WO2013186754A2 - Method for detecting and identifying enterohemorrhagic escherichia coli - Google Patents

Method for detecting and identifying enterohemorrhagic escherichia coli Download PDF

Info

Publication number
WO2013186754A2
WO2013186754A2 PCT/IB2013/054888 IB2013054888W WO2013186754A2 WO 2013186754 A2 WO2013186754 A2 WO 2013186754A2 IB 2013054888 W IB2013054888 W IB 2013054888W WO 2013186754 A2 WO2013186754 A2 WO 2013186754A2
Authority
WO
WIPO (PCT)
Prior art keywords
primers
ehec
seq
crispr
sequence
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/IB2013/054888
Other languages
English (en)
French (fr)
Other versions
WO2013186754A3 (en
Inventor
Patrick Fach
Sabine Delannoy
Lothar Beutin
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Agence National de Securite Sanitaire de l'Alimentation de l'Environnement Et du Travail
Original Assignee
Agence National de Securite Sanitaire de l'Alimentation de l'Environnement Et du Travail
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Agence National de Securite Sanitaire de l'Alimentation de l'Environnement Et du Travail filed Critical Agence National de Securite Sanitaire de l'Alimentation de l'Environnement Et du Travail
Priority to CA2875919A priority Critical patent/CA2875919C/en
Priority to EP13747516.6A priority patent/EP2861762B1/en
Priority to BR112014031370-9A priority patent/BR112014031370B1/pt
Priority to JP2015516741A priority patent/JP6166365B2/ja
Priority to CN201380030965.9A priority patent/CN104619860B/zh
Priority to US14/407,884 priority patent/US10190175B2/en
Priority to MX2014015130A priority patent/MX357697B/es
Priority to ES13747516.6T priority patent/ES2659469T3/es
Priority to KR1020157000638A priority patent/KR102065053B1/ko
Priority to AU2013276084A priority patent/AU2013276084B2/en
Publication of WO2013186754A2 publication Critical patent/WO2013186754A2/en
Publication of WO2013186754A3 publication Critical patent/WO2013186754A3/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/689Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844Nucleic acid amplification reactions
    • C12Q1/686Polymerase chain reaction [PCR]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2537/00Reactions characterised by the reaction format or use of a specific feature
    • C12Q2537/10Reactions characterised by the reaction format or use of a specific feature the purpose or use of
    • C12Q2537/143Multiplexing, i.e. use of multiple primers or probes in a single reaction, usually for simultaneously analyse of multiple analysis
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/156Polymorphic or mutational markers
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/158Expression markers
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/16Primer sets for multiplex assays

