WO2013093106A1 - Detection of meca variant strains of methicillin-resistant staphylococcus aureus - Google Patents

Detection of meca variant strains of methicillin-resistant staphylococcus aureus Download PDF

Info

Publication number
WO2013093106A1
WO2013093106A1 PCT/EP2012/076856 EP2012076856W WO2013093106A1 WO 2013093106 A1 WO2013093106 A1 WO 2013093106A1 EP 2012076856 W EP2012076856 W EP 2012076856W WO 2013093106 A1 WO2013093106 A1 WO 2013093106A1
Authority
WO
WIPO (PCT)
Prior art keywords
oligonucleotide
region
meca
nucleic acid
acid sequence
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/EP2012/076856
Other languages
English (en)
French (fr)
Inventor
François PAILLIER
Céline CHAMBON
Cathy SAINT-PATRICE
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Biomerieux SA
Original Assignee
Biomerieux SA
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to HK15102527.1A priority Critical patent/HK1201888B/en
Priority to AU2012356749A priority patent/AU2012356749B2/en
Priority to IN5831DEN2014 priority patent/IN2014DN05831A/en
Priority to ES12813030.9T priority patent/ES2693158T3/es
Priority to CN201280070541.0A priority patent/CN104169437B/zh
Priority to EP12813030.9A priority patent/EP2794917B1/en
Priority to BR112014015401A priority patent/BR112014015401A8/pt
Priority to EP18185906.7A priority patent/EP3450572A1/en
Priority to CA2858284A priority patent/CA2858284A1/en
Priority to JP2014548106A priority patent/JP2015511116A/ja
Application filed by Biomerieux SA filed Critical Biomerieux SA
Publication of WO2013093106A1 publication Critical patent/WO2013093106A1/en
Priority to IL23314814A priority patent/IL233148B/en
Priority to ZA2014/04536A priority patent/ZA201404536B/en
Anticipated expiration legal-status Critical
Priority to AU2018256562A priority patent/AU2018256562B2/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/689Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/16Primer sets for multiplex assays

