogate light chain encoding gene can be used, including but not limited to the VpreB l (SEQ ID NO: 154), VpreB3 (SEQ ID NO: 178) and ⁇ 5 (also known as IgLLl, SEQ ID NO: 157) human antibody surrogate light chains, and combinations thereof.
- the VpreB gene and the ⁇ 5 gene are positioned within the human antibody lambda chain gene locus at 22ql 1.2 of the human chromosome 22. Therefore, in one embodiment the HAC may comprise the 22ql 1.2 region of human chromosome 22 containing the VpreB gene and the ⁇ 5 gene.
- the human VpreB gene of the present invention provides either or both of the VpreBl gene (SEQ ID NO: 154) and the VpreB3 (SEQ ID NO: 178) gene and in one embodiment provides both of the VpreB l gene and the VpreB3 gene.
- the HAC vector comprises a gene encoding an ungulate-derived IgM heavy chain constant region.
- the IgM heavy chain constant region is expressed as a chimera with the human IgM antibody heavy chain variable region.
- Any suitable ungulate IgM heavy chain antibody constant region encoding nucleic acid can be used, including but not limited to bovine IgM, (SEQ ID NO: 152), horse IgM, (SEQ ID NO: 176), sheep IgM, (SEQ ID NO: 174), and pig IgM, (SEQ ID NO: 175).
- the chimeric IgM comprises the sequence in SEQ ID NO: 200.
- Pre-BCR/BCR signaling through the IgM heavy chain molecule promotes proliferation and development of the B cell by interacting with the B cell membrane molecule Ig-alpha/Ig-beta to cause a signal transduction in cells.
- Transmembrane region and/or other constant region of IgM are considered to have important roles in the interaction with Ig-alpha/Ig-beta for signal transduction.
- the IgM heavy chain constant regions include nucleic acids encoding constant region domains such as CHI, CH2, CH3, and CH4, and the B-cell transmembrane and cytoplasmic domains such as TM1 and TM2.
- the nucleic acid encoding an ungulate-derived IgM heavy chain constant region which is comprised in the human artificial chromosome vector of the invention is not particularly limited so long as the region is in a range which may sufficiently induce the signal of the B-cell receptor or B-cell proliferation/development in the above-described IgM heavy chain constant region.
- the nucleic acid encoding an ungulate-derived IgM heavy chain constant region provides a transmembrane and cytoplasmic TM1 domain and TM2 domain derived from an ungulate, and in other embodiments encodes the ungulate-derived CH2 domain, CH3 domain, CH4 domain, TM1 domain, and TM2 domain or the ungulate-derived CHI domain, CH2 domain, CH3 domain, CH4 domain, TM1 domain, and TM2 domain.
- the gene encoding the IgM heavy chain constant region of the bovine is a gene encoding a bovine IgM heavy chain constant region which is included in an IGHM region at which a bovine endogenous IgM heavy chain gene is positioned (derived from IGHM) or a gene encoding a bovine IgM heavy chain constant region in an IGHML1 region (derived from IGHML1).
- the gene encoding a bovine IgM heavy chain constant region is included in the IGHM region.
- the HAC comprises a gene encoding a human antibody heavy chain comprises a gene encoding a human heavy chain (for example, a human IgG heavy chain, such as an IgGl heavy chain), and wherein a transmembrane domain and an intracellular domain of a constant region of the human heavy chain gene are replaced with a transmembrane domain and an intracellular domain of an ungulate- derived heavy chain (for example, an ungulate IgG heavy chain, such as an IgGl heavy chain),constant region gene.
- a human antibody heavy chain comprises a gene encoding a human heavy chain (for example, a human IgG heavy chain, such as an IgGl heavy chain), and wherein a transmembrane domain and an intracellular domain of a constant region of the human heavy chain gene are replaced with a transmembrane domain and an intracellular domain of an ungulate- derived heavy chain (for example, an ungulate IgG heavy chain, such as an IgGl heavy chain),cons
- gene encoding the transmembrane domain and the intracellular domain of an ungulate-derived (such as bovine) IgG (such as IgGl) heavy chain constant region are used to replace the corresponding regions of the human IgG heavy chain gene.
- gene encoding the TM1 and TM2 domains of an ungulate-derived (such as bovine) IgG (such as IgGl) heavy chain constant region are used to replace the corresponding regions of the human IgG heavy chain gene.
- the gene encoding the one or more of the CH1-CH4 domains and/or the TM1 and TM2 domains of an ungulate-derived (such as bovine) IgG (such as IgGl) heavy chain constant region are used to replace the corresponding regions of the human IgG heavy chain gene.
- the invention provides transgenic ungulates comprising a HAC vector according to any embodiment or combination of embodiments of the first aspect of the invention.
- the transgenic ungulate comprising the HAC vector of the present invention refers to an animal into which the human artificial chromosome vector of the present invention is introduced.
- the transgenic ungulate having the HAC of the present invention is not particularly limited so long as the animal is a transgenic ungulate in which the human artificial chromosome fragment may be introduced into a cell thereof, and any non-human animals, for example, ungulates such as cows, horses, goats, sheep, and pigs; and the like may be used.
- the transgenic ungulate is a bovine.
- a transgenic ungulate having the HAC vector of the present invention may be constructed, for example, by introducing the HAC vector of the present invention into an oocyte of a host animal using any suitable technique, such as those described herein.
- the HAC vector of the present invention may, for example, be introduced into a somatic cell derived from a host ungulate by a microcell fusion method. Thereafter, the animal having the HAC vector may be constructed by transplanting a nucleus or chromatin agglomerate of the cell into an oocyte and transplanting the oocyte or an embryo to be formed from the oocyte into the uterus of a host animal to give birth. It may be confirmed by a method of Kuroiwa et al.
- the invention provides transgenic ungulates comprising genes integrated into its genome encoding:
- the transgenic ungulate may comprise any embodiment or combination of embodiments of the nucleic acids as described herein for the HAC, but rather than being present in a HAC, they are integrated into a chromosome of the ungulate.
- the invention provides a method of producing a human antibody, comprising: (a) administering a target antigen to the transgenic ungulate of any embodiment or combination of embodiments of the invention to produce and accumulate human antibody specific to the target antigen in the serum or plasma of the ungulate; and (b) recovering the human antibody specific to the target antigen from the serum or plasma of the ungulate.
- recovering the antibody comprises: (i) isolating lymphocytes from the transgenic ungulate; (ii) generating a human monoclonal antibody producing hybridoma from the lymphocytes; and (iii) recovering human monoclonal antibody specific to the target antigen from the hybridoma.
- the lymphocytes from the transgenic ungulate are isolated from lymph nodes of the transgenic ungulate.
- the transgenic ungulate is hyperimmunized with the target antigen.
- a target antigen-specific human antibody may be produced by immunizing the transgenic ungulate having the HAC vector of the present invention with a desired target antigen to produce the target antigen-specific human antibody in the serum of the transgenic ungulate and recovering the target antigen-specific human antibody from the serum of the transgenic ungulate.
- the target antigens for immunizing the transgenic ungulate having the HAC vector of the present invention are not particularly limited and examples include a tumor-associated antigen, an antigen associated with allergy or inflammation, an antigen associated with cardiovascular disease, an antigen associated with autoimmune disease, an antigen associated with neurodegenerative disease, and an antigen associated with viral or bacterial infections.
- tumor-associated antigens examples include CD la, CD2, CD3, CD4, CD5, CD6, CD7, CD9, CD10, CD13, CD19, CD20, CD21, CD22, CD25, CD28, CD30, CD32, CD33, CD38, CD40, CD40 ligand (CD40L), CD44, CD45, CD46, CD47, CD52, CD54, CD55, CD55, CD59, CD63, CD64, CD66b, CD69, CD70, CD74, CD80, CD89, CD95, CD98, CD105, CD134, CD137, CD138, CD147, CD 158, CD160, CD162, CD 164, CD200, CD227, adrenomedullin, angiopoietin related protein 4 (ARP4), aurora, B7-H1, B7-DC, integlin, bone marrow stromal antigen 2 (BST2), CA125, CA19.9, carbonic anhydrase 9 (CA9), cadherin,
- TIM-1 immunoglobulin domain and mucin domain 1
- human tissue factor hTF
- Tn antigen human tissue factor
- TNF tumor necrosis factor
- TF antigen tumor necrosis factor-related apoptosis-inducing ligand
- TRAIL tumor necrosis factor-related apoptosis-inducing ligand
- DR4, DRS and the like
- system ASC amino acid transporter 2 ASCT2
- trkC trkC
- TROP-2 TWEAK receptor Fnl4
- type IV collagenase urokinase receptor
- VEGF vascular endothelial growth factor
- VEGF receptor VEGFR1, VEGFR2, VEGFR3, and the like
- vimentin VLA-4, and the like.