Definitions

  • the invention relates to the identification of Shiga toxin producing E. coli (STEC) that constitutes a severe risk for human health.
  • STEM Shiga toxin producing E. coli
  • Shiga toxin-producing Escherichia coli are a diverse group of E. coli belonging to over 400 E. coli ⁇ . ⁇ serotypes, some of which cause outbreaks and sporadic cases of foodborne illness ranging from diarrhoea to hemorrhagic colitis (HC) and the haemolytic uremic syndrome (HUS). According to their human pathogenicity the latter strains were also designated as enterohaemorrhagic E. coli (EH EC) (Lcvine 1987, Nataro and Kaper 1998). Numerous cases of HC and HUS have been attributed to EH EC serotype 0157:H7 strains, but it has now been recognized that other serotypes of STEC belong to the EHEC group.
  • EH EC enterohaemorrhagic E. coli
  • serotypes of STEC are implicated in outbreaks and sporadic cases of HC and HUS. These comprise serotypes 026:[H11], 045:[H2], O103:[H2], 0111 :[H8], 0121 :[H19], 0145:[H28], 0157:[H7] and their non-motile derivatives.
  • EHEC enterohaemorrhagic E. coli
  • PCT WO 201 1/018762 describes a method involving the combined detection of the genes six I, stx2, eae, nleB and espK to predict the presence of EHEC in a sample.
  • the inventors have now identified discriminative genetic markers associated with several STEC strains constituting a severe risk for human health.
  • they have identified genetic markers located within CRISP s (Clustered Regularly Interspaced Short Palindromic Repeats) sequences of EHEC strains with high virulence for humans.
  • CRISP s Simple Regularly Interspaced Short Palindromic Repeats
  • CRISPRs are present within the genomes of many bacterial species, including E. coli. They consist of tandem sequences containing direct repeats of 21 to 47 bp long and separated by spacers of similar size. Spacers are derived from foreign nucleic acids, such as phages or plasmids, and it has been hypothesized that they can protect bacteria from subsequent infection by homologous phages and plasmids.
  • the inventors have sequenced the CRISPR loci of various EHEC strains which are associated with the world's most frequent clinical cases, and have identified different spacers that can be used for a specific identification of the EHEC serotypes 0157:[H7], 0145:[H28], O103:[H2], 01 1 1 :[H8], 0121 :[H19], 045:[H2], 026:[H11], O104:[H4] and their non motile derivatives, which are responsible for the majority of EHEC infections in humans.
  • an object of the present invention is a method for identifying the serotypc(s) of EHEC suspected to be present in a sample, wherein said method comprises detecting the presence or the absence, in said sample or DNA isolated therefrom, of the following E. coli CRISPRs sequences: a) CRISPRs sequences for identifying EH EC 0157:[H7] wherein said CRISPRs sequences are selected among:
  • a CRISPR sequence for identifying EHEC 026:[H11] wherein said CRISPR sequence is the sequence SEQ ID NO: 10, and wherein the presence of said CRISPR sequence is indicative of the presence of EHEC 026:[H11].
  • said method comprises performing a PCR assay on said sample or DNA isolated therefrom, with primers designed for amplifying said CRISPR sequences, and checking for the presence of the corresponding amplification products.
  • said PCR assay is performed with a combination of primers comprising:
  • primers for detecting EHEC 0157:[H7] wherein said primers consist of :
  • primers targeting both the CRISPR sequences SEQ ID NO: 1 and SEQ ID NO: 2, wherein said primers are defined by the following sequences:
  • CTTAGTGTGTTCCCCGCGC (SEQ ID NO: 12) and - a set of primers targeting the CRISPR sequence SEQ ID NO: 3 wherein said primers are defined by the following sequences:
  • primers targeting the CRISPR sequence SEQ ID NO: 4 wherein said primers are defined by the following sequences:
  • primers for detecting EH EC 0145:[H28] wherein said primers consist of:
  • primers targeting the CRISPR sequence SEQ ID NO: 5 wherein said primers are defined by the following sequences:
  • primers for detecting EHEC 01 1 1 :[H8] wherein said primers consist of:
  • primers for detecting EHEC 0121 :[H19] wherein said primers consist of:
  • primers for detecting EH EC O103:[H2] and/or EH EC 045:[H2] wherein said primers consist of:
  • primers targeting the CRISPR sequence SEQ ID NO: 8 wherein said primers are defined by the following sequences:
  • GAGTCTATCAGCGACACTACC SEQ ID NO: 24
  • primers for detecting EHEC O104:[H4] wherein said primers consist of: - a set of primers targeting the CRISPR sequence SEQ ID NO: 9, wherein said primers are defined by the following sequences:
  • GGAACTCACCGAGCGCCG (SEQ ID NO: 26);
  • primers for detecting EHEC 026:[H1 1] wherein said primers consist of:
  • ATAAACCGATCTCCTCATCCTC SEQ ID NO: 31 );
  • the amplification products can be detected by any appropriate method for detection of PCR products. For instance, they can be detected by means of probes derived from the respective target sequences.
  • SEQ ID NO: 1 and SEQ ID NO: 2 defined by the following sequence: CGATCAATCCGAATATGAGCGGT (SEQ ID NO: 32), and a probe allowing the detection of amplification products derived from SEQ ID NO: 3, defined by the following sequence: CACTGTTTTGGTGACGGTTTATCC (SEQ ID NO: 33), and/or a probe allowing the detection of amplification products derived from SEQ ID NO: 4, defined by the following sequence: ACAAAAACTGTCACCAAAGTGTTC (SEQ ID NO: 34);
  • SEQ ID NO: 7 defined by the following sequence:
  • EHEC enterohemorrhagic Escherichia coli
  • Escherichia coli strains both positive for stx and eae
  • Typical EHEC strains include in particular EHEC 0157:H7, 0145:H28, O103:H2, 01 1 1 :H8, 0121 :H19, 026:H 11 and 045 :H2 serotypes and their non-motile derivatives.
  • Said method comprises the detection of the espK gene and of one or more of the following target genes: espV, ureD, Z2098, Zl 151, Zl 153, 1154, Zl 155, Z1156, and Z6065.
  • E. coli gene targets correspond to non LEE-encoded type III effectors derived from various genomic O-islands: 01-43, OI-44, OI-50, 01-57 and 01-71.
  • said method comprises performing a PGR assay on said sample or DNA isolated therefrom with a combination of primers comprising a set of primers derived from espK and a set of primers derived from at least one oiespV, ureD, Z2098, Z1151, Z1153, Z1154, Z1155, 7.1156, and Z6065;
  • the combination of primers further comprises a set of primers derived from stxl and a set of primers derived from .s .v .
  • the method of the invention does not necessitate the detection of the eae gene.
  • Primers derived from espK, espV, ureD, Z2098, Z1 151 , Z1153, Z1154, Zl 155, Zl J 56, Z6065, stxl or stx2 and suitable for use in the PGR assay of the invention, as well as probes allowing the detection of the amplification products obtained with these primers, can easily be designed by one of skill in the art, on the basis of the sequences of these genes available in the databases, for instance within the annotated sequence of Escherichia coli 0157:H7 (strain EDL933) available in GenBank under accession number AE005174.2 .
  • CTGAAAAGAGCCAGAACGTGC (SEQ ID NO: 48)
  • a set of primers targeting Z6065 defined by the following sequences: GCACTGGCCCTTGTTGCTCAGGC (SEQ ID NO: 60) GCTCTTCCAGTGAGAATGTCTTTCCGG (SEQ ID NO: 61 )
  • Non-limitative examples of probes for detecting the amplification products are given bellow:
  • Zl 151 defined by the following sequence:
  • TCGTCAGGCACTGTCTGAAACTGCTCC (SEQ ID NO: 75);
  • the invention provides a method for predicting whether a sample contains typical enterohemorrhagic Escherichia coli (EHEC) of at least one of EHEC 0157:[H7], 0145:[H28], O103:[H2], Oi l 1 :[H8], 0121 :[H19], 026:[H11] and 045:[H2] serotypes, and further identifying the serotype(s) of said EHEC, wherein said method comprises:
  • the PCR assays of the invention can be used for testing any sample of a substance potentially containing EHEC, such as food samples, water samples, soil samples, etc.
  • PCR assays of the invention can be carried out using any method suitable for PCR amplification of target sequences, using any of the various natural or engineered enzymes available for this purpose.
  • Alternative methods such as nucleic acid sequence-based amplification (NASBA), branched DNA, strand displacement amplification or the loop-mediated isothermal amplification (LAMP) method (Compton 1991 , Chang 1991 , Walker et al.1992, Notomi et al., 2000) can also be used.
  • NASBA nucleic acid sequence-based amplification
  • LAMP loop-mediated isothermal amplification
  • Particularly preferred methods are those involving real time PCR amplification as described by Ian M. Mackay in "Real-time PCR in Microbiology : from diagnosis to characterization " (2007) Caister Academic Press, Norfolk, UK.
  • Real time PCR also called quantitative real time polymerase chain reaction (qPCR) or kinetic polymerase chain reaction
  • qPCR quantitative real time polymerase chain reaction
  • kinetic polymerase chain reaction kinetic polymerase chain reaction
  • Non-limiting examples of suitable fluorescent labels include 6-carboxyl- fluorescein (FAM), tetrachloro-6-carboxyfluorescein (TET), 6-carboxy-X-rhodamine (ROX).
  • suitable quenchers for labelling dual-labelled probes include 6-carboxy-tetramethyl-rhodamine (TAMRA).
  • TAMRA 6-carboxy-tetramethyl-rhodamine
  • DABCYL Non-Fluorescent Quenchers such as quenchers of the Black Hole Quencher family (BHQ), or including a minor groove binder group (MGB).
  • Each of the PCR assays of the invention can be carried out by performing a separate PCR reaction for each target sequence to be detected (simplex PCR). However, in many cases it will be preferred to carry out multiplex PCR, allowing amplification of several target sequences in a single reaction.
  • a macroarray i.e. a preformed structure such as a substrate upon which the desired DNA primers have been spotted.
  • Such a macroarray allows the routine performance of multiplex PCR assays described herein.
  • GeneDisc® macroarray Pall-GencDisc Technology, Bruz, France
  • Beutin et al. Beutin et al.2009
  • the assay may also comprise a negative amplification control to ensure any detected products are true positives and also an inhibition control to ensure that the DNA from the sample is able to be amplified and hence that no false negatives are generated.
  • the invention also encompasses the primer sets and the probes defined above, allowing carrying out the PGR assays of the invention, as well as kits associating these primer sets and these probes, eventually associated with reagents to perform a PGR reaction. These kits may also comprise instructions for performing said amplification reaction.
  • the amplification products using the primers of the invention are also part of the invention.
  • a kit of the invention comprises a combination of primers comprising:
  • SEQ ID NO: 12 and a set of primers defined by the sequences SEQ ID NO: 13 and SEQ ID NO: 14, and/or a set of primers defined by the sequences SEQ ID NO: 15 and SEQ ID NO: 16;
  • said kit also comprises:
  • a probe allowing the detection of amplification products derived from SEQ ID NO: 1 and SEQ ID NO: 2, and a probe allowing the detection of amplification products derived from SEQ ID NO: 3, and/or a probe allowing the detection of amplification products derived from SEQ ID NO: 4, as defined above;