Definitions

  • the present invention relates to molecular detection of methicillin-resistant Staphylococcus aureus (MRSA). More particularly, the present invention relates to an improved detection of MRSA that includes additional strains bearing a variant of the mecA gene.
  • MRSA methicillin-resistant Staphylococcus aureus
  • MRSA methicillin-resistant Staphylococcus aureus
  • SCCmec Staphylococcal Cassette Chromosome mec
  • the mecA gene encodes for a modified Penicillin Binding Protein called PBP2a or PBP2'. Contrary to the native PBP, this PBP2a has a low affinity for the ⁇ -lactam antibiotics that permits to continue the synthesis of cell wall even in presence of ⁇ -lactam antibiotics.
  • SCCmec element can be incorporated into the chromosome of 5. aureus and other coagulase negative Staphylococci, mainly S. epidermidis and S. haemolyticus. SCCmec is characterized by the presence of terminal inverted and direct repeats, a set of site-specific recombinase genes [ccrA and ccrB], and the mecA gene complex (Ito et al., 1999, Antimicrob. Agents Chemother. 43:1449-1458; Katayama et al., 2000, Antimicrob. Agents Chemother. 44:1549-1555).
  • the site of insertion of this mecA gene cassette SCCmec into the Staphylococcus aureus genome is known and the sequence conserved (Ito et al., 2001, Antimicrob. Agents Chemother. 45:1323-1336).
  • the SCCmec After insertion into the S. aureus chromosome, the SCCmec has a left extremity junction and a right extremity junction (see FIG. 1), with a surrounding left extremity junction region and right extremity junction region, respectively, that includes the SCCmec cassette and chromsosomal DNA where the SCCmec sequence is contiguous with the S. aureus chromosomal sequence.
  • the nucleotide sequence of the regions surrounding the left and right boundaries of SCCmec DNA i.e.
  • AttBscc the bacterial chromosome attachment site for SCCmec DNA
  • ORF ⁇ , orfX. orfX encodes a polypeptide of 159 amino acids annotated recently as a 23S rRNA methyltransferase (http://www.uniprot.org/uniprot/Q6I7F2 ⁇ .
  • Organization of the mecA region of SCCmec has additionally been studied (Oliveira, D.C., et al., 2000, Antimicrob. Agents Chemother. 44(7 ⁇ :1906-1910 ⁇ .
  • a nasal swab is taken from the patient and cultured repeatedly, to determine if an MRSA strain is present.
  • Newer methods are being developed that allow identification of MRSA directly from a nasal swab and in a much shorter amount time.
  • Samples are also evolving, and many papers show the interest to sample several anatomical sites of the same patient to increase the possibility to detect MRSA carriers. The sites could be nasal plus throat, axilla, groin and or perineum.
  • Amplification is a well known art, and various methods have been developed, including transcription-based amplification such as transcription-mediated amplification (TMA; U.S. Pat. Nos. 5,766,849 5,399,491; 5,480,784; 5,766,849; and 5,654,142 ⁇ and nucleic acid sequence-based amplification (NASBA; 5,130,238; 5,409,818; 5,654,142; and 6,312,928 ⁇ , and cycling nucleic acid amplification technologies (thermocycling ⁇ such as polymerase chain reaction (PCR; U.S. Pat. Nos. 4,683,195; 4,965,188; 4,683,202 ⁇ and ligase chain reaction (LCR; U.S. Pat. No. 5,792,607 ⁇ .
  • Known amplification methods also include strand displacement amplification (SDA ⁇ , self-sustained sequence replication (3SR ⁇ , Q- ⁇ replicase, and cascade rolling circle amplification (CRCA ⁇ .
  • Detection methods utilizing nucleic acids are also well known in the art. Nucleic acids are often labeled for various detection purposes. For example, methods described in U.S. Patent Nos 4,486,539 (Kourlisky ⁇ ; 4,411,955 (Ward ⁇ ; 4,882,269 (Schneider ⁇ and 4,213,893 (Carrico ⁇ , illustrate preparation of labeled detection probes for detecting specific nucleic acid sequences. Probe designs for different detection methods, such as target-capture, HPA, TaqMan, molecular beacons and sandwich hybridization have also been described (e.g., U.S. Pat. No. 4,486,539, and U.S. Pat. No.
  • the SCCmec right extremity junction concept is based on the amplification of a region covering the right extremity junction region of the SCCmec integration site.
  • the principle is the following: the SCCmec cassette always integrates the S.aureus chromosome upstream of a S.aureus specific open reading frame called orfi ⁇ ; the amplification (e.g., PCR] assay combines multiple forward primers located on the right part of the cassette ("right extremity junction region" of SCCmec cassette], one reverse primer and a probe, both located in the S.aureus chromosomal orfX, i.e., downstream of the right extremity junction of SCCmec with orfX ("right extremity junction region" of orfK).
  • Hiramatsu et al. describe a test with two forward primers in the right extremity junction region of the cassette to amplify the main SCCmec types described at that time (one primer for SCCmec types I and II and a second primer for type III ⁇ .
  • Huletsky et al set forth that several MRSA strains were not detected if only the two forward primers described by Hiramatsu were used, and they determined new types of cassettes named as MREJ types having sequence variations in the right part of the SCCmec cassette.
  • a commercially available (Infectio Diagnostics Inc.] test combines five forward primers located in the right part of the cassette (one primer was designed for the detection of MREJ types i and ii and the four others for the MREJ types iii, iv, v and vii], one reverse primer located in the orfX, and three generic probes covering the same portion of the orfX region and required to identify the orfX variants identified.
  • This test is performed in real-time PCR. However, the specificity of this test as reported (Huletsky et al. 2004 ⁇ shows that 4.6 % of MSSA (26 out of 569 tested] were misidentified.
  • US20090203013 addressed primary sources of MRSA false positives and provided an improved test to detect MRSA that had not been previously addressed by then- available tests.
  • This application provided that the identification of false positives by the previous molecular methods can be explained in some instances by the presence in MSSA strains of a residual SCCmec right extremity fragment following the deletion of a chromosomal region containing mecA or the presence of an SCCmec which does not contain mecA.
  • SCCmec element having a highly divergent blaZ-mecA-mecRI-mecI, and indicated that the mec element present in the SCCmec element had 70% sequence identity to S.aureus mecA homologues; further, the SCCmec element was almost identical to SCCmec type XI previously identified (sequence type 425 bovine MRSA strain LGA251 listed on the website of the International Working Group on the Classification of Staphylococcal Cassette Chromosome Elements ⁇ .
  • the SCCmec element is integrated at the same nucleotide position within orf as all other SCCmec elements.
  • the strain additionally included a class E mec complex a type 8 cassette chromosome recombinase [ccf] complex consisting of ccrAl-ccrB3, an arsenic resistance operon and flanking direct repeats. Present detection methods would not identify this strain as MRSA.
  • the present invention provides a method of amplifying in a sample a methicillin- resistant Staphylococcus aureus (MRSA] which comprises an insertion of an SCCmec cassette within Staphylococcus aureus chromosomal DNA, wherein the SCCmec cassette comprises a mecA variant element, the method comprising:
  • an oligonucleotide set comprising: a. a first oligonucleotide having a nucleic acid sequence capable of specifically hybridizing to a region of chromosomal Staphylococcus aureus DNA in an extremity junction region, and b. a second oligonucleotide having a nucleic acid sequence capable of specifically hybridizing to a region of a mecA variant,
  • each of the first oligonucleotide and the second oligonucleotide is oriented such that, under amplification conditions, if the sample contains the MRSA, the region of the MRSA between the hybridizing region of the first oligonucleotide and the hybridizing region of the second oligonucleotide is amplified.
  • the present invention additionally provides a method of amplifying in a sample a methicillin-resistant Staphylococcus aureus (MRSA] which comprises an insertion of an SCCmec cassette within Staphylococcus aureus chromosomal DNA, wherein the SCCmec cassette comprises mecA or a mecA variant element, the method comprising:
  • a first oligonucleotide set comprising:
  • a second oligonucleotide set comprising:
  • each of the first oligonucleotide and the second oligonucleotide is oriented such that, under amplification conditions, if the sample contains the MRSA, the region of the MRSA between the hybridizing region of the first oligonucleotide and the hybridizing region of the second oligonucleotide is amplified.
  • the present invention further provides a kit for amplifying a methicillin-resistant Staphylococcus aureus (MRSA] which comprises an insertion of an SCCmec cassette within Staphylococcus aureus chromosomal DNA, wherein the SCCmec cassette comprises a mecA variant element, the kit comprising a first oligonucleotide set comprising:
  • the present invention provides a kit for amplifying in a sample a methicillin-resistant Staphylococcus aureus (MRSA] which comprises an insertion of an SCCmec cassette within Staphylococcus aureus chromosomal DNA, wherein the SCCmec cassette comprises mecA or a mecA variant element, the kit comprising:
  • a] a first oligonucleotide set comprising:
  • first mecA variant oligonucleotide having a nucleic acid sequence capable of specifically hybridizing to a first region of a mecA variant element and 2 ⁇ a second mecA variant oligonucleotide having a nucleic acid sequence capable of specifically hybridizing to a second region of a mecA variant element;
  • a second oligonucleotide set comprising:
  • Figure 1 shows generally the region of MRSA chromosome with the inserted
  • Figure 2 demonstrates generally the region of MRSA chromosome with an inserted SCCmec cassette bearing a mecA variant ( mecAiGMSi).
  • the present invention provides the identification of strains of methicillin-resistant S. aureus which include a variant meeA gene (typically not detected with presently commercially-available MRSA detection kits] and which are structurally arranged such that a single amplification reaction can amplify both a relevant portion of meeA and an extremity junction at the insertion point of a SCCmec cassette into the S. aureus chromosome.
  • the present invention addresses a newly-discovered source of false negative results and provides an improved test.
  • the strains identified by the present invention are methicillin-resistant, but they do not harbour the classical meeA gene known to be well-conserved so far. Methicillin resistance is conferred in this case by a new meek variant gene.
  • meeA variant is referred to in publications variously as mecAuw/oo i, meeA homologue, and mecAnew variant (this variant has more recently been proposed to be renamed "mecC" [Ito, T. et al., Guidelines for Reporting Novel meeA Gene Homologues, Agents Chemother. doi:10.1128/AAC.01199-12] ⁇ ; however, other meeA variants may be detected with the present invention.
  • meeA variant will be used to refer to any meeA variant gene that confers methicillin resistance and can be detected by a claimed method, in particular, in an amplification reaction that, with a single primer set, amplifies a region that includes both a relevant portion of a meeA variant (i.e., sufficient to identify it as a meeA variant] and an extremity junction at the insertion point of a SCCmec cassette into the S. aureus chromosome.
  • primer sets for detection of a mecA variant gene may be designed to hybridize farther from this target region comprising a relevant portion of a mecA variant gene and an extremity junction of SCCmec cassette.
  • the size of the SCCmec cassettes in previously studied MRSA strains is divergent, but generally the mecA gene has been found to be about 8000 to 15,000 bp from the S. aureus chromosome in the direction of orfX (sometimes herein referred to as "downstream" ⁇ and longer in the other direction [see Fig.l and Fig. 2a ⁇ .
  • the mecA variant gene has been found to be positioned closer to orfX, with the distance only about 1500 bp [see Fig. 2b ⁇ .
  • the present invention advantageously amplifies the region between the mecA variant gene and an S.aureus chromosomal extremity junction region (i.e., across an extremity junction ⁇ directly using a primer in the mecA variant gene and another in the S. aureus chromosome region in an extremity junction region [see FIG 2, e.g., across the right extremity junction ⁇ . While still an unconventionally long amplicon, applicants have found that this design works surprisingly well. Additionally, this new invention resolves the problem of poor specificity because only one amplification is needed and this amplification confirms in the same reaction the presence both of S. aureus strain and of variant methicillin-resistance gene.
  • the present invention provides a method of amplifying in a sample a methicillin- resistant Staphylococcus aureus (MRSA ⁇ which comprises an insertion of an SCCmec cassette within Staphylococcus aureus chromosomal DNA, wherein the SCCmec cassette comprises a mecA variant element, the method comprising:
  • an oligonucleotide set comprising: a. a first oligonucleotide having a nucleic acid sequence capable of specifically hybridizing to a region of chromosomal Staphylococcus aureus DNA in an extremity junction region , and b. a second oligonucleotide having a nucleic acid sequence capable of specifically hybridizing to a region of a mecA variant,
  • each of the first oligonucleotide and the second oligonucleotide is oriented such that, under amplification conditions, if the sample contains the MRSA, the region of the MRSA between the hybridizing region of the first oligonucleotide and the hybridizing region of the second oligonucleotide is amplified.
  • the region of chromosomal S. aureus DNA can be in a right extremity junction region.
  • Oligonucleotides of the present invention that specifically hybridize with a target can be selected as those which selectively hybridize, at the selected hybridization conditions, with their target, i.e., which bind with their intended target(s ⁇ but not with non- targets.
  • Hybridization/ amplification conditions can be selected for appropriate stringency to achieve selectivity, as is known in the art (e.g., Sambrook and Russell, Molecular Cloning: A Laboratory Manual (Cold Spring Harbor Laboratory Press; 3rd edition (2001 ⁇ . Minor modifications can be made to select oligonucleotides as long as the reaction conditions allow the modified oligonucleotide to specifically hybridize to the target(s ⁇ .
  • a first oligonucleotide having a nucleic acid sequence capable of specifically hybridizing to a region of chromosomal Staphylococcus aureus DNA in an extremity junction region and a second oligonucleotide having a nucleic acid sequence capable of specifically hybridizing to a region of a mecA variant each can function as a primer, and each is oriented such that, upon hybridization to its specific target nucleic acid, and upon initiation of an amplification reaction including the primer, an amplicon is formed that includes the region of the MRSA between the hybridizing region of the first oligonucleotide and the hybridizing region of the second oligonucleotide.
  • Such a reaction is designed to amplify across an extremity junction of SCCmec at its insertion into the S. aureus chromosome [i.e., to be in sufficiently close proximity of the junction so that an amplification reaction can extend across the junction ⁇ .
  • a primer pair for mecA variant useful for amplifying a junction will typically hybridize to two regions, one in the mecA variant and one in an S. aureus chromosomal region, in effect surrounding the junction, and each primer will be oriented to hybridize such as to be capable of directing amplification in a 5'-3' direction toward the junction.