- antigens associated with allergy or flare examples include IL-6, IL-6R, IL-5,
- IL-5R IL-4
- IL-4R TNF, TNF receptor, CCR4, chemokine, chemokine receptor, and the like.
- antigens associated with cardiovascular disease include
- GPIIb/IIIa PDGF, PDGF receptor, blood coagulation factor, IgE, and the like.
- antigens associated with viral or bacterial infections include gpl20, CD4, CCR5, a verotoxin, an anthrax protective antigen, a methicillin-resistant Staphylococcus aureus (MRSA) antigen, a hepatitis type B virus (HBV) antigen, a cytomegalovirus (CMV) antigen, a Rabies antigen, a Varicella zoster antigen, and the like.
- MRSA methicillin-resistant Staphylococcus aureus
- HBV hepatitis type B virus
- CMV cytomegalovirus
- Rabies antigen a Rabies antigen
- Varicella zoster antigen and the like.
- Other examples thereof include a T cell surface membrane protein mixtures, a Rh (D) antigen, crotalid venom, digoxin, and the like.
- the immunization is carried out by administering the target antigen with, for example, a complete Freund's adjuvant or an appropriate adjuvant such as an aluminum hydroxide gel, and pertussis bacteria vaccine, subcutaneously, intravenously, or intraperitoneally into a transgenic ungulate.
- the immunization comprises hyper-immunization, which refers to immunization that goes beyond just giving the animals protective titers to an antigen. For example, if a protective titer is 1 : 120, we may hyperimmunize an animal to 1 : 10,240 so that these titers may be diluted in the production of a biotherapeutic in order to give protective titers in a passive transfer of immunity.
- Examples of the form of administering the target antigen into an transgenic ungulate having the HAC vector of the present invention include peptides, protein, bacteria, viruses, cells, biological tissue pieces, and the like.
- a conjugate is produced with a carrier protein such as bovine serum albumin (BSA), keyhole Limpet hemocyanin (KLH) or the like, and is used as the immunogen.
- BSA bovine serum albumin
- KLH keyhole Limpet hemocyanin
- the target antigen is administered once to 10 times every 1 to 4 weeks after the first administration. After 1 to 14 days from each administration, blood is collected from the animal to measure the antibody value of the serum.
- Examples of the method for detecting and measuring the target antigen-specific human antibody included in the serum include a binding assay by an enzyme-linked immunosorbent assay, and the like.
- the binding amount of a human antibody in the serum may be measured by incubating the serum comprising the human antibody with antigen expressing cells, and then using an antibody specifically recognizing a human antibody.
- the antibody may be selected by identifying a target antigen of the antibody according to a method known in the art.
- the method for recovering human antibodies from the serum include a method of purifying by adsorbing the human antibody on a protein A carrier, a protein G carrier, or a carrier on which the human immunoglobulin specific antibody is supported. Methods used in purification of proteins, such as gel filtration, ion exchange chromatography, and ultrafiltration, may be combined.
- a human antibody produced by the above method may be a polyclonal antibody or a monoclonal antibody.
- Methods of preparing and utilizing various types of antibodies are well-known to those of skill in the art and would be suitable in practicing the present invention (see, for example, Harlow, et al. Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory, 1988; Kohler and Milstein, Nature, 256:495 (1975)).
- An example of a preparation method for hybridomas comprises the following steps of: (1) immunizing a transgenic ungulate with a target antigen; (2) collecting antibody- producing cells from the transgenic ungulate (i.e.
- Genomic library Genomic DNA was extracted either from CHO cells containing the KHAC vector (KC1-1) or the bovine fibroblast cell lines, 6939 and 3427, to construct the KHAC or bovine genomic libraries, respectively.
- KHAC vector KC1-1
- bovine fibroblast cell lines 6939 and 3427
- Each ⁇ phage-based genomic library was constructed using FIX II vector through a custom library construction service (Lofstrand Labs Ltd.). Library screening and ⁇ phage DNA extraction/purification was done as described previously 5 .
- the bovine genomic BAC library (CHORI-240) was purchased from Children's Hospital Oakland Research Institute and screening was performed, according to their instruction.
- pTEL'hisDpuro lox2272 F9R9 a genomic DNA fragment for a homologous arm was amplified by using a PCR primer pair, kD-F9 and kD-R9, in 40 cycles of 98 °C for 10 s and 68 °C for 9 min.
- This PCR product was subcloned into Bam HI site of a plasmid pTEL'hisDpuro lox2272 , which was constructed as follows.
- the modified lox2272- containing oligo DNAs (Oligo DNA pair 1 ; see Table 1 below) were, after annealing, cloned into Hin dill site of a plasmid pPUR (BD Bioscience Clontech), generating a plasmid pPUR lox2272 .
- another plasmid pTEL'hisDPm was constructed by modifying the previous plasmid pTELpuro, where the puro gene was replaced with hisD gene, Eco RI site was replaced with Srfl and Spe I site was converted to Pme I site.
- the Bam HI fragment from the pPUR lox2272 was then cloned, after blunting, to Pme I site of the pTEL'hisDPm, which generated
- pTELCAGzeo SLF2R2 the plasmid pTELpuro was further modified by converting the Eco RI site to Srfl and then to Pme I and by replacing the puro gene to CAGzeo gene (pTELCAGzeo(Sr)Pm ⁇ .
- a genomic DNA fragment for a homologous arm was amplified by using a PCR primer pair, SL-F2 and SL-R2, in 40 cycles of 98 °C for 10 s and 68 °C for 9 min. This PCR product was subcloned into Bam HI site of the plasmid pTELCAGzeo(Sr)Pm, which generated
- p553CAG lox2272 BsrDT The previous targeting vector pHCF21oxPHyg was modified where the homology arm sequence of the HCF2 gene was replaced with that of the AP000553, which was amplified by using a PCR primer pair, 553-F3 and 553-R3, in 40 cycles of 98°C for 10 seconds and 68°C for 15 min, generating p5531oxPHyg(F).
- This plasmid was Not I-digested and self-ligated, followed by cloning oiDT-A fragment into Srfl site.
- pDRIVE-CAG InvivoGen
- the lacZ fragment (Bsr Gl-Eco RI) was replaced with the loxP-containing oligo DNAs (Oligo DNA pair 2; see Table 1 below) after annealing and then Sda l-Swa I fragment was cloned into Pst llSma I-digested pBluescript SK- (Stratagene), generating pCAG loxP .
- the loxP sequence was further replaced with the lox2272-containing sequence that was generated after annealing two oligo DNAs (Oligo DNA pair 3; see Table 1 below). And then, the bsr gene was added to Spe I site, generating pCAG loxP2272 bsr. Finally, the Not l-Kpn I fragment (CAG-lox2272-polyA-fcr) was cloned into the Not I site to complete p553CAG lox2272 BsrDT.
- pSC355CAG lox511 hisDDT a genomic DNA fragment for a homologous arm was amplified by using a PCR primer pair, SC355-F3 and SC355-R3, in 40 cycles of 98°C for 10 seconds and 68°C for 15 min.
- This PCR product was subcloned into Spe I site of a plasmid pBluescript where the Kpn I site was converted to Srfl site, generating pSC355F3R3.
- the pCAG loxP plasmid was similarly modified where the loxP sequence was further replaced with the lox51 1 -containing sequence that was generated after annealing two oligo DNAs (Oligo DNA pair 4; see Table 1 below).
- pl4CEN(TR)hvgpuro lox511 DT a genomic DNA fragment for a homologous arm was amplified by using a PCR primer pair, 14CEN-F and 14CEN-R, in 40 cycles of 98°C for 10 seconds and 68°C for 15 min. This PCR product was subcloned into Bam HI site of a plasmid pBluescript where the Kpn I site was converted to Pme I site, generating pl4CEN(FR).
