WO2013176504A1 - 신규한 단백질 및 이의 용도 - Google Patents

신규한 단백질 및 이의 용도 Download PDF

Info

Publication number
WO2013176504A1
WO2013176504A1 PCT/KR2013/004539 KR2013004539W WO2013176504A1 WO 2013176504 A1 WO2013176504 A1 WO 2013176504A1 KR 2013004539 W KR2013004539 W KR 2013004539W WO 2013176504 A1 WO2013176504 A1 WO 2013176504A1
Authority
WO
WIPO (PCT)
Prior art keywords
protein
silica
antibody
binding
present
Prior art date
Application number
PCT/KR2013/004539
Other languages
English (en)
French (fr)
Inventor
고성호
정광회
김아람
Original Assignee
차의과학대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 차의과학대학교 산학협력단 filed Critical 차의과학대학교 산학협력단
Publication of WO2013176504A1 publication Critical patent/WO2013176504A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K19/00—Hybrid peptides, i.e. peptides covalently bound to nucleic acids, or non-covalently bound protein-protein complexes
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/315—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Streptococcus (G), e.g. Enterococci
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/62—DNA sequences coding for fusion proteins
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/543—Immunoassay; Biospecific binding assay; Materials therefor with an insoluble carrier for immobilising immunochemicals
    • G01N33/551—Immunoassay; Biospecific binding assay; Materials therefor with an insoluble carrier for immobilising immunochemicals the carrier being inorganic
    • G01N33/552—Glass or silica
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/20—Fusion polypeptide containing a tag with affinity for a non-protein ligand
    • C07K2319/22—Fusion polypeptide containing a tag with affinity for a non-protein ligand containing a Strep-tag