  • the primer for mecA variant would be designed to hybridize within 1600nt, 1550nt, 1500 nt, 1450 nt, 1400 nt, 1350 nt, 1300 nt, 1200 nt, 1100 nt, 1000 nt, 900 nt, 800 nt, 700 nt, 600nt, 500nt, 400nt, 350nt, 300nt, 250nt, 200nt 150nt, lOOnt, 50nt, 30nt, 25nt, 20nt, etc. of the junction; however, as new technologies allow longer amplicons, primers can be designed that hybridize farther distances from the junction.
  • the primer having a nucleic acid sequence capable of specifically hybridizing to a region of a mecA variant will typically be designed to hybridize farther from the junction than the primer having a nucleic acid sequence capable of specifically hybridizing to a region of chromosomal Staphylococcus aureus DNA in an extremity junction region because of the organization of the SCCmec having a mecA variant gene and the distance of the mecA variant gene from the junction.
  • the oligonucleotide set for amplification of orfX-mecA variant can further comprise a third oligonucleotide capable of specifically hybridizing within a region of the MRSA between the hybridizing region of the first oligonucleotide and the hybridizing region of the second oligonucleotide, and, wherein if the sample contains the MRSA, hybridization of the third oligonucleotide is detected.
  • Such an oligonucleotide can function as a probe for detecting an amplification product and is therefore selected to be capable of specifically hybridizing to a region between the hybridizing region of the first oligonucleotide and the hybridizing region of the second oligonucleotide.
  • such a probe can specifically hybridize to a region of chromosomal Staphylococcus aureus DNA, such as a region of orfX.
  • a probe can specifically hybridize to a region of a right extremity junction region of SCCmec cassette DNA (e.g., within blaZ sequences], and in a further embodiment, a probe can specifically hybridize to a region of the mecA variant.
  • Amplification can be detected by any means selected.
  • this third oligonucleotide can be labeled by any of several means and with any of several methods.
  • the third oligonucleotide which can be a labeled probe, can hybridize to the amplicon.
  • Hybridization of the third oligonucleotide can be detected by any known means.
  • an intercalating dye can be used to detect amplification from the two primers. If a probe is used, the probe can be designed to specifically hybridize to a region of a right extremity junction region of SCCmec cassette DNA.
  • the probe can be designed to specifically hybridize to a region of chromosomal Staphylococcus aureus DNA such as a region of orf oi chromosomal Staphylococcus aureus DNA.
  • a probe can be designed to specifically hybridize to a region of the mecA variant.
  • the presence or absence of any target within the present invention can be determined by performing whatever analysis provides detection of the product, e.g., if a labeled probe is used, detection of the hybridized label by the appropriate detection device.
  • lack of a detectable signal indicates the absence of the target; perception of a detectable signal indicates presence of the target.
  • Examples of a first oligonucleotide, or primer, capable of specifically hybridizing to a region of chromosomal Staphylococcus aureus DNA in an extremity junction region can include, but are not limited to, an oligonucleotide that specifically hybridizes in the orfX region.
  • examples of such an oligonucleotide include SEQ ID NOs: 9 and 10.
  • Examples of a second oligonucleotide having a nucleic acid sequence capable of specifically hybridizing to a region of a mecA variant can include, but are not limited to, a nucleic acid sequence selected from the group consisting of: SEQ ID NOs: 6, 7, 16, 17 and 21.
  • a third oligonucleotide which can be used as a probe, capable of specifically hybridizing within a region of the MRSA between the hybridizing region of the first oligonucleotide (hybridizing within in chromosomal Staphylococcus aureus DNA] and the hybridizing region of the second oligonucleotide (hybridizing within a region of a mecA variant ⁇ can include, but is not limited to, a nucleic acid sequence set forth as SEQ ID NO: 8, 18 and 19.
  • the genomic structure of MRSA has been characterized previously.
  • the "SCCmec cassette" (sometimes referred to as "mecDNA,” e.g., in Hiramatsu U.S. Pat. No. 6,156,507 ⁇ has the definition as known in the art, i.e., an integrated adventitious DNA existing on a chromosome of MRSA or MR-CNS and including the mec gene complex, a set of site-specific recombinase genes [ccrA and ccrB), and terminal inverted and direct repeats (at both 3' and 5' ends ⁇ ; as used in the specification, this term includes any variation of SCCmec found in strains harboring a mecA variant.
  • "mecA gene” includes all sequences necessary to confer methicillin resistance (i.e., to encode PBP2a or PBP2' (Penicillin Binding Protein ⁇ .
  • aureus chromosomal nucleic acid within distance of either the right or the left extremity junction, or insertion site, such that a primer that hybridizes in either SCCmec (e.g.., J3 region] or orfX can, in a primer extension reaction or a transcription-type (e.g., NASBA or TMA] reaction, be extended across that junction, e.g., within 600nt, 550nt, 500nt, 450nt, 400nt, 350nt, 300nt, 250nt, 200nt, 150nt, lOOnt, or 50nt (in either direction] of the junction. Useful distances may vary depending upon the amplification technology used.
  • Extremity junction region can refer to a region within the SCCmec DNA or a region within the S. aureus chromosomal DNA; both uses refer to such DNA within distance of the junction such that an appropriately selected primer that hybridizes in either SCCmec (e.g.., J3 region] or orfX could, under appropriate, standard extension or amplification conditions, be extended, or transcribed, from it, in the direction of the junction, across the junction. That is, "an extremity junction region of the SCCmec cassette” would be a region within the SCCmec DNA near its abutment, or integration site, with the S.
  • aureus chromosomal DNA and "an extremity junction region of orp ' would be a region within the orfX DNA near an abutment with SCCmec DNA (an SCCmec integration site].
  • an extremity junction region of chromosomal S. aureus DNA would be a region within the chromosomal S. aureus DNA near an abutment with SCCmec DNA. Alternatively, this region may also be referred to as chromosomal S. aureus DNA in the region of the SCCmec extremity junction.
  • right extremity junction region refers to the region surrounding the junction on the right (or downstream] side of the SCCmec cassette
  • left extremity junction region refers to the region surrounding the junction on the left (or upstream] side of the SCCmec cassette (see Figure 1].
  • an amplification and detection reaction can be performed, e.g., in separate containers or in a single container as a multiplex reaction.
  • an assay can include a reaction to detect, e.g., a junction region of a standard (i.e., as described for SCCmec types I-X] SCCmec cassette insertion, a standard (i.e., as described for SCCmec types I-X] mecA gene, and/or an S. aureus- specific chromosomal region.
  • a reaction to detect e.g., a junction region of a standard (i.e., as described for SCCmec types I-X] SCCmec cassette insertion, a standard (i.e., as described for SCCmec types I-X] mecA gene, and/or an S. aureus- specific chromosomal region.
  • amplifying a portion of mecA DNA is meant performing an amplification reaction on a sample that produces an amplification product that includes sequences corresponding to any portion of a mecA gene, for example, the region between primers comprising a nucleic acid sequence set forth in SEQ ID NOs: 12 and 13.
  • a primer can comprise a nucleic acid sequence as set forth in SEQ ID NOs: 12 and 13.
  • Primers comprising these sequences and primers consisting essentially of these sequences can be utilized as well as primers consisting of these sequences.
  • Amplification can be detected, for example, utilizing a probe comprising a nucleic acid sequence between the target nucleic acids of the primers, or using an intercalating dye. Primers and probes can be readily designed for hybridization to the known mecA sequence.
  • the present inventive method in addition to amplifying the mecA variant, if present, can further comprise amplifying a methicillin-resistant Staphylococcus aureus (MRSA] which comprises an insertion of an SCCmec cassette within Staphylococcus aureus chromosomal DNA, wherein the SCCmec cassette comprises a mecA, by utilizing in an amplification reaction a second oligonucleotide set for amplification of a right extremity junction of SCCmec cassette with Staphylococcus aureus chromosomal DNA, the second oligonucleotide set comprising:
  • a second junction oligonucleotide having a nucleic acid sequence capable of specifically hybridizing within a region of a right extremity junction region of the SCCmec cassette of the MRSA comprising a mecA, wherein each of the first junction oligonucleotide and the second junction oligonucleotide is oriented such that, under amplification conditions, if the sample contains the MRSA comprising a mecA, the right junction is amplified.
  • the second oligonucleotide set can further comprise a third junction oligonucleotide having a nucleic acid sequence capable of specifically hybridizing within a region of the MRSA between the hybridizing region of the first junction oligonucleotide and the hybridizing region of the second junction oligonucleotide, wherein if the sample contains the MRSA comprising the right extremity junction, hybridization of the third junction oligonucleotide is detected.
  • the third junction oligonucleotide can be a probe.
  • the third junction oligonucleotide can have a nucleic acid sequence capable of specifically hybridizing within a region of a right extremity junction region of the SCCmec cassette, or it can have a nucleic acid sequence capable of specifically hybridizing within orfX. Alternatively, a method of detection such as use of an intercalating dye can be performed.
  • the first junction oligonucleotide, which can function as an amplification primer, can have a nucleic acid sequence capable of specifically hybridizing within orfX.
  • Primers and probes used in any reaction of this invention are capable of specifically hybridizing with a target nucleic acid.
  • Specific hybridization is known in the art, and, typically, specific hybridization is achieved through nucleic acid identity or high similarity of the primer/probe with the target nucleic acid and/or through use of stringent hybridization conditions (e.g., stringent temperature and/or salt conditions ⁇ .
  • stringent hybridization conditions e.g., stringent temperature and/or salt conditions ⁇ .
  • Specific hybridization provides selective hybridization to the target within the reaction.
  • the primer is selected such that amplification product synthesized utilizing it and a second primer (located in an S. aureus genomic sequence] will be of approximately 100 to 350nt in length.
  • PCR amplification can be designed to generate longer or shorter amplicons (e.g., 50, 100, 150, 200, 250, 300, 350, 400, 500, 600, 700, 800, 900, lOOOnt or longer], preferred amplicon lengths for either transcription-based (e.g., NASBA or TMA] or PCR-type reactions for detection of mecA, junction or chromosomal S. aureus genes in the present invention will be within about 100 to 300nt (e.g. 150, 200, 250, 300nt] in length. Additionally, for a multiplex amplification reaction, whether transcription-based or PCR-based, an amplicon in the range of 100 to 300nt or shorter is preferable for these targets, to enhance sensitivity of the test.
  • transcription-based e.g., NASBA or TMA
  • PCR-type reactions for detection of mecA, junction or chromosomal S. aureus genes in the present invention will be within about 100 to 300nt (e.g. 150,
  • the amplification utilizing a first oligonucleotide having a nucleic acid sequence capable of specifically hybridizing to a region of chromosomal Staphylococcus aureus DNA in an extremity junction region and a second oligonucleotide having a nucleic acid sequence capable of specifically hybridizing to a region of a mecA variant will have a longer amplicon than that typically used in other amplifications that can form part of the present assay. It is also noted that, as amplification methods are further developed and refined, longer amplicons may become possible and eventually routine and are encompassed by the present invention.
  • a primer oriented such that, "under amplification conditions, the junction is amplified” includes a primer oriented such that, upon hybridization to its specific target nucleic acid, and upon initiation of an amplification reaction including the primer, an amplicon is formed that includes the junction.
  • Such a reaction is designed to amplify across the junction (i.e., to be in sufficiently close proximity of the junction so that a typical amplification reaction would extend across the junction ⁇ .
  • a primer pair useful for amplifying a junction will typically hybridize to two regions that surround the junction and each primer will be oriented to hybridize in a 5'-3' direction toward the junction.
  • the primer would be designed to hybridize within 600nt, 500nt, 400nt, 350nt, 300nt, 250nt, 200nt 150nt, lOOnt, 50nt, 30nt, 25nt, 20nt, etc. of the junction.
  • a probe for detecting an amplification product is therefore selected to be capable of specifically hybridizing within a region of a right extremity junction region of the SCCmec cassette between the target sequences of the primers.
  • the probe can hybridize within S. aureus genomic sequences (e.g., orfX, between the target sequence of the S.aureus probe and the junction] or within SCCmec (between the target sequence of the SCCmec primer and the junction] or across the junction.
  • such a probe can specifically hybridize fully within or primarily within SCCmec cassette.
  • the region to which the probe hybridizes can additionally include the junction and, therefore, at least one, or two or three or a few nucleotides of orfX that abut the junction.
  • the primer is selected such that amplification product synthesized utilizing it and a second primer (located in an S. aureus genomic sequence] will be of approximately 100 to 350nt in length.
  • PCR amplification can be designed to generate longer amplicons (e.g., 150, 200, 250, 300, 350, 400, 500, 600, 700, 800, 900, lOOOnt or longer], preferred amplicon lengths for either transcription-based (e.g., NASBA or TMA] or PCR-type reactions for detection of mecA, junction or chromosomal S. aureus genes in the present invention will be within about 100 to 300nt (e.g. 150, 200, 250, 300nt] in length. Additionally, for a multiplex amplification reaction, whether transcription-based or PCR-based, an amplicon in the range of 100 to 300nt or shorter is preferable for these targets, to enhance sensitivity of the test. Specific primers useful for amplifying extremity junction regions can readily be designed, given the teachings herein and knowledge and skill in the art.
  • amplification conditions are those appropriate for a selected amplification reaction, as are known to those of skill in the art, such as are utilized in various amplification reactions. Such conditions can be optimized for a specific reaction, primers, etc. as also known by the skilled artisan. As is known, such amplification conditions include contact with the required reagents for the amplification, e.g., nucleotides and enzymes, as well as the appropriate selected temperature, salt and pH conditions, among other aspects. Furthermore, as used in the claims, a primer or probe may be a primer or probe set, i.e., multiple primers or probes.