- the modified lox51 1 -containing oligoDNAs (Oligo DNA pair 5; see Table 1 below) were, after annealing, cloned into Hind III site of a plasmid pPUR (BD Bioscience Clontech), generating a plasmid pPUR lox5U .
- the Bam HI fragment from the pPUR lox511 was cloned to Bam HI site of pBluescript SK- (Stratagene), followed by cloning of the hyg gene to Eco RV, generating
- pCH 1 CAGzeotT DTfF a genomic ⁇ phage library was constructed from CHO cells containing the KHAC using FIX II vector through a custom library construction service (Lofstrand). The genomic library was screened for IGHM constant region by using a probe that was a PCR product by amplified a PCR pair, hC ⁇ -FR, and then clones #1, #4 and #7 were isolated. From the clone #4, 1.7 kb oiPml I fragment was subcloned into Sma I site of pBluescript, generating pCHlS (F).
- the Eco RI fragment from the pRISeCAGzeoE was subcloned into Eco RI site of the pCH2LS, generating pCH2CAGzeo (F).
- the DT-A cassette was subcloned into Not I site of the pCH2CAGzeo (F) to complete the pCH2CAGzeoDT.
- the genomic ⁇ phage library constructed from CHO cells containing the KHAC was screened to isolate genomic DNA fragments covering the human I yl -S yl region followed by the hIGHGl constant region by using a probe that was a PCR product by amplified with a PCR pair, gl(g2)-FR, and then we identified clones #hl0 and #hl8/h20. From the clone #hl0, 2 kb of Afe l-Bam HI fragment was rescued to be used as a short arm while 10.5 kb ⁇ l-Hpa I fragment was obtained from the clone #hl8/h20 for a long arm.
- a bovine genomic ⁇ phage library was screened to isolate genomic DNA fragments covering the bovine I yl -S yl region followed by the hIGHGl constant region by using a probe that was a PCR product by amplified with a PCR pair, blgGl-FR, and then we identified a clone #b42, from which a 9.7 kb fragment (5' end through Bsu36 1) was assembled to replace a 6.8 kb of the human I yl -S yl region.
- a Bsu36 l-Apa I linker was used to join 3 ' end of the bovine I yl - S y i region and 5 ' end of the hIGHGl constant region.
- the neo gene flanked by FRT and DT-A gene were inserted as shown in Fig. 22B. All the above assembles were done on a BAC-based backbone vector pCClBAC (EPICENTRE).
- ph ly _jFRTCAGattPhisDDT 11.4 kb ⁇ l-Not I genomic fragment from clone hlO was isolated from the clone #hl0 and subcloned into pBluescript SK(-) vector. Then, the FRT-CAG promoter-attP-polyA-/zz ' &D cassette was inserted into the 5' Bam HI site which is 1.8 kb downstream from the Kpn I site. Finally, DT-A gene was cloned into Not I site.
- ph- ⁇ TMNeoattPDT 7.5 kb of Sac II genomic fragment from clone h20 was subcloned into pBluescript SK (-) vector.
- the neo-attP cassette was inserted into Hin dill site, followed by cloning of DT-A gene into Not I site.
- pBAC-istHAC 7.3 kb oiBmg l-Sph I bovine genomic fragment containing the bovine TM1/TM2 domain was obtained from the clone #b66, of which 5' part was joined with 3 ' part of the 9.5 kb of the bovine I y i-S yl fragment (from #b42) and 1.6 kb of hIGHGl gene (from #hl0) from the isHAC by a linker, pNsil-bGl-hGl-BmgBI.
- the attB-DsRed-FRT cassette was inserted at 5' side of the 9.5 kb of the bovine I yl -S yl fragment (from #b42) and another attB sequence was placed at 3 ' side of 7.3 kb of Bmg Bl-Sph I bovine genomic fragment containing the bovine TM1/TM2 domain that was obtained from the clone #b66. All the above assembles were done on a BAC-based backbone vector pCClBAC (EPICENTRE).
- pCjjCAGzeoPuro loxP DT a probe amplified by a primer pair, bCLR-FR, identified several ⁇ phage clones covering the 5' side of the IGLJ1-IGLC1 gene.
- the 13 kb Nde l-Hin dill genomic fragment was subcloned into pBluescript SK(-) vector and the CAGzeo/loxP/promoter-less puro cassette was inserted at Afe I site present in the genomic fragment. Finally, DT-A gene was inserted at Not I site. This vector was constructed from the alleles A and B.
- pC j ⁇ CAG loxP neoDT a probe amplified by a primer pair, bCLL-FR, identified several ⁇ phage clones covering the 3' side of the IGLJ5-IGLC5 gene.
- the 10 kb Sac ll-Nsi I genomic fragment was subcloned into pBluescript SK(-) vector and the CAG promoter/loxP/poly A/neo cassette was inserted at Hin dill site present in the genomic fragment. Finally, DT-A gene was inserted at Not I site. This vector was constructed from the alleles A and B.
- Colonies were selected with histidinol and subjected to genomic PCR screening to confirm the occurrence of the homologous recombination with primers, SC355KO-F2/R2, as a positive PCR and also with primers, 355N-F/R, as a negative PCR (Fig. 17D). Clone 1355-2 was identified as a successfully targeted clone.
- pl4CEN(FR)hygpuro lox511 DT to integrate another lox51 1 and the promoter-less puro gene at the locus AL391156, which is about the 85 Mb centromeric to the AL512355.
- Colonies were selected with hygromycin B and subjected to PCR screening to confirm the occurrence of the homologous recombination with primers, 14CENKO-F3/R3(see Table 1 below), as a positive PCR and also with primers, 14CEN(N)-F2/R2 (see Table 1 below), as a negative PCR (Fig. 17D).
- Clone 1156-10 was identified as a successfully targeted clone.
- Clone D8 was sequentially modified with the targeting vector pRNR21oxPbsrDT to integrate the loxP sequence and the GFP gene at the RNR2 locus, as described previously 20 ' 21 .
- Clones 14D1 was selected for the final IgM bovinization step (CHID and CH2D).
- pCHlCAGzeo(R)DT(F) to replace the CHI domain through the TM2 domain of the hIGHM gene with that of bovine to generate the clgM (CHI) protein.
- Colonies were selected with zeocin and subjected to genomic PCR screening to confirm the occurrence of the homologous recombination with primers (see Table 1 below), cHAC-F3/R3, as a positive PCR and also with primers, CHI 5'-F/R and cHAC 3'-F/R, to make sure that the junction sequences between human and bovine are accurate (Fig. 17D).
- Clone CH1D2 was identified as a positive clone retaining the CHID fragment for the
- clone 14D1 was bovinized with the targeting vector pCH2CAGzeoDT(F) to replace the CH2 domain through the TM2 domain of the hIGHM gene with that of bovine to generate the clgM (CH2) protein and then clone CH2D4 was selected for the cKSL-HACA construction. Modification of the human chromosome 2 fragments in chicken DT40 cells.
- KTLI is a DT40 clone containing the hChr2 fragment covering the IGK locus.
- This cell line was transfected with the vector pTELCAGzeoCD8A to simply replace the PGKpuro cassette with the CAGzeo because zeocin selection usually works better in bovine fibroblasts at later steps.
- the KTLI was also electroporated with the targeting vector pTEL'hisDpuro lox2272 F9R9 to both truncate the hChr2 fragment and integrate the lox2272 and the promoter-less puro gene at the locus AC104134, which is about 300 kb telomeric to the hIGK constant region CK gene, IGKC. Colonies were selected with histidinol, and then puromycin sensitivity was confirmed since the successful truncation results in the loss of the puro cassette at the CD8A locus.
- Genomic DNA was extracted from puromycin sensitive colonies and subjected to PCR screening with primers, FABP1-F, which amplifies the FABP1 locus present in KTLI but absent in the targeted clones (Fig. 18B). Clone K53 was identified and used for the cKSL-HACA construction.
- Fig. 19A. 52-18 a DT40 cell line retaining the intact hChr22, was electroporated with the targeting vector pTELCAGzeoSLFR to truncate the hChr22 at the AP000350 locus, which is about 450 kb telomeric to the AP000344 locus at which the hChr22 was truncated for the AAHAC vector (Fig. 19B).