  • a kit of the invention comprises:
  • said kit also comprises a probe allowing the detection of amplification products derived from espK, and one or more probe(s) selected among: a probe allowing the detection of amplification products derived from espV, a probe allowing the detection of amplification products derived from ureD, or a probe allowing the detection of amplification products derived from Z2098, a probe allowing the detection of amplification products derived from ZJ 151, a probe allowing the detection of amplification products derived from Z1153, a probe allowing the detection of amplification products derived from Zl 154, a probe allowing the detection of amplification products derived from Z1155, a probe allowing the detection of amplification products derived from Z1156, a probe allowing the detection of amplification products derived from Z6065.
  • a probe allowing the detection of amplification products derived from espV a probe allowing the detection of amplification products derived from ureD, or a probe allowing the detection of amplification products
  • kits according to the second embodiment described above may further comprise a set of primers targeting stxl and a set of primers targeting stx2, and preferably a probe allowing the detection of amplification products derived from stxl, and a probe allowing the detection of amplification products derived from stx2.
  • EXAMPLE 1 IDENTIFICATION OF DNA SEQUENCES DERIVED FROM THE CRISPRS LOCI OF E. COLI FOR SPECIFIC IDENTIFICATION OF ENTEROHAEMORRHAGIC E. COLI (EHEC)
  • the STEC EHEC type was defined on the presence of six- and eae-genes.
  • EHEC strains were defined as harbouring both a stx gene ⁇ stxl and/or stx 2) and eae, while STEC strains harboured stx only.
  • EHEC coli strains of serotypes 091 :[H21], OH3:[H21], O104:[H21], also named atypical EHEC, which are less frequently involved in hemorrhagic diseases than other EHEC, but are a frequent cause of diarrhea.
  • St.v-negative derivatives of EHEC strains were designated as EHEC-like and were defined based on their nle gene profile, eae subtype and serotype as described by Bugarel et al. (2010; 201 1 ) except for the EHEC-like strains of serotype 026 :H 1 1 which were identified based on the presence of the gene espK and their allelic type 2 of the arcA gene (Bugarel et al., 2011).
  • EPEC strains were defined as described by Bugarel et al. (2011).
  • Apathogenic E. coli were defined as stx- and eae- negative strains.
  • the CRISPR loci of E. coli strains were PGR amplified with the primers listed in Table II.
  • the double stranded DNA sequencing of the CRISPR amplicons was performed by Eurofins MWG Operon (Courtaboeuf, France) using the sequencing primers listed in Table II.
  • the LightCycler® 1536 (Roche, Meylan, France) was used to perform high- throughput real-time PGR amplifications.
  • the Bravo liquid dispenser automat (Agilent Technologies, Massy, France) equipped with a chiller and the PlateLoc thermal microplate sealer (Agilent Technologies) were used.
  • the PGR reactions contained 0.5 ⁇ sample and I ⁇ master mix containing lx RealTime ready DNA Probes master (Roche) (corresponding to ().7x final), 300 nM each primer and 300 nM each probe (corresponding to 200 nM final each). Amplifications were performed using FAM- or HEX-labeled TaqMan® probes.
  • Primers and probes used for PGR amplifications are listed in Table III.
  • the LightCycler® 1536 real-time PGR system was used with the following thermal profile: 95°C for 1 min followed by 35 cycles of 95°C for 0 s (ramp: 4.8°C/s) and 60°C for 30 s (ramp: 2.5°C/s) and a final cooling step at 40°C for 30s.
  • the software settings were Dual color hydrolysis probes/UPL probes and Master Control. Table III
  • coli strains including 75 strains of EHEC 0157:[H7] (Table I).
  • the PCR tests proved to be highly sensitive and specific for EHEC 0157:[H7]. Sensitivity of the assays was ranging from 92.0% to 97.3% with only few 0157:[H7] strains being not detected by each assay. The specificity of the PCR tests was high, ranging from 99.6 to 100%.
  • the PCR assay SP 0157 B was the unique test giving cross reaction with very few strains of serogroup 055.
  • the CRISPR locus of EHEC 0145:[H28] has been characterized (SEQ ID NO: 5) by sequencing one of the two CRISPR loci identified in E. coli.
  • a PCR assay (SP_0145) has been designed from this CRISPR sequence to target EHEC 0145:[H28].
  • SP_0145 has been designed from this CRISPR sequence to target EHEC 0145:[H28].
  • 955 E. coli strains that were investigated with this PCR test, only the 29 EHEC 0145:[H28] and 4 EPEC 028:H28 strains were tested positive. Sensitivity and specificity of the PCR assay SP_0145 were respectively of 100% and 99.5%.
  • the CRISPR locus of EHEC 0121 :[H 19] has been sequenced in this study (SEQ ID NO: 7).
  • a PCR assay (SP 0121 ) has been designed from this sequence to target EHEC 0121 :[H19].
  • SP 0121 The CRISPR locus of EHEC 0121 :[H 19] has been sequenced in this study.
  • a PCR assay (SP 0121 ) has been designed from this sequence to target EHEC 0121 :[H19].
  • 955 E. coli strains tested by the PCR assay SP 0121 only one O104:H7 and the 12 EHEC 0121 :[H19] strains were tested positive, showing that this PCR test was highly sensitive (100%) and specific (99.9%).
  • PCR assay SP_0405 Based on the sequence determination of the CRISPR locus of EHEC 045:[H2] (SEQ ID NO: 8) and the sequence of the CRISPR locus of EHEC O103:H2, issued from strain 12009 (accession number APO 10958), a PCR assay (SP_045) has been designed and tested positive one strain f EHEC 045 :H2 and all the 38 EHEC O103:H2 strains investigated in this study. Thus, the PCR assay SP 045 has shown high sensitivity (100%) for EHEC O103:[H2] and 045:[H2]. This test has 98.6% specificity when tested on a large panel of E.
  • the CRISPR locus of EHEC O104:[H4] has been sequenced in this study (SEQ ID NO: 9).
  • a PCR assay (SP O 104) has been designed from this sequence to target EHEC O104:[H4].
  • the PCR assay targeting the CRISPR locus of E. coli O104:H4 has been evaluated on a panel of 1303 strains of E. coli that included the 186 known O-serogroups and 56 H-types. This PCR assay gave positive results for the 48 O104:H4 isolates (including one Or:H4 isolate) related to the outbreak occurring in May 201 1 , and to one O104:H4 clinical isolate reported in 2001 .
  • EXAMPLE 2 IDENTIFICATION OF GENETIC MARKERS FOR IDENTIFYING SHIGA TOXIN-PRODUCING ESCHERICHIA COLI (STEC) ASSOCIATED WITH HIGH VIRULENCE FOR HUMANS
  • Nomenclature of ORFs and mobile elements refers to sequence of E. coli 0157:H7 EDL933 (GenBank AE005174)
  • Primers and probes used for PCR amplifications of the genetic markers espK, Z1151, Z1153, Z1154, Z1155, Z1156 and Z6065 are listed in Table VI. Primers and probes for the detection of stx J, stx2 and eae, were described previously (Bugarel et al. 2010). Amplification of the genes stxl, stx2 and eae were used as internal controls and for group assignment purposes.
  • the distribution of the different genetic markers espK, Z1151, Z1153, Z1154. Z1155, Z1156 and Z6065 among the different E. coli pathogroups is shown in Table VII below. Overall, the genetic markers investigated were mostly detected in EH EC strains with frequencies ranging from 51.9% (Z6065) to 90.8% (espK). These markers were less associated with EPEC strains with frequencies ranging from 17.7% (ZII54) to 53.8% (Z1155) and rarely detected in STEC (3.4 to 20.7%) and non-pathogenic E. coli (3.6 to 9.4%).
  • EPEC strains with frequencies ranging from 31.2% (espKIZll56) to 61 .8% (espK/ ⁇ 155), STEC strains with frequencies of 6.7% to 23.5% and non-pathogenic E. coli strains with frequencies between 7.9% and 13.7%.
  • each genetic marker espK, Z1151, Z1153, Z1154, Z1155, Z1156 and Z6065 was significantly different according to EHEC serotypes (Table VIII).
  • the genetic marker Z6065 is the unique genetic marker able to detect EHEC O104:H4 (stx positive, eae negative, aggR positive) that has been involved in the large German outbreak in 201 1.
  • EHEC strains of top 7 EHEC serotypes were detected.
  • all EHEC strains of the top 7 serotypes were tested positive, with the exception of 1 to 2 strains of EHEC 0121 :[H 19] which tested negative with espK/Z1154 and espK/Z6065 respectively; one strain of O103:[H2] that failed to be detected with espK/Z1154 and 7 to 8 strains of EHEC 026:[H11] which were found negative with all tested associations of genetic markers.
  • only few EHEC strains did not react with the genetic markers tested here.
  • EHEC / . coli strains both six and cue positive
  • the introduction of the genetic marker Z6065 allows detecting in addition EHEC O104:H4 (six positive, eae negative, aggR positive) that has been involved in the large German outbreak in 201 1.
  • Shiga toxin Shiga toxin
  • EH EC enterohemorrhagic E. coli
  • HC Hemorrhagic colitis
  • HUS Hemolytic Uremic Syndrome
  • STEC strains associated with human infections harbor other factors which might be used to distinguish STEC strains constituting a severe risk for human health from STEC strains that are not associated with severe and epidemic disease.
  • EH EC 0157:H7, Ol l l , O103 and 026 Genome sequencing of EH EC strains (EH EC 0157:H7, Ol l l , O103 and 026) has also pointed out other genetic markers, such as e.sp V whose role in disease has not been evaluated. This gene is located on 01-44 of EH EC 0157:H7 but its prevalence in other E. coli pathogroups has not been documented yet.
  • the EH EC type strains (n 340) and were defined on the presence of stx- and eae-genes.
  • espK/espV represent strains giving a positive result for espK and/or espV
  • espK/ureD represent strains giving a positive result for espK and/or ureD
  • espK/Z2098 represent strains giving a positive result for Z2098 and/or espK
  • each genetic marker ureD, espV, espK, and Z2098 was significantly different according to EHEC serotypes. Distribution of each genetic marker in various EHEC serogroups is reported in Table XI. Except espV which was not detected in any EHEC 045:[H2], all the other genetic markers investigated were found highly prevalent in EHEC strains of the top 7 serotypes, with frequencies ranging from 71.4% (prevalence of ureD in O103:[H2]) to 100%.
  • espK/espV represent strains giving a positive result for espK and/or espV
  • espK/ureD represent strains giving a positive result for espK and/or ureD
  • espK/Z2098 represent strains giving a positive result for Z2098 and/or espK
  • the genetic markers ureD, espV, espK, Z2098, Zl 151, Z1153, Zl 154, Zl 155, Zl 156 and Z6065 were detected at different frequencies among the EHEC serotypes. We explored the various associations of these genetic markers to search for the best combinations of markers giving the higher specificity and sensitivity for detecting EHEC. Association of the genetic marker espK with one of the other nine genetic markers allows detecting most of the typical EHEC strains and in particular those belonging to the top7 EHEC serotypes. The genetic markers esp V, ureD and Z2098 were shown the best candidates to be combined with espK for detecting EHEC.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biophysics (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
PCT/IB2013/054888 2012-06-14 2013-06-14 Method for detecting and identifying enterohemorrhagic escherichia coli Ceased WO2013186754A2 (en)