  • Such primer/probe sets can be utilized in a reaction in which more than one type or subtype of MRSA is desired to be amplified and/or detected, and wherein the nucleic acid sequence of the target MRSA region selected for hybridization of the primer and/or probe varies among types and/or subtypes.
  • Individual primers/probes can be designed for each type or subtype, as exemplified herein.
  • the present method can additionally comprise amplifying a
  • Staphylococcus aureus comprising mecA by utilizing in an amplification reaction a third oligonucleotide set for amplification of a mecA element comprising:
  • a a first mecA oligonucleotide having a nucleic acid sequence capable of specifically hybridizing within a region of mecA;
  • the third oligonucleotide set can further comprise a third mecA oligonucleotide having a nucleic acid sequence capable of specifically hybridizing within a region of the mecA between the hybridizing region of the first mecA oligonucleotide and the hybridizing region of the second mecA oligonucleotide
  • a method of detection such as use of an intercalating dye can be used.
  • primers for mecA can include SEQ ID NOs: 12 and 13.
  • amplifying a portion of mecA DNA is meant performing an amplification reaction on a sample that produces an amplification product that includes sequences corresponding to any identifying portion of a mecA gene, for example, the region between primers comprising a nucleic acid sequence set forth in SEQ ID NO: 12 and 13.
  • Amplification can be detected using a probe that hybridizes between the target nucleic acids of the primers or using an intercalating dye. Primers and probes can be readily designed for hybridization to the known mecA sequence.
  • S. aureus chromosome The present method can further comprise utilizing a fourth oligonucleotide set for amplification of a Staphylococcus aureus- specific chromosomal DNA comprising:
  • the fourth oligonucleotide set can further comprise a third S. aureus oligonucleotide having a nucleic acid sequence capable of specifically hybridizing within a region of the S. aureus DNA between the hybridizing region of the first S. aureus oligonucleotide and the hybridizing region of the second S. aureus oligonucleotide, wherein if the sample contains the region of the S. aureus DNA between the hybridizing region of the first S. aureus oligonucleotide and the hybridizing region of the second S. aureus oligonucleotide, hybridization of the third oligonucleotide is detected.
  • a third S. aureus oligonucleotide having a nucleic acid sequence capable of specifically hybridizing within a region of the S. aureus DNA between the hybridizing region of the first S. aureus oligonucleotide and the hybridizing region of the second S. aureus oligon
  • the Staphylococcus aureus -specific chromosomal DNA can be any known S.aureus- specific genomic region, such as within the genes spa, orfX or nuc.
  • primers for spa can include SEQ ID NOs: 24 and 25, and probe, SEQ ID NO: 26.
  • primers for orfX can include SEQ ID NOs: 9 and 10, and probe, SEQ ID NO: 11.
  • primers for nuc can include SEQ ID NOs: 27, 28 and 30, and probe, SEQ ID NO: 29.
  • a method of detection such as use of an intercalating dye can be performed.
  • the present invention comprises a method of amplifying in a sample a methicillin-resistant Staphylococcus aureus (MRSA] which comprises an insertion of an SCCmec cassette within Staphylococcus aureus chromosomal DNA, wherein the SCCmec cassette comprises mecA or a mecA variant element, the method comprising performing on the sample an amplification reaction utilizing MRSA.
  • MRSA methicillin-resistant Staphylococcus aureus
  • a. a first oligonucleotide set comprising:
  • a second oligonucleotide set comprising:
  • a second mecA oligonucleotide having a nucleic acid sequence capable of specifically hybridizing to a second region of mecA, wherein each of the first oligonucleotide and the second oligonucleotide is oriented such that, under amplification conditions, if the sample contains the MRSA, the region of the MRSA between the hybridizing region of the first oligonucleotide and the hybridizing region of the second oligonucleotide is amplified.
  • the first oligonucleotide set can further comprise a third mecA variant oligonucleotide capable of specifically hybridizing within a region of the MRSA between the hybridizing region of the first mecA variant oligonucleotide and the hybridizing region of the second mecA variant oligonucleotide, and wherein if the sample contains the MRSA comprising a mecA variant element, hybridization of the third mecA variant oligonucleotide is detected.
  • the second oligonucleotide set can further comprise a third mecA oligonucleotide capable of specifically hybridizing within a region of the MRSA between the hybridizing region of the first mecA oligonucleotide and the hybridizing region of the second mecA oligonucleotide, and wherein if the sample contains the MRSA comprising mecA, hybridization of the third mecA oligonucleotide is detected.
  • Such third oligonucleotide can be a probe.
  • a method of detection such as use of an intercalating dye can be performed.
  • the first mecA variant oligonucleotide can comprise a nucleic acid sequence selected from the group consisting of: SEQ ID NOs: 6, 7, 14, 15 and 20.
  • the second mecA variant oligonucleotide can comprise a nucleic acid sequence selected from the group consisting of: SEQ ID Nos: 16, 17 and 21.
  • the third mecA variant oligonucleotide can comprise a nucleic acid sequence selected from the group consisting of: SEQ ID Nos: 8, 18 and 19.
  • the mecA variant can be or it can be another mecA variant.
  • Staphylococcus aureus which comprises an insertion of an SCCmec cassette within Staphylococcus aureus chromosomal DNA, wherein the SCCmec cassette comprises mecA or a mecA variant element, can further comprise amplification of additional MRSA and/or S. aureus elements.
  • the method can comprise amplifying a methicillin-resistant Staphylococcus aureus (MRSA] which comprises an insertion of an SCCmec cassette within Staphylococcus aureus chromosomal DNA, wherein the SCCmec cassette comprises a mecA, by utilizing in an amplification reaction a second oligonucleotide set for amplification of a right extremity junction of SCCmec cassette with Staphylococcus aureus chromosomal DNA, the second oligonucleotide set comprising:
  • a second junction oligonucleotide having a nucleic acid sequence capable of specifically hybridizing within a region of a right extremity junction region of the SCCmec cassette of the MRSA comprising a mecA,
  • each of the first junction oligonucleotide and the second junction oligonucleotide is oriented such that, under amplification conditions, if the sample contains the MRSA comprising a mecA, the right junction is amplified.
  • the third oligonucleotide set can further comprise a third junction oligonucleotide having a nucleic acid sequence capable of specifically hybridizing within a region of the MRSA between the hybridizing region of the first junction oligonucleotide and the hybridizing region of the second junction oligonucleotide, wherein if the sample contains the MRSA comprising the right extremity junction, hybridization of the third junction oligonucleotide is detected.
  • the third junction oligonucleotide can have a nucleic acid sequence capable of specifically hybridizing within a region of a right extremity junction region of the SCCmec cassette.
  • the first junction oligonucleotide can have a nucleic acid sequence capable of specifically hybridizing within orfX.
  • the third junction oligonucleotide can have a nucleic acid sequence capable of specifically hybridizing within orfX.
  • a method of detection such as use of an intercalating dye can be performed.
  • Staphylococcus aureus which comprises an insertion of an SCCmec cassette within Staphylococcus aureus chromosomal DNA, wherein the SCCmec cassette comprises mecA or a mecA variant element, can further comprise utilizing a fourth oligonucleotide set for amplification of a Staphylococcus aureus- specific chromosomal DNA comprising:
  • the fourth oligonucleotide set can further comprise a third S. aureus oligonucleotide having a nucleic acid sequence capable of specifically hybridizing within a region of the S. aureus DNA between the hybridizing region of the first S. aureus oligonucleotide and the hybridizing region of the second S. aureus oligonucleotide,
  • the sample contains the region of the S. aureus DNA between the hybridizing region of the first S. aureus oligonucleotide and the hybridizing region of the second S. aureus oligonucleotide, hybridization of the third oligonucleotide is detected.
  • Such third S. aureus oligonucleotide can function as a probe.
  • a method of detection such as use of an intercalating dye can be performed.
  • the Staphylococcus aureus -specific chromosomal DNA can be selected from, for example, spa, orfX and nuc; however, other S. aureus-specific chromosomal DNA targets, as may be known to those of skill in the art, may be used.
  • the invention includes that one can additionally amplify one or more additional relevant sequences, such as the SCCmec junction for SCCmec types other than those bearing mecA variant, mecA (non-variant], and an S. aureus- specific chromosomal sequence.
  • additional relevant sequences such as the SCCmec junction for SCCmec types other than those bearing mecA variant, mecA (non-variant], and an S. aureus- specific chromosomal sequence.
  • One can combine any or all of these additional amplification reactions, in a multiplex reaction or in individual reactions.
  • a multiplex amplification reaction means that the specific reagents for amplification of more than one target are contacted together, such that more than one amplification can occur within the same reaction container. Additionally, detection reagents for more than one target can be included. Thus one can conduct a multiplex amplification and detection reaction by placing into contact all of the specific reagents for amplification and detection of more than one target. Thus, in a multiplex reaction, one can amplify multiple target regions in the same reaction. Multiple amplification reactions can also be run sequentially.
  • Simultaneous amplification can also be utilized, if a multiplex is not desired or feasible, wherein individual reactions are allowed to proceed at the same time, but the reagents for more than one amplification reaction are not necessarily all within the same reaction container or tube, but rather are carried out in separate reaction containers. It is understood that, even in a multiplex amplification reaction, each reaction will occur at whatever pace the individual reactions proceed under the provided conditions. Detection can also be "simultaneous,” meaning that, if appropriate probes for each reaction in the reaction container are included, under the appropriate conditions, detection of more than one target can be achieved in either a single reaction container (multiplex] or in more than one reaction container (appropriate probes distributed to the relevant reaction container].
  • reaction mixture can include all the necessary reagents for performing a reaction, which may include, but not be limited to, buffering agents to maintain pH at a selected level during a reaction, salts, co-factors, scavengers, and the like.
  • amplification conditions are those appropriate for a selected amplification reaction, as are known to those of skill in the art, such as are utilized in various amplification reactions. Such conditions can be optimized for a specific reaction, primers, etc. as also known by the skilled artisan. As is known, such amplification conditions include contact with the required reagents for the amplification, e.g., nucleotides and enzymes, as well as the appropriate selected temperature, salt and pH conditions, among other aspects. Furthermore, as used in the claims, a primer or probe may be a primer or probe set, i.e., multiple primers or probes.
  • Such primer/probe sets can be utilized in a reaction in which more than one type or subtype of MRSA is desired to be amplified and/or detected, and wherein the nucleic acid sequence of the target MRSA region selected for hybridization of the primer and/or probe varies among types and/or subtypes.
  • Individual primers/probes can be designed for each type or subtype, as exemplified herein.
  • an oligonucleotide "having" a nucleic acid sequence included in a portion of target DNA means the sequence has sufficient identity to the target DNA sequence, or its complement, to specifically and selectively hybridize to that target DNA under stringent hybridization conditions. It includes nucleic acid sequences having full sequence identity to the sequence.
  • amplification reactions producing amplicons are "template-driven” in that base pairing of reagents, either nucleotides or oligonucleotides, have complements in a template polynucleotide that are required for the creation of reaction products.
  • template-driven reactions are primer extensions with a nucleic acid polymerase or oligonucleotide ligations with a nucleic acid ligase.
  • Amplification can include any known or newly designed method of amplification, including those used in published methods (e.g., transcription-based amplification such as transcription-mediated amplification (TMA] and nucleic acid sequence-based amplification NASBA (as exemplified herein], and cycling nucleic acid amplification technologies (thermocycling] such as polymerase chain reaction (PCR], reverse transcriptase PCR (RT-PCR], and ligase chain reaction (LCR], and any method of amplification, e.g., sustained sequence replication (3SR], strand displacement amplification (SDA], branched DNA (bDNA], cycling probe technology (CPT], solid phase amplification (SPA], rolling circle amplification technology (RCA], solid phase RCA, anchored SDA and nuclease dependent signal amplification (NDSA], all of which are known to the skilled artisan.
  • transcription-based amplification such as transcription-mediated amplification (TMA] and nucleic acid sequence-based amplification NASBA (as
  • An amplification reaction may be a "real-time" amplification if a detection chemistry is available that permits a reaction product to be measured as the amplification reaction progresses, e.g. real-time PCR or real-time NASBA.
  • this invention includes the use of any nucleic acid amplification method or any other procedure which may be used to increase the sensitivity and/or the rapidity of nucleic acid- based diagnostic tests.
  • the present invention also includes the use of any detection technology including post-amplification detection technologies, any amplification technology combined with detection, any hybridization nucleic acid chips or array technologies, and any amplification chips or combination of amplification and hybridization chip technologies. Detection and identification by any nucleotide sequencing method is also within the present invention.
  • Probes of the present kits and/or for use in the present methods can be labeled by any selected label suitable for the detection method chosen, many of which are known in the art, such as a phosphatase [e.g., alkaline phosphatase], biotin, avidin, a peroxidase [e.g., horseradish peroxidase], digoxigenin, a fluorescent dye (such as Cy3 and Cy5 dyes, fluorescein, FAM, ROX], a chemiluminescent label, a chromophoric label, a radioactive label [e.g., a radioisotope] and a ligand.
  • a phosphatase e.g., alkaline phosphatase
  • biotin avidin
  • a peroxidase e.g., horseradish peroxidase
  • digoxigenin e.g., digoxigenin
  • a fluorescent dye such as Cy3 and Cy5 dyes
  • Probe designs for different detection methods can be used, such as target-capture, HPA, TaqMan, molecular beacons, scorpions and sandwich hybridization.
  • Hybridization conditions can be selected in accordance with the type of probe and the type of detection reaction selected.