- Colonies were selected with zeocin and their genomic DNA was subjected to PCR screening with primers (see Table 1 below), 350T-FR, which amplifies the AP000350 locus present in 52- 18 but absent in the targeted clones. Clone ST13 was identified as a successfully truncated clone.
- ST13 was modified with the targeting vector p553CAG lox2272 bsrDT to integrate the lox2272 and the CAG promoter at the locus AP000553. Colonies were selected with blasticidin S and subjected to PCR screening to confirm the occurrence of homologous recombination with primers, 553KO-FR, as a positive PCR and also with primers, 553-F4R4, as a negative PCR (Fig. 19C). Clone STL54 was identified as a successfully targeted clone.
- the SLKH fragment was constructed in DT40 hybrid cells using the chromosome cloning system (Fig. 20A). Clone K53 retaining the hChr2 fragment with the hyg cassette and clone STL54 retaining the hChr22 fragment with the bsr cassette were fused (whole cell fusion, WCF) to generate DT40 hybrid cells. Colonies were maintained in hygromycin B and blasticidin S to select for cells retaining both hChr fragments, which was confirmed by genomic PCR with the following primers (see
- SLK2 was transfected with the Cre expression plasmid to mediate site-specific recombination between the two lox2272 sites, one at the locus AC104134 on the hChr2 fragment and another at the locus AP000553 on the hChr22 fragment.
- Recombinants were selected by puromycin as puromycin resistance is conferred by reconstitution of the CAG promoter-lox2272-pwro cassette at the translocation site. This was also confirmed by the genomic PCR, CAGpuro-F3R3, followed by direct sequencing of the PCR product.
- SLKH6 was identified as a successfully translocated clone retaining the SLKH fragment (Fig. 20A, 20B).
- the SLKH fragment was transferred from DT40 hybrid cell line SLKH6 to plain DT40 cells by MMCT. Selection was done with puromycin and then colonies were investigated for blasticidin S sensitivity as the successful transfer of the SLKH fragment into DT40 cells should result in the loss of the bsr cassette (Fig. 20A).
- Genomic DNA from blasticidin S-sensitive and puromycin-resistant colonies was extracted and the SLKH fragment retention was confirmed by PCR primers (see Table 1 below), IGKC- F/R, IGKV-F/R, RPIA-F/R, EIF2AK3-F/R, cos l38KO-F/R, CAGpuro-F3/R3, 553P- F/R, hVpreBl-F/R, hVpreB3-F/R, IgL-F/R, 344-F/R, hL5-F/R, 350P-F/R, and 553KO- F/R.
- the cKSL-HACA vector was constructed in DT40 hybrid cells as outlined in Fig. 3B, using the chromosome cloning system.
- SLKD 18 which contains the hChr2 fragment translocated with the hChr22 fragment, bearing the hyg cassette, and CH2D4 which contains the hChrl4 fragment (14D) with the bsr cassette and the clgM (CH2)- bovinized hIGH locus, were fused to generate DT40 hybrid clone cKSLD22, selected by hygromycin B and blasticidin S.
- Extensive genomic PCR was done with a first set of PCR primers (see Table 1 below) for the hChr22, 553P-F/R, hVpreB 1 -F/R, hVpreB3-F/R, IgL-F/R, 344-F/R, hL5-F/R, 350P-F/R, and 553KO-F/R, a second set of primers for the hChr2, IGKC-F/R, IGKV-F/R, RPIA-F/R, EIF2AK3-F/R, cos l38KO- F/R, CAGpuro-F3/R3 (junction between the hChr2 and hChr22), and a third set of primers (see Table 1 below) for the hChrl4, R R2-1 x STOP-3, VH3-F/R, gl(g2)-F/R, 14CENKO-F3/R3, CH2 5'-
- FISH using Human COT-1 DNA also confirmed the presence of the two human chromosome fragments.
- cKSLD22 was electroporated with the Cre expression plasmid to mediate site- specific recombination between the two loxP sites, one at the cos 138 locus on the SLKH fragment and another at the RNR2 locus on the CH2D fragment, and also to delete the floxed CAG promoter-zeo cassette within the clgM (CH2) domain.
- Recombinants were enriched by sorting of GFP positive cells as GFP expression is conferred by reconstitution of the PGK promoter-loxP-G cassette at the translocation site. Sorting was conducted twice which resulted in two distinct GFP positive populations with different expression levels.
- the lower GFP population contained the successfully translocated cKSL-HACA determined by PCR primers (see Table 1 below), PGK2 x GFP2, and PCR primers, CreCAGzeo-F3/R3, confirmed the CAG promoter-zeo cassette deletion in the clgM (CH2) site.
- the higher GFP population contained an inverted CH2D fragment between the loxP at the RNR2 locus and the lox511 at the locus AL512355IAL391156 by a leaky Cre-mediated recombination which was confirmed by PCR primers (see Table 1 below), CAGpuro-F3 x GFP2 and STOPpuro-F2 x STOPpuro-R, followed by direct sequencing (Fig. 21).
- cKSLDH22 (2L) was finally identified as a DT40 hybrid cell line retaining the cKSL-HACA, subjected to extensive genomic PCR and three color-FISH (Fig. 12A).
- the KcHACA vector was similarly constructed in DT40 cells as outlined in Fig. 3C.
- the clone KCDH1 was subjected to extensive genomic PCR and two color-FISH (Fig. 12B).
- Fig. 12B we also constructed the KcHAC where the hChr2 fragment (KTLI ) was translocated to the SC20 fragment bearing the bovinized clgM (CHI).
- FIG. 22 A Outline of the isHAC (isKcHACA) construction is depicted in Fig. 22 A.
- the targeting vector pCClBAC-isHAC was constructed (Fig. 22B) and used to bovinize the I yl -S yl region on the cKSL-HACA or KcHACA.
- Clone cKSLDD 1 a chicken DT40 cell line retaining the cKSL-HACA obtained by MMCT from cKSLDH22 (2L), was
- Fig. 22C One clone is 1-11 was selected for the subsequent neo cassette deletion by introduction of the FLP-expression plasmid.
- the is 1-1 1 was co-transfected with the FLP- expressing plasmid and the DsRed-expressing plasmid. DsRed-positive cells were sorted and subjected to single colony isolation.
- the isKcHACA was constructed in DT40 cells, similarly to the isHAC, and two clones, isKCDH17, isKCDH30, were selected and then were transferred to CHO cells to establish master cell banks, isKCDC8 and isKCDC38, respectively, for which the extensive genomic PCR and CGH were performed to check structural integrity (Fig. 22G, 22H).
- FIG. 23A A scheme of construction of the istHAC is depicted in Fig. 23A.
- Clone cKSLDDl was sequentially targeted with the two targeting vectors ph y iTMNeoattPDT (Fig. 23B) and phl y iFRTCAGattPhisDDT (Fig. 23C) to integrate the attP sequence at 3 ' side of the hIGHGl TM2 domain and at 5 'side of the human I yl region, respectively, which generated two clones istl-5 and istl-21. They were co-electroporated with the pBAC- istHAC and ⁇ 031 -expression vectors together to bring about the big DNA replacement.
- the expected recombination between the attP and attB should result in reconstitution of the CAG promoter-Z3 ⁇ 4Re ⁇ i gene expression, which can be detected by flow cytometry.
- DsRed-positive cells were accordingly sorted. This sorting process was repeated 2-3 times until purity of DsRed-positive cells reached >95 %. And then, cells were subjected to single colony isolation and examined by three diagnostic genomic PCRs (see Table 1 below), CAGDsRed-F2/R2 (positive), bIgGl-3 '-SeqF3 x hIgGl-R15 (positive) and WgGl-3'-SeqF3 x attPPuro-R3 (negative). As a result, istH5-S16 from istl-5 and istH21H-S10 from istl-21 were selected.
- istHD16L from istH5-S 16 and istHD IOL from istH21H-S10 were selected and then were transferred to CHO cells to establish master cell banks, istCl-49 and istCl-6, respectively, for which the extensive genomic PCR and CGH were performed to check structural integrity (Fig. 23F, 23G).