Definitions

  • the present invention is a novel protein, a biosensor comprising the same, a manufacturing method of the biosensor, immunodetection method using the biosensor, a specific antigen separation and purification column bound to the antibody on the silica-containing solids with the protein, separation using the column It relates to purification methods, in vivo drug carriers and imaging means.
  • the present invention provides a technique for attaching an antibody to silica having excellent biocompatibility by using a protein consisting of an N-terminus having a high binding force to silica and a C-terminus having a binding force to the Fc region of the antibody.
  • the attached antibody may have an appropriate orientation, and thus has a high antigen detection sensitivity as a biosensor.
  • proteins can bind antibodies to various antigens on silica-containing solids, which can be used for biosensors, immunodetection, isolation or purification, target specific drug delivery, and target specific imaging of various antigens in which the antibodies are present. There is a very wide field of effect that can be used.
  • Immunoassays based on the specific response of antibody-antigens are one of the important techniques used extensively because of their sensitivity and high selectivity. Over the past decade, research has shown that when immunoassays are stably immobilized on solid substrates, they can maintain their structure and function and thus effectively capture other target antigens in solution. Protein immobilization technology, including antibodies, has become an integral part of the bionanotechnology field.
  • Silica (SiO 2 ) has excellent biocompatibility and has been widely used for research on antigen-antibody specific reaction based biosensors and biomaterial delivery systems after immobilizing antibodies on silica nanoparticles, silica substrates, and magnetic nanoparticles coated with silica. .
  • conventional chemical methods for immobilizing biomolecules on inorganic surfaces such as silica (SiO 2 ) are used to formulate amines, ligand thiols, aldehydes, or self-assembled ligands with functional groups. It has been used to form as a self-assembly monolayer.
  • the antibody may be adsorbed on the silica surface arbitrarily, so that the activation site that binds the antigen may not maintain the proper orientation in the direction of the solution in which the antigen is present, and may also cause the denaturation of the antibody.
  • the method requires a complex chemical surface treatment process when immobilizing the antibody on the surface of the solid substrate, does not properly maintain the orientation and function of the antibody, and the self-assembled monolayer formed on the surface of the solid substrate is stable while the protein is immobilized.
  • drawbacks such as falling (K. Fujiwara, H. Watarai, H.
  • Peptides that can be directly bound to minerals can be isolated from organisms with hard tissues, such as diatoms, or cell surface proteins capable of specific binding to minerals can be selectively obtained using recombinant molecular techniques.
  • GaAs gallium arsenide
  • platinum Pt
  • gold Au
  • Cu 2 O copper oxide
  • ZnO zinc oxide
  • silica silver (Ag)
  • titanium dioxide TiO 2
  • fluorite Peptides that can specifically bind to the back have been discovered, and research activities using these genetically engineered peptides have become active, and much effort is being made to use them as linkers for binding, assembling and connecting biological materials to inorganic surfaces.
  • silica nanoparticles are known to be excellent hosts for capturing materials of various sizes, shapes and functions. Porous silica nanoparticles have porous channels, and thus can be applied to fields such as drug delivery because of the high stability of trapping foreign substances in the channels and the specific responsiveness to external stimuli.
  • Porous silica nanoparticles are porous structures that are stable to the surrounding environment, have a large surface area, can control pore sizes, and surface properties are known. Since porous silica nanoparticles are easy to functionalize surfaces, research on porous silica nanoparticles having functionalized surfaces for application to stimulus-controlled release has recently been made. In addition, research on imaging technology using silica nanoparticles including a fluorescent material or a magnetic resonance contrast agent inside the silica nanoparticles has been actively conducted. Due to the high biocompatibility of silica and the development of processing technology, it is being developed for various purposes.
  • a protein composed of the N-terminus having a strong binding force to silica and the C-terminus having a strong binding force to the antibody Fc region was present in the silica-containing solid phase.
  • the ability to bind is found to be excellent.
  • the protein was used to confirm that the sensitivity to the antigen was markedly improved by fixing the antibody on the silica-containing solid phase while maintaining the orientation of the antibody, thereby completing the present invention.
  • An object of the present invention is a protein consisting of the amino acid sequence of SEQ ID NO: 5, the protein is N-terminal can bind to silica, C-terminal is characterized in that the protein can bind to the Fc region of the antibody To provide.
  • Another object of the present invention is to provide a polynucleotide encoding the protein.
  • Still another object of the present invention is to provide an expression vector comprising the polynucleotide encoding the protein.
  • Still another object of the present invention is to provide a transformant transformed with the expression vector.
  • Another object of the present invention is to provide a method for producing the protein.
  • Still another object of the present invention is to provide a biosensor comprising a silica-containing solid phase to which the protein is bound.
  • Still another object of the present invention is to provide a method for manufacturing a biosensor comprising a silica-containing solid phase to which the protein is bound.
  • Still another object of the present invention is to provide an immunodetection method using the biosensor.
  • Still another object of the present invention is to provide a method for separating or purifying a specific antigenic substance using the specific antigen separation or purification column.
  • Another object of the present invention is to bind to the protein; Binding antibodies having target specific binding properties; It is to provide a silica nanoparticle containing a drug inside and outside.
  • Another object of the present invention is to bind to the protein; Binding antibodies having target specific binding properties; It is to provide a silica nanoparticles containing a fluorescent material inside and outside.
  • Another object of the present invention is to bind to the protein; Binding antibodies having target specific binding properties; It is to provide silica nanoparticles containing a contrast agent inside and outside.
  • the fusion protein according to the present invention can be immobilized on a silica-containing solid phase in a state of proper orientation by a simple process to increase the binding of the antigen, thereby increasing the detection sensitivity of the biosensor antigen. have.
  • it can be provided as a component that can give an orientation in the application device, such as columns, biosensors, drug carriers through a variety of antigen-antibody reactions.
  • Figure 1 is a schematic diagram of a silica fusion coupled protein fusion of SBP and protein G.
  • Figure 2 is a schematic diagram showing the position of the nucleotide sequence inserted SBP into 6His-protein G protein and the primers used therein.
  • Figure 3 is a result of electrophoresis on agarose gel to confirm that the nucleotide sequence of SBP-ProG was correctly amplified, a band of about 639bp was confirmed.
  • FIG. 4 is a schematic diagram of a method for producing SBP-ProG protein by transforming E. coli into an expression vector and a corresponding expression vector produced by elution of SBP-ProG identified in FIG. .
  • Figure 5 is a picture of electrophoresis after digestion using Ndel / Xhol restriction enzyme to confirm the insertion of SBP-protein G in the vector. The band was confirmed at about 639 bp.
  • FITC-labeled protein G or SBP-ProG (FITC-ProG or FITC-SBP-ProG) to silica nanobeads to confirm the specific binding degree of SBP in the absence of any chemical treatment on the silica surface. It is a figure which shows the result of a measurement column of fluorescence intensity.
  • Figure 7 is a diagram showing the fluorescence intensity by specific binding of FITC-IgG and silica beads / SBP-ProG to confirm whether the antibody Fc site specific binding of the protein G region of the novel protein.
  • FIG. 8 is a diagram showing the degree of bonding by combining FITC-ProG and FITC-SBP-ProG on a silica slide solid substrate.
  • FIG. 9 is a diagram showing the binding degree by binding 500 ⁇ g / mL FITC-IgG (5 ⁇ L) to each of the SBP-ProG protein and ProG layer bound to the silica slide surface.
  • the present invention is a protein consisting of the amino acid sequence of SEQ ID NO: 5, the protein is capable of binding to the N-terminal silica, C-terminal to the Fc region of the antibody Provided are proteins that can be bound.
  • the novel protein of the invention serves as a linker connecting the antibody to the silica-containing solid phase of the biosensor.
  • the protein refers to a fusion protein in which part or all of two or more heterologous proteins of different origin are linked or combined.
  • Such a fusion protein may be produced in recombinant form in one vector, or may be produced by expressing a protein and a silica binding protein which bind to the Fc region of an antibody in different vectors, and then binding by enzyme or chemical method. . For the purposes of the present invention it may be expressed in one vector.
  • the protein consists of an N-terminus having a property of binding to silica and a C-terminus having a function of Protein G capable of binding to the Fc region of the antibody, and reflects a functional aspect of the protein as SBP-protein G. Can be represented.
  • the protein of the present invention is a fusion protein connecting a silica binding protein and a protein binding to the Fc region of the antibody in order to improve specific binding efficiency with the antibody, preferably as shown in Figure 2, the Fc region of the antibody It is possible to connect the 3-terminal end of the silica binding protein (SBP) to the 5-terminal end of the protein that binds to (protein G of FIG. This linkage allows for the proper orientation of the activation site that binds the antigen of the antibody to the direction of the solution with the antigen.
  • SBP silica binding protein
  • the protein that binds to the Fc region of the antibody of the present invention is a protein having activity that binds to the Fc region of the antibody, proteins and peptides having such activity can be used without limitation.
  • protein G or protein A more preferably protein G of SEQ ID NO: 3.
  • Protein G SEQ ID NO: 3
  • Protein G is a bacterial cell wall protein isolated from group G streptococci and is known to bind to the Fc and Fab regions of mammalian antibodies (J. Immuunol. Methods 1988, 112, 113-120). .
  • protein G is known to have a binding force of about 10 times higher than that of the Fab site.
  • protein A which has a property of binding to the antibody Fc region similarly to protein G, binds strongly to these antibodies in large amounts, whereas protein A binds weakly to antibodies made in rats, sheep, goats, and horses. .
  • the protein G is not particularly limited in origin, and protein G derivatives in which amino acids are deleted, added, or substituted in the native protein G as long as it retains the binding strength to the Fc region of the antibody are also used in the present invention. Can be used to meet the purpose.
  • the silica binding protein (SBP) of the present invention is a protein having activity that binds to a silica-containing solid phase, and preferably may be a silica binding protein having an amino acid sequence of SEQ ID NO: 1.
  • the present invention provides a polynucleotide encoding the protein, an expression vector comprising the same, a transformant transformed with the expression vector, and a method for producing a fusion protein by culturing the transformant.
  • the polynucleotide of the present invention is a polynucleotide such as DNA, RNA or the like encoding a novel protein linked to a silica binding site and a protein binding to the Fc region of the antibody, and preferably may be a polynucleotide having a nucleotide sequence of SEQ ID NO: 6 .
  • SBP-protein G SEQ ID NO: 6
  • the expression vector is a means for expressing the protein by introducing DNA into the host cell to make a transformant expressing the novel protein of the present invention
  • a plasmid vector a cosmid vector, a bacteriophage vector and the like
  • a plasmid vector can be used.
  • Expression vectors for the purposes of the present invention may include expression control elements such as promoters, initiation codons, termination codons, polyadenylation signals and enhancers.
  • an expression vector pET-SBP-protein G comprising a base sequence encoding a protein that is linked to the silica binding site and protein G (Example 3).
  • a tag for protein purification may be included at the N-terminus to facilitate the isolation of novel proteins of the invention.
  • hexa histidine (6His) is bound to the N-terminus, but for the purposes of the present invention, a tag for protein purification may use any known tag without limitation.
  • the transformant may use any host cell such as E. coli or Bacillus subtilis capable of expressing the fusion protein of the present invention, and preferably E. coli.
  • the protein of the present invention can also be produced by peptide synthesis, but can be produced particularly efficiently by genetic engineering methods.
  • Genetic engineering is a method of expressing a desired protein in a large amount in a host cell such as E. coli by genetic engineering.
  • Gene sequences of the invention can be readily modified by one or more bases by substitutions, deletions, insertions or combinations thereof. Accordingly, DNAs or proteins having high homology with SEQ ID NO: 5, for example, DNAs and proteins having high homology of 70% or more, preferably 80% or more, are also included within the scope of the present invention. Should be.
  • the novel protein of the present invention comprises the steps of: a) preparing an expression vector comprising a polynucleotide encoding a protein of the present invention; b) transforming the transformant into a transformant by introducing the expression vector into a host cell; And c) it can be prepared through the method of producing a protein of claim 1 or claim 2 comprising the step of culturing the transformant.
  • the method of transforming by introducing the expression vector into the host cell is preferably a method known in the art, such as, but not limited to, transient transfection of the expression vector comprising the DNA of the present invention, Microinjection, transduction, cell fusion, calcium phosphate precipitation, liposome-mediated transfection, DEAE Dextran-mediated transfection, polybrene-mediated Transfection may be performed by introducing into a host cell by a known method such as polybrene-mediated transfection or electroporation.
  • the method for culturing the transformant to produce the fusion protein of the present invention by culturing the transformant may use any method known in the art, for example, 37 ° C., which is a general condition for growing Escherichia coli, Conditions can be performed in LB medium.
  • E. coli BL21 (DE3) was prepared as competent cells and transformed with the expression vector pET-SBP-protein G to express SBP-protein G (Examples 1-3).
  • the present invention provides a biosensor and a method for manufacturing the biosensor comprising a silica-containing solid phase to which a protein is bound.
  • the novel protein according to the present invention is a form in which a silica binding site and a protein G are linked, wherein the silica binding site according to the present invention is composed of 12 amino acids and can selectively bind to silica.
  • Protein G of the protein specifically binds to the Fc region of the antibody, unlike other proteins.
  • the silica-binding protein portion of the fusion protein according to the invention selectively binds to the silica-containing solid phase, and the protein G portion specifically binds to the Fc region of the antibody, which, when used, selectively binds to the silica-containing solid phase. While binding, it is possible to provide a biosensor capable of specifically binding to the Fc region of an antibody.
  • the biosensor to bind the fusion protein onto a silica-containing solid phase and to maintain the proper orientation of the Fab portion, which is the activating portion to which the antigen binds by binding to the Fc region of the antibody, in the direction of the solution. It can be usefully used in the field of immunoassay applying the silica reaction. This orientation allows the activation site that binds to the antigen of the antibody to react efficiently with the antigen.
  • Biosensor is a machine for investigating the properties of substances using the functions of the living organism, biosensors used in enzyme analysis and immunoassay, optical biosensors and electrochemical biosensors, etc.
  • the biosensor can be a lab-on-a-chip that automatically processes the entire process of the experiment, such as sample injection, hybridization and detection, into one small chip.
  • the biosensor of the present invention may preferably be a biosensor using surface plasmon resonance (surface plasmon resonance).
  • Biosensors using surface plasmon resonance not only provide qualitative information (whether two molecules specifically bind) and quantitative information (reaction rate, kinetics and equilibrium constants, equilibrium constants), but also need to be labeled in real time without the need for fluorescence labeling. It is particularly useful for measuring antigen and antibody binding.
  • the silica-containing solid phase of the present invention may preferably be selected from the group consisting of silica beads, silica particles, silica coating particles and silica coated substrates.
  • biosensors of the present invention can use fusion proteins to immobilize antibodies strongly onto silica-containing solids without affecting other biological activities.
  • the biosensor of the present invention comprises the steps of: a) preparing a transformant by inserting an expression vector comprising the polynucleotide encoding the present invention into a host cell; b) culturing the transformant to express the protein; c) recovering the transformant expressing the protein and then crushing to obtain the protein; And d) specifically fixing the obtained protein to a silica-containing solid phase.
  • the present invention provides an immunodetection method using a biosensor.
  • an antigen that specifically binds to the antibody can be detected.
  • Immunodetection characterized by identifying the specific binding of the antigen-antibody can be carried out by visually, optically, or electrochemically, in particular, surface plasmon resonance as an example of the optical method. (SPR) technology.
  • the immunoassay of the present invention may preferably use a surface plasmon resonance method.
  • Surface Plasmon Resonance (SPR) uses surface plasmon resonance due to attenuated total reflectance, which is not disturbed by solvent flow or electrical noise when compared to detection systems using current or mechanical changes. It has a merit that a stable signal can be obtained.
  • the immunodetection method of the present invention comprises the steps of: a) specifically binding the antibody to the fusion protein of the biosensor; And b) treating the antigen specific for the antibody to detect specific binding of the antigen-antibody.
  • the antigen to be reacted with the antibody bound to the fusion protein is treated without the loss of the expensive antibody.
  • the specific binding of the antigen-antibody can be detected by measuring the change in surface plasmon resonance signal.
  • the present invention provides a specific antigen separation and purification column in which an antibody to a specific antigen is bound to a silica-containing solid to which a fusion protein is bound.
  • the term "separation tablet” refers to an operation of separating a substance from mixed impurities and removing other impurities to increase purity, and according to the attached antibody for the purposes of the present invention, the antibody is specifically bound. It can be achieved through the method of detecting the antigen from the impurities mixed in the liquid.
  • the impurity is a substance mixed in addition to the target substance in the purification process, but is not limited thereto, preferably host cell protein (HCP), host cell protein (HCP), host cell-derived DNA (HCD) and cell growth It may include a factor for, and more preferably, the impurities to be mainly removed in the present invention may be a host cell protein. Removal of such impurities includes the purpose of quality control.
  • the term column is a means for separating or purifying a mixture using various physicochemical properties of the material.
  • the device is a mechanism for separating a substance from a mixture by filling a column with specific beads according to the degree of hydrophilicity or hydrophobicity of a substance, the potential of a molecule, or the binding force of a specific substance.
  • the present invention provides a method for separating or purifying a specific antigenic substance using a specific antigen separation and purification column in which the antibody is bound to a specific antigen on a silica-containing solid to which the protein is bound.
  • the present invention uses protein G, which binds to the Fc region of the antibody, various antibodies can be attached to the column beads. Therefore, it has the advantage of being able to isolate or purify various antigen in which an antibody exists.
  • protein A which has a property of binding to the antibody Fc region similarly to protein G, weakly binds to antibodies made in rats, sheep, goats, and horses, whereas protein G binds strongly to these antibodies in large amounts. . Therefore, the function of binding to the Fc region is similar, but there is a big difference in the range of antibodies that can be used.
  • the present invention binds to the protein; Binding antibodies having target specific binding properties; It provides silica nanoparticles containing the drug inside and outside.
  • target specific refers to a property characteristic of the target or tissue in various targets or tissues existing in vivo in humans or animals. These properties include physiological features such as the presence or extent of expression, modification, and location of specific genes, as well as physical features such as the size and shape of proteins or cells.
  • the target or tissue is not only in the brain tissue or pancreatic tissue constituting the human body normally, but also includes a target or tissue in an abnormal tissue such as cancer cell tissue.
  • target specific binding in the present invention refers to the ability of a substance to bind to a target according to the characteristics of each target in vivo. In the present invention, it mainly refers to the binding ability of an antibody that recognizes a target specific surface antigen of a cell. In particular, antibodies that bind to specific surface antigens of cancer cells, such as CD20 or Her2, include the ability to specifically bind to cancer cells.
  • the term “drug” refers to a substance for alleviating the symptoms of a specific disease or removing or preventing the etiology.
  • the term “drug” refers to a drug for a disease related to a tissue recognized by a bound antibody.
  • the drug when using an antibody that specifically binds to cancer cells, the drug includes an anticancer agent.
  • sica nanoparticles refers to particles having a size of at least 1 to 100 nm made of silica material having excellent biocompatibility.
  • Silica nanoparticles in the present invention includes a property that includes a variety of materials inside the silica in a porous manner and concentrated in a tissue in which a specific target is present through a target specific antibody.
  • the present invention binds to the protein; Binding antibodies having target specific binding properties; Provided are silica nanoparticles containing a fluorescent material inside and outside.
  • fluorescent material is a material that emits light having a specific wavelength when a specific wavelength is cut, specifically, fluorescein-based TRITC (Tetramethylrhodamine-5- (and 6) -isothiocyanate) and FITC (Fluorescein). -5-isothiocyanate), DAPI (4,6-diamidino-2-phenylindole), pyrene, propidium iodide or RITC (Rhodamine isothiocyanate).
  • the silica nanoparticles are contained inside and outside, and are concentrated in a specific tissue to include a property of emitting light of a specific wavelength.
  • the present invention binds to the protein; Binding antibodies having target specific binding properties; Provided are silica nanoparticles containing a contrast agent in and out.
  • the term "contrast agent” is a material that exhibits optical characteristics positively or negatively when a specific wavelength is cut. Specifically, the term “contrast agent” is used for magnetic resonance imaging, computed tomography, angiography, and the like. It is a drug that increases the contrast of the image by artificially increasing the line absorption difference. Contrast agent in the present invention includes iodine-containing contrast agent, barium sulfate, air, gas, carbon dioxide gas and the like.
  • Example 1-1 Expression vector construction of novel proteins that can bind to silica and antibody Fc sites
  • the PCR mixture was filled with 1 ⁇ L of template, 0.4 ⁇ L of 10mM dNTPs, 1 ⁇ L of 10 pmol of primer, 2 ⁇ L of 10X buffer, 0.2 ⁇ L of taq polymerase (Takara LA taq), and the rest with D.W.
  • PCR was performed under the PCR conditions of Table 1, and electrophoresed on agarose gel to confirm that the base sequence of SBP-ProG was correctly amplified. As a result, a band of about 639bp could be confirmed (FIG. 3).
  • SBP-ProG identified in Figure 3 above was elution on agarose gel to ligation to the pET 22b vector (Fig. 4).
  • Ndel / Xhol restriction enzyme NDE
  • Enzyme cutting mixure was filled with 10 ⁇ L of DNA, 0.5 ⁇ L of enzyme, 2 ⁇ L of 10Xbuffer, and 20 ⁇ L of total volume of DW, and incubated at 37 °C for 1 hour, and then electrophoresed on agarose gel to confirm the band at about 639bp. 5).
  • Example 1-2 Expression transformant of a new protein, SBP-ProG
  • the expression vector of SBP-ProG was cloned using DH5 cells. 50 ⁇ L of DH5 competent cell (cp) and 1 ⁇ L of pET-6His-SBP-ProG were added to a 1.5 mL epitube and incubated on ice for 45 minutes. Give a 42 °C heat shock for 20 seconds to transform and immediately put on ice. After 1 minute, 800ul of LB was mixed and incubated for 1 hour at 37 °C, and 50 ⁇ L was grown overnight at 37 °C on LB plate containing amp, IPTG and Xgal. White colonies were grown overnight in LB medium in solution, and DNA was extracted using the preparation kit.
  • cp DH5 competent cell
  • pET-6His-SBP-ProG 50 ⁇ L was added to a 1.5 mL epitube and incubated on ice for 45 minutes. Give a 42 °C heat shock for 20 seconds to transform and immediately put on ice. After 1 minute, 800ul of LB was mixed and incubated
  • the DNA was injected into BL21 (DE3) cp cells to prepare a transformant.
  • the expression vector in TE buffer
  • the expression vector having a concentration of 1 ⁇ g / mL in 100 ⁇ L cp cell, resuspention and incubated for 30 minutes on ice, and gave a heat shock at 42 °C shaker for 30 seconds. Immediately afterwards it was left on ice for 2-3 minutes.
  • Add 900 ⁇ L of liquid LB medium shake incubation at 200rpm 37 °C for 1 hour, and spread on LB plate containing ampicillin (100mg / L). Incubated overnight at 37 ° C. incubator. The colonies formed were incubated overnight at 37 ° C.
  • LA LB medium containing ampicillin
  • DNA was extracted to confirm that the plasmid was successfully inserted into the cells.
  • the rest was made into cell stock in 70% glycerol for protein purification and stored in a deep freezer.
  • Cell stock 200L was added to LA medium 5, shaken at 37 ° C. overnight at 250 rpm, and then aliquoted into four fresh 50mL LA mediums at 800 ⁇ L. This was incubated until 600 O.D 0.6 at the spectrophotometer 600nm and 1mM IPTG (isopropylthiogalactoside) was added to shake the culture (270rpm 37 °C 3hr) to express the fusion protein. Next, the cell and the medium were transferred to a 50mL falcon tube and centrifuged (4000g, 4 ° C, 30min) to remove the supernatant, and then rapidly cooled using liquid nitrogen and stored in a deep freezer.
  • IPTG isopropylthiogalactoside
  • centrifugation 10,000g, 4 ° C, 30min was carried out to obtain the supernatant.
  • 1 mL of 50% NiNTA HisBind slurry was mixed with 4 mL 1X NiNTA Bind Buffer, and 4 mL of supernatant was removed by separating the slurry and buffer by gravity.
  • the ultrasonically pulverized sample was subjected to shaking incubation at slurry and 4 ° C. for one hour.
  • the buffer was removed by loading slurry / protein on the column to purify protein samples bound by charge to the slurry.
  • IgG Imunoglobulin G
  • FITC-labeled ProG or SBP-ProG was reacted with silica nanobeads to increase the fluorescence intensity. Measured. 15 ⁇ L of 100 nm silica beads were vortexed into 120 ⁇ L D.W. (distilled water), followed by centrifugation at 17000 rpm, 4 ° C., and 30 min. Next, the supernatant was removed, and 100 ⁇ L of PBS was added, and sonication and vortexing were sufficiently applied to distribute evenly.
  • D.W. distilled water
  • ProG or SBP-ProG was reacted with silica nanobeads (100 nm) to produce silica beads / SBP-ProG and silica beads / ProG composites.
  • the fluorescence intensity due to the specific binding of FITC-IgG and silica beads / SBP-ProG was higher at all concentrations than the fluorescence intensity of the reaction of silica beads / ProG and FITC-IgG, and the concentration of FITC-IgG was higher. It turned out that the intensity of fluorescence increases as it goes up.
  • the binding function of the novel protein of the present invention was confirmed not only on silica nanobeads but also on silica slide solid substrates.
  • FITC-ProG and FITC-SBP-ProG at a concentration of 1 mg / mL were reacted on a silica slide for 20 minutes, washed with a buffer, and the fluorescence intensity was measured by a confocal fluorescence microscope.
  • the SBP-ProG protein adheres about 4 times better than ProG.
  • the results also show that the protein binds effectively by the N-terminus to silica slide solid substrates.
  • novel protein of the present invention can effectively bind to silica through the N-terminus and the C-terminus to the Fc terminus of the antibody. It supports the novel protein linked without linker can effectively bind to the Fc region of silica and antibody without interfering with each function.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Urology & Nephrology (AREA)
  • Hematology (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Cell Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Food Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • General Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • General Engineering & Computer Science (AREA)
  • Plant Pathology (AREA)
  • Inorganic Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Peptides Or Proteins (AREA)