  • intercalating dyes can be utilized.
  • An intercalating dye is one that binds specifically to double-stranded DNA fluoresce brightly upon such binding; in the absence of double stranded DNA, with nothing to bind to they only fluoresce at a low level. Detection is monitored by measuring the increase in fluorescence throughout the amplification cycle.
  • An intercalating dye can, if desired, be used with melt analysis, as is known in the art.
  • intercalating dyes can include, but are not limited to, ethidium bromide, SYBR® Green, LC Green, LC Green Plus, ResoLight, EvaGreen, Chromofy and SYTO 9. Others will be known to those of skill in the art and new such dyes may become available.
  • the present method further provides useful kits for use in such amplification and detection methods.
  • the present invention provides a kit for amplifying a methicillin-resistant Staphylococcus aureus (MRSA] which comprises an insertion of an SCCmec cassette within Staphylococcus aureus chromosomal DNA, wherein the SCCmec cassette comprises a mecA variant element, the kit comprising a first oligonucleotide set comprising: a. a first oligonucleotide having a nucleic acid sequence capable of specifically hybridizing to a region of chromosomal Staphylococcus aureus DNA in an extremity junction region, and b.
  • MRSA methicillin-resistant Staphylococcus aureus
  • kit can further comprise a third oligonucleotide capable of specifically hybridizing within a region of the MRSA between the hybridizing region of the first oligonucleotide and the hybridizing region of the second oligonucleotide.
  • third oligonucotide can be a probe.
  • the first oligonucleotide comprises a nucleic acid sequence selected from the group consisting of: SEQ ID NOs: 9 and 10.
  • the second oligonucleotide comprises a nucleic acid sequence selected from the group consisting of: SEQ ID NOs: 6, 7, 14, 15, 16, 17, 20 and 21.
  • the third oligonucleotide comprises a nucleic acid sequence set forth as SEQ ID NO: 8. : 8, 18 and 19.
  • the mecA variant for which this kit is useful to detect can be mecAiGA25i or another mecA variant.
  • a kit of the present invention for amplifying a methicillin-resistant
  • Staphylococcus aureus which comprises an insertion of an SCCmec cassette within Staphylococcus aureus chromosomal DNA, wherein the SCCmec cassette comprises a mecA variant element, can further comprise one or more additional elements, including oligonucleotide sets for detection of additional MRSA and MSSA elements. Though sometimes described herein as “second,” “third” or “fourth” oligonucleotide sets, choice of an additional nucleotide set is independent of the other options.
  • the kit can include oligonucleotide sets for amplification of one or more of the SCCmec junction for SCCmec types other than those bearing mecA variant, mecA (non-variant], and a S. aureus chromosomal sequence.
  • a kit can comprise a second oligonucleotide set comprising: a. a first junction oligonucleotide having a nucleic acid sequence capable of specifically hybridizing within a region of chromosomal Staphylococcus aureus DNA in a right extremity junction region; and
  • kits can comprise a third oligonucleotide set for amplification of a mecA element comprising:
  • a a first mecA oligonucleotide having a nucleic acid sequence capable of specifically hybridizing within a region of mecA DNA
  • kits can comprise a fourth oligonucleotide set for amplification of a Staphylococcus aureus- specific chromosomal DNA comprising:
  • kits of the present invention provides a kit for amplifying in a sample a methicillin-resistant Staphylococcus aureus (MRSA] which comprises an insertion of an SCCmec cassette within Staphylococcus aureus chromosomal DNA, wherein the SCCmec cassette comprises mecA or a mecA variant element, wherein the SCCmec cassette comprises mecA or a mecA variant element.
  • MRSA methicillin-resistant Staphylococcus aureus
  • a] a first oligonucleotide set comprising:
  • a second oligonucleotide set comprising:
  • the kit can further comprise in the first oligonucleotide set a third mecA variant oligonucleotide capable of specifically hybridizing within a region of the MRSA between the hybridizing region of the first oligonucleotide and the hybridizing region of the second oligonucleotide.
  • the second oligonucleotide set can comprise in the second oligonucleotide set a third mecA oligonucleotide capable of specifically hybridizing within a region of the MRSA between the hybridizing region of the first oligonucleotide and the hybridizing region of the second oligonucleotide.
  • the first mecA variant oligonucleotide can comprise a nucleic acid sequence selected from the group consisting of: SEQ ID NOs: 9 and 10.
  • the second mecA variant oligonucleotide comprises a nucleic acid sequence selected from the group consisting of: SEQ ID NOs: 6, 7, 14, 15, 16, 17, 20 and 21.
  • the third mecA variant oligonucleotide comprises a nucleic acid sequence set forth as SEQ ID NO: 8. : 8, 18 and 19.
  • the mecA variant can preferably be mecA Qpasi; however, it can be another mecA variant.
  • a kit of this invention can further comprise a third oligonucleotide set comprising:
  • the third oligonucleotide set can further comprise a third junction oligonucleotide having a nucleic acid sequence capable of specifically hybridizing within a region of the MRSA between the hybridizing region of the first junction oligonucleotide and the hybridizing region of the second junction oligonucleotide.
  • a kit of this invention can further comprise a fourth oligonucleotide set comprising: a. a first S. aureus oligonucleotide having a nucleic acid sequence capable of specifically hybridizing within a region within Staphylococcus aureus -specific chromosomal DNA; and b. a second S. aureus oligonucleotide having a nucleic acid sequence capable of specifically hybridizing within a second region within Staphylococcus aureus -specific chromosomal DNA, wherein each of the first S. aureus oligonucleotide and the second S.
  • aureus oligonucleotide is oriented such that, under amplification conditions in the presence of an MRSA, a portion of S. aureus -specific DNA is amplified.
  • the fourth oligonucleotide set can further comprise a third S. aureus oligonucleotide having a nucleic acid sequence capable of specifically hybridizing within a region of the S. aureus DNA between the hybridizing region of the first S. aureus oligonucleotide and the hybridizing region of the second S. aureus oligonucleotide
  • Probes of this invention can advantageously be labeled for detection, as known by persons of skill in the art. Labels can appropriately be selected for the specific design and type of amplification reaction to be performed. Primer and probe reagents can be provided in any of several states, including dried, lyophilized, pelleted, spray-dried, or in liquid.
  • Kits of this invention can include additional elements, such as reagents for a selected amplification method (e.g., amplification enzymefs], bufferfs], and/or restriction enzymefs], among others], controls], reaction containers], and the like. If an intercalating dye is to be used, such can be included in the kit. Additionally, a kit of the present invention can comprise a container comprising a kit as described herein. Elements can be provided in a single container or in more than one container. Such kits can be useful for performing multiplex amplifications.
  • references to primer and probe sequences that include thymidine can be readily adapted to utilize uridine in substitution for thymidine, where useful for the particular assay.
  • nucleotides may be modified by addition of chemical groups, or substitution of individual residues by analogues (e.g., 2'-0-methoxy versions ⁇ .
  • modified nucleotides are known in the art; some examples include hydroxymethyl nucleotides, methylated nucleotides, fluorinated nucleotides, alpha thio phosphate nucleotides, amine- modified nucleotides, methoxy nucleotides, carboxymethyl nucleotides, thio nucleotides, inosine, dihydrouridine, pseudouridine, wybutosine, queuosine, C7dGTP. Additional modified nucleotides are found in U.S. Pat. Nos 5,405,950 and 5,633,364 (both, Mock and Lovern ⁇ .
  • a probe can comprise DNA, RNA, modified DNA or RNA, PNA, other synthetic nucleic acids or nucleic acid substitutes that use nucleotide bases as means of selectively hybridizing to a target.
  • the present method can be utilized on any selected sample, such as a direct patient sample, e.g., nasal or inguinal swab, perineum swab, axilla swab, throat swab, rectal swab, samples from wounds, all particularly suitable for screening, as well as particularly suitable for diagnosis, bronchoalveolar lavage or blood (e.g., septicemia or blood culture ⁇ .
  • samples typically contain a mixed population of organisms.
  • this method can be applied to a sample having only a single bacterial species or strain, e.g., samples utilizing isolation, culture, capture, and/or enrichment of MRSA.
  • the invention also relates to a method of amplifying in a sample a methicillin- resistant Staphylococcus aureus (MRSA] which comprises an insertion of an SCCmec cassette within Staphylococcus aureus chromosomal DNA, wherein the SCCmec cassette comprises a mecA variant element, the method comprising:
  • an oligonucleotide set comprising: a. a first oligonucleotide having a nucleic acid sequence capable of specifically hybridizing to a region of chromosomal Staphylococcus aureus DNA in an extremity junction region, and b. a second oligonucleotide having a nucleic acid sequence capable of specifically hybridizing to a region of a mecA variant,
  • each of the first oligonucleotide and the second oligonucleotide is oriented such that, under amplification conditions, if the sample contains the MRSA, the region of the MRSA between the hybridizing region of the first oligonucleotide and the hybridizing region of the second oligonucleotide is amplified.
  • the extremity junction region of chromosomal S. aureus DNA is a right extremity junction region.
  • the oligonucleotide set further comprises a third oligonucleotide capable of specifically hybridizing within a region of the MRSA between the hybridizing region of the first oligonucleotide and the hybridizing region of the second oligonucleotide, and wherein if the sample contains the MRSA, hybridization of the third oligonucleotide is detected.
  • the method according to the invention further comprises contacting the amplified sample with an intercalating dye, wherein if the sample contains the MRSA, intercalation of the dye into an amplification product is detected.
  • the third oligonucleotide specifically hybridizes to a region of chromosomal Staphylococcus aureus DNA.
  • the third oligonucleotide specifically hybridizes to a region of orfX of chromosomal Staphylococcus aureus DNA.
  • the third oligonucleotide specifically hybridizes to a region of a right extremity junction region of SCCmec cassette DNA
  • the third oligonucleotide specifically hybridizes to a region of the mecA variant.
  • the first oligonucleotide specifically hybridizes to a region of orfX of chromosomal Staphylococcus aureus DNA.
  • the mecA variant is mecAiGA25i-
  • the first oligonucleotide comprises a nucleic acid sequence selected from the group consisting of: SEQ ID NOs: 9 and 10.
  • the second oligonucleotide comprises a nucleic acid sequence selected from the group consisting of: SEQ ID NOs: 6, 7, 14, 15 16, 17, 20 and 21.
  • the third oligonucleotide comprises a nucleic acid sequence set forth as SEQ ID NO: 8, 11, 18 and 19.
  • the method according to the invention further comprises amplifying a methicillin-resistant Staphylococcus aureus (MRSA] which comprises an insertion of an SCCmec cassette within Staphylococcus aureus chromosomal DNA, wherein the SCCmec cassette comprises a mecA, by utilizing in an amplification reaction a second oligonucleotide set for amplification of a right extremity junction of SCCmec cassette with Staphylococcus aureus chromosomal DNA, the second oligonucleotide set comprising: a. a first junction oligonucleotide having a nucleic acid sequence capable of specifically hybridizing within a region of chromosomal Staphylococcus aureus DNA in a right extremity junction region; and
  • a second junction oligonucleotide having a nucleic acid sequence capable of specifically hybridizing within a region of a right extremity junction region of the SCCmec cassette of the
  • MRSA comprising a mecA
  • each of the first junction oligonucleotide and the second junction oligonucleotide is oriented such that, under amplification conditions, if the sample contains the MRSA comprising a mecA, the right junction is amplified.
  • the second oligonucleotide set further comprises a third junction oligonucleotide having a nucleic acid sequence capable of specifically hybridizing within a region of the MRSA between the hybridizing region of the first junction oligonucleotide and the hybridizing region of the second junction oligonucleotide,
  • the third junction oligonucleotide has a nucleic acid sequence capable of specifically hybridizing within a region of a right extremity junction region of the SCCmec cassette.
  • the third junction oligonucleotide has a nucleic acid sequence capable of specifically hybridizing within orfX.
  • the first oligonucleotide has a nucleic acid sequence capable of specifically hybridizing within orfX.
  • the method according to the invention further comprises amplifying a Staphylococcus aureus comprising mecA by utilizing in an amplification reaction a third oligonucleotide set for amplification of a mecA element comprising:
  • a a first mecA oligonucleotide having a nucleic acid sequence capable of specifically hybridizing within a region of mecA DNA
  • a second mecA oligonucleotide having a nucleic acid sequence capable of specifically hybridizing within a second region within mecA DNA, wherein each of the first mecA oligonucleotide and the second mecA oligonucleotide is oriented such that, under amplification conditions, a portion of the mecA DNA is amplified.
  • the third oligonucleotide set further comprises a third mecA oligonucleotide having a nucleic acid sequence capable of specifically hybridizing within a region of the mecA between the hybridizing region of the first mecA oligonucleotide and the hybridizing region of the second mecA oligonucleotide
  • the method according to the invention further comprises utilizing a fourth oligonucleotide set for amplification of a Staphylococcus aureus- specific chromosomal DNA comprising:
  • the fourth oligonucleotide set further comprises a third S. aureus oligonucleotide having a nucleic acid sequence capable of specifically hybridizing within a region of the S. aureus DNA between the hybridizing region of the first S. aureus oligonucleotide and the hybridizing region of the second S. aureus oligonucleotide,
  • the sample contains the region of the S. aureus DNA between the hybridizing region of the first S. aureus oligonucleotide and the hybridizing region of the second S. aureus oligonucleotide, hybridization of the third oligonucleotide is detected.
  • the Staphylococcus aureus -specific chromosomal DNA is selected from the group consisting of spa, orf and nuc.
  • the invention also relates to a method of amplifying in a sample a methicillin- resistant Staphylococcus aureus (MRSA] which comprises an insertion of an SCCmec cassette within Staphylococcus aureus chromosomal DNA, wherein the SCCmec cassette comprises mecA or a mecA variant element, the method comprising:
  • a. a first oligonucleotide set comprising:
  • a second oligonucleotide set comprising:
  • each of the first oligonucleotide and the second oligonucleotide is oriented such that, under amplification conditions, if the sample contains the MRSA, the region of the MRSA between the hybridizing region of the first oligonucleotide and the hybridizing region of the second oligonucleotide is amplified.