Priority Applications (10)

Application Number Priority Date Filing Date Title
CA2875919A CA2875919C (en) 2012-06-14 2013-06-14 Method for detecting and identifying enterohemorrhagic escherichia coli.
EP13747516.6A EP2861762B1 (en) 2012-06-14 2013-06-14 Method for detecting and identifying enterohemorrhagic escherichia coli
BR112014031370-9A BR112014031370B1 (pt) 2012-06-14 2013-06-14 Método para a identificação de serotipo(s) de escherichia coli enterohemorrágica em uma amostra
JP2015516741A JP6166365B2 (ja) 2012-06-14 2013-06-14 腸出血性大腸菌を検出及び同定する方法
CN201380030965.9A CN104619860B (zh) 2012-06-14 2013-06-14 用于检测和鉴定肠出血性大肠杆菌的方法
US14/407,884 US10190175B2 (en) 2012-06-14 2013-06-14 Method for detecting and identifying enterohemorrhagic Escherichia coli
MX2014015130A MX357697B (es) 2012-06-14 2013-06-14 Método para detectar e identificar escherichia colienterohemorrágica.
ES13747516.6T ES2659469T3 (es) 2012-06-14 2013-06-14 Método para detectar e identificar Escherichia Coli enterohemorrágica
KR1020157000638A KR102065053B1 (ko) 2012-06-14 2013-06-14 장출혈성 대장균의 검출 및 식별 방법
AU2013276084A AU2013276084B2 (en) 2012-06-14 2013-06-14 Method for detecting and identifying enterohemorrhagic Escherichia coli

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP12171941.3A EP2674501A1 (en) 2012-06-14 2012-06-14 Method for detecting and identifying enterohemorrhagic Escherichia coli
EP12171941.3 2012-06-14

Publications (2)

Publication Number Publication Date
WO2013186754A2 true WO2013186754A2 (en) 2013-12-19
WO2013186754A3 WO2013186754A3 (en) 2014-02-20

Family

ID=48949190

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/IB2013/054888 Ceased WO2013186754A2 (en) 2012-06-14 2013-06-14 Method for detecting and identifying enterohemorrhagic escherichia coli

Country Status (12)

Country Link
US (1) US10190175B2 (https=)
EP (2) EP2674501A1 (https=)
JP (1) JP6166365B2 (https=)
KR (1) KR102065053B1 (https=)
CN (1) CN104619860B (https=)
AU (1) AU2013276084B2 (https=)
BR (1) BR112014031370B1 (https=)
CA (1) CA2875919C (https=)
CL (1) CL2014003377A1 (https=)
ES (1) ES2659469T3 (https=)
MX (1) MX357697B (https=)
WO (1) WO2013186754A2 (https=)

Cited By (38)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9068179B1 (en) 2013-12-12 2015-06-30 President And Fellows Of Harvard College Methods for correcting presenilin point mutations
US9163284B2 (en) 2013-08-09 2015-10-20 President And Fellows Of Harvard College Methods for identifying a target site of a Cas9 nuclease
US9228207B2 (en) 2013-09-06 2016-01-05 President And Fellows Of Harvard College Switchable gRNAs comprising aptamers
US9322037B2 (en) 2013-09-06 2016-04-26 President And Fellows Of Harvard College Cas9-FokI fusion proteins and uses thereof
US9322006B2 (en) 2011-07-22 2016-04-26 President And Fellows Of Harvard College Evaluation and improvement of nuclease cleavage specificity
WO2016087621A1 (en) * 2014-12-03 2016-06-09 Qiagen Gmbh Highly specific and sensitive methods for detecting enterohemorrhagic escherichia coli serotypes o157:h7 and/or o145:h28
WO2016115441A1 (en) * 2015-01-16 2016-07-21 Kansas State University Research Foundation Co-detection and association of multiple genes from the same genome in a sample
US9526784B2 (en) 2013-09-06 2016-12-27 President And Fellows Of Harvard College Delivery system for functional nucleases
US9725714B2 (en) 2013-03-14 2017-08-08 Caribou Biosciences, Inc. Compositions and methods of nucleic acid-targeting nucleic acids
US9834791B2 (en) 2013-11-07 2017-12-05 Editas Medicine, Inc. CRISPR-related methods and compositions with governing gRNAS
US9885026B2 (en) 2011-12-30 2018-02-06 Caribou Biosciences, Inc. Modified cascade ribonucleoproteins and uses thereof
US10000772B2 (en) 2012-05-25 2018-06-19 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US10077453B2 (en) 2014-07-30 2018-09-18 President And Fellows Of Harvard College CAS9 proteins including ligand-dependent inteins
US10113163B2 (en) 2016-08-03 2018-10-30 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US10167457B2 (en) 2015-10-23 2019-01-01 President And Fellows Of Harvard College Nucleobase editors and uses thereof
WO2020051301A1 (en) * 2018-09-06 2020-03-12 Hygiena, Llc Sequences and their use for detection and characterization of escherichia coli serotype o157:h7
US10731181B2 (en) 2012-12-06 2020-08-04 Sigma, Aldrich Co. LLC CRISPR-based genome modification and regulation
US10745677B2 (en) 2016-12-23 2020-08-18 President And Fellows Of Harvard College Editing of CCR5 receptor gene to protect against HIV infection
US11268082B2 (en) 2017-03-23 2022-03-08 President And Fellows Of Harvard College Nucleobase editors comprising nucleic acid programmable DNA binding proteins
US11306324B2 (en) 2016-10-14 2022-04-19 President And Fellows Of Harvard College AAV delivery of nucleobase editors
US11319532B2 (en) 2017-08-30 2022-05-03 President And Fellows Of Harvard College High efficiency base editors comprising Gam
US11447770B1 (en) 2019-03-19 2022-09-20 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US11542496B2 (en) 2017-03-10 2023-01-03 President And Fellows Of Harvard College Cytosine to guanine base editor
US11542509B2 (en) 2016-08-24 2023-01-03 President And Fellows Of Harvard College Incorporation of unnatural amino acids into proteins using base editing
US11560566B2 (en) 2017-05-12 2023-01-24 President And Fellows Of Harvard College Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation
US11661590B2 (en) 2016-08-09 2023-05-30 President And Fellows Of Harvard College Programmable CAS9-recombinase fusion proteins and uses thereof
US11732274B2 (en) 2017-07-28 2023-08-22 President And Fellows Of Harvard College Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE)
US11795443B2 (en) 2017-10-16 2023-10-24 The Broad Institute, Inc. Uses of adenosine base editors
US11898179B2 (en) 2017-03-09 2024-02-13 President And Fellows Of Harvard College Suppression of pain by gene editing
US11912985B2 (en) 2020-05-08 2024-02-27 The Broad Institute, Inc. Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence
US12157760B2 (en) 2018-05-23 2024-12-03 The Broad Institute, Inc. Base editors and uses thereof
US12281338B2 (en) 2018-10-29 2025-04-22 The Broad Institute, Inc. Nucleobase editors comprising GeoCas9 and uses thereof
US12351837B2 (en) 2019-01-23 2025-07-08 The Broad Institute, Inc. Supernegatively charged proteins and uses thereof
US12390514B2 (en) 2017-03-09 2025-08-19 President And Fellows Of Harvard College Cancer vaccine
US12406749B2 (en) 2017-12-15 2025-09-02 The Broad Institute, Inc. Systems and methods for predicting repair outcomes in genetic engineering
US12435330B2 (en) 2019-10-10 2025-10-07 The Broad Institute, Inc. Methods and compositions for prime editing RNA
US12473543B2 (en) 2019-04-17 2025-11-18 The Broad Institute, Inc. Adenine base editors with reduced off-target effects
US12522807B2 (en) 2018-07-09 2026-01-13 The Broad Institute, Inc. RNA programmable epigenetic RNA modifiers and uses thereof