Abstract

본 발명은 신규한 단백질, 이를 포함하는 바이오센서, 바이오센서의 제작방법, 바이오센서를 이용한 면역검출법, 상기 단백질이 결합된 실리카-함유 고체상에 항체를 결합한 특정 항원 분리정제용 컬럼, 컬럼을 이용한 분리정제 방법과 생체내 약물전달체에 관한 것이다. 본 발명은 실리카에 높은 결합력을 갖는 N-말단과 항체의 Fc 부위에 결합력을 갖는 C-말단으로 이루어진 단백질을 이용하여 생체적합성이 뛰어난 실리카에 항체를 부착시키는 기술을 제공한다. 해당 단백질을 링커로 사용할 경우 부착된 항체는 적절한 배향성을 가질 수 있어 바이오센서로서 높은 항원 검출 민감도를 가지게 되는 효과가 있다. 또한, 단백질을 통해서 실리카-함유 고체상에 다양한 항원에 대한 항체를 결합시킬 수 있어, 항체가 존재하는 각종 항원에 대한 바이오센서, 면역검출법, 분리 또는 정제, 표적특이적 약물전달 및 표적특이적 이미징에 이용될 수 있어 활용될 수 있는 분야가 매우 넓은 효과가 있다.

Description

신규한 단백질 및 이의 용도
본 발명은 신규한 단백질, 이를 포함하는 바이오센서, 바이오센서의 제작방법, 바이오센서를 이용한 면역검출법, 상기 단백질이 결합된 실리카-함유 고체상에 항체를 결합한 특정 항원 분리정제용 컬럼, 컬럼을 이용한 분리정제 방법, 생체내 약물전달체 및 이미징 수단에 관한 것이다. 본 발명은 실리카에 높은 결합력을 갖는 N-말단과 항체의 Fc 부위에 결합력을 갖는 C-말단으로 이루어진 단백질을 이용하여 생체적합성이 뛰어난 실리카에 항체를 부착시키는 기술을 제공한다. 해당 단백질을 링커로 사용할 경우 부착된 항체는 적절한 배향성을 가질 수 있어 바이오센서로서 높은 항원 검출 민감도를 가지게 되는 효과가 있다. 또한, 단백질을 통해서 실리카-함유 고체상에 다양한 항원에 대한 항체를 결합시킬 수 있어, 항체가 존재하는 각종 항원에 대한 바이오센서, 면역검출법, 분리 또는 정제, 표적특이적 약물전달 및 표적특이적 이미징에 이용될 수 있어 활용될 수 있는 분야가 매우 넓은 효과가 있다.
항체-항원의 특이적 반응을 기본으로 하는 면역분석법은 고민감도와 고선택성 때문에 광범위하게 사용되는 중요한 기술 중에 하나이다. 이러한 면역분석법에서 항체가 고체 기질 상에 안정적으로 고정화되었을 때, 그 구조 및 기능을 유지할 수 있게 되고 이에 따라 용액 내에 존재하는 여타의 목적 항원을 효과적으로 포획할 수 있다는 연구 결과들이 발표되면서 지난 10년 동안 항체를 비롯한 단백질 고정화 기술은 바이오나노 기술 분야에서 핵심적인 부분을 차지하게 되었다.
실리카(SiO2)는 생체적합성이 뛰어나 실리카 나노입자와 실리카 기판 및 실리카가 코팅된 자성 나노입자에 항체를 고정시킨 후 항원-항체 특이적 반응 기반 바이오센서 및 생체물질 전달시스템 연구에 광범위하게 사용되고 있다. 일반적으로 생체 분자들을 실리카(SiO2)와 같은 무기물 표면에 고정화시키기 위한 전통적인 화학적 방법으로 아민(amine), 리간드 티올(ligand thiol), 알데히드(aldehyde)를 수식화하거나 기능기가 부착된 리간드를 자기조립 단일층(self-assembly monolayer)으로서 형성하는 방식을 사용하여 왔다 . 하지만 위의 방법으로 항체가 실리카 표면에 임의로 흡착될 수 있어 항원과 결합하는 활성화 부위가 항원이 있는 용액의 방향으로 향하는 적절한 배향성(orientation)을 유지하지 못할 수 있고 항체의 변성 역시 야기시킬 수 있다. 이러한 결과는, 항체-실리카 반응을 응용하는 분야에서 민감성(sensitivity)과 재현성(reproducibility)을 떨어뜨려 이 방법의 유용성을 감소시키는 문제를 야기하였다. 즉, 상기 방법은 고체 기질 표면에 항체 고정화시 복잡한 단계의 화학적 표면처리 과정이 필요하고, 항체의 배향성 및 기능을 적절히 유지시키지 못하며, 고체 기질 표면에 형성된 자가조립 단일층이 단백질이 고정화되는 동안 안정성이 떨어지는 등의 문제가 발생하는 단점이 있었다 (K. Fujiwara, H. Watarai, H. Itoh, E. Nakahama, N. Ogawa, Anal. Bioanal. Chem. 2006, 386, 639.; T. J. Park, S. Y. Lee, S. J. Lee, J. P. Park, K. S. Yang, K. B. Lee, S. Ko, J. B. Park, T. Kim, S. K. Kim, Y. B. Shin, B. H. Chung, S. J. Ku, D. H. Kim, I. S. Choi, Anal. Chem. 2006, 78, 7197.).
최근 무기물 표면으로의 강한 결합 가능성을 갖는 펩타이드가 등장하면서 이들을 링커로서 사용하고자 하는 시도들이 이루어지고 있다. 무기물에 직접적으로 결합 가능한 펩타이드는 규조류와 같은 딱딱한 조직을 갖는 유기체로부터 분리해 내거나 무기물과 특이적인 결합을 할 수 있는 세포 표면 단백질을 재조합 분자 기술을 이용하여 선택적으로 획득할 수 있었다. 위와 같은 노력을 통해 갈륨비소(GaAs), 백금(Pt), 금(Au), 산화구리(Cu2O), 산화아연(ZnO), 실리카, 은(Ag), 이산화타이타늄(TiO2), 불석 등에 특이적으로 결합할 수 있는 펩타이드들이 발견되었으며, 이러한 유전자 조작 펩타이드를 활용한 연구 활동이 활발해 지면서 무기물 표면에 생체 물질의 결합, 조립 및 연결을 위한 링커로서 이용하기 위한 연구에 많은 노력을 기울이고 있다.
한편, 실리카 나노입자(silica nanoparticles, Si-NPs)는 다양한 크기, 모양 및 기능을 가진 물질을 포획할 수 있는 훌륭한 호스트로 알려져 있다. 다공성 실리카나노입자는 기공 채널(porous channels)을 가지고 있어서, 채널 내에 외부 물질은 포획할 수 있는 높은 안정성과, 외부 자극에 대한 특이한 반응성 때문에 약물전달 등의 분야에 적용할 수 있다.
다공성 실리카 나노입자는 주위 환경에 안정적인 다공성 구조체로서 넓은 표면적을 가지고 있고, 기공크기를 조절할 수 있고, 표면 특성이 알려져 있다. 다공성 실리카 나노입자는 표면 기능화가 용이하기 때문에 최근에는 자극-제어 방출에 적용할 수 있도록 표면을 기능화시킨 다공성 실리카 나노입자에 대한 연구가 이루어지고 있다. 또한, 실리카 나노입자 내부에 형광 물질 또는 자기 공명 조영제 등을 포함하는 실리카 나노입자를 이용한 이미징 기술에 대한 연구도 활발히 이루어지고 있다. 실리카의 높은 생체적합성과 가공기술의 발전으로 다양한 용도로의 개발이 이루어지고 있는 실정이다.
이에, 본 발명자들은 항체를 실리카-함유 고체상에 결합시키기 위한 연결자를 연구하던 중에, 실리카에 강한 결합력을 가지는 N-말단과 항체 Fc 부위에 강한 결합력을 가지는 C-말단으로 구성된 단백질이 실리카-함유 고체상에 결합하는 능력이 우수함을 발견하였다. 해당 단백질을 이용하여 실리카-함유 고체상에 항체를 항체의 배향성을 유지시키며 고정시킴으로써 항원에 대한 민감성이 현저히 향상되었음을 확인하고, 본 발명을 완성하였다.
본 발명의 목적은 서열번호 5의 아미노산 서열로 구성되는 단백질로서, 상기 단백질은 N-말단은 실리카에 결합할 수 있고, C-말단은 항체의 Fc 부위에 결합할 수 있는 것을 특징으로 하는 단백질을 제공하는 것이다.
본 발명의 또 다른 목적은 상기 단백질을 코딩하는 폴리뉴클레오티드를 제공하는 것이다.
본 발명의 또 다른 목적은 상기 단백질을 코딩하는 폴리뉴클레오티드를 포함하는 발현벡터를 제공하는 것이다.
본 발명의 또 다른 목적은 상기 발현벡터로 형질전환된 형질전환체를 제공하는 것이다.
본 발명의 또 다른 목적은 상기 단백질을 생산하는 방법을 제공하는 것이다.
본 발명의 또 다른 목적은 상기 단백질이 결합된 실리카-함유 고체상을 포함하는 바이오센서를 제공하는 것이다.
본 발명의 또 다른 목적은 상기 단백질이 결합된 실리카-함유 고체상을 포함하는 바이오센서의 제작방법을 제공하는 것이다.
본 발명의 또 다른 목적은 상기 바이오센서를 이용한 면역검출법을 제공하는 것이다.
본 발명의 또 다른 목적은 상기 단백질이 결합된 실리카-함유 고체상에 특정 항원에 대한 항체를 결합한 특정 항원 분리 또는 정제용 컬럼을 제공하는 것이다.
본 발명의 또 다른 목적은 상기 특정 항원 분리 또는 정제용 컬럼을 이용하여 특정 항원 물질을 분리 또는 정제하는 방법을 제공하는 것이다.
본 발명의 또 다른 목적은 상기 단백질과 결합하고; 표적특이적 결합성을 갖는 항체를 결합시키며; 내외부에 약물을 함유하는 실리카 나노입자를 제공하는 것이다.
본 발명의 또 다른 목적은 상기 단백질과 결합하고; 표적특이적 결합성을 갖는 항체를 결합시키며; 내외부에 형광물질을 함유하는 실리카 나노입자를 제공하는 것이다.
본 발명의 또 다른 목적은 상기 단백질과 결합하고; 표적특이적 결합성을 갖는 항체를 결합시키며; 내외부에 조영제를 함유하는 실리카 나노입자를 제공하는 것이다.
본 발명에 따른 융합 단백질은 간단한 과정만으로 항체를 적절한 배향성을 가진 상태로 실리카-함유 고체상에 고정 시킬 수 있어 항원와의 결합성을 높여 줌으로써 바이오센서의 항원에 대한 검출 민감도 증가를 유도할 수 있는 효과가 있다. 또한, 다양한 항원-항체 반응을 통한 컬럼, 바이오센서, 약물전달체 등 적용 기기에서 배향성을 줄 수 있는 구성요소로 제공될 수 있다.
도 1은 SBP와 protein G를 융합한 단백질을 실리카 비드와 결합시킨 모식도이다.
도 2는 6His-protein G 단백질에 SBP를 삽입한 염기서열과 이에 사용된 primer의 위치를 보여주는 모식도이다.
도 3은 SBP-ProG의 염기 서열이 올바르게 증폭되었는지 확인하고자 아가로스겔에 전기영동한 결과로, 약 639bp의 밴드를 확인하였다.
도 4는 도 3에서 확인된 SBP-ProG를 아가로스겔에서 elution하여 pET 22b 벡터에 ligation한 결과 제작된 발현벡터 및 해당 발현벡터를 대장균에 형질전환시켜 SBP-ProG 단백질을 생산하는 방법의 모식도이다.
도 5는 해당 벡터에 SBP-protein G의 삽입 여부를 확인하기 위해 Ndel/Xhol 제한효소를 사용하여 digestion한 후 전기영동한 사진이다. 약 639bp정도에서 밴드를 확인하였다.
도 6은 실리카 표면에 아무런 화학적 처리도 없는 상태에서 SBP의 특이적 결합 정도를 확인하기 위하여 FITC가 표지된 단백질 G 또는 SBP-ProG (FITC-ProG 또는 FITC-SBP-ProG)를 실리카 나노비드에 반응시켜 형광 세기를 측정란 결과를 나타낸 도이다.
도 7은 신규한 단백질의 단백질 G 부위의 항체 Fc 부위 특이적 결합을 하는 지에 대한 확인을 위해 FITC-IgG와 실리카비드/SBP-ProG의 특이적 결합에 의한 형광세기를 보인 도이다.
도 8은 FITC-ProG 와 FITC-SBP-ProG를 실리카 슬라이드 고체 기판에 결합시켜 결합 정도를 보인 도이다.