  • the first oligonucleotide set further comprises a third mecA variant oligonucleotide capable of specifically hybridizing within a region of the MRSA between the hybridizing region of the first mecA variant oligonucleotide and the hybridizing region of the second mecA variant oligonucleotide, and
  • the second oligonucleotide set further comprises a third mecA oligonucleotide capable of specifically hybridizing within a region of the MRSA between the hybridizing region of the first mecA oligonucleotide and the hybridizing region of the second mecA oligonucleotide, and
  • the method according to the invention further comprises contacting the amplified sample with an intercalating dye, wherein if the sample contains the MRSA, intercalation of the dye into an amplification product is detected.
  • the first mecA variant oligonucleotide comprises a nucleic acid sequence selected from the group consisting of: SEQ ID NOs: 6, 7, 14, 15 and 20.
  • the second mecA variant oligonucleotide comprises a nucleic acid sequence selected from the group consisting of: SEQ ID Nos: 16, 17 and 21.
  • the third mecA variant oligonucleotide comprises a nucleic acid sequence selected from the group consisting of: SEQ ID Nos: 8, 18 and 19.
  • the mecA variant is mecA Ghisi.
  • the method according to the invention further comprises amplifying a methicillin-resistant Staphylococcus aureus (MRSA] which comprises an insertion of an SCCmec cassette within Staphylococcus aureus chromosomal DNA, wherein the SCCmec cassette comprises a mecA, by utilizing in an amplification reaction a second oligonucleotide set for amplification of a right extremity junction of SCCmec cassette with Staphylococcus aureus chromosomal DNA, the second oligonucleotide set comprising:
  • a second junction oligonucleotide having a nucleic acid sequence capable of specifically hybridizing within a region of a right extremity junction region of the SCCmec cassette of the MRSA comprising a mecA,
  • each of the first junction oligonucleotide and the second junction oligonucleotide is oriented such that, under amplification conditions, if the sample contains the MRSA comprising a mecA, the right junction is amplified.
  • the third oligonucleotide set further comprises a third junction oligonucleotide having a nucleic acid sequence capable of specifically hybridizing within a region of the MRSA between the hybridizing region of the first junction oligonucleotide and the hybridizing region of the second junction oligonucleotide, wherein if the sample contains the MRSA comprising the right extremity junction, hybridization of the third junction oligonucleotide is detected.
  • the third junction oligonucleotide has a nucleic acid sequence capable of specifically hybridizing within a region of a right extremity junction region of the SCCmec cassette.
  • the first junction oligonucleotide has a nucleic acid sequence capable of specifically hybridizing within orfX.
  • the third junction oligonucleotide has a nucleic acid sequence capable of specifically hybridizing within orfX.
  • the method according to the invention further comprises utilizing a fourth oligonucleotide set for amplification of a Staphylococcus aureus- specific chromosomal DNA comprising:
  • the fourth oligonucleotide set further comprises a third S. aureus oligonucleotide having a nucleic acid sequence capable of specifically hybridizing within a region of the S. aureus DNA between the hybridizing region of the first S. aureus oligonucleotide and the hybridizing region of the second S. aureus oligonucleotide,
  • the sample contains the region of the S. aureus DNA between the hybridizing region of the first S. aureus oligonucleotide and the hybridizing region of the second S. aureus oligonucleotide, hybridization of the third oligonucleotide is detected.
  • the Staphylococcus aureus -specific chromosomal DNA is selected from the group consisting of spa, orfX and nuc.
  • kits for amplifying a methicillin-resistant Staphylococcus aureus which comprises an insertion of an SCCmec cassette within Staphylococcus aureus chromosomal DNA, wherein the SCCmec cassette comprises a mecA variant element
  • the kit comprising a first oligonucleotide set comprising:
  • the kit according to the invention further comprises a third oligonucleotide capable of specifically hybridizing within a region of the MRSA between the hybridizing region of the first oligonucleotide and the hybridizing region of the second oligonucleotide.
  • the first oligonucleotide comprises a nucleic acid sequence selected from the group consisting of: SEQ ID NOs: 9 and 10.
  • the second oligonucleotide comprises a nucleic acid sequence selected from the group consisting of: SEQ ID NOs: 6, 7, 14, 15, 16, 17, 20 and 21.
  • the third oligonucleotide comprises a nucleic acid sequence set forth as SEQ ID NO: 8, 18 and 19.
  • the mecA variant is mecAiGA25i-
  • kit according to the invention further comprises a second oligonucleotide set comprising:
  • a second junction oligonucleotide having a nucleic acid sequence capable of specifically hybridizing within a region of a right extremity junction region of the SCCmec cassette.
  • the kit according to the invention further comprises a third oligonucleotide set for amplification of a mecA element comprising:
  • the kit according to the invention further comprises a fourth oligonucleotide set for amplification of a Staphylococcus aureus- specific chromosomal DNA comprising:
  • Another object of the invention is a kit for amplifying in a sample a methicillin- resistant Staphylococcus aureus (MRSA] which comprises an insertion of an SCCmec cassette within Staphylococcus aureus chromosomal DNA, wherein the SCCmec cassette comprises mecA or a mecA variant element, the kit comprising:,
  • a] a first oligonucleotide set comprising:
  • a second oligonucleotide set comprising:
  • each set oriented such that, when a sample is placed under amplification conditions with the oligonucleotide set, if the sample contains the MRSA, amplification can occur.
  • the kit according to the invention further comprises in the first oligonucleotide set a third mecA variant oligonucleotide capable of specifically hybridizing within a region of the MRSA between the hybridizing region of the first oligonucleotide and the hybridizing region of the second oligonucleotide.
  • the kit according to the invention further comprises in the second oligonucleotide set a third mecA oligonucleotide capable of specifically hybridizing within a region of the MRSA between the hybridizing region of the first oligonucleotide and the hybridizing region of the second oligonucleotide.
  • the first mecA variant oligonucleotide comprises a nucleic acid sequence selected from the group consisting of: SEQ ID NOs: 9 and 10.
  • the second mecA variant oligonucleotide comprises a nucleic acid sequence selected from the group consisting of: SEQ ID NOs: 6, 7, 14, 15, 16, 17, 20 and 21.
  • the third mecA variant oligonucleotide comprises a nucleic acid sequence set forth as SEQ ID NO: 8, 18 and 19.
  • the mecA variant is N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoe [00118]
  • the kit according to the invention further comprises a third oligonucleotide set comprising
  • a second junction oligonucleotide having a nucleic acid sequence capable of specifically hybridizing within a region of a right extremity junction region of the SCCmec cassette comprising mecA,
  • each of the first junction oligonucleotide and the second junction oligonucleotide is oriented such that, under amplification conditions in the presence of the MRSA wherein the SCCmec cassette comprises mecA, an SCCcassette right insertion junction is amplified.
  • the third oligonucleotide set further comprises a third junction oligonucleotide having a nucleic acid sequence capable of specifically hybridizing within a region of the MRSA between the hybridizing region of the first junction oligonucleotide and the hybridizing region of the second junction oligonucleotide.
  • kit according to the invention further comprises a fourth oligonucleotide set comprising:
  • the fourth oligonucleotide set further comprises a third S. aureus oligonucleotide having a nucleic acid sequence capable of specifically hybridizing within a region of the S. aureus DNA between the hybridizing region of the first S. aureus oligonucleotide and the hybridizing region of the second S. aureus oligonucleotide.
  • mecA variant can be combined in any desired combination, in multiplex or multiple simplex form, with another desired assay, such as primers and/or probefs] for mecA, genomic S. aureus and / or SCCmec junction.
  • Amplifications using PCR can be performed under standard conditions.
  • Such conditions can include:
  • Oligonucleotides dedicated to amplification or detection and belonging to genomic regions described herein can be utilized whatever the method used for their design.
  • these methods which can be used are, for example (without being limited], design by hand (human expertise in oligonucleotide design] or design using computer means (scripts, programs, software] (e.g., http://www.ncbi.nlm.nih.gov/pubmed/1476746 Eberhardt NL, A shell program for the design of PCR primers using genetics computer group (GCG] software (7.1] on VAX/VMS systems, Biotechniques.
  • GCG genetics computer group
  • Staphylococcus aureus orfX-mecA variant region Staphylococcus aureus orfX-mecA variant region.
  • primer(s] on the orfX side of the SCCmec junction two primers and one probe were designed in the orfX region.
  • a mecA variant -specific set of oligos for mecAiGA25i, also described in literature as mecAMio/ooei, mecA homologue, and mecA ne w variant] were also designed.
  • mecA variant orientation was initially unknown, we designed mecA variant divergent primers in order to obtain a mecA variant -orfX amplicon. Further candidates on both ends of mecA variant gene have been designed to develop specific PCR of Staphylococcus aureus.
  • the PCR assay selected for mecA variant amplification across the SCCmec junction should generate an amplicon about 1300 nt long.
  • the PCR assay selected for detection of the mecA variant element itself may vary from this amplicon size; for example, it may produce a shorter amplicon.
  • a mecA variant reference sequence was found on NCBI with the following accession number: FR823292 and utilized for initial primer design.
  • a first step was to design mecA variant -specific oligos. As the mecA variant orientation was initially unknown, mecA variant divergent primers (both at 5' and 3' ends of the mecA variant gene] were designed in order to obtain a mecA variant -orf amplicon.
  • thermodynamic characteristics (data not shown), and two of them were selected based on thermodynamic characteristics:
  • Input parameters Temperature: 63°C; [Na+]: 0.05 M; [Mg2+] : 0.005 M;
  • mecA variant 3' -end primers
  • MIX 1 positive control for mecA variant
  • MIX 2 test oligo mecAv-orfX-6 (SEQ ID NO: 6 ⁇ in mecA variant (amplicon 1498 nt long]
  • MIX 3 test oligo mecAv-orfX-7 (SEQ ID NO: 7 ⁇ in mecA variant (amplicon 1484 nt long] Table 7a: Positive Control
  • MIX 1 Positive Control
  • mecA variant primers were effective in amplifying the mecA variant-orfii amplicon and therefore for use in an assay to detect mecA variant- bearing MRSA strains. Details of an orfX-mecA variant PCR using orfX primer mecAv-orfX-9, mecA variant primer mecAv-orfX-7 and orfX primer mecAv-orfX-10 that was prepared and conducted is provided below. Successful amplification of the mecA variant was achieved.
  • MIX PCR orfX-mecA variant
  • EXAMPLE 2b Amplification with probe in orfX and probe in the mecA variant gene
  • MIX 1 mecAv-orfX-9/ mecAv-orfX-10/ mecAv-orfX-7/ mecAv-orfX-11 at 0.6 ⁇
  • MIX 2 mecAv-orfX-9/ mecAv-orfX-10/ mecAv-orfX-7/ mecAv-orfX-11 at 0.3 ⁇
  • MIX 3 mecAv-orfX-9/ mecAv-orfX-10/ mecAv-orfX-7/ mecAv-orfX-8 at 0.6 ⁇
  • MIX 4 mecAv-orfX-9/ mecAv-orfX-10/ mecAv-orfX-7/ mecAv-orfX-8 at 0.3 ⁇
  • EXAMPLE 3 Amplification of SCCmec:orfflIunction Region of non-typeXI and of mecA
  • An assay can be performed in combination with an assay for SCCmec typeXI to additionally detect the presence or absence of non-typeXI SCCmec-carrying MRSA strains (those that harbor mecA).
  • An assay can also be performed in combination with an assay for other sequences, such as S. aureus genomic region(s] and/or mecA to additionally characterize the organism(s) present in a sample. These assays can be performed in multiplex or separately.
  • EXAMPLE 3a Detection of Right Extremity lunction Region.
  • kits that can be utilized to detect this junction include:
  • primers can be designed using Path-MRSA or Path-MRSA std (both, Genesig).
  • EXAMPLE 3b Multiplex amplification and detection of mecA gene and cassette insertion (junction) region
  • simultaneous amplification and detection of both the insertion cassette region and the mecA gene can be utilized to reduce detection of certain strains (false MRSA positive) for non-typeXI strains.
  • certain strains fralse MRSA positive
  • this strategy can be used for a multiplex amplification for detection of both the mecA gene and the cassette junction region in the same tube.
  • the assay uses 5 SCCmec cassette-specific forward primers in SCCmec right extremity junction region, 1 reverse primer in orfX, and 5 labeled SCCmec cassette-specific probes for the cassette junction region in combination with 1 forward primer, 1 reverse primer and 1 labeled probe for mecA.
  • the results of such an assay show that, in the case of an MSSA possessing the insertion cassette region without the mecA gene, this portion of the assay can properly provide a "MRSA negative" result [SCCmec junction (+ ⁇ plus mecA (- ⁇ .
  • the S. aureus spa gene is a gene encoding the protein A, which is a surface protein found specifically in the cell wall of Staphylococcus aureus bacteria.
  • One part of spa gene, the polymorphic region X, is highly variable and is used for the spa typing permitting to differentiate several S. aureus. However more conservative areas are also present in spa gene and are used as specific markers to detect all the S. aureus strains. [Kuhn, JCM 2007, Double- locus sequence typing using clfB and spa, a fast and simple method for epidemiological typing of methicillin-resistant Staphylococcus aureus].
  • Oligonucleotides are as follows:
  • the nuc gene encodes the S. aureus thermostable nuclease also called thermonuclease. This gene is S. aureus specific and is h ighly conserved [Brags tad et al. JCM 1992, Detection of Staphylococcus aureus by polymerase chain reaction amplification of the nuc gene].
  • Oligonucleotides are as follows:
  • mecA encodes for the PBP2a (Penicillin Binding Protein 2a), which Is a modified PBP.
  • mecA variant discovered recently also encodes for a protein belonging to the PBP2a family.
  • the oligonucleotides were designed in conservative areas of the gene. Oligonucleotides can be designed in order to amplify and detect both mecA and mecA variant either in the same simplex reaction or in several distinct simplex reactions or in multiplex reaction.
  • the resulting amplification and/or detection of mecA and/or mecA variant demonstrate that the methiclllln resistance gene is present i n the sample.
  • mecA can be assayed by amplification using the following oligonucleotides, under standard PCR conditions: Oligo SEQ ID Sequence
  • mecA variant can be assayed by amplification using the fc oligonucleotides to detect mecA variant sequences:
  • mecA variant can be determined using a mecA variant-orfX assay.
  • One such assay is exemplified above in Example 2.
  • Primer/probe sequences are selected in a region common to both mecA and mecA variant.
  • mecA + mecA variant can be amplified usin the followin oli onucleotides:
  • mecAv-6 19 mecA ATTGGAGAAAAAGGCTGAAAACGGAAAAGA (30nt) variant
  • mecAv-7 20 mecA C C AGAT AT AGT AG C ATTAT A (20n )
  • S.aureus-4 27 nuc G GT GT AG AGAAATATG GT C C TG AAG C (26n )