Families Citing this family (19)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10760064B2 (en) 2013-03-15 2020-09-01 The General Hospital Corporation RNA-guided targeting of genetic and epigenomic regulatory proteins to specific genomic loci
WO2014204578A1 (en) 2013-06-21 2014-12-24 The General Hospital Corporation Using rna-guided foki nucleases (rfns) to increase specificity for rna-guided genome editing
CN112301024A (zh) 2013-03-15 2021-02-02 通用医疗公司 使用RNA引导的FokI核酸酶(RFN)提高RNA引导的基因组编辑的特异性
US9926546B2 (en) 2015-08-28 2018-03-27 The General Hospital Corporation Engineered CRISPR-Cas9 nucleases
US9512446B1 (en) 2015-08-28 2016-12-06 The General Hospital Corporation Engineered CRISPR-Cas9 nucleases
JP6799586B2 (ja) 2015-08-28 2020-12-16 ザ ジェネラル ホスピタル コーポレイション 遺伝子操作CRISPR−Cas9ヌクレアーゼ
CN105779584A (zh) * 2015-12-18 2016-07-20 珠海出入境检验检疫局检验检疫技术中心 大肠杆菌o111检测用的引物和探针组、试剂盒及pcr检测方法
CN105821124A (zh) * 2016-04-06 2016-08-03 山东省滨州畜牧兽医研究院 一种大肠杆菌 o26、o45、o121血清型三重pcr检测试剂盒及其引物组
US11591589B2 (en) 2017-04-21 2023-02-28 The General Hospital Corporation Variants of Cpf1 (Cas12a) with altered PAM specificity
EP3630849A4 (en) 2017-05-25 2021-01-13 The General Hospital Corporation BIPARTITE BASIC EDITOR (BBE) AND TYPE II-C-CAS9 ZINC FINGER EDITOR ARCHITECTURES
EP3731959B1 (en) * 2017-12-29 2025-10-08 Clear Labs, Inc. Automated priming and library loading device
US10597714B2 (en) 2017-12-29 2020-03-24 Clear Labs, Inc. Automated priming and library loading device
US10246704B1 (en) 2017-12-29 2019-04-02 Clear Labs, Inc. Detection of microorganisms in food samples and food processing facilities
CN108950033B (zh) * 2018-07-26 2022-01-11 江苏省农业科学院 同时检测肠出血性大肠杆菌o45和o145的纳米pcr试剂盒及其应用
CN111100862B (zh) * 2018-10-26 2023-09-29 厦门大学 一种检测细菌血清型的方法
US11946040B2 (en) 2019-02-04 2024-04-02 The General Hospital Corporation Adenine DNA base editor variants with reduced off-target RNA editing
US20230279442A1 (en) 2021-12-15 2023-09-07 Versitech Limited Engineered cas9-nucleases and method of use thereof
CN116903710B (zh) * 2023-09-12 2023-11-14 山东省农业科学院畜牧兽医研究所 噬菌体靶向蛋白分子及其在鉴定o103抗原血清型的产志贺毒素大肠杆菌中的应用
WO2026006542A2 (en) 2024-06-26 2026-01-02 Yale University Compositions and methods for crispr/cas9 based reactivation of human angelman syndrome

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2011018762A1 (en) 2009-08-11 2011-02-17 Agence Nationale Chargee De La Securite Sanitaire De L'alimentation, De L'environnement Et Du Travail An assay for determining a molecular risk assessment of a complex polymicrobial sample suspected to contain an ehec

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2002355074A (ja) * 2001-01-24 2002-12-10 Univ Tsukuba 腸管出血性病原性大腸菌o157:h7に特異的な核酸分子およびポリペプチド並びにこれらの使用方法
US20060051751A1 (en) * 2002-01-23 2006-03-09 Gehua Wang Major virulence factor detection and verocytontoxin type 2 subtype from clinical e. coli isolates using a one-step multiplex pcr

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2011018762A1 (en) 2009-08-11 2011-02-17 Agence Nationale Chargee De La Securite Sanitaire De L'alimentation, De L'environnement Et Du Travail An assay for determining a molecular risk assessment of a complex polymicrobial sample suspected to contain an ehec

Non-Patent Citations (24)

* Cited by examiner, † Cited by third party
Title
BUGAREL M; BEUTIN L; FACH P.: "Low-density macroarray targeting non-locus of enterocyte effacement effectors (nle genes) and major virulence factors of Shiga toxin- producing Escherichia coli (STEC): a new approach for molecular risk assessment of STEC isolates", APPL ENVIRON MICROBIOL., vol. 76, no. 1, January 2010 (2010-01-01), pages 203 - 11, XP009127973, DOI: doi:10.1128/AEM.01921-09
BUGAREL M; BEUTIN L; MARTIN A; GILL A; FACH P.: "Micro-array for the identification of Shiga toxin-producing Escherichia coli (STEC) seropathotypes associated with Hemorrhagic Colitis and Hemolytic Uremic Syndrome in humans", INT J FOOD MICROBIOL., vol. 142, no. 3, pages 318 - 29, XP027219916
BUGAREL M; BEUTIN L; SCHEUTZ F; LOUKIADIS E; FACH P: "Identification of genetic markers for differentiation of Shiga toxin-producing, enteropathogenic, and avirulent strains of Escherichia coli 026", APPL ENVIRON MICROBIOL., vol. 77, no. 7, April 2011 (2011-04-01), pages 2275 - 81, XP055039698, DOI: doi:10.1128/AEM.02832-10
BUGAREL M; MARTIN A; FACH P; BEUTIN L.: "Virulence gene profiling of enterohemorrhagic (EHEC) and enteropathogenic (EPEC) Escherichia coli strains: a basis for molecular risk assessment of typical and atypical EPEC strains", BMC MICROBIOL., vol. 11, 21 June 2011 (2011-06-21), pages 142, XP021102743, DOI: doi:10.1186/1471-2180-11-142
CERGOLE-NOVELLA MC; NISHIMURA LS; DOS SANTOS LF; IRINO K; VAZ TM; BERGAMINI AM; GUTH BE: "Distribution of virulence profiles related to new toxins and putative adhesins in Shiga toxin-producing Escherichia coli isolated from diverse sources in Brazil", FEMS MICROBIOL LETT., vol. 274, no. 2, 25 July 2007 (2007-07-25), pages 329 - 34
CHANG, C.: "Branched DNA Amplification Multimers for the Sensitive, Direct Detection of Human Hepatitis Viruses", NUCLEIC ACIDS SYMPOSIUM SERIES, 1991, pages 197 - 200
COMPTON, J.: "Nucleic Acid Sequence-Based Amplification", NATURE, vol. 350, no. 6313, 1991, pages 91 - 92, XP000176319, DOI: doi:10.1038/350091a0
COOMBES BK; WICKHAM ME; MASCARENHAS M; GRUENHEID S; FINLAY BB; KARMALI MA: "Molecular analysis as an aid to assess the public health risk of non-0157 Shiga toxin- producing Escherichia coli strains", APPL ENVIRON MICROBIOL., vol. 74, no. 7, April 2008 (2008-04-01), pages 2153 - 60, XP002564138, DOI: doi:10.1128/AEM.02566-07
CREUZBURG K; MIDDENDORFB; MELLMANN A; MARTALER T; HOLZ C; FRUTH A; KARCH H; SCHMIDT H.: "Evolutionary analysis and distribution of type III effector genes in pathogenic Escherichia coli from human, animal and food sources", ENVIRON MICROBIOL., vol. 13, February 2011 (2011-02-01), pages 2
FRANK C; WERBER D; CRAMER JP; ASKAR M; FABER M; AN DER HEIDEN M; BERNARD H; FRUTH A; PRAGER R; SPODE A: "HUS Investigation Team. Epidemic profile of Shiga-toxin-producing Escherichia coli 0104:H4 outbreak in Germany", N ENGL J MED., vol. 365, no. 19, 10 November 2011 (2011-11-10), pages 1771 - 80
GAULT G; WEILL FX; MARIANI-KURKDJIAN P; JOURDAN-DA SILVA N; KING L; ALDABE B; CHARRON M; ONG N; CASTOR C; MACE M: "Outbreak of haemolytic uraemic syndrome and bloody diarrhoea due to Escherichia coli 0104:H4, south- west France", EURO SURVEILL., vol. 16, no. 26, 30 June 2011 (2011-06-30)
IMAMOVIC L; TOZZOLI R; MICHELACCI V; MINELLI F; MARZIANO ML; CAPRIOLI A; MORABITO S.: "OI-57, a genomic island of Escherichia coli 0157, is present in other seropathotypes of Shiga toxin-producing E. coli associated with severe human disease", INFECT IMMUN., vol. 78, no. 11, November 2010 (2010-11-01), pages 4697 - 704
J. APPL. MICROBIOL., vol. 106, no. 4, pages 1122 - 1132
KARMALI, M. A.; M. MASCARENHAS; S. SHEN; K. ZIEBELL; S. JOHNSON; R. REID-SMITH; J. ISAAC- RENTON; C. CLARK; K. RAHN; J. B. KAPER: "Association of genomic 0 island 122 of Escherichia coli EDL 933 with verocytotoxin-producing Escherichia coli seropathotypes that are linked to epidemic and/or serious disease", J. CLIN. MICROBIOL., vol. 41, 2003, pages 4930 - 4940
LEVINE, M. M.: "Escherichia coli That Cause Diarrhea - Enterotoxigenic, Enteropathogenic, Enteroinvasive, Enterohemorrhagic, and Enteroadherent", J. INFECT. DIS., vol. 155, 1987, pages 377 - 389, XP001000816
MACKAY, 1.: "Real-time PCR in Microbiology, from diagnosis to characterization", 2007, CAISTER ACADEMIC PRESS
NATARO, J. P.; J. B. KAPER: "Diarrheagenic Escherichia coli", CLINICAL MICROBIOL. REV., vol. 11, 1998, pages 142 - 201, XP002244492
NOTOMI, T.; OKAYAMA, H.; MASUBUCHI, H.; YONEKAWA, T.; WATANABE, K.; AMINO, N.; HASE, T.: "Loop-Mediated Isothermal Amplification of DNA", NUCLEIC ACIDS RESEARCH, vol. 28, no. 12, 2000, pages E63, XP003018858, DOI: doi:10.1093/nar/28.12.e63
SCHEUTZ F; NIELSEN EM; FRIMODT-MOLLER J; BOISEN N; MORABITO S; TOZZOLI R; NATARO JP; CAPRIOLI A: "Characteristics of the enteroaggregative Shiga toxin/verotoxin-producing Escherichia coli 0104:H4 strain causing the outbreak of haemolytic uraemic syndrome in Germany", EURO SURVEILL., vol. 16, no. 24, May 2011 (2011-05-01)
SPEARS KJ; ROE AJ; GALLY DL: "A comparison of enteropathogenic and enterohaemorrhagic Escherichia coli pathogenesis", FEMS MICROBIOL LETT., vol. 255, no. 2, February 2006 (2006-02-01), pages 187 - 202, XP002634275, DOI: doi:10.1111/j.1574-6968.2006.00119.x
STRUELENS MJ; PALM D; TAKKINEN J.: "Enteroaggregative, Shiga toxin-producing Escherichia coli 0104:H4 outbreak: new microbiological findings boost coordinated investigations by European public health laboratories", EURO SURVEILL., vol. 16, no. 24, 16 June 2011 (2011-06-16)
TOBE T; BEATSON SA; TANIGUCHI H; ABE H; BAILEY CM; FIVIAN A; YOUNIS R; MATTHEWS S; MARCHES 0; FRANKEL G: "An extensive repertoire of type III secretion effectors in Escherichia coli 0157 and the role of lambdoid phages in their dissemination", PROC NATL ACAD SCI U S A., vol. 103, no. 40, 3 October 2006 (2006-10-03), pages 14941 - 6, XP002634274, DOI: doi:10.1073/pnas.0604891103
VLISIDOU I; MARCHES 0; DZIVA F; MUNDY R; FRANKEL G; STEVENS MP: "Identification and characterization of EspK, a type III secreted effector protein of enterohaemorrhagic Escherichia coli 0157:H7", FEMS MICROBIOL LETT., vol. 263, no. 1, October 2006 (2006-10-01), pages 32 - 40, XP002604107, DOI: doi:10.1111/J.1574-6968.2006.00410.X
WALKER, G.; FRAISER, M.; SCHRAM, J.; LITTLE, M.; NADEAU, J.; DOUGLAS P.; MALINOWSKI, D.: "Strand Displacement Amplification-An Isothermal, In Vitro DNA Amplification Technique", NUCLEIC ACIDS RESEARCH, vol. 20, no. 7, 1992, pages 1691 - 1696