도 9는 실리카 슬라이드 표면에 결합한 SBP-ProG 단백질과 ProG 층 각각에 500μg/mL FITC-IgG(5μL)를 결합시켜 결합 정도를 보인 도이다.
상기의 목적을 달성하기 위한 하나의 양태로서, 본 발명은 서열번호 5의 아미노산 서열로 구성되는 단백질로서, 상기 단백질은 N-말단은 실리카에 결합할 수 있고, C-말단은 항체의 Fc 부위에 결합할 수 있는 것을 특징으로 하는 단백질을 제공한다.
본 발명의 신규한 단백질은 바이오센서의 실리카-함유 고체상과 항체를 연결시키는 연결자로서 역할을 한다. 상기 단백질은 기원이 다른 두 개 이상의 이종 단백질의 일부 또는 전부가 연결 또는 결합된 융합 단백질을 의미한다. 이와 같은 융합 단백질은 하나의 벡터 내에서 재조합 형태로 제작되거나, 각기 서로 다른 벡터에서 항체의 Fc 부위에 결합하는 단백질 및 실리카 결합 단백질을 발현시킨 후, 효소나 화학적 방법에 의해 결합하여 제작될 수 있다. 본 발명의 목적상 바람직하게는 하나의 벡터에서 발현시킬 수 있다.
상기 단백질은 실리카와 결합하는 특성을 갖는 N-말단과 항체의 Fc 부위와 결합할 수 있는 단백질 G의 기능을 갖는 C-말단으로 이루어진바, 기능적인 면을 반영하여 단백질을 SBP-protein G와 같이 나타낼 수 있다.
본 발명의 단백질은 항체와의 특이적 결합 효율성을 향상시키기 위하여 실리카 결합 단백질 및 항체의 Fc 부위에 결합하는 단백질을 연결한 융합 단백질로서, 바람직하게는 도 2에 도시한 바와 같이, 항체의 Fc 부위에 결합하는 단백질(도 2의 protein G)의 5-말단에 실리카결합 단백질(SBP)의 3-말단을 연결할 수 있다(도 2). 이와 같은 연결은 항체의 항원과 결합하는 활성화 부위가 항원이 있는 용액의 방향으로 향하도록 하는 적절한 배향성을 줄 수 있게 한다.
본 발명의 항체의 Fc 부위에 결합하는 단백질은 항체의 Fc 부위에 결합하는 활성을 가진 단백질로서, 이러한 활성을 가진 단백질, 펩티드는 제한 없이 사용할 수 있다. 바람직하게는 단백질 G 또는 단백질 A일 수 있고, 보다 바람직하게는 서열번호 3의 단백질 G일 수 있다.
단백질 G : 서열번호3
L K G E T T T E A V D A A T A E K V F K Q Y A N D N G V D G E W T Y D D A T K T F T V T E K P E V I D A S E L T P A V T T Y K L V I N G K T L K G E T T T E A V D A A T A E K V F K Q Y A N D N G V D G E W T Y D D A T K T F T V T E K P E V I D A S E L T P A V T T Y K L V I N G K T L K G E T T T K A V D A E T A E K A F K Q Y A N D N G V D G V W T Y D D A T K T F T V T E L E H H H H H H
단백질 G는 그룹 G 스트렙토코카이(streptococci)에서 분리된 박테리아 세포막 단백질(cell wall protein)로서, 포유동물 항체의 Fc 부위 및 Fab 부위와 결합하는 것으로 알려져 있다(J. Immuunol. Methods 1988, 112,113-120). 그러나, 단백질 G는 항체의 Fc 부위에 대한 결합력이 Fab 부위에 대한 결합력보다 약 10배 정도 높다고 알려져 있다. 또한, 단백질 G와 유사하게 항체 Fc 부위에 결합하는 특성을 갖는 단백질 A는 rat, sheep, goat, 및 horse에서 만든 항체에는 미약하게 결합하는 것에 비해, 단백질 G는 이들 항체에 많은 양으로 강하게 결합한다.
본 발명에 있어서, 단백질 G는 그 기원이 특별히 제한되지 아니하며, 항체의 Fc 부위와의 결합력을 보유하는 한 천연형의 단백질 G에 아미노산이 결실, 부가, 치환 등이 일어난 단백질 G 유도체도 본 발명의 목적에 부합되게 사용될 수 있다.
본 발명의 실리카결합 단백질(silica binding protein, SBP)은 실리카-함유 고체상에 결합하는 활성을 가진 단백질로서, 바람직하게는 서열번호 1의 아미노산 서열을 갖는 실리카결합 단백질 일 수 있다.
실리카결합 단백질 : 서열번호 1
P P P W L P Y M P P W S
다른 하나의 양태로서, 본 발명은 상기 단백질을 코딩하는 폴리뉴클레오티드, 이를 포함하는 발현벡터, 상기 발현벡터로 형질전환된 형질전환체 및 상기 형질전환체를 배양하여 융합 단백질을 제조하는 방법을 제공한다.
본 발명의 폴리뉴클레오티드는 실리카결합 부위과 항체의 Fc 부위에 결합하는 단백질이 연결된 신규한 단백질을 코딩하는 DNA, RNA 등의 폴리뉴클레오티드로서, 바람직하게는 서열번호 6의 염기서열을 갖는 폴리뉴클레오티드일 수 있다.
SBP-protein G : 서열번호 6
ccacctccttggctaccatacatgccgccttggtctttgaaaggcgaaacaactactgaagctgttgatgctgctactgcagaaaaagtcttcaaacaatacgctaacgacaacggtgttgacggtgaatggacttacgacgatgcgactaagacctttacagttactgaaaaaccagaagtgatcgatgcgtctgaattaacaccagccgtgacaacttacaaacttgttattaatggtaaaacattgaaaggcgaaacaactactgaagctgttgatgctgctactgcagaaaaagtcttcaaacaatacgctaacgacaacggtgttgacggtgaatggacttacgacgatgcgactaagacctttacagttactgaaaaaccagaagtgatcgatgcgtctgaattaacaccagccgtgacaacttacaaacttgttattaatggtaaaacattgaaaggcgaaacaactactaaagcagtagacgcagaaactgcagaaaaagccttcaaacaatacgctaacgacaacggtgttgatggtgtttggacttatgatgatgcgactaagacctttacggtaactgaactcgagcaccaccaccaccaccactga
발현벡터는 본 발명의 신규 단백질을 발현시키는 형질전환체를 만들기 위하여 숙주세포에 DNA를 도입하여 상기 단백질을 발현시키기 위한 수단으로서, 플라스미드 벡터, 코즈미드 벡터, 박테리오파아지 벡터 등이 사용될 수 있으며, 바람직하게는 플라스미드 벡터를 사용할 수 있다. 본 발명의 목적상 발현벡터는 프로모터, 개시코돈, 종결코돈, 폴리아데닐화 시그널 및 인헨서 같은 발현조절 엘리먼트를 포함할 수 있다.
본 발명의 실시예에서는 실리카결합 부위과 단백질 G이 연결된 단백질을 코딩하는 염기서열을 포함하는 발현벡터 pET-SBP-protein G를 제조하였다(실시예 3). 본 발명의 신규 단백질의 분리를 편하게 하기 위하여 N-말단에 단백질 정제를 위한 태그를 포함할 수 있다. 본 발명의 실시예에서는 헥사 히스티딘(6His)을 N-말단에 결합시켰으나, 본 발명의 목적상 단백질 정제를 위한 태그는 공지된 태그를 제한 없이 사용할 수 있다.
형질전환체는 본 발명의 융합 단백질을 발현할 수 있는 대장균(E.coli), 바실러스 서브틸리스(Bacillus subtilis) 등의 임의의 숙주세포를 사용할 수 있으며, 바람직하게는 대장균을 사용할 수 있다.
본 발명의 단백질은 펩티드 합성법에 의해 제조할 수도 있으나, 유전공학적 방법에 의해 특히 효율적으로 제조할 수 있다. 유전공학적 방법은 유전자조작에 의해 원하는 단백질을 대장균(E.coli) 등의 숙주세포에서 다량으로 발현시키는 방법이다.
본 발명의 유전자 서열은 하나 이상의 염기가 치환, 결실, 삽입 또는 이들 조합에 의해 용이하게 변형될 수 있다. 따라서, 서열번호 5와 높은 상동성을 갖는 DNA 또는 단백질, 예를 들면 그 상동성이 70% 이상, 바람직하게는 80% 이상의 높은 상동성을 갖는 DNA와 단백질도 본 발명의 범위에 포함되는 것으로 해석되어야 한다.
본 발명의 신규한 단백질은 a) 본 발명의 단백질을 코딩하는 폴리뉴클레오티드를 포함하는 발현벡터 제조단계; b) 상기 발현벡터를 숙주세포에 도입하여 형질전환체로 형질전환하는 단계; 및 c) 상기 형질전환체를 배양하는 단계를 포함하는 제 1항 또는 제 2항의 단백질을 생산하는 방법을 통하여 제조할 수 있다.
상기 발현벡터를 숙주세포에 도입하여 형질전환하는 방법은 바람직하게 본 발명의 DNA를 포함하는 발현 벡터를 당업계에 공지된 방법, 예를 들어 이에 한정되지는 않으나, 일시적인 형질감염(transient transfection), 미세 주사, 형질 도입(transduction), 세포 융합, 칼슘 포스페이트 침전법, 리포좀 매개된 형질감염(liposem-mediated transfection), DEAE 덱스트란-매개된 형질 감염(DEAE Dextran-mediated transfection), 폴리브렌-매개된 형질 감염(polybrene-mediated transfection), 전기 침공법(electroporation) 등의 공지 방법으로 숙주세포에 도입하여 형질전환 시킬 수 있다.
형질전환체를 배양하여 본 발명의 융합 단백질을 생산하기 위한 형질전환체를 배양하는 방법은 당업계에 공지된 임의의 방법을 이용할 수 있는데, 예를 들면, 대장균을 키우는 일반적인 조건인 37℃, 호기조건, LB 배지에서 수행할 수 있다.
본 발명의 실시예를 보면, 대장균 BL21(DE3)을 컴피턴트 세포로 제작한 후 발현벡터 pET-SBP-protein G로 형질전환하여 SBP-protein G를 발현시켰다(실시예 1-3).
본 발명은 또 다른 하나의 양태로서, 단백질이 결합된 실리카 함유 고체상을 포함하는 바이오센서 및 바이오센서의 제조방법을 제공한다.
본 발명에 따른 신규한 단백질은 실리카결합 부위와 단백질 G가 연결된 형태로서, 여기서 본 발명에 따른 상기 실리카결합 부위는 12개의 아미노산으로 이루어져 있으며 실리카에 선택적으로 결합할 수 있다. 상기 단백질의 단백질 G는 다른 단백질과 달리 항체의 Fc 부위에 특이적으로 결합한다.
따라서, 본 발명에 따른 융합 단백질에 실리카결합 단백질 부분은 실리카-함유 고체상에 선택적으로 결합하고, 단백질 G 부분은 항체의 Fc 부위에 특이적으로 결합함으로, 이를 이용하는 경우, 실리카-함유 고체상에 선택적으로 결합하면서, 항체의 Fc 부위에 특이적으로 결합할 수 있는 바이오센서를 제공할 수 있게 된다.
이로써 상기 바이오센서는, 상기 융합 단백질이 실리카-함유 고체상에 결합되며, 또한 항체의 Fc 부위에 결합하여 항원이 결합하는 활성화 부분인 Fab 부분이 용액의 방향으로 향하는 적절한 배향성을 유지할 수 있게 됨으로써, 항체-실리카 반응을 응용하는 면역분석 분야에서 유용하게 사용될 수 있다. 이러한 배향성으로 인해 항체의 항원과 결합하는 활성화 부위가 효율적으로 항원과 반응할 수 있다.