- HAC vector construction was carried out as previously described 5 ' 20 ' 21 . Briefly, DT40 cells containing each hChr fragment were electroporated (550 V, 25 ⁇ ) with ⁇ 25 ⁇ g of each targeting vector. Colonies were selected by each drug; G418 (2 mg/ml), puromycin (0.5 ⁇ g/ml), hygromycin B (1.5 mg/ml), blasticidin S (15 ⁇ g/ml), histidinol (0.5 mg/ml) or zeocin (1 mg/ml) for two weeks and their DNAs were subjected to PCR screening as indicated.
- Bovine fetal fibroblasts were cultured and transfected as previously described 5 ' 12 ' 21 . Briefly, fibroblasts were electroporated with -30 ⁇ g of each targeting vector at 550 V and 50 ⁇ . After 48 hours, the cells were selected under an appropriate drug; zeocin (0.4 mg/ml) or puromycin (1 ⁇ g/ml) for two weeks and resistant colonies were picked up and transferred to replica plates; one was for genomic DNA extraction and the other was for embryonic cloning. MMCT was done with each HAC vector as described previously 5 ' 20 ' 21 .
- BCm O-F14 CCACAAAGGAAAAAGCTGCACTGCTATAC 47
- BCmKO-R14 TGTGGGATCAGGAGGTCAGATAGACATC 48
- blgL-Ld-Fl GTGGGGCCACAGAAGGCAGGAC 49
- blgL-C-R ACCCGGGTAGAAGTCGCTGATGAGA 50
- VH3-R CTTGTGCTACTCCCATCACT 115 iscontl-Fl TTGCAAAGGGGCCTGGTGGAATA 116
- GGGTCACTTTCTCGGTCCTGGTCT 126 iscontl-F3 GGCCCCTCCATTTGTACTTTCTAT 127 iscontl-R6 GGGGCAGGAGGAGAAGGGGACGAC 128
- CAGDsRed-R2 CTTGGCCATGTAGATTGACTTGAACTCC 143 blgGl-dig-Fl GGCGCCGCTTAAACCACCCCACCAACCCACAA 144
- Flow cytometry analysis Flow cytometry analysis on B cell development in newborn transgenic (Tc) calves were performed as previously described 5 with the following modifications.
- To detect surface hlgG on Tc bovine B cells goat anti-hlgG (Life Technologies) directly labeled with AF 488 was used.
- To label surface hlgK or hlg on Tc bovine B cells mouse anti-hlgK antibody directly labeled with PE
- mouse monoclonal anti-blg in-house clone 132D7
- mouse monoclonal anti-blgK in-house clone 132B10
- Zenon mouse IgGIPE labeling Novose
- hlgG ELISA Total hlgG ELISA assay was performed as previously described 5 .
- goat anti-hlgK affinity -purified or goat anti- hlg affinity-purified Bethyl
- goat anti-hlgG Fc-HRP Bethyl
- mouse monoclonal anti-blgK in-house clone 132B10
- mouse anti-hlgG Fcy-HRP Jackson
- mouse anti-hlgG 1 Fc or mouse anti-hIgG2 Fc (Hybridoma Reagent Laboratory) as a capture and mouse anti- hlgG HRP (Southern Biotech) as a detection antibody were used.
- Anti-human oral squamous cell carcinoma antibody titers were determined by flow cytometry analysis.
- the assay was performed in PBS supplemented with 4 % horse serum, 0.1% sodium azide and 2 mM EDTA. The results were expressed as % of the human carcinoma cells stained and mean fluorescence intensity (MFI) as measured by FACSARIATM flow cytometer (BD Biosciences).
- MFI mean fluorescence intensity
- Somatic cell nuclear transfer Cloned fetuses and calves were produced using chromatin transfer procedure as described previously ' ' ' .
- IGLJ1-IGLC1 A gene cluster composed of the five IGLJ-IGLC genes (IGLJ1-IGLC1 through IGLJ5-IGLC5) was identified, three of which (IGLJ2-IGLC2 through IGLJ4-IGLC4) appeared to be functional, judged from its deduced amino acid sequence (Fig. 1A). Both the IGLJ1-IGLC1 and IGLJ5-IGLC5 genes contain immature stop codon mutations, indicating possible pseudo genes. Around 13 kb downstream of the IGLJ5-IGLC5 gene, a potential enhancer element was found, 3 ⁇ , which showed -60 % DNA sequence homology with the human 3 ⁇ 3 ⁇ 4, (HSS-3) enhancer sequence.
- IGLJ2-IGLC2 and IGLJ3-IGLC3 exon sequences were identical, however their surrounding sequences, such as intron and 3 ' untranslated region (UTR), were slightly but different, which led to the conclusion that the IGLJ2-IGLC2 and IGLJ3-IGLC3 are distinct genes (Fig. 8A, 8B).
- each loxP sequence was integrated 5' outside of the IGLJ1 gene by a targeting vector p ⁇ iCAGzeoPuro loxP DT and 3' outside of the IGLC5 gene by another targeting vector p ⁇ 5 CAG loxP neoDT, respectively, followed by Cre introduction.
- This step required three rounds of transfection and somatic cell nuclear transfer (SCNT) just for the hemizygous cluster deletion, which could compromise animal development due to accumulated epigenetic errors.
- SCNT somatic cell nuclear transfer
- the strategy was to reduce the number of transfection and SCNT by implementing co- transfection of the Cre expression and second knockout (KO) vectors together; two rounds of transfections (1 st KO and then 2 nd KO + Cre) could complete the cluster deletion.
- KO second knockout
- the implementation of the two-step big DNA deletion in somatic cells supported the ability of the cells to give rise to healthy cloned animals that are fertile.
- this is the first report of a site-specific big DNA deletion of multiple genes in somatic cells without using ES cells, therefore, it supports a feasibility of more dynamic genome engineering, than just one-to-one single gene modification, in non-murine species where somatic fibroblast cells are available.
- IGHM and IGHMLl loci were sequentially knocked out in an allele-specific manner to establish IGHM ⁇ I+ IGHMLF I ⁇ cell lines by using the targeting vectors, ⁇ , ⁇ (3 ⁇ 4 ⁇ and pbC ⁇ AYKObsr, for the alleles U, u and AY, respectively.
- HoJo Holstein x Jersey cross-breed
- the male cell line J481 (IGHM ⁇ IGHMLF ), in which the inventors designated the bIGL alleles as A and D, was transfected with the vector specific to the allele A, selected under zeocin and then screened for the occurrence of homologous recombination by a genomic PCR using a primer pair, CLlpuro-F2R2, as shown in Fig. 2C. Positive colonies (18 %) were identified by sequencing the PCR product, some of which were further subjected to another genomic PCR using a PCR pair, R-Rl x R-F2, followed by sequencing (Fig. 2C).
- the cell line J481 contains the alleles A and D for the bIGL locus and this PCR amplifies one polymorphic site between the two alleles; T for the allele A and G for the allele D.
- T for the allele A
- G for the allele D.
- Colony 27 was used for SCNT to generate 40 day fetuses from which a cell line K655-1 IGHM ⁇ ⁇ IGHML1 ⁇ /+ IGLF l+ was established.
- the cell line K655-1 was co-transfected with the
- the double positive colonies were used for cloning to establish a cell line G054 IGHM ⁇ ⁇ IGHML1 ⁇ /+ IGL ⁇ /+ , which was further used to generate calves.
- the female cell line H412 (IGHM ⁇ ' ⁇ IGHMLr /+ ), in which the inventors designated the bIGL alleles as B and C, was subjected to the two-step cluster deletion on the allele B to generate calves.
- the male and female IGHM ⁇ ⁇ IGHML1 ⁇ /+ IGL ⁇ /+ animals were bred each other around 18-20 months of age.
- 58 fetuses were collected and genotyped.
- Five fetuses (8.62 %,) were of the IGHM ⁇ ⁇ IGHML1 ⁇ ⁇ IGL ⁇ ⁇ genotype, and then five IGHM ⁇ ⁇ IGHML1 ⁇ ⁇ IGL ⁇ ⁇ triple knock out (TKO) cell lines were established (Fig. 2E and Fig. 10).