Cited By (157)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US12006520B2 (en) 2011-07-22 2024-06-11 President And Fellows Of Harvard College Evaluation and improvement of nuclease cleavage specificity
US9322006B2 (en) 2011-07-22 2016-04-26 President And Fellows Of Harvard College Evaluation and improvement of nuclease cleavage specificity
US10323236B2 (en) 2011-07-22 2019-06-18 President And Fellows Of Harvard College Evaluation and improvement of nuclease cleavage specificity
US9885026B2 (en) 2011-12-30 2018-02-06 Caribou Biosciences, Inc. Modified cascade ribonucleoproteins and uses thereof
US11939604B2 (en) 2011-12-30 2024-03-26 Caribou Biosciences, Inc. Modified cascade ribonucleoproteins and uses thereof
US10954498B2 (en) 2011-12-30 2021-03-23 Caribou Biosciences, Inc. Modified cascade ribonucleoproteins and uses thereof
US10711257B2 (en) 2011-12-30 2020-07-14 Caribou Biosciences, Inc. Modified cascade ribonucleoproteins and uses thereof
US10435678B2 (en) 2011-12-30 2019-10-08 Caribou Biosciences, Inc. Modified cascade ribonucleoproteins and uses thereof
US10982230B2 (en) 2012-05-25 2021-04-20 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US10988782B2 (en) 2012-05-25 2021-04-27 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US11634730B2 (en) 2012-05-25 2023-04-25 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US11549127B2 (en) 2012-05-25 2023-01-10 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US11674159B2 (en) 2012-05-25 2023-06-13 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US11814645B2 (en) 2012-05-25 2023-11-14 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US11479794B2 (en) 2012-05-25 2022-10-25 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US11473108B2 (en) 2012-05-25 2022-10-18 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US11401532B2 (en) 2012-05-25 2022-08-02 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US11332761B2 (en) 2012-05-25 2022-05-17 The Regenis of Wie University of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US11970711B2 (en) 2012-05-25 2024-04-30 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US11293034B2 (en) 2012-05-25 2022-04-05 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US10000772B2 (en) 2012-05-25 2018-06-19 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US10626419B2 (en) 2012-05-25 2020-04-21 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US10113167B2 (en) 2012-05-25 2018-10-30 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US10612045B2 (en) 2012-05-25 2020-04-07 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US11242543B2 (en) 2012-05-25 2022-02-08 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US12123015B2 (en) 2012-05-25 2024-10-22 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US11186849B2 (en) 2012-05-25 2021-11-30 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US10227611B2 (en) 2012-05-25 2019-03-12 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US11028412B2 (en) 2012-05-25 2021-06-08 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US10266850B2 (en) 2012-05-25 2019-04-23 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US10301651B2 (en) 2012-05-25 2019-05-28 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US10308961B2 (en) 2012-05-25 2019-06-04 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US11008590B2 (en) 2012-05-25 2021-05-18 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US10337029B2 (en) 2012-05-25 2019-07-02 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US10351878B2 (en) 2012-05-25 2019-07-16 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US10358658B2 (en) 2012-05-25 2019-07-23 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US10358659B2 (en) 2012-05-25 2019-07-23 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US10385360B2 (en) 2012-05-25 2019-08-20 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US10400253B2 (en) 2012-05-25 2019-09-03 The Regents Of The University Of California Methods and compositions or RNA-directed target DNA modification and for RNA-directed modulation of transcription
US10407697B2 (en) 2012-05-25 2019-09-10 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US10415061B2 (en) 2012-05-25 2019-09-17 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US10421980B2 (en) 2012-05-25 2019-09-24 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US10428352B2 (en) 2012-05-25 2019-10-01 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US11008589B2 (en) 2012-05-25 2021-05-18 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US10443076B2 (en) 2012-05-25 2019-10-15 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US11001863B2 (en) 2012-05-25 2021-05-11 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US10487341B2 (en) 2012-05-25 2019-11-26 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US10597680B2 (en) 2012-05-25 2020-03-24 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US10513712B2 (en) 2012-05-25 2019-12-24 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US10519467B2 (en) 2012-05-25 2019-12-31 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US10526619B2 (en) 2012-05-25 2020-01-07 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US10533190B2 (en) 2012-05-25 2020-01-14 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US10550407B2 (en) 2012-05-25 2020-02-04 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US10563227B2 (en) 2012-05-25 2020-02-18 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US10570419B2 (en) 2012-05-25 2020-02-25 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US10577631B2 (en) 2012-05-25 2020-03-03 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US12215343B2 (en) 2012-05-25 2025-02-04 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US10988780B2 (en) 2012-05-25 2021-04-27 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US10982231B2 (en) 2012-05-25 2021-04-20 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US12180504B2 (en) 2012-05-25 2024-12-31 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US11274318B2 (en) 2012-05-25 2022-03-15 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US10640791B2 (en) 2012-05-25 2020-05-05 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US10900054B2 (en) 2012-05-25 2021-01-26 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US10669560B2 (en) 2012-05-25 2020-06-02 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US10676759B2 (en) 2012-05-25 2020-06-09 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US10793878B1 (en) 2012-05-25 2020-10-06 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US10774344B1 (en) 2012-05-25 2020-09-15 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US10752920B2 (en) 2012-05-25 2020-08-25 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US12180503B2 (en) 2012-05-25 2024-12-31 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US10731181B2 (en) 2012-12-06 2020-08-04 Sigma, Aldrich Co. LLC CRISPR-based genome modification and regulation
US10745716B2 (en) 2012-12-06 2020-08-18 Sigma-Aldrich Co. Llc CRISPR-based genome modification and regulation
US9725714B2 (en) 2013-03-14 2017-08-08 Caribou Biosciences, Inc. Compositions and methods of nucleic acid-targeting nucleic acids
US9803194B2 (en) 2013-03-14 2017-10-31 Caribou Biosciences, Inc. Compositions and methods of nucleic acid-targeting nucleic acids
US9809814B1 (en) 2013-03-14 2017-11-07 Caribou Biosciences, Inc. Compositions and methods of nucleic acid-targeting nucleic acids
US11312953B2 (en) 2013-03-14 2022-04-26 Caribou Biosciences, Inc. Compositions and methods of nucleic acid-targeting nucleic acids
US9909122B2 (en) 2013-03-14 2018-03-06 Caribou Biosciences, Inc. Compositions and methods of nucleic acid-targeting nucleic acids
US10125361B2 (en) 2013-03-14 2018-11-13 Caribou Biosciences, Inc. Compositions and methods of nucleic acid-targeting nucleic acids
US10508298B2 (en) 2013-08-09 2019-12-17 President And Fellows Of Harvard College Methods for identifying a target site of a CAS9 nuclease
US11920181B2 (en) 2013-08-09 2024-03-05 President And Fellows Of Harvard College Nuclease profiling system
US9163284B2 (en) 2013-08-09 2015-10-20 President And Fellows Of Harvard College Methods for identifying a target site of a Cas9 nuclease
US10954548B2 (en) 2013-08-09 2021-03-23 President And Fellows Of Harvard College Nuclease profiling system
US9322037B2 (en) 2013-09-06 2016-04-26 President And Fellows Of Harvard College Cas9-FokI fusion proteins and uses thereof
US10682410B2 (en) 2013-09-06 2020-06-16 President And Fellows Of Harvard College Delivery system for functional nucleases
US10597679B2 (en) 2013-09-06 2020-03-24 President And Fellows Of Harvard College Switchable Cas9 nucleases and uses thereof
US12559737B2 (en) 2013-09-06 2026-02-24 President And Fellows Of Harvard College Cas9 variants and uses thereof