바이오센서(biosensor)는 생물이 가지고 있는 기능을 이용하여 물질의 성질 등을 조사하는 기계로서, 효소 분석법과 면역 분석법에 사용하는 바이오센서, 광학적 바이오센서와 전기화학적 바이오센서 등이 있으며, 본 발명의 바이오센서는 샘플 주입, 혼성화 반응과 검출 등 실험의 전 과정을 하나의 작은 칩으로 자동적으로 처리하는 랩온어칩(lab-on-a-chip)일 수 있다.
또한, 본 발명의 바이오센서는 바람직하게는 표면 플라즈몬 공명(surface plasmon resonance)을 이용한 바이오센서일 수 있다. 표면 플라즈몬 공명을 이용하는 바이오센서는 정성적인 정보(두 분자들이 특이적으로 결합을 하는지)와 정량적인 정보(반응 속도, Kinetics와 평형상수, equilibrium constants)를 제공할 뿐만 아니라 형광으로 표지할 필요 없이 실시간으로 감지할 수 있어, 항원과 항체 결합을 측정하는데 특히 유용하다.
본 발명의 실리카-함유 고체상은 바람직하게는 실리카 비드, 실리카 입자, 실리카코팅 입자 및 실리카가 도포된 기판으로 이루어진 군으로부터 선택될 수 있다.
본 발명의 바이오센서는 융합 단백질을 이용하여 다른 생물학적 활성에 영향을 주지 않으면서 강력하게 항체를 실리카-함유 고체상에 고정시킬 수 있다.
본 발명의 바이오센서는 a) 본 발명의 코딩하는 폴리뉴클레오티드를 포함하는 발현벡터를 숙주세포에 삽입하여 형질전환체를 준비하는 단계; b) 상기 형질전환체를 배양하여 상기 단백질을 발현시키는 단계; c) 상기 단백질이 발현된 형질전환체를 회수한 다음, 파쇄하여 상기 단백질을 수득하는 단계; 및 d) 상기 수득한 단백질을 실리카-함유 고체상에 특이적으로 고정시키는 단계를 통하여 제조할 수 있다.
또 다른 하나의 양태로서, 본 발명은 바이오센서를 이용한 면역검출법을 제공한다.
본 발명의 바이오센서에는 항체가 결합되어 있으므로 상기 항체에 특이적으로 결합하는 항원을 검출할 수 있다. 항원-항체의 특이적 결합을 확인하는 것을 특징으로 하는 면역검출법은 가시적(visually), 광학적(optically), 전기화학적(electrochemically) 방법을 통해 수행할 수 있으며, 특히, 광학적 방법의 한 예로 표면플라즈몬공명(SPR) 기술을 들 수 있다. 본 발명의 면역분석법은 바람직하게는 표면 플라즈몬 공명 방법을 사용할 수 있다. 표면 플라즈몬 공명(Surface Plasmon Resonance, SPR)은 전반사(attenuated total reflectance)에 의한 표면 플라즈몬 공명 현상을 이용하는 것으로, 전류 또는 기계적 변화를 이용하는 검출 시스템과 비교하였을 때, 용매의 흐름이나 전기적 잡음에 의해 방해받지 않기 때문에 안정된 신호를 얻을 수 있다는 장점을 가지고 있다.
본 발명의 면역검출법은 a) 바이오센서의 융합 단백질에 항체를 특이적으로 결합시키는 단계; 및 b) 상기 항체에 특이적인 항원을 처리하여 항원-항체의 특이적 결합을 검출하는 단계를 포함할 수 있다.
본 발명의 융합 단백질을 포함하는 바이오센서를 이용한 면역분석은 단백질이 항체와 결합하는 빈도가 현저히 향상되었기 때문에, 고가인 항체의 손실 없이 융합 단백질에 결합된 항체에 반응시키고자 하는 항원을 처리하고, 표면 플라즈몬 공명 신호의 변화를 측정함으로써 항원-항체의 특이적 결합을 검출할 수 있는 이점이 있다.
또 다른 하나의 양태로서, 본 발명은 융합 단백질이 결합된 실리카-함유 고체상에 특정 항원에 대한 항체를 결합시킨 특정 항원 분리정제용 컬럼을 제공한다.
본 발명에서 용어, 분리정제는 어떤 물질을 혼재해 있는 불순물로부터 분리하여, 다른 불순물을 제거하여 순도를 높이는 조작을 의미하며, 본 발명의 목적상 부착한 항체에 따라, 해당 항체가 특이적으로 결합하는 항원을 액체에 혼재해 있는 불순물로부터 검출하는 방법을 통해 이뤄질 수 있다. 상기 불순물은 정제의 과정에서 목적물질 이외에 섞여있는 물질로서, 본 발명에서는 이에 제한되지는 않으나 바람직하게는 숙주세포 단백질(HCP), 숙주세포 단백질(HCP), 숙주세포 유래 DNA(HCD) 및 세포생장을 위한 인자 등을 포함할 수 있으며, 보다 바람직하게는 본 발명에서 주로 제거하고자 하는 불순물은 숙주세포 단백질일 수 있다. 상기 불순물의 제거는 품질 조절의 목적을 포함한다.
본 발명에서 용어, 컬럼은 물질의 각종 물리화학적 특성을 이용해 혼합물을 분리하거나 정제하는 수단이다. 구체적으로, 물질의 친수성이나 소수성 정도 또는 분자의 전위, 특정 물질의 결합력 여부 등에 따라 칼럼을 특정 비드로 채워 혼합물로부터 물질을 분리하는 기구이다.
또 다른 하나의 양태로서, 본 발명은 상기 단백질이 결합된 실리카-함유 고체상에 특정 항원에 대한 항체를 결합시킨 특정 항원 분리정제용 컬럼을 이용한 특정 항원 물질의 분리 또는 정제 방법을 제공한다.
본 발명은 항체의 Fc 부위에 결합하는 protein G를 이용하기 때문에 다양한 항체를 컬럼 비드에 부착시킬 수 있다는 특징이 있다. 따라서, 항체가 존재하는 각종 항원을 분리 또는 정제할 수 있는 장점을 가지고 있다. 특히, protein G와 유사하게 항체 Fc 부위에 결합하는 특성을 갖는 protein A는 rat, sheep, goat, 및 horse에서 만든 항체에는 미약하게 결합하는 것에 비해, Protein G는 이들 항체에 많은 양으로 강하게 결합한다. 따라서, Fc부위에 결합하는 기능은 비슷하지만 사용할 수 있는 항체의 범위에서 큰 차이를 가지고 있다.
또 다른 하나의 양태로서, 본 발명은 상기 단백질과 결합하고; 표적특이적 결합성을 갖는 항체를 결합시키며; 내외부에 약물을 함유하는 실리카 나노입자를 제공한다.
본 발명에서 용어 "표적특이"는 인간 또는 동물의 생체 내 존재하는 각종 표적 또는 조직에 있어서, 해당 표적 또는 조직에 특징적으로 갖는 성질을 말한다. 해당 성질은 단백질이나 세포의 크기, 모양 같은 물리적 특징 뿐 아니라 특정 유전자 발현 여부나 발현 정도, modification 여부, 세포 내 위치 등 생리학적인 특징을 포함한다. 또한, 해당 표적 또는 조직은 정상적으로 인체를 구성하는 뇌조직이나 췌장조직에 있는 것 뿐 아니라 암세포 조직과 같은 비정상적인 조직등에 있는 표적이나 조직도 포함한다.
본 발명에서 용어 "표적특이적 결합성"은 생체 내 각 표적의 특성에 따라 어떤 물질이 해당 표적에 결합하는 능력을 말한다. 본 발명에서는 주로 세포의 표적특이적 표면 항원을 표적으로 인식한 항체의 결합능력을 말한다. 특히, 암세포의 특이적 표면 항원, 예를 들어, CD20이나 Her2등의 항원에 대해 결합성을 갖는 항체가 암세포에 특이적으로 결합하는 능력을 포함한다.
본 발명에서 용어 "약물"은 특정 질환의 증상을 완화시키거나 병인을 제거하거나 예방하는 물질로서, 본 발명에서는 결합된 항체가 인식하는 조직과 관련된 질환에 대한 약물을 말한다. 특히, 암세포에 특이적 결합하는 항체를 이용하는 경우 해당 약물은 항암제를 포함한다.
본 발명에서 용어 "실리카 나노입자"는 생체적합성이 뛰어난 실리카 재질로 이루어진 최소 1~100nm의 크기의 입자를 뜻한다. 본 발명에서 실리카 나노입자는 다공성으로 실리카 내부에 다양한 물질을 포함하고 이를 표적특이적 항체를 통해 특정 표적이 존재하는 조직에 밀집하게 되는 성질을 포함한다.
또 다른 하나의 양태로서, 본 발명은 상기 단백질과 결합하고; 표적특이적 결합성을 갖는 항체를 결합시키며; 내외부에 형광물질을 함유하는 실리카 나노입자를 제공한다.
본 발명에 있어서 용어 "형광물질"은 특정 파장을 쪼였을 때 고유의 파장의 빛을 방출하는 물질로서, 구체적으로는 fluorescein 계열의 TRITC(Tetramethylrhodamine-5-(and 6)-isothiocyanate), FITC(Fluorescein-5-isothiocyanate), DAPI( 4,6-diamidino-2-phenylindole), 피렌, 프로피디움 요오드화물 또는 RITC(Rhodamine isothiocyanate)이 될 수 있다. 본 발명에서는 실리카 나노입자의 내외부에 함유되어 특정 조직에 밀집되어 고유 파장의 빛을 방출하는 성질을 포함한다.
또 다른 하나의 양태로서, 본 발명은 상기 단백질과 결합하고; 표적특이적 결합성을 갖는 항체를 결합시키며; 내외부에 조영제를 함유하는 실리카 나노입자를 제공한다.
본 발명에 있어서 용어 "조영제"는 특정 파장을 쪼였을 때 양성적으로 또는 음성적으로 광학적 특성을 보이는 물질로, 구체적으로는 자기공명영상 촬영이나 컴퓨터 단층촬영, 또는 혈관조영술 등에 사용되며 각 조직의 X선 흡수차를 인위적으로 크게함으로써 영상의 대조도를 크게 해주는 약품이다. 본 발명에서 조영제는 요오드 함유 조영제, 황산 바륨, 공기, 가스, 탄산 가스 등을 포함한다.
이하, 본 발명을 실시예 및 실험예에 의해 보다 상세히 설명한다. 단, 하기 실시예는 본 발명을 예시하는 것일 뿐 본 발명의 내용이 하기 실시예에 한정되는 것은 아니다.
실시예 1. 실리카 및 항체 Fc 부위와 결합할 수 있는 신규한 단백질 제조
실시예 1-1. 실리카 및 항체 Fc 부위와 결합할 수 있는 신규한 단백질의 발 현벡터 제작
본 발명가들은 이전 본 연구진이 보유하고 있던 pET22b/ProG 발현벡터에서 6개의 His와 단백질 G의 N-말단 사이에 서열번호 1의 실리카 결합 단백질을 삽입하였다. SBP를 삽입하기 위해 3개의 프라이머(서열번호 7 내지 9)를 제작하였다. 해당 프라이머를 이용하여 PCR을 수행하여 최종적으로 6His-SBP와 단백질 G가 융합된 형태의 유전자 산물 6His-SBP-protein G를 수득하였다(도 2). PCR 조건으로 첫 번째 변성(denaturation)은 95℃에서 5분간 한번 하였으며, 이후 두 번째 변성은 95℃에서 30초간, 교잡(annealing)은 65℃에서 30초간, 연장(extension)은 72℃에서 40초간 수행하였으며 이를 40회 반복하였다. 이후 72℃에서 5분간 마지막 연장을 한번 더 수행하였다. PCR 반응이 끝난 후에는 4℃에서 보관되도록 하였다 (표 1).
표 1 SBP-ProG 합성을 위한 PCR 조건
PCR condition
Predenaturation 95℃ 5 min
Denaturation 95℃ 30 sec 40 cycle
Anneling 65℃ 30 sec
Extension 72℃ 40 sec
Final extention 72℃ 5 min
4℃
PCR mixture는 template 1μL, 10mM dNTPs 0.4μL, 프라이머 10pmol 1μL씩, 10X buffer 2μL, taq polymerase(Takara LA taq) 0.2μL, 나머지를 D.W.로 채워 총 부피를 20μL으로 넣어 주었다. 상기 표 1의 PCR 조건으로 PCR을 수행하였고, SBP-ProG의 염기 서열이 올바르게 증폭되었는지 확인하고자 아가로스겔에 전기영동 하였다. 그 결과 약 639bp의 밴드를 확인할 수 있었다(도 3). 위 그림 3에서 확인된 SBP-ProG를 아가로스겔에서 elution하여 pET 22b 벡터에 ligation하였다(도 4).