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Analytical Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Immunology (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
PCT/EP2012/076856 2011-12-23 2012-12-21 Detection of meca variant strains of methicillin-resistant staphylococcus aureus Ceased WO2013093106A1 (en)

Priority Applications (13)

Application Number Priority Date Filing Date Title
CA2858284A CA2858284A1 (en) 2011-12-23 2012-12-21 Detection of meca variant strains of methicillin-resistant staphylococcus aureus
IN5831DEN2014 IN2014DN05831A (https=) 2011-12-23 2012-12-21
ES12813030.9T ES2693158T3 (es) 2011-12-23 2012-12-21 Detección de cepas variantes mecA de Staphylococcus aureus resistentes a meticilina
CN201280070541.0A CN104169437B (zh) 2011-12-23 2012-12-21 甲氧西林抗性金黄色葡萄球菌的mecA变体菌株的检测
EP12813030.9A EP2794917B1 (en) 2011-12-23 2012-12-21 Detection of meca variant strains of methicillin-resistant staphylococcus aureus
BR112014015401A BR112014015401A8 (pt) 2011-12-23 2012-12-21 detecção de cepas da variante de meca de staphylococcus aureus resistente à meticilina
EP18185906.7A EP3450572A1 (en) 2011-12-23 2012-12-21 Detection of meca variant strains of methicillin-resistant staphylococcus aureus
HK15102527.1A HK1201888B (en) 2011-12-23 2012-12-21 Detection of meca variant strains of methicillin-resistant staphylococcus aureus
AU2012356749A AU2012356749B2 (en) 2011-12-23 2012-12-21 Detection of mecA variant strains of methicillin-resistant Staphylococcus aureus
JP2014548106A JP2015511116A (ja) 2011-12-23 2012-12-21 メチシリン耐性黄色ブドウ球菌の変異型mecA株の検出
IL23314814A IL233148B (en) 2011-12-23 2014-06-11 Discovery of meca variants of Staphylococcus aureus that are resistant to methicillin
ZA2014/04536A ZA201404536B (en) 2011-12-23 2014-06-20 Detection of meca variant strains of methicillin-resistant staphylococcus aureus
AU2018256562A AU2018256562B2 (en) 2011-12-23 2018-10-31 Detection of MecA Variant Strains of Methicillin-Resistant Staphylococcus Aureus

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP11306776.3 2011-12-23
EP11306776 2011-12-23

Publications (1)

Publication Number Publication Date
WO2013093106A1 true WO2013093106A1 (en) 2013-06-27

Family

ID=47522617

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2012/076856 Ceased WO2013093106A1 (en) 2011-12-23 2012-12-21 Detection of meca variant strains of methicillin-resistant staphylococcus aureus

Country Status (12)

Country Link
US (2) US9394573B2 (https=)
EP (2) EP2794917B1 (https=)
JP (3) JP2015511116A (https=)
CN (1) CN104169437B (https=)
AU (2) AU2012356749B2 (https=)
BR (1) BR112014015401A8 (https=)
CA (1) CA2858284A1 (https=)
ES (1) ES2693158T3 (https=)
IL (1) IL233148B (https=)
IN (1) IN2014DN05831A (https=)
WO (1) WO2013093106A1 (https=)
ZA (1) ZA201404536B (https=)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10407739B2 (en) 2013-09-23 2019-09-10 Quest Diagnostics Investments Incorporated Detection of methicillin-resistant Staphylococcus aureus in biological samples
US9920381B2 (en) * 2014-12-02 2018-03-20 Roche Molecular Systems, Inc. Compositions and methods for detecting MECC-containing methicillin-resistant Staphylococcus aureus

Citations (26)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
FR823292A (fr) 1936-06-23 1938-01-18 Bakovenbouw Voorheen H P Den B Four à plusieurs zones de chauffage, par lesquelles les articles à cuire sont passés successivement, la température de chaque zone pouvant être réglée séparément
US4213893A (en) 1978-10-12 1980-07-22 Miles Laboratories, Inc. Flavin adenine dinucleotide-labeled conjugates for use in specific binding assays
US4411955A (en) 1980-11-05 1983-10-25 Hoechst Aktiengesellschaft Reactive hardenable binder mixture, process for preparing hardened products and use of the mixture for the preparation of coatings
US4486539A (en) 1981-10-16 1984-12-04 Orioon Corporation Ltd. Detection of microbial nucleic acids by a one-step sandwich hybridization test
US4683195A (en) 1986-01-30 1987-07-28 Cetus Corporation Process for amplifying, detecting, and/or-cloning nucleic acid sequences
US4683202A (en) 1985-03-28 1987-07-28 Cetus Corporation Process for amplifying nucleic acid sequences
US4751177A (en) 1985-06-13 1988-06-14 Amgen Methods and kits for performing nucleic acid hybridization assays
US4851330A (en) 1983-01-10 1989-07-25 Kohne David E Method for detection, identification and quantitation of non-viral organisms
US4882269A (en) 1985-12-13 1989-11-21 Princeton University Amplified hybridization assay
US4965188A (en) 1986-08-22 1990-10-23 Cetus Corporation Process for amplifying, detecting, and/or cloning nucleic acid sequences using a thermostable enzyme
US5130238A (en) 1988-06-24 1992-07-14 Cangene Corporation Enhanced nucleic acid amplification process
US5210015A (en) 1990-08-06 1993-05-11 Hoffman-La Roche Inc. Homogeneous assay system using the nuclease activity of a nucleic acid polymerase
US5399491A (en) 1989-07-11 1995-03-21 Gen-Probe Incorporated Nucleic acid sequence amplification methods
US5405950A (en) 1985-05-15 1995-04-11 Amoco Corporation N4 -substituted cytidines and process for incorporation into an oligonucleotides
US5409818A (en) 1988-02-24 1995-04-25 Cangene Corporation Nucleic acid amplification process
US5480784A (en) 1989-07-11 1996-01-02 Gen-Probe Incorporated Nucleic acid sequence amplification methods
US5654142A (en) 1992-08-24 1997-08-05 Akzo Nobel N.V. Method for nucleic acid amplification using inosine triphosphates to partially replace guanosine triphosphates in the synthesis of multiple RNA copies
WO1997031125A2 (fr) 1996-02-23 1997-08-28 Kainos Laboratories, Inc. Procede de diagnostic
US5766849A (en) 1989-07-11 1998-06-16 Gen-Probe Incorporated Methods of amplifying nucleic acids using promoter-containing primer sequence
US5792607A (en) 1990-01-26 1998-08-11 Abbott Laboratories Method and kits for amplifying target nucleic acids applicable to both polymerase and ligase chain reactions
US5994076A (en) 1997-05-21 1999-11-30 Clontech Laboratories, Inc. Methods of assaying differential expression
US6312928B1 (en) 1997-11-17 2001-11-06 Akzo Nobel N.V. Transcription based amplification of double stranded DNA targets
WO2002082086A2 (en) 2001-03-15 2002-10-17 Jacques Schrenzel Detection of methicillin-resistant staphylococcus aureus (mrsa)
WO2002099034A2 (en) 2001-06-04 2002-12-12 Infectio Diagnostic (I.D.I.) Inc. Sequences for detection and identification of methicillin-resistant staphyloccocus aureus
US20060057613A1 (en) 2004-07-26 2006-03-16 Nanosphere, Inc. Method for distinguishing methicillin resistant S. aureus from methicillin sensitive S. aureus in a mixed culture
WO2009085221A2 (en) 2007-12-21 2009-07-09 Biomerieux Sa Detection of methicillin-resistant staphylococcus aureus

Family Cites Families (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6379897B1 (en) 2000-11-09 2002-04-30 Nanogen, Inc. Methods for gene expression monitoring on electronic microarrays
US5702895A (en) 1995-01-19 1997-12-30 Wakunaga Seiyaku Kabushiki Kaisha Method and kit for detecting methicillin-resistant Staphylococcus aureus
DE60210621T2 (de) 2001-07-19 2007-03-08 Infectio Diagnostic (I.D.I.) Inc., Sainte-Foy Universelle methode und zusammensetzung zur schnellen lysierung von zellen zur freisetzung von nukleinsäuren und ihre detektion
DE60304481T8 (de) 2003-11-07 2007-03-08 Federal Rep. of Germany repr.by the Ministry of Health & Soc.Security, the latter repr. by the Pres. of the Robert Koch Inst. Verfahren zur Identifizierung von Methicilin resistente Staphylococcus aureus (MRSA)
WO2006111028A1 (en) 2005-04-21 2006-10-26 Uti Limited Partnership Pcr for mrsa sccmec typing
WO2007096702A2 (en) 2005-07-25 2007-08-30 Asm Scientific, Inc. Methods for multiplexing recombinase polymerase amplification
US11834720B2 (en) 2005-10-11 2023-12-05 Geneohm Sciences, Inc. Sequences for detection and identification of methicillin-resistant Staphylococcus aureus (MRSA) of MREJ types xi to xx
US7838221B2 (en) 2005-10-11 2010-11-23 Geneohm Sciences, Inc. Sequences for detection and identification of methicillin-resistant Staphylococcus aureus (MRSA)
ES2403587T3 (es) 2006-12-29 2013-05-20 Mayo Foundation For Medical Education And Research Métodos de detección de S. aureus resistente a meticilina, así como cebadores, sondas y kits para los mismos
CA2684570A1 (en) 2007-04-19 2008-10-30 Molecular Detection Inc. Methods, compositions and kits for detection and analysis of antibiotic-resistant bacteria
EP2183391A4 (en) 2007-07-31 2010-10-27 Quest Diagnostics Invest Inc DETECTION OF METHICILLIN-RESISTANT AND METHICILLIN-RESISTANT STAPHYLOCOCCUS AUREUS IN BIOLOGICAL SAMPLES
FI121884B (fi) 2008-01-17 2011-05-31 Mobidiag Oy Menetelmä metisilliiniresistenttien stafylokokkien havaitsemiseksi ja tunnistamiseksi sekä menetelmään tarkoitettu koetin ja testipakkaus
US20120165229A1 (en) * 2010-12-07 2012-06-28 Intelligent Medical Devices, Inc. Optimized probes and primers and methods of using same for the detection, screening, isolation and sequencing of mrsa, mssa, staphylococcus markers, and the antibiotic resistance gene mec a
ES2537189T3 (es) * 2011-05-24 2015-06-03 Elitech Holding B.V. Detección de estafilococos áureos resistentes a la meticilina