- Example 3 cKSL-HACA and KcHACA vector construction It is possible that there could be some species-incompatibilities between human and bovine that could hamper high production of fully hlgG in the bovine. As one of such species-incompatibilities, the IgM-based pre-BCR/BCR function was addressed. Among immunoglobulin heavy (IgH) chain classes, the IgM heavy chain is the first to be expressed, and is important for B cell development to eventually lead to secretion of IgG.
- IgH immunoglobulin heavy
- hlgM is expressed on the bovine B cell surface to interact with bovine surrogate light chain, followed by orthodox bovine light chain, and with bovine Ig-a/Ig- ⁇ molecules for the pre-BCR/BCR-mediated signaling, which is crucial for the subsequent B cell development.
- bovine surrogate light chain followed by orthodox bovine light chain
- bovine Ig-a/Ig- ⁇ molecules for the pre-BCR/BCR-mediated signaling
- part of the hIGHM constant region gene (the CHI through TM2 domains) was bovinized so that such a chimeric IgM ⁇ clgM (CHI) ⁇ protein could interact with bovine surrogate light chain, orthodox light chain and Ig- a/Ig- ⁇ molecules for better pre-BCR/BCR signaling.
- CHI chimeric IgM ⁇ clgM
- part of the hIGHM constant region gene (the CH2 through TM2 domains) was differently bovinized and, additionally, the human surrogate light chain hVPREBl and hlGLLl ( ⁇ 5 in the mouse) genes were introduced with the hChr22 fragment so that such a chimeric IgM ('clgM (CH2)' ; SEQ ID NO: 200) protein could pair with human surrogate light chain and could also interact with bovine Ig-a/Ig- ⁇ molecules for better pre-BCR/BCR signaling.
- hVPREBl and hlGLLl ⁇ 5 in the mouse
- HAC vector e.g., KHAC, KCHACA, CKSL-HACA, respectively
- the hChrl4 fragment SC20 was used as a starting HAC vector onto which a defined human chromosome region can be cloned (chromosome cloning) by means of site-specific chromosome translocation.
- SC20 was a naturally occurring fragment during microcell-mediated chromosome transfer (MMCT), thus its structure was not defined.
- MMCT microcell-mediated chromosome transfer
- the intact hChrl4 was modified, followed by the IgM bovinizations, which generated new hChrl4-based vectors, CH1D2 and CH2D4, for the KcHACA and cKSL-HACA vector construction, respectively.
- the cKSL-HACA vector was constructed in chicken DT40 cells as outlined in Fig. 3B (see also Methods).
- Clone SLKD18 which contains the SLKH fragment was created by translocating the hChr22 fragment, covering the entire IGL and surrogate light chain hVPREBl/hlGLLl loci, to the hChr2 fragment having the IGK locus, and clone CH2D4 which contains the hChrl4 fragment (14D) with the clgM (CH2)- bovinized hIGH locus, were fused to generate DT40 hybrid clone cKSLD22.
- the Cre expression plasmid was introduced to mediate site-specific recombination between the two loxP sites, one at the cos 138 locus on the SLKH fragment and another at the RNR2 locus on the CH2D fragment, and also to delete the floxed CAG promoter-zeo cassette within the clgM (CH2) domain. Recombinants were enriched by sorting of GFP positive cells as GFP expression was conferred by reconstitution of the PGK promoter- loxP-G cassette at the translocation site. This is the first report of construction of an artificial chromosome composed of structurally defined, three different chromosome fragments (e.g., hChr2, hChrl4 and hChr22).
- the KcHACA vector was similarly constructed in DT40 cells as outlined in Fig. 3C (see also Methods). Likewise, the KcHAC vector was constructed in which the hChr2 fragment (KTLI) was translocated to the SC20 fragment bearing the bovinized IgM ⁇ clgM (CHI) ⁇ sequence.
- KTLI hChr2 fragment
- CHI bovinized IgM ⁇ clgM
- Example 4 Human IgG production in a series of ACIIGHM ⁇ IGHML (DKO) cattle
- cKSL-HACA, KcHACA and KcHAC vectors were transferred to Chinese hamster ovary (CHO) cells by means of MMCT to establish CHO-based master cell banks, cKSLDC6, 15, 23, KCDC15 and CKF4, respectively, which were confirmed by the extensive genomic PCR and CGH (Fig. 12A-12C).
- Three HAC vectors, cKSL- HACA, KcHAC and KHAC, were then transferred from the CHO cell lines to
- IGHM ⁇ ' ⁇ IGHMLF' ⁇ (DKO) cell lines obtained from breeding to generate cKSL- HACA/DKO, KcHAC/DKO and KHAC/DKO calves.
- An aim of the cKSL-HACA and KcHAC vectors was to address the species-incompatibility between human and bovine in the IgM-mediated pre-BCR/BCR function for B cell development, therefore B cell development profile was investigated in peripheral blood mononuclear cells (PBMCs) of these animals at newborn stage (Fig. 4A).
- PBMCs peripheral blood mononuclear cells
- IgM/CD21 -double positive B cells IgM/CD21 -double positive B cells.
- IgM/blg , IgM/blgK and even IgM hlgK-double positive B cells were only detected in the KcHAC/DKO animals.
- either hlgM/blg , hlgM/blgK, hlgM hlgK or hlgM/hlg - double positive B cells were undetectable by flow cytometry, despite the increased percentage of hIgM/CD21 -double positive B cells, although these transcripts were detected by RT-PCR (Fig. 12D).
- the next strategy was to directly alter the efficiency of class switch to hlgG, especially to hlgGl, by direct bovinization of the hIGHGl gene class switch regulatory element on the cKSL-HACA and KcHACA vectors.
- the transmembrane and cytoplasmic domains of the hIGHGl gene were also bovinized for potentially better hlgGl BCR-mediated signaling under the bovine environment.
- IgG subclass class switch recombination is preceded by transcription from each immunoglobulin heavy chain (IGH) locus-associated switch region (SH), called germline transcript.
- IGH immunoglobulin heavy chain
- SH locus-associated switch region
- Each IGH constant region (CH) gene is linked with its own SH region which is also associated with its own I H exons.
- the germline transcript IH-SH-CH (eventually spliced to mature IH-CH) is driven by the
- promoter/enhancer elements located just 5' of the 1 ⁇ 2 exons and those elements are cytokine or other activator-responsive.
- the specific activators and/or cytokines induce the germline transcript from its activator/cytokine- responsive 1 ⁇ 2 promoter/enhancer.
- the 3 ⁇ ⁇ element further enhances the transcription of IH-SH-CH sequence. This transcription causes the switch region to be relaxed so that it can be targeted by the enzyme, activation-induced cytidine deaminase (AID), which causes fusion with another SH region, leading to class switch.
- AID activation-induced cytidine deaminase
- the hI y i-hS Y i class switch regulatory element was bovinized with the class switch regulatory element of the hIGHGl gene to construct the isHAC vector having the bI Y i-bS Y i sequence upstream of the hC Y i (human heavy chain IgGl) region on the cKSL-HACA vector (Fig. 5, see also Methods).
- the transmembrane and cytoplasmic domains of the hIGHGl gene on the isHAC was further bovinized with the hIGHGl gene transmembrane and cytoplasmic domains to generate the istHAC (Fig. 5, see also Methods), considering the species-specific sequence differences (Fig. 13C).
- the KcHACA vector was also bovinized to build the isKcHACA vector having the bI Y i-bS Y i sequence upstream of the hC Y i region on the KcHACA (Fig. 5, see also Methods).
- the isHAC, istHAC, isKcHACA, KcHACA and cKSL-HACA vectors were transferred from the CHO master cell banks to the IGHAf / ⁇ IGHMLl ⁇ / ⁇ IGL ⁇ / ⁇ (TKO) cell lines by MMCT to generate a series of HAC/TKO calves.
- Calving efficiency at 270 days of gestation was around 7 % out of recipients implanted, 60-70 % of which survived at least up to 5-6 months after birth (Table 2).
- the lack of the bIGL expression was confirmed by RT-PCR at newborn stage (Fig. 6A). Then, in order to address an impact of the ablation of the bIGL expression on B cell
- percentages of blgM-single positive and bIgM CD21 -double positive B cells appear to be considerably similar to that of the DKO background in the KcHACA series (e.g., isKcHACA and KcHACA itself), with percentages of blgM/hlgK (or bIgM/bIgK)-double positive B cells substantially increased.