상기 벡터에 DNA의 삽입 여부를 확인하고자 Ndel/Xhol 제한효소(NEB)를 사용하여 digestion을 수행하였다. Enzyme cutting mixure는 DNA 10μL, enzyme 0.5μL, 10Xbuffer 2μL, D.W를 총 부피 20μL되도록 채워 37℃에서 1시간 incubation한 뒤 바로 ice에 넣어 아가로스겔에 전기영동하여 약 639bp정도에서 밴드를 확인하였다(도 5).
실시예 1-2. 신규 단백질인 SBP-ProG의 발현 형질전환체 제작
SBP-ProG의 발현벡터를 DH5 cell을 이용하여 cloning 하였다. 1.5mL epitube에 DH5 competent cell(cp) 50μL와 pET-6His-SBP-ProG 1μL를 넣고 45분간 ice에서 incubation하였다. 42℃ heat shock을 20초간 주어 형질전환하고 바로 ice에 넣어둔다. 1분이 지나면 LB 800ul을 섞어 37℃에서 1시간 동안 incubation한 뒤 amp, IPTG, Xgal이 함유된 LB plate에 50μL을 37℃에서 overnight 키웠다. White colony를 따서 용액상태의 LB배지에서 밤새 키운 후 preparation kit을 사용하여 DNA를 추출하였다.
상기 DNA를 BL21(DE3) cp cell에 주입하여 형질전환체를 제작하였다. 구체적으로는, 농도가 1μg/mL인 발현벡터(in TE buffer)를 100μL cp cell에 넣고 resuspention한 뒤 얼음에 30분간 배양하고, 30초간 42℃ 진탕기에서 heat shock을 주었다. 이 후 바로 얼음에 2~3분간 놓아두었다. 액체 LB배지 900μL을 넣고 200rpm 37℃ 조건으로 1시간 shaking incubation을 한 뒤 ampicillin(100mg/L)을 포함한 LB plate에 깔아준다. 37℃ 배양기에서 밤새 배양하였다. 형성된 colony를 LA(ampicillin을 포함하고 있는 LB배지)배지 10mL에서 37℃ 밤새 배양한 후, 1mL은 DNA 추출하여 plasmid가 cell내에 성공적으로 삽입되었는지를 확인하였다. 나머지는 단백질 정제를 위해 70% glycerol에 cell stock으로 만들어 deep freezer에 보관하였다.
실시예 1-3. SBP-ProG 단백질 정제
Cell stock 200L을 LA배지 5에 첨가한 후 37℃에서 밤새 250rpm으로 shaking 배양한 후 800μL씩 4개의 신선한 50mL LA배지에 분주하였다. 이를 spectrophotometer 600nm에서 O.D 0.6이 나올 때까지 배양한 후 1mM IPTG(isopropylthiogalactoside)를 첨가하여 shaking 배양을(270rpm 37℃ 3hr)하면서 융합 단백질을 발현시켰다. 다음으로 cell과 배지를 50mL falcon tube로 옮겨 원심분리(4000g, 4℃, 30min)하여 상등액을 제거하고, 액체 질소를 이용하여 급속 냉각시켜 deep freezer에 보관하였다.
융합 단백질의 정제는 NiNTA His Bind Resins(Novagen,USA)이용하였다. 보관한 sample은 정제 전에 꺼내어 약 15분간 얼음에 넣어둔 뒤에 1x Ni NTA bind buffer(50mM NaH2PO4, pH8.0; 300mM NaCl; 10mM imidazole) 각 1.5mL을 넣어 resuspension 한 뒤, 15㎖ falcon tube로 sample을 옮겨 lysozyme을 1mg/mL이 되도록 넣어 30min간 얼음에 incubation하였다. 다음으로 10초간 sonication, 10초간 ice incubation하여 총 25분간 초음파처리(sonication)한다. 다음으로 원심분리(10,000g, 4℃, 30min)를 실시하여 상등액을 취하였다. 초음파 처리를 하는 동안 50% NiNTA HisBind slurry 1mL을 4mL 1X NiNTA Bind Buffer와 섞어 준 뒤, 중력에 의해 slurry와 buffer가 분리되도록 하여 상층액 4mL 제거하였다. 초음파분쇄한 샘플을 slurry와 4℃에서 shaking incubation을 한시간 동안 진행하였다. Slurry에 charge에 의해 결합되어진 단백질 샘플들을 정제하기 위해 column에 slurry/단백질을 loading하여 버퍼를 제거하였다. 그 후, 4mL 1X NiNTA Wash Buffer(50mM NaH2PO4, pH8.0; 300mM NaCl; 80mM imidazole)를 두 번 흘려 SBP-ProG 외에 잔류하는 단백질 및 불순물을 제거하였다. 마지막으로 0.5 mL 1X NiNTA Elution buffer(50mM NaH2PO4, pH8.0; 300mM NaCl; 200mM imidazole)를 4번에 걸쳐 column에 흘려 주면서 SBP-ProG를 정제하였다. 정제된 단백질은 모두 SDS-PAGE로 확인한 뒤 centricon( >10KDa)으로 농축하여 PBS 버퍼에 희석한 다음 -72℃ 냉동보관 하였다.
2. 신규한 단백질의 기능 분석
신규한 단백질의 기능 확인 실험에 앞서 ProG, SBP-ProG, Imunoglobulin G(IgG)를 AnaTagTM 5-FITC Protein Labeling Kit(ANASPEC,USA)을 이용하여 형광 표지 하였다.
2-1. SBP-ProG와 실리카 비드와의 결합 확인
실리카 표면에 아무런 화학적 처리도 없는 상태에서 SBP의 특이적 결합 정도를 확인하기 위하여 FITC가 표지된 ProG 또는 SBP-ProG (FITC-ProG 또는 FITC-SBP-ProG)를 실리카 나노비드에 반응시켜 형광 세기를 측정하였다. 120μL의 D.W.(증류수)에 100nm 크기의 실리카 비드 15μL 넣어 vortexing 한 뒤 17000rpm, 4℃, 30min 조건으로 원심 분리하였다. 다음으로 상층액을 제거하고 PBS 100μL를 넣어 고르게 분포하도록 초음파처리(sonication) 및 vortexing을 충분히 가해 주었다. 그 뒤 500μg/mL의 농도로 PBS 버퍼에 희석해 놓은 FITC-ProG 또는 FITC-SBP-ProG를 20μL씩 넣어 실온에서 20분 동안 반응시키고 위와 같은 조건으로 원심분리하여 상층액을 제거하고 PBS 버퍼 100μL 넣어 초음파처리 및 vortexing하였다(원심분리는 3 반복 실시함). 최종적으로 Nikon C1si Laser Confocal Microscope(Nikon, Tokyo)을 통해 형광세기를 측정하였다. 도 6에서 보듯, 실리카 나노비드에 FITC-ProG를 반응시켰을 때 보다 FITC-SBP-ProG를 반응시켰을 때 3.2배 높은 형광세기를 보였다. 이는 본 발명의 신규한 단백질이 N 말단 부위에 의해서 실리카 나노비드 표면에 효과적으로 결합할 수 있음을 보여준다.
2-2. 실리카비드/SBP-ProG 복합체의 항체와의 결합력 확인
위 실험을 통해 본 발명의 신규한 단백질에서 N 말단 부위가 실리카 비드 표면에 단백질의 특이적 결합에 직접적으로 관여한다는 것을 확인한 다음, 단백질의 C말단에 존재하는 단백질 G 부위가 항체의 Fc부위에 특이적 결합을 성공적으로 하는지에 대한 확인 실험을 수행하였다.
위 실험과 같이 실리카 나노비드(100 nm)에 ProG 또는 SBP-ProG를 반응시켜 실리카비드/SBP-ProG 및 실리카비드/ProG 복합체를 만들었다.
그 다음 1% BSA 20L 넣어 30분간 실온에서 반응시켜 반응하지 않은 실리카 비드 표면을 blocking 한 후 원심분리 하여 상층액을 제거하였다. 다양한 농도의 FITC-IgG(10, 100, 250, 500, 1000μg/mL) 10㎕를 각각 30분간 반응시킨 후 30분 간 원심분리(10000rpm, 4℃) 하여 상층액을 제거하였다 (원심분리와 상층액 제거 2 반복). 그 후 PBS 버퍼를 100μL 넣고 최종적으로 Nikon C1si Laser Confocal Microscope(Nikon, Tokyo)을 통해 형광세기를 측정하였다.
도 7의 결과를 보면, FITC-IgG와 실리카비드/SBP-ProG의 특이적 결합에 의한 형광세기는 실리카비드/ProG와 FITC-IgG 반응의 형광세기 보다 모든 농도에서 높았고, FITC-IgG의 농도가 올라감으로써 형광의 세기가 높아짐을 알 수 있었다. 이러한 결과는 본 발명의 신규한 단백질이 N-말단 부위에 의해서 효과적으로 실리카 나노비드 표면에 결합하였고 단백질의 C-말단의 단백질 G 부위 또한 항체 Fc부위와의 특이적 결합 기능이 소실되지 않았음을 의미한다. 따라서 본 발명의 단백질이 실리카 표면에 어떠한 화학적 처리 없이 신속하고 간단히 배향성을 가지면서 고정화 시킬 수 있는 효율적인 생체 연결자임을 보여준다.
2-3. 실리카 슬라이드 고체 기판에서 신규한 단백질의 결합 기능 확인
본 발명의 신규한 단백질의 결합 기능을 실리카 나노비드 뿐만 아니라 실리카 슬라이드 고체 기판에도 확인하였다. 실리카 슬라이드에 1mg/mL 농도의 FITC-ProG 와 FITC-SBP-ProG를 20 분간 반응시킨 뒤 버퍼로 세척한 후 공초점형광현미경으로 형광 세기를 측정하였다. 도 8에서 보듯이, SBP-ProG 단백질이 ProG 보다 약 4배가량 잘 붙는 것을 확인할 수 있었다. 이 결과 또한 실리카 슬라이드 고체 기판에도 본 단백질은 N-말단에 의해서 효과적으로 결합함을 보여준다.
실리카 슬라이드 표면에 결합한 SBP-ProG 단백질과 ProG 층 각각에 500μg/mL FITC-IgG(5μL)를 실온에서 30분간 반응시키고 버퍼로 세척한 후 결합 정도를 확인하기 위해 공초점 현미경으로 형광세기를 확인하였다. 도 9는 항체가 ProG 층 보다 SBP-ProG 단백질 층에 4.5배 정도 더 많이 결합하였음을 보여준다. 이는 또한 본 발명의 신규 단백질은 실리카 나노입자 뿐만 아니라 슬라이드 기판에도 항체를 효과적으로 간단히 결합시킬 수 있음을 의미한다.
상기와 같은 결과들은 본 발명의 신규한 단백질이 효과적으로 N-말단을 통해 실리카에 결합할 수 있고, C-말단은 항체의 Fc 말단에 결합할 수 있음을 뒷받침하는 것으로, 실리카 결합 부위와 단백질 G를 링커없이 연결시킨 신규한 단백질이 각각의 기능의 간섭없이 효과적으로 실리카 및 항체의 Fc 영역에 결합할 수 있는 것을 뒷받침하는 것이다.
이상의 설명으로부터, 본 발명이 속하는 기술분야의 당업자는 본 발명이 그 기술적 사상이나 필수적 특징을 변경하지 않고서 다른 구체적인 형태로 실시될 수 있다는 것을 이해할 수 있을 것이다. 이와 관련하여, 이상에서 기술한 실시 예들은 모든 면에서 예시적인 것이며 한정적인 것이 아닌 것으로서 이해해야만 한다. 본 발명의 범위는 상기 상세한 설명보다는 후술하는 특허 청구범위의 의미 및 범위 그 리고 그 등가 개념으로부터 도출되는 모든 변경 또는 변형된 형태가 본 발명의 범 위에 포함되는 것으로 해석되어야 한다.