US9526784B2 (en) 2013-09-06 2016-12-27 President And Fellows Of Harvard College Delivery system for functional nucleases
US9340799B2 (en) 2013-09-06 2016-05-17 President And Fellows Of Harvard College MRNA-sensing switchable gRNAs
US12584118B2 (en) 2013-09-06 2026-03-24 President And Fellows Of Harvard College Cas9 variants and uses thereof
US9340800B2 (en) 2013-09-06 2016-05-17 President And Fellows Of Harvard College Extended DNA-sensing GRNAS
US9737604B2 (en) 2013-09-06 2017-08-22 President And Fellows Of Harvard College Use of cationic lipids to deliver CAS9
US9388430B2 (en) 2013-09-06 2016-07-12 President And Fellows Of Harvard College Cas9-recombinase fusion proteins and uses thereof
US10912833B2 (en) 2013-09-06 2021-02-09 President And Fellows Of Harvard College Delivery of negatively charged proteins using cationic lipids
US11299755B2 (en) 2013-09-06 2022-04-12 President And Fellows Of Harvard College Switchable CAS9 nucleases and uses thereof
US9228207B2 (en) 2013-09-06 2016-01-05 President And Fellows Of Harvard College Switchable gRNAs comprising aptamers
US12473573B2 (en) 2013-09-06 2025-11-18 President And Fellows Of Harvard College Switchable Cas9 nucleases and uses thereof
US10858639B2 (en) 2013-09-06 2020-12-08 President And Fellows Of Harvard College CAS9 variants and uses thereof
US9999671B2 (en) 2013-09-06 2018-06-19 President And Fellows Of Harvard College Delivery of negatively charged proteins using cationic lipids
US9834791B2 (en) 2013-11-07 2017-12-05 Editas Medicine, Inc. CRISPR-related methods and compositions with governing gRNAS
US11390887B2 (en) 2013-11-07 2022-07-19 Editas Medicine, Inc. CRISPR-related methods and compositions with governing gRNAS
US10190137B2 (en) 2013-11-07 2019-01-29 Editas Medicine, Inc. CRISPR-related methods and compositions with governing gRNAS
US10640788B2 (en) 2013-11-07 2020-05-05 Editas Medicine, Inc. CRISPR-related methods and compositions with governing gRNAs
US11124782B2 (en) 2013-12-12 2021-09-21 President And Fellows Of Harvard College Cas variants for gene editing
US9068179B1 (en) 2013-12-12 2015-06-30 President And Fellows Of Harvard College Methods for correcting presenilin point mutations
US9840699B2 (en) 2013-12-12 2017-12-12 President And Fellows Of Harvard College Methods for nucleic acid editing
US10465176B2 (en) 2013-12-12 2019-11-05 President And Fellows Of Harvard College Cas variants for gene editing
US12215365B2 (en) 2013-12-12 2025-02-04 President And Fellows Of Harvard College Cas variants for gene editing
US11053481B2 (en) 2013-12-12 2021-07-06 President And Fellows Of Harvard College Fusions of Cas9 domains and nucleic acid-editing domains
US10077453B2 (en) 2014-07-30 2018-09-18 President And Fellows Of Harvard College CAS9 proteins including ligand-dependent inteins
US12398406B2 (en) 2014-07-30 2025-08-26 President And Fellows Of Harvard College CAS9 proteins including ligand-dependent inteins
US10704062B2 (en) 2014-07-30 2020-07-07 President And Fellows Of Harvard College CAS9 proteins including ligand-dependent inteins
US11578343B2 (en) 2014-07-30 2023-02-14 President And Fellows Of Harvard College CAS9 proteins including ligand-dependent inteins
US10920285B2 (en) 2014-12-03 2021-02-16 Qiagen Gmbh Highly specific and sensitive methods for detecting enterohemorrhagic Escherichia coli serotypes O157:H7 and/or O145:H28
WO2016087621A1 (en) * 2014-12-03 2016-06-09 Qiagen Gmbh Highly specific and sensitive methods for detecting enterohemorrhagic escherichia coli serotypes o157:h7 and/or o145:h28
WO2016115441A1 (en) * 2015-01-16 2016-07-21 Kansas State University Research Foundation Co-detection and association of multiple genes from the same genome in a sample
US10233505B2 (en) 2015-01-16 2019-03-19 Kansas State University Research Foundation Co-detection and association of multiple genes from the same genome in a sample
US11214780B2 (en) 2015-10-23 2022-01-04 President And Fellows Of Harvard College Nucleobase editors and uses thereof
US12043852B2 (en) 2015-10-23 2024-07-23 President And Fellows Of Harvard College Evolved Cas9 proteins for gene editing
US12344869B2 (en) 2015-10-23 2025-07-01 President And Fellows Of Harvard College Nucleobase editors and uses thereof
US10167457B2 (en) 2015-10-23 2019-01-01 President And Fellows Of Harvard College Nucleobase editors and uses thereof
US10947530B2 (en) 2016-08-03 2021-03-16 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US11702651B2 (en) 2016-08-03 2023-07-18 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US10113163B2 (en) 2016-08-03 2018-10-30 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US11999947B2 (en) 2016-08-03 2024-06-04 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US11661590B2 (en) 2016-08-09 2023-05-30 President And Fellows Of Harvard College Programmable CAS9-recombinase fusion proteins and uses thereof
US11542509B2 (en) 2016-08-24 2023-01-03 President And Fellows Of Harvard College Incorporation of unnatural amino acids into proteins using base editing
US12084663B2 (en) 2016-08-24 2024-09-10 President And Fellows Of Harvard College Incorporation of unnatural amino acids into proteins using base editing
US11306324B2 (en) 2016-10-14 2022-04-19 President And Fellows Of Harvard College AAV delivery of nucleobase editors
US11820969B2 (en) 2016-12-23 2023-11-21 President And Fellows Of Harvard College Editing of CCR2 receptor gene to protect against HIV infection
US10745677B2 (en) 2016-12-23 2020-08-18 President And Fellows Of Harvard College Editing of CCR5 receptor gene to protect against HIV infection
US11898179B2 (en) 2017-03-09 2024-02-13 President And Fellows Of Harvard College Suppression of pain by gene editing
US12516308B2 (en) 2017-03-09 2026-01-06 President And Fellows Of Harvard College Suppression of pain by gene editing
US12390514B2 (en) 2017-03-09 2025-08-19 President And Fellows Of Harvard College Cancer vaccine
US12435331B2 (en) 2017-03-10 2025-10-07 President And Fellows Of Harvard College Cytosine to guanine base editor
US11542496B2 (en) 2017-03-10 2023-01-03 President And Fellows Of Harvard College Cytosine to guanine base editor
US11268082B2 (en) 2017-03-23 2022-03-08 President And Fellows Of Harvard College Nucleobase editors comprising nucleic acid programmable DNA binding proteins
US11560566B2 (en) 2017-05-12 2023-01-24 President And Fellows Of Harvard College Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation
US12359218B2 (en) 2017-07-28 2025-07-15 President And Fellows Of Harvard College Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE)
US11732274B2 (en) 2017-07-28 2023-08-22 President And Fellows Of Harvard College Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE)
US11319532B2 (en) 2017-08-30 2022-05-03 President And Fellows Of Harvard College High efficiency base editors comprising Gam
US11932884B2 (en) 2017-08-30 2024-03-19 President And Fellows Of Harvard College High efficiency base editors comprising Gam
US11795443B2 (en) 2017-10-16 2023-10-24 The Broad Institute, Inc. Uses of adenosine base editors
US12406749B2 (en) 2017-12-15 2025-09-02 The Broad Institute, Inc. Systems and methods for predicting repair outcomes in genetic engineering
US12157760B2 (en) 2018-05-23 2024-12-03 The Broad Institute, Inc. Base editors and uses thereof
US12522807B2 (en) 2018-07-09 2026-01-13 The Broad Institute, Inc. RNA programmable epigenetic RNA modifiers and uses thereof
WO2020051301A1 (en) * 2018-09-06 2020-03-12 Hygiena, Llc Sequences and their use for detection and characterization of escherichia coli serotype o157:h7
US12281338B2 (en) 2018-10-29 2025-04-22 The Broad Institute, Inc. Nucleobase editors comprising GeoCas9 and uses thereof
US12351837B2 (en) 2019-01-23 2025-07-08 The Broad Institute, Inc. Supernegatively charged proteins and uses thereof
US12281303B2 (en) 2019-03-19 2025-04-22 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US11643652B2 (en) 2019-03-19 2023-05-09 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US12570972B2 (en) 2019-03-19 2026-03-10 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US11447770B1 (en) 2019-03-19 2022-09-20 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US12509680B2 (en) 2019-03-19 2025-12-30 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US11795452B2 (en) 2019-03-19 2023-10-24 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US12473543B2 (en) 2019-04-17 2025-11-18 The Broad Institute, Inc. Adenine base editors with reduced off-target effects
US12435330B2 (en) 2019-10-10 2025-10-07 The Broad Institute, Inc. Methods and compositions for prime editing RNA
US11912985B2 (en) 2020-05-08 2024-02-27 The Broad Institute, Inc. Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence
US12031126B2 (en) 2020-05-08 2024-07-09 The Broad Institute, Inc. Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence

Also Published As

Publication number Publication date
CA2875919A1 (en) 2013-12-19
KR102065053B1 (ko) 2020-01-10
JP6166365B2 (ja) 2017-07-19
CA2875919C (en) 2021-08-31
WO2013186754A3 (en) 2014-02-20
MX357697B (es) 2018-07-19
CN104619860B (zh) 2018-01-30
BR112014031370A2 (pt) 2017-07-25
US10190175B2 (en) 2019-01-29
CL2014003377A1 (es) 2015-08-07
EP2674501A1 (en) 2013-12-18
MX2014015130A (es) 2015-08-06
ES2659469T3 (es) 2018-03-15
AU2013276084A8 (en) 2015-02-12
EP2861762A2 (en) 2015-04-22
CN104619860A (zh) 2015-05-13
AU2013276084B2 (en) 2019-04-04
KR20150030783A (ko) 2015-03-20
US20150176064A1 (en) 2015-06-25
JP2015519075A (ja) 2015-07-09
EP2861762B1 (en) 2017-12-13
AU2013276084A1 (en) 2015-01-29
BR112014031370B1 (pt) 2022-06-07

Similar Documents

Publication Publication Date Title
CA2875919C (en) Method for detecting and identifying enterohemorrhagic escherichia coli.
Perelle et al. Detection by 5′-nuclease PCR of Shiga-toxin producing Escherichia coli O26, O55, O91, O103, O111, O113, O145 and O157: H7, associated with the world's most frequent clinical cases
Liu et al. High-resolution melt curve PCR assay for specific detection of E. coli O157: H7 in beef
You et al. A novel DNA microarray for rapid diagnosis of enteropathogenic bacteria in stool specimens of patients with diarrhea
US10724106B2 (en) Method for determining the presence of diarrhoea causing pathogens
KR101837781B1 (ko) Ehec를 함유한 것이 의심되는 복합 다균성 시료의 분자 위해성 평가 분석
US8883488B2 (en) Detection of food threat agents and food-borne pathogens
Youmans et al. Development and accuracy of quantitative real-time polymerase chain reaction assays for detection and quantification of enterotoxigenic Escherichia coli (ETEC) heat labile and heat stable toxin genes in travelers' diarrhea samples
Taminiau et al. Validation of real-time PCR for detection of six major pathogens in seafood products
Nessa et al. Usefulness of a multiplex PCR for detection of diarrheagenic Escherichia coli in a diagnostic microbiology laboratory setting
Yang et al. Development of rapid real-time PCR and most-probable-number real-time PCR assays to quantify enterotoxigenic strains of the species in the Bacillus cereus group
Ferdous Shiga toxin-producing Escherichia coli (STEC) from Humans in the Netherlands: Novel diagnostic approach, molecular characterization and phylogenetic background
Beneduce et al. Occurrence and characterization of Escherichia coli O157 and other serotypes in raw meat products in Morocco
Oyong et al. High resolution melting (HRM)-coupled multiplex real-time PCR for rapid identification and virulence gene profiling of enterohemorrhagic Escherichia coli (EHEC) O157: H7 from slaughterhouse pigs
Ziebella et al. Evaluation of PCR and PCR-RFLP protocols for identifying Shiga toxins

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 13747516

Country of ref document: EP

Kind code of ref document: A2

ENP Entry into the national phase

Ref document number: 2875919

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: MX/A/2014/015130

Country of ref document: MX

ENP Entry into the national phase

Ref document number: 2015516741

Country of ref document: JP

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 2014003377

Country of ref document: CL

Ref document number: 14407884

Country of ref document: US

WWE Wipo information: entry into national phase

Ref document number: 15003768

Country of ref document: CO

ENP Entry into the national phase

Ref document number: 20157000638

Country of ref document: KR

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 2013747516

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 2013276084

Country of ref document: AU

Date of ref document: 20130614

Kind code of ref document: A

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112014031370

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 112014031370

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20141215