- A332A isHAC/TKO 68 21 (31) 13(19) 12(18) 6(9) 6(9)
- a Percentages were calculated by dividing the number of fetuses or calves by that of recipients implanted.
- the isHAC/TKO particularly the istHAC/TKO calves, considerably raised both total hlgG and fully hlgG/hlgK production when compared with their original cKSL-HACA/DKO and even cKSL-HACA/TKO animals (Fig 6E and Table 4).
- hIgGl/hIgG2 ratio drastically arose both in the isHAC/TKO and istHAC/TKO calves while the cKSL-HACA/TKO animals turned hIgG2 -dominant from hlgGl-dominancy in the cKSL-HACA/DKO ones (Fig. 61).
- the non-bovinized HAC would have been sufficient for providing the humanlike hlgG expression profile, such as hlgGl-dominancy, in the bovine condition, which, however, was not the case.
- the finding that bovinization of the hI y i-hS Y i sequence surprisingly caused the sufficient switch from hIgG2-dominancy to hlgGl- dominancy in the Tc bovine condition strongly suggests the species-incompatibility in IgGl class switch regulation between the two species.
- transmembrane/cytoplasmic domains was additionally necessary to significantly improve fully hlgG/hlgK production (i.e. istHAC vs cKSL-HACA).
- istHAC vs cKSL-HACA
- the bovinized Iyl-Syl sequence drastically altered hlgGl subclass-dominancy.
- HAC/TKO calves that underwent such complex chromosome engineering functionally generate fully hlgG/hlgK polyclonal antibodies in response to antigen immunization
- HAC/TKO animals were hyperimmunized with human oral squamous cell carcinoma to see antigen-specific fully hlgG/hlgK immune response in comparison with the HAC/DKO genotype, cKSL-HACA/DKO.
- HAC/TKO calves immunized mounted robust anti-human carcinoma fully hlgG/hlgK response (28.45-80.36% positive for both hlgG and hlgK), whereas the two cKSL-HACA/DKO animals had only 0.73-1.54% positive for both hlgG and hlgK, and only showed hlgG-response (Fig. 6L, Fig. 16).
- the data indicates that HAC/TKO genotype is important for high productivity of antigen-specific fully hlgG/hlgK polyclonal antibodies, which was further enhanced by the bovinized HAC vectors, istHAC and isKcHACA.
- the invention is capable of producing a large quantity of fully hlgG/hlgK (>5 g/1 on average/median in the novel genotypes, i.e. isHAC/TKO, istHAC/TKO and isKcHACA/TKO) in sera of a large farm animal species.
- This serum concentration of fully hlgG/hlgK is, to the inventors' knowledge, the highest of any other transgenic mouse systems producing fully hlgG (typically around 0.5 g/1) and is the closest to that in healthy humans.
- hlgG subclass produced in the isHAC/TKO, istHAC/TKO and isKcHACA/TKO calves can be controlled to be hlgG 1 -dominant, which is the major subclass in healthy humans and is also that of therapeutic hlgG recombinant antibodies in development and on the market.
- Kitamura, D. et al. A critical role of ⁇ 5 protein in B cell development. Cell 69,
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- General Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Environmental Sciences (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Wood Science & Technology (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biomedical Technology (AREA)
- Veterinary Medicine (AREA)
- Immunology (AREA)
- Animal Husbandry (AREA)
- Medicinal Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Animal Behavior & Ethology (AREA)
- Biodiversity & Conservation Biology (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Microbiology (AREA)
- Mycology (AREA)
- Peptides Or Proteins (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Priority Applications (9)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| NZ703973A NZ703973A (en) | 2012-08-03 | 2013-08-05 | Complex chromosome engineering for production of human antibodies in transgenic animals |
| US14/416,870 US9902970B2 (en) | 2012-08-03 | 2013-08-05 | Complex chromosome engineering for production of human antibodies in transgenic animals |
| JP2015525643A JP6426606B2 (ja) | 2012-08-03 | 2013-08-05 | トランスジェニック動物におけるヒト抗体産生のための複合染色体工学 |
| KR1020157005433A KR102159163B1 (ko) | 2012-08-03 | 2013-08-05 | 유전자삽입 동물에서 인간 항체의 제조를 위한 복합 염색체 조작 |
| EP13747631.3A EP2880055B1 (en) | 2012-08-03 | 2013-08-05 | Complex chromosome engineering for production of human antibodies in transgenic animals |
| IN1700DEN2015 IN2015DN01700A (https=) | 2012-08-03 | 2013-08-05 | |
| AU2013296182A AU2013296182B2 (en) | 2012-08-03 | 2013-08-05 | Complex chromosome engineering for production of human antibodies in transgenic animals |
| HK15111388.0A HK1210621B (en) | 2012-08-03 | 2013-08-05 | Complex chromosome engineering for production of human antibodies in transgenic animals |
| CN201380041315.4A CN104755493B (zh) | 2012-08-03 | 2013-08-05 | 用于在转基因动物中生产人类抗体的复杂的染色体工程 |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201261679288P | 2012-08-03 | 2012-08-03 | |
| US61/679,288 | 2012-08-03 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2014022853A1 true WO2014022853A1 (en) | 2014-02-06 |
Family
ID=48949296
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2013/053618 Ceased WO2014022853A1 (en) | 2012-08-03 | 2013-08-05 | Complex chromosome engineering for production of human antibodies in transgenic animals |
Country Status (9)
| Country | Link |
|---|---|
| US (1) | US9902970B2 (https=) |
| EP (1) | EP2880055B1 (https=) |
| JP (1) | JP6426606B2 (https=) |
| KR (1) | KR102159163B1 (https=) |
| CN (1) | CN104755493B (https=) |
| AU (1) | AU2013296182B2 (https=) |
| IN (1) | IN2015DN01700A (https=) |
| NZ (1) | NZ703973A (https=) |
| WO (1) | WO2014022853A1 (https=) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104904661A (zh) * | 2015-06-05 | 2015-09-16 | 王彦刈 | 一种人源化小鼠 |
Families Citing this family (13)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US11072649B2 (en) | 2015-11-25 | 2021-07-27 | Sab, Llc | Systems and methods for the production of human polyclonal antibodies |
| CN109906272A (zh) * | 2016-10-31 | 2019-06-18 | 国立大学法人鸟取大学 | 产生人抗体的非人动物和使用该非人动物的人抗体制作方法 |
| WO2019015677A1 (en) * | 2017-07-21 | 2019-01-24 | Beijing Biocytogen Co., Ltd | GENETICALLY MODIFIED IMMUNOGLOBULIN HEAVY CHAIN ANIMALS |
| CN108486126A (zh) * | 2018-03-27 | 2018-09-04 | 重庆金迈博生物科技有限公司 | 一种核酸分子及其在人源化抗体中的应用 |
| CN108486125B (zh) * | 2018-03-27 | 2024-01-05 | 重庆金迈博生物科技有限公司 | 一种核酸分子及其在制备人源单域抗体中的应用 |
| US12331320B2 (en) | 2018-10-10 | 2025-06-17 | The Research Foundation For The State University Of New York | Genome edited cancer cell vaccines |
| CN112852826B (zh) * | 2019-06-04 | 2023-05-19 | 中国农业科学院兰州兽医研究所 | 猪α环形转录本αCT基因及应用 |
| WO2021163035A1 (en) * | 2020-02-12 | 2021-08-19 | Sab, Llc. | Anti-thymocyte globulin |
| EP4204005A1 (en) | 2020-08-31 | 2023-07-05 | Sab, Llc | Ungulate-derived polyclonal immunoglobulin specific for coronavirus protein and uses thereof |
| WO2022104152A1 (en) * | 2020-11-13 | 2022-05-19 | SAB Biotherapeutics, Inc. | Ungulate-derived polyclonal immunoglobulin specific for pd-l1 and uses thereof |
| EP4243870A4 (en) * | 2020-11-13 | 2024-12-18 | Sab, Llc | UNGLILATE-DERIVED POLYCLONAL IMMUNGLOBULIN SPECIFIC TO EGFR AND USES THEREOF |