Claims (22)

  1. 서열번호 5의 아미노산 서열로 구성되는 단백질로서, 상기 단백질은 N-말단은 실리카에 결합할 수 있고, C-말단은 항체의 Fc 부위에 결합할 수 있는 것을 특징으로 하는 단백질.
  2. 제 1항의 단백질을 코딩하는 폴리뉴클레오티드.
  3. 제 2항에 있어서, 상기 폴리뉴클레오티드는 서열번호 6의 염기서열로 구성되는 폴리뉴클레오티드.
  4. 제 3항의 폴리뉴클레오티드를 포함하는 발현벡터.
  5. 제 4항의 발현벡터로 형질전환된 형질전환체.
  6. a) 제 1항의 단백질을 코딩하는 폴리뉴클레오티드를 포함하는 발현벡터 제조단계;
    b) 상기 발현벡터를 숙주세포에 도입하여 형질전환체로 형질전환하는 단계; 및
    c) 상기 형질전환체를 배양하는 단계를 포함하는 제 1항의 단백질을 제조하는 방법.
  7. 제 1항의 단백질이 결합된 실리카-함유 고체상을 포함하는 바이오센서.
  8. a) 제 1항의 단백질을 코딩하는 폴리뉴클레오티드를 포함하는 발현벡터를 숙주세포에 삽입하여 형질전환체를 준비하는 단계;
    b) 상기 형질전환체를 배양하여 제 1항의 단백질을 발현시키는 단계;
    c) 상기 단백질이 발현된 형질전환체를 회수한 다음, 파쇄하여 상기 단백질을 수득하는 단계; 및
    d) 상기 수득한 단백질을 실리카-함유 고체상에 특이적으로 고정시키는 단계를 포함하는 제 7항의 바이오센서 제작방법.
  9. 제 7항의 바이오센서를 이용한 면역검출법.
  10. 제 9항에 있어서, 상기 바이오센서의 융합 단백질에 항체를 특이적으로 결합시키는 단계; 및 상기 항체에 특이적인 항원을 처리하여 항원-항체의 특이적 결합을 검출하는 단계를 포함하는 면역검출법.
  11. 제 1항의 단백질이 결합된 실리카-함유 고체상에 특정 항원에 대한 항체를 결합시킨 해당 특정 항원 분리 또는 정제용 컬럼.
  12. 제 11항에 있어서, 상기 항원은 독소, 단백질, 세포, DNA 또는 RNA인 컬럼.
  13. 제 11항의 특정 항원 분리 또는 정제용 컬럼을 이용하여 특정 항원 물질을 분리 또는 정제하는 방법.
  14. 제 1항의 단백질과 결합하고;
    표적특이적 결합성을 갖는 항체를 결합시키며;
    내외부에 약물을 함유하는 실리카 나노입자.
  15. 제 14항에 있어서, 상기 표적특이적 결합성을 갖는 항체는 암세포 특이 항원에 대한 항체인 실리카 나노입자.
  16. 제 14항에 있어서, 상기 약물은 항암제인 실리카 나노입자.
  17. 제 14항 내지 제 16항 중 어느 한 항의 실리카 나노입자를 포함하는 약물전달체.
  18. 제 1항의 단백질과 결합하고;
    표적특이적 결합성을 갖는 항체를 결합시키며;
    내외부에 형광물질을 함유하는 실리카 나노입자.
  19. 제 18항에 있어서,
    상기 표적특이적 결합성을 갖는 항체는 암세포 특이 항원에 대한 항체인 실리카 나노입자.
  20. 제 18항에 있어서,
    상기 형광물질은 fluorescein 계열의 TRITC(Tetramethylrhodamine-5-(and 6)-isothiocyanate), FITC(Fluorescein-5-isothiocyanate), DAPI( 4,6-diamidino-2-phenylindole), 피렌, 프로피디움 요오드화물 및 RITC(Rhodamine isothiocyanate)로 이루어진 군으로부터 선택된 하나 이상인 것을 특징으로 하는 실리카 나노입자.
  21. 제 1항의 단백질과 결합하고;
    표적특이적 결합성을 갖는 항체를 결합시키며;
    내외부에 조영제를 함유하는 실리카 나노입자.
  22. 제 21항에 있어서,
    상기 표적특이적 결합성을 갖는 항체는 암세포 특이 항원에 대한 항체인 실리카 나노입자.
PCT/KR2013/004539 2012-05-23 2013-05-23 신규한 단백질 및 이의 용도 WO2013176504A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2012-0054954 2012-05-23
KR1020120054954A KR101457186B1 (ko) 2012-05-23 2012-05-23 신규한 단백질 및 이의 용도