Patent Citations (35)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
FR823292A (fr) 1936-06-23 1938-01-18 Bakovenbouw Voorheen H P Den B Four à plusieurs zones de chauffage, par lesquelles les articles à cuire sont passés successivement, la température de chaque zone pouvant être réglée séparément
US4213893A (en) 1978-10-12 1980-07-22 Miles Laboratories, Inc. Flavin adenine dinucleotide-labeled conjugates for use in specific binding assays
US4411955A (en) 1980-11-05 1983-10-25 Hoechst Aktiengesellschaft Reactive hardenable binder mixture, process for preparing hardened products and use of the mixture for the preparation of coatings
US4486539A (en) 1981-10-16 1984-12-04 Orioon Corporation Ltd. Detection of microbial nucleic acids by a one-step sandwich hybridization test
US4563419A (en) 1981-10-16 1986-01-07 Orion Corporation Ltd. Detection of microbial nucleic acids by a one-step sandwich hybridization test
US4851330A (en) 1983-01-10 1989-07-25 Kohne David E Method for detection, identification and quantitation of non-viral organisms
US4683202A (en) 1985-03-28 1987-07-28 Cetus Corporation Process for amplifying nucleic acid sequences
US4683202B1 (https=) 1985-03-28 1990-11-27 Cetus Corp
US5405950A (en) 1985-05-15 1995-04-11 Amoco Corporation N4 -substituted cytidines and process for incorporation into an oligonucleotides
US5633364A (en) 1985-05-15 1997-05-27 Amoco Corporation N4 -substituted 2'-deoxycytidine compounds, oligonucleotides including N4 -labeled 2'-deoxycytidines, and a process for making oligonucleotides with N-modified 2'-deoxycytidines
US4751177A (en) 1985-06-13 1988-06-14 Amgen Methods and kits for performing nucleic acid hybridization assays
US4882269A (en) 1985-12-13 1989-11-21 Princeton University Amplified hybridization assay
US4683195B1 (https=) 1986-01-30 1990-11-27 Cetus Corp
US4683195A (en) 1986-01-30 1987-07-28 Cetus Corporation Process for amplifying, detecting, and/or-cloning nucleic acid sequences
US4965188A (en) 1986-08-22 1990-10-23 Cetus Corporation Process for amplifying, detecting, and/or cloning nucleic acid sequences using a thermostable enzyme
US5409818A (en) 1988-02-24 1995-04-25 Cangene Corporation Nucleic acid amplification process
US5130238A (en) 1988-06-24 1992-07-14 Cangene Corporation Enhanced nucleic acid amplification process
US5399491A (en) 1989-07-11 1995-03-21 Gen-Probe Incorporated Nucleic acid sequence amplification methods
US5480784A (en) 1989-07-11 1996-01-02 Gen-Probe Incorporated Nucleic acid sequence amplification methods
US5766849A (en) 1989-07-11 1998-06-16 Gen-Probe Incorporated Methods of amplifying nucleic acids using promoter-containing primer sequence
US5792607A (en) 1990-01-26 1998-08-11 Abbott Laboratories Method and kits for amplifying target nucleic acids applicable to both polymerase and ligase chain reactions
US5487972A (en) 1990-08-06 1996-01-30 Hoffmann-La Roche Inc. Nucleic acid detection by the 5'-3'exonuclease activity of polymerases acting on adjacently hybridized oligonucleotides
US5210015A (en) 1990-08-06 1993-05-11 Hoffman-La Roche Inc. Homogeneous assay system using the nuclease activity of a nucleic acid polymerase
US5804375A (en) 1990-08-06 1998-09-08 Roche Molecular Systems, Inc. Reaction mixtures for detection of target nucleic acids
US5654142A (en) 1992-08-24 1997-08-05 Akzo Nobel N.V. Method for nucleic acid amplification using inosine triphosphates to partially replace guanosine triphosphates in the synthesis of multiple RNA copies
WO1997031125A2 (fr) 1996-02-23 1997-08-28 Kainos Laboratories, Inc. Procede de diagnostic
EP0887424A2 (en) 1996-02-23 1998-12-30 Kainos Laboratories Inc. Diagnostic method
US6156507A (en) 1996-02-23 2000-12-05 Kainos Laboratories, Inc. Method of identifying methicillin-resistant Staphylococcus aureus or methicillin-resistant coagulase-negative staphylococci
US5994076A (en) 1997-05-21 1999-11-30 Clontech Laboratories, Inc. Methods of assaying differential expression
US6312928B1 (en) 1997-11-17 2001-11-06 Akzo Nobel N.V. Transcription based amplification of double stranded DNA targets
WO2002082086A2 (en) 2001-03-15 2002-10-17 Jacques Schrenzel Detection of methicillin-resistant staphylococcus aureus (mrsa)
WO2002099034A2 (en) 2001-06-04 2002-12-12 Infectio Diagnostic (I.D.I.) Inc. Sequences for detection and identification of methicillin-resistant staphyloccocus aureus
US20060057613A1 (en) 2004-07-26 2006-03-16 Nanosphere, Inc. Method for distinguishing methicillin resistant S. aureus from methicillin sensitive S. aureus in a mixed culture
WO2009085221A2 (en) 2007-12-21 2009-07-09 Biomerieux Sa Detection of methicillin-resistant staphylococcus aureus
US20090203013A1 (en) 2007-12-21 2009-08-13 Biomerieux Sa Detection of Methicillin-Resistant Staphylococcus aureus

Non-Patent Citations (33)

* Cited by examiner, † Cited by third party
Title
A. C. SHORE ET AL: "Detection of Staphylococcal Cassette Chromosome mec Type XI Carrying Highly Divergent mecA, mecI, mecR1, blaZ, and ccr Genes in Human Clinical Isolates of Clonal Complex 130 Methicillin-Resistant Staphylococcus aureus", ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, vol. 55, no. 8, 2 June 2011 (2011-06-02), pages 3765 - 3773, XP055054814, ISSN: 0066-4804, DOI: 10.1128/AAC.00187-11 *
ANNA SHORE ET AL: "Seven Novel Variants of the Staphylococcal Chromosomal Cassette mec in Methicillin-Resistant Staphylococcus aureus Isolates from Ireland", ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, vol. 49, no. 5, 1 May 2005 (2005-05-01), pages 2070 - 2083, XP055054816, DOI: 10.1128/AAC.49.5.2070-2083.2005 *
B. PICHON ET AL: "Development of a real-time quadruplex PCR assay for simultaneous detection of nuc, Panton-Valentine leucocidin (PVL), mecA and homologue mecALGA251", JOURNAL OF ANTIMICROBIAL CHEMOTHERAPY, vol. 67, no. 10, 11 June 2012 (2012-06-11), pages 2338 - 2341, XP055054916, ISSN: 0305-7453, DOI: 10.1093/jac/dks221 *
BIOTECHNIQUES, vol. 13, no. 6, December 1992 (1992-12-01), pages 914 - 7
BRAGSTAD ET AL., JCM, 1992
CHRISTIANE CUNY ET AL: "Rare Occurrence of Methicillin-Resistant Staphylococcus aureus CC130 with a Novel mecA Homologue in Humans in Germany", PLOS ONE, vol. 6, no. 9, 8 September 2011 (2011-09-08), pages e24360, XP055054913, DOI: 10.1371/journal.pone.0024360 *
DUNN ET AL., CELL, vol. 12, 1978, pages 23 - 26
FRANCOIS, P ET AL., J.CLIN.MICROBIOL, vol. 41, no. L, 2003, pages 254 - 260
FREDERIC LAURENT ET AL: "MRSA Harboring mec A Variant Gene mec C, France", EMERGING INFECTIOUS DISEASES, vol. 18, no. 9, 1 September 2012 (2012-09-01), pages 1465 - 1467, XP055054818, ISSN: 1080-6040, DOI: 10.3201/eid1809.111920 *
GARCIA-ALVAREZ, L. ET AL., LANCET, 3 June 2011 (2011-06-03)
HIRAMATSU ET AL., MICROBIOL. IMMUNOL, vol. 36, 1992, pages 445 - 453
HIRAMATSU ET AL., TRENDS MICROBIOL, vol. 9, no. 10, October 2001 (2001-10-01), pages 486 - 93
HULETSKY ET AL., J. CLIN.MICROBIOL, vol. 42, no. 5, 2004, pages 1875 - 1884
ITO ET AL., ANTIMICROB. AGENTS CHEMOTHER, vol. 43, 1999, pages 1449 - 1458
ITO ET AL., ANTIMICROB. AGENTS CHEMOTHER, vol. 45, 2001, pages 1323 - 1336
ITO ET AL., ANTIMICROB. AGENTS CHEMOTHER, vol. 45, no. 5, May 2001 (2001-05-01), pages 1323 - 1336
ITO ET AL.: "Staphylococcal Cassette Chromosome mec", ANTIMICROB. AGENTS CHEMOTHER, vol. 45, no. 5, 2001, pages 1323 - 1336, XP002238384, DOI: doi:10.1128/AAC.45.5.1323-1336.2001
ITO, T. ET AL.: "Guidelines for Reporting Novel mecA Gene Homologues", AGENTS CHEMOTHER
J CLIN LAB ANAL., vol. 10, no. 5, 1996, pages 277 - 84
KATAYAMA ET AL., ANTIMICROB. AGENTS CHEMOTHER, vol. 44, 2000, pages 1549 - 1555
KUHN, JCM, 2007
LAURA GARCÍA-ÁLVAREZ ET AL: "Meticillin-resistant Staphylococcus aureus with a novel mecA homologue in human and bovine populations in the UK and Denmark: a descriptive study", THE LANCET INFECTIOUS DISEASES, vol. 11, no. 8, 1 August 2011 (2011-08-01), pages 595 - 603, XP055054812, ISSN: 1473-3099, DOI: 10.1016/S1473-3099(11)70126-8 *
LAURA GARCIA-ALVAREZ ET AL: "Staphylococcus aureus subsp. aureus LGA251 complete genome sequence", NCBI, 23 August 2011 (2011-08-23), XP055054956, Retrieved from the Internet <URL:http://www.ncbi.nlm.nih.gov/nuccore/fr821779> [retrieved on 20130301] *
MERMEL ET AL.: "Methicillin Resistant Staphylococcus aureus colonisation at different Body Sites: a Prospective, Quantitative Analysis", JOURNAL OF CLINICAL MICROBIOLOGY, 2011
MURAKAMI ET AL., J. CLIN. MICROBIOL, vol. 29, 1991, pages 2240 - 2244
OLIVEIRA, D.C. ET AL., ANTIMICROB. AGENTS CHEMOTHER, vol. 44, no. 7, 2000, pages 1906 - 1910
RUPP, J ET AL., J. CLIN. MICROBIOL., vol. 44, no. 6, 2006, pages 2317
RUPP, J. ET AL., J. CLIN. MICROBIOL, vol. 44, no. 6, 2006, pages 2317
SAITO ET AL., J. CLIN. MICROBIOL, vol. 33, 1995, pages 2498 - 2500
SAMBROOK ET AL.: "Molecular Cloning A Laboratory Manual, 2nd Ed.", December 1989, COLD SPRING LAB. PRESS
SAMBROOK; RUSSELL: "Molecular Cloning: A Laboratory Manual", 2001, COLD SPRING HARBOR LABORATORY PRESS
SHORE, A.C. ET AL., ANTIMICROB. AGENTS CHEMOTHER, 2 June 2011 (2011-06-02)
UBUKATA ET AL., J. CLIN. MICROBIOL., vol. 30, 1992, pages 1728 - 1733

Also Published As

Publication number Publication date
US10829825B2 (en) 2020-11-10
BR112014015401A8 (pt) 2017-07-04
EP2794917A1 (en) 2014-10-29
JP2015511116A (ja) 2015-04-16
IN2014DN05831A (https=) 2015-06-26
US20130164752A1 (en) 2013-06-27
HK1201888A1 (en) 2015-09-11
JP2018038402A (ja) 2018-03-15
EP3450572A1 (en) 2019-03-06
IL233148A0 (en) 2014-07-31
CA2858284A1 (en) 2013-06-27
AU2012356749B2 (en) 2018-08-02
AU2018256562A1 (en) 2018-11-22
CN104169437B (zh) 2017-07-11
EP2794917B1 (en) 2018-08-08
JP2020072723A (ja) 2020-05-14
AU2018256562B2 (en) 2021-01-28
ZA201404536B (en) 2016-07-27
US9394573B2 (en) 2016-07-19
BR112014015401A2 (pt) 2017-06-13
AU2012356749A1 (en) 2014-07-03
US20160281144A1 (en) 2016-09-29
IL233148B (en) 2019-11-28
ES2693158T3 (es) 2018-12-07
CN104169437A (zh) 2014-11-26

Similar Documents

Publication Publication Date Title
AU2016277561B2 (en) Detection of methicillin-resistant staphylococcus aureus
JP2023154068A (ja) MREJタイプXXIのメチシリン耐性Staphylococcus aureus(MRSA)を検出および同定するための配列
AU2018256562B2 (en) Detection of MecA Variant Strains of Methicillin-Resistant Staphylococcus Aureus
HK1201888B (en) Detection of meca variant strains of methicillin-resistant staphylococcus aureus
HK1152080B (zh) 抗甲氧西林金黄色葡萄球菌的检测
JP2017521066A (ja) 水質汚染を検出するための方法及び試薬
HK1152080A (en) Detection of methicillin-resistant staphylococcus aureus

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 12813030

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2858284

Country of ref document: CA

ENP Entry into the national phase

Ref document number: 2014548106

Country of ref document: JP

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 233148

Country of ref document: IL

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2012356749

Country of ref document: AU

Date of ref document: 20121221

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 2012813030

Country of ref document: EP

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112014015401

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 112014015401

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20140623