| EP4441091A4 (en) * | 2021-11-30 | 2025-12-17 | Sab Llc | UNGULATE-DERIVED POLYCLONAL IMMUNE GLOBULIN SPECIFIC FOR INFLUENCE VAVIRUS AND USES THEREOF |
| US20240279315A1 (en) | 2023-02-17 | 2024-08-22 | Sab, Llc | Ungulate-derived polyclonal immunoglobulin specific for influenza virus and uses thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5625126A (en) * | 1990-08-29 | 1997-04-29 | Genpharm International, Inc. | Transgenic non-human animals for producing heterologous antibodies |
| US20040068760A1 (en) * | 1999-11-19 | 2004-04-08 | Robl James M. | Transgenic ungulates capable of human antibody production |
| CA2780945A1 (en) * | 2009-11-17 | 2011-05-26 | Kyowa Hakko Kirin Co., Ltd. | Human artificial chromosome vector |
Family Cites Families (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6833268B1 (en) | 1999-06-10 | 2004-12-21 | Abgenix, Inc. | Transgenic animals for producing specific isotypes of human antibodies via non-cognate switch regions |
| DE60144305D1 (de) | 2000-11-17 | 2011-05-05 | Kyowa Hakko Kirin Co Ltd | Expression von xenogenen (humanen) Immunglobulinen in klonierten, transgenen Huftieren |
| US7476536B2 (en) * | 2001-05-11 | 2009-01-13 | Kirin Pharma Kabushiki Kaisha | Artificial human chromosome containing human antibody a light chain gene |
| NZ536341A (en) * | 2002-05-17 | 2008-05-30 | Kirin Holdings Kk | Transgenic ungulates capable of human antibody production |
| EP1644417B1 (en) | 2003-07-15 | 2014-04-30 | Therapeutic Human Polyclonals, Inc. | Humanized immunoglobulin loci |
| CN102164676B (zh) * | 2008-07-10 | 2014-10-29 | 菲活机器制造公司 | 带有分离器的珠磨机 |
| EP2346994B1 (en) * | 2008-09-30 | 2022-02-16 | Ablexis, LLC | Knock-in mice for the production of chimeric antibodies |
| BR112012000536A2 (pt) * | 2009-07-08 | 2020-08-11 | Kymab Limited | métodos para produção de anticorpo ou cadeia leve ou pesada de anticorpo específico para um antígeno desejado, para produção de anticorpo ou cadeia de anticorpo e seu uso, composição farmacêutica e derivado de anticorpo quimérico |
| US20150018225A1 (en) * | 2011-05-13 | 2015-01-15 | University Of Miyazaki | Cell adhesion inhibitor, cell proliferation inhibitor, and method and kit for examining cancer |
-
2013
- 2013-08-05 KR KR1020157005433A patent/KR102159163B1/ko active Active
- 2013-08-05 CN CN201380041315.4A patent/CN104755493B/zh active Active
- 2013-08-05 AU AU2013296182A patent/AU2013296182B2/en active Active
- 2013-08-05 EP EP13747631.3A patent/EP2880055B1/en active Active
- 2013-08-05 US US14/416,870 patent/US9902970B2/en active Active
- 2013-08-05 WO PCT/US2013/053618 patent/WO2014022853A1/en not_active Ceased
- 2013-08-05 IN IN1700DEN2015 patent/IN2015DN01700A/en unknown
- 2013-08-05 JP JP2015525643A patent/JP6426606B2/ja active Active
- 2013-08-05 NZ NZ703973A patent/NZ703973A/en unknown
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5625126A (en) * | 1990-08-29 | 1997-04-29 | Genpharm International, Inc. | Transgenic non-human animals for producing heterologous antibodies |
| US20040068760A1 (en) * | 1999-11-19 | 2004-04-08 | Robl James M. | Transgenic ungulates capable of human antibody production |
| CA2780945A1 (en) * | 2009-11-17 | 2011-05-26 | Kyowa Hakko Kirin Co., Ltd. | Human artificial chromosome vector |
Non-Patent Citations (6)
| Title |
|---|
| CHOI, YOON JONG: "Fully human antigen-specific polyclonal antibody responses induced in cloned human artificial chromosome transchromosomic cattle", 5 February 2005 (2005-02-05), XP002714035, Retrieved from the Internet <URL:http://scholarworks.umass.edu/dissertations/AAI3179866/> [retrieved on 20131001] * |
| DUTEAU, ANAE: "Characterization of the human Ig guest locus in HAC transgenic cattle", May 2005 (2005-05-01), XP002714034, Retrieved from the Internet <URL:http://scholarworks.umass.edu/dissertations/AAI3179871/> [retrieved on 20131001] * |
| KUROIWA Y ET AL: "Cloned transchromosomic calves producing human immunoglobulin", NATURE BIOTECHNOLOGY, NATURE PUBLISHING GROUP, NEW YORK, NY, US, vol. 20, no. 9, 1 September 2002 (2002-09-01), pages 889 - 894, XP002976595, ISSN: 1087-0156, DOI: 10.1038/NBT727 * |
| WILFRIED A KUES ET AL: "Advances in farm animal transgenesis", PREVENTIVE VETERINARY MEDICINE, vol. 102, no. 2, 18 April 2011 (2011-04-18), pages 146 - 156, XP028311241, ISSN: 0167-5877, [retrieved on 20110418], DOI: 10.1016/J.PREVETMED.2011.04.009 * |
| YOSHIMI KUROIWA ET AL: "Antigen-specific human polyclonal antibodies from hyperimmunized cattle", NATURE BIOTECHNOLOGY, vol. 27, no. 2, 1 February 2009 (2009-02-01), pages 173 - 181, XP055012629, ISSN: 1087-0156, DOI: 10.1038/nbt.1521 * |
| ZHAO Y ET AL: "Physical mapping of the bovine immunoglobulin heavy chain constant region gene locus", JOURNAL OF BIOLOGICAL CHEMISTRY, AMERICAN SOCIETY FOR BIOCHEMISTRY AND MOLECULAR BIOLOGY, vol. 278, no. 37, 26 June 2003 (2003-06-26), pages 35024 - 35032, XP002509391, ISSN: 0021-9258, [retrieved on 20030626], DOI: 10.1074/JBC.M301337200 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104904661A (zh) * | 2015-06-05 | 2015-09-16 | 王彦刈 | 一种人源化小鼠 |
Also Published As
| Publication number | Publication date |
|---|---|
| KR20150039820A (ko) | 2015-04-13 |
| NZ703973A (en) | 2018-04-27 |
| IN2015DN01700A (https=) | 2015-05-22 |
| EP2880055B1 (en) | 2017-06-28 |
| JP2016504012A (ja) | 2016-02-12 |
| US9902970B2 (en) | 2018-02-27 |
| CN104755493B (zh) | 2020-12-25 |
| JP6426606B2 (ja) | 2018-11-21 |
| HK1210621A1 (en) | 2016-04-29 |
| CN104755493A (zh) | 2015-07-01 |
| AU2013296182A1 (en) | 2015-02-19 |
| US20150211020A1 (en) | 2015-07-30 |
| KR102159163B1 (ko) | 2020-09-23 |
| AU2013296182B2 (en) | 2018-03-08 |
| EP2880055A1 (en) | 2015-06-10 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| AU2013296182B2 (en) | Complex chromosome engineering for production of human antibodies in transgenic animals | |
| EP2502993B1 (en) | Human artificial chromosome vector | |
| CA3006810C (en) | Genetic engineering of non-human animals for the production of chimeric antibodies | |
| HK1210621B (en) | Complex chromosome engineering for production of human antibodies in transgenic animals | |
| HK1176637A (en) | Human artificial chromosome vector | |
| HK1176637B (en) | Human artificial chromosome vector | |
| HK1176638A (en) | Human artificial chromosome vector |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 13747631 Country of ref document: EP Kind code of ref document: A1 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 14416870 Country of ref document: US |
|
| REEP | Request for entry into the european phase |
Ref document number: 2013747631 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2013747631 Country of ref document: EP |
|
| ENP | Entry into the national phase |
Ref document number: 2015525643 Country of ref document: JP Kind code of ref document: A |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 2013296182 Country of ref document: AU Date of ref document: 20130805 Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 20157005433 Country of ref document: KR Kind code of ref document: A |