Publications (1)

Publication Number Publication Date
WO2013176504A1 true WO2013176504A1 (ko) 2013-11-28

Family

ID=49624114

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2013/004539 WO2013176504A1 (ko) 2012-05-23 2013-05-23 신규한 단백질 및 이의 용도

Country Status (2)

Country Link
KR (1) KR101457186B1 (ko)
WO (1) WO2013176504A1 (ko)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10835495B2 (en) 2012-11-14 2020-11-17 W. R. Grace & Co.-Conn. Compositions containing a biologically active material and a non-ordered inorganic oxide material and methods of making and using the same

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101864375B1 (ko) * 2016-04-14 2018-07-13 고려대학교 세종산학협력단 바이오 실리카를 이용한 물질의 검출, 분리 또는 정제

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20100320086A1 (en) * 2009-05-13 2010-12-23 KAIST (Korea Advanced Institute of Science and Technology) Flexible biosensor and manufacturing method for the same
KR101047422B1 (ko) * 2008-07-08 2011-07-07 연세대학교 산학협력단 형광 자성 실리카 나노입자, 그 제조방법 및 상기를포함하는 생물의학적 조성물

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101047422B1 (ko) * 2008-07-08 2011-07-07 연세대학교 산학협력단 형광 자성 실리카 나노입자, 그 제조방법 및 상기를포함하는 생물의학적 조성물
US20100320086A1 (en) * 2009-05-13 2010-12-23 KAIST (Korea Advanced Institute of Science and Technology) Flexible biosensor and manufacturing method for the same

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
SEKER, U. O. S. ET AL.: "Assembly kinetics ofnanocrystals via peptide hybridization", LANGMUIR, vol. 27, no. 8, 19 April 2011 (2011-04-19), pages 4867 - 4872 *
SEKER, U. O. S. ET AL.: "Material binding peptides for nanotechnology", MOLECULES, vol. 16, no. 2, 9 February 2011 (2011-02-09), pages 1426 - 1451 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10835495B2 (en) 2012-11-14 2020-11-17 W. R. Grace & Co.-Conn. Compositions containing a biologically active material and a non-ordered inorganic oxide material and methods of making and using the same

Also Published As

Publication number Publication date
KR101457186B1 (ko) 2014-10-31
KR20130131128A (ko) 2013-12-03

Similar Documents

Publication Publication Date Title
US11300572B2 (en) Methods and systems for producing nanolipoprotein particles
JP6215223B2 (ja) マルチプレックス免疫スクリーニングアッセイ
KR101218206B1 (ko) 금-형광 실리카 나노입자 복합체 및 이의 제조방법
CN106536555B (zh) 胰岛素样生长因子1受体特异性抗体及其用途
US20070190578A1 (en) Method of site specific labeling of proteins and uses therefor
CN106459194B (zh) 胰岛素样生长因子1受体特异性抗体及其用途
CN118085109A (zh) 免疫调节化合物
WO2013055058A9 (ko) 항체결합 펩타이드-페리틴 융합단백질 및 이의 용도
US20110098197A1 (en) Method for Specific Covalent Coupling of Antibody Using a Photoactivable Protein G Variant
US20100203653A1 (en) Protein G-Oligonucleotide Conjugate
KR100931027B1 (ko) Ｎ-말단에 시스테인 태그된 단백질 ｇ 변형체
Yi et al. A preparation strategy for protein-oriented immobilized silica magnetic beads with Spy chemistry for ligand fishing
WO2013176504A1 (ko) 신규한 단백질 및 이의 용도
EP2816110B1 (en) Peptide having affinity for silicon nitride (si3n4), and use therefor
JP4832291B2 (ja) ラベル用物質とキメラ物質、これらの物質の作製方法、並びに該ラベル用物質を用いて生体物質を捕捉、構造解析又は／及び同定する方法
KR20100001090A (ko) 면역글로불린 Ｇ의 Ｆｃ 부위에 선택적으로 결합하는 신규펩타이드 및 그의 제조방법
WO2017132701A1 (en) Method for screening antibodies
Kinns et al. The surface location of individual residues in a bacterial S-layer protein
WO2006041211A1 (ja) 可塑剤に対する結合能を有する蛋白質
WO2008024311A2 (en) Purification of low-abundant recombinant proteins from cell culture
KR100979282B1 (ko) 실리카 결합단백질을 이용한 바이오-실리카 칩 및 그제조방법
KR101300187B1 (ko) 융합 단백질 및 이를 포함하는 바이오센서
KR101695274B1 (ko) 링커를 통한 단백질 g와 항체의 결합체
WO2024107916A1 (en) Methods and composition relating to particle capture
Li Development of VHH-and antibody-based imaging and diagnostic tools

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 13794480

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 13794480

Country of ref document: EP

Kind code of ref document: A1