WO2013084157A1 - Expression cassette - Google Patents

Expression cassette Download PDF

Info

Publication number
WO2013084157A1
WO2013084157A1 PCT/IB2012/056977 IB2012056977W WO2013084157A1 WO 2013084157 A1 WO2013084157 A1 WO 2013084157A1 IB 2012056977 W IB2012056977 W IB 2012056977W WO 2013084157 A1 WO2013084157 A1 WO 2013084157A1
Authority
WO
WIPO (PCT)
Prior art keywords
genomic dna
dna sequence
promoter
translated genomic
expression cassette
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/IB2012/056977
Other languages
English (en)
French (fr)
Inventor
Daniel Luescher
Christel AEBISCHER-GUMY
Pierre MORETTI
Martin Bertschinger
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Ichnos Sciences SA
Original Assignee
Glenmark Pharmaceuticals SA
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to AU2012348558A priority Critical patent/AU2012348558A1/en
Priority to KR1020147018672A priority patent/KR102135745B1/ko
Priority to ES12816132.0T priority patent/ES2679291T3/es
Priority to CA2856479A priority patent/CA2856479A1/en
Priority to EP12816132.0A priority patent/EP2788483B1/en
Priority to MX2014006869A priority patent/MX362393B/es
Priority to JP2014545423A priority patent/JP2015501642A/ja
Priority to US14/003,410 priority patent/US20130344604A1/en
Priority to NZ626252A priority patent/NZ626252B2/en
Priority to HK15102932.0A priority patent/HK1202578A1/xx
Priority to BR112014013597-5A priority patent/BR112014013597A2/pt
Application filed by Glenmark Pharmaceuticals SA filed Critical Glenmark Pharmaceuticals SA
Priority to EA201491034A priority patent/EA037273B1/ru
Priority to SG11201402477VA priority patent/SG11201402477VA/en
Priority to CN201280069001.0A priority patent/CN104093834A/zh
Publication of WO2013084157A1 publication Critical patent/WO2013084157A1/en
Priority to IL232845A priority patent/IL232845A0/en
Anticipated expiration legal-status Critical
Priority to US15/653,243 priority patent/US20180163225A1/en
Priority to AU2018204332A priority patent/AU2018204332B2/en
Priority to US16/397,006 priority patent/US20200087679A1/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts

Definitions

  • the present invention relates to an expression cassette useful for the expression of a polynucleotide sequence encoding a polypeptide.
  • the present invention is also directed to vectors and host cells which comprise the expression cassette and uses of the expression cassette for the production of a polypeptide from a host cell.
  • Polypeptides for use in pharmaceutical applications are preferably produced in mammalian cells such as CHO cells, NSO cells, SP2/0 cells, COS cells, HEK cells, BHK cells, or the like.
  • the essential elements of an expression vector used for this purpose are normally selected from a prokaryotic plasmid propagation unit, for example E.coli, comprising a prokaryotic origin of replication and a prokaryotic selection marker, optionally a eukaryotic selection marker, and one or more expression cassettes for the expression of the structural gene(s) of interest each comprising a promoter, a polynucleotide sequence encoding a polypeptide, and optionally a transcription terminator including a polyadenylation signal.
  • a mammalian origin of replication such as the SV40 Ori or OriP, can be included.
  • promoter a constitutive or inducible promoter can be selected.
  • a Kozak sequence may be included in the 5' untranslated region.
  • mRNA processing in particular mRNA splicing and transcription termination, mRNA splicing signals, depending on the organization of the structural gene (exon/intron organization), may be included as well as a polyadenylation signal.
  • Expression of a gene is performed either in transient or using a stable cell line. The level of stable and high expression of a polypeptide in a production cell line is crucial to the overall process of the production of recombinant polypeptides.
  • the demand for biologic molecules such as proteins and specifically antibodies or antibody fragments has increased significantly over the last few years.
  • the present invention relates generally to expression systems such as expression cassettes and expression vectors which can be used to obtain increased expression in recombinant polypeptide production.
  • the present disclosure provides an expression cassette which comprises a promoter, a polynucleotide sequence encoding a polypeptide, and a non- translated genomic DNA sequence downstream of a eukaryotic Glyceraldehyde 3 -phosphate dehydrogenase (GAPDH) promoter, wherein the polypeptide encoded by the polynucleotide sequence is not GAPDH, and wherein the non-translated genomic DNA sequence
  • GPDH eukaryotic Glyceraldehyde 3 -phosphate dehydrogenase
  • downstream of the eukaryotic GAPDH promoter starts within a region spanning from nucleotide position around +1 to nucleotide position around +7000, wherein the nucleotide position is relative to the transcription start of the GAPDH mRNA, and wherein the length of the non-translated genomic DNA sequence downstream of the eukaryotic GAPDH promoter is from around 100 to around 15000 nucleotides.
  • the present disclosure provides an expression cassette which comprises a promoter, a polynucleotide sequence encoding a polypeptide, and a non-translated genomic DNA sequence upstream of a eukaryotic GAPDH promoter, wherein the polypeptide encoded by the polynucleotide sequence is not GAPDH, and wherein the non-translated genomic DNA sequence upstream of the eukaryotic GAPDH promoter starts within a region spanning from around the 5' end of the eukaryotic GAPDH promoter to nucleotide position around -3500, wherein the nucleotide position is relative to the transcription start of the GAPDH mRNA, wherein the length of the non-translated genomic DNA sequence upstream of the eukaryotic GAPDH promoter is from 100 to around 15000 nucleotides, with the proviso that the expression cassette does not comprise a eukaryotic GAPDH promoter or fragments thereof.
  • the present disclosure provides an expression vector comprising an expression cassette and a host cell comprising an expression cassette or an expression vector comprising an expression cassette.
  • the present disclosure provides an in vitro method for the expression of a polypeptide, comprising transfecting a host cell with an expression cassette or an expression vector and recovering the polypeptide and the use of an expression cassette or an expression vector for the expression of a heterologous polypeptide from a mammalian host cell.
  • Figure 1 shows reporter expression construct (REP) consisting of mouse cytomegalovirus promoter (mCMV), Ig donor acceptor fragment (IgDA) containing the first intron, IgGl antibody light chain (IgGl LC), Internal Ribosomal Entry Sites derived from
  • Encephalomyocarditis virus IgGl antibody heavy chain (IgGl HC), green fluorescent protein (GFP) and simian virus 40 polyadenylation signal (poly (A)).
  • FIG. 2 shows transient expression of IgGl antibody in CHO-S cells on day 5 post- transfection (Mean of IgG titers are plotted for two independent transfections).
  • Cells were transfected using the GAPDH A and GAPDH B vectors (GAPDH A and GAPDH B), the same vectors without GAPDH upstream and downstream elements (A and B) and the pGLEX41 vector as a control (pGLEX41).
  • the concentration of the accumulated IgGl antibody in the supernatant was determined using the Octet instrument (Fortebio, Menlo, CA, USA).
  • FIG. 3 shows expression of IgGl antibody in HEK293 EBNA cells.
  • Cells were transfected using the GAPDH A and GAPDH B vectors (GAPDH A and GAPDH B) and the pGLEX41 vector as a control (pGLEX41).
  • the supernatant was harvested and analysed on day 10 after transfection using the Octet instrument.
  • Figure 4 shows an expression level study on a batch production using cellular pools.
  • Cells were transfected and pools of stable cells were created using GAPDH A and GAPDH B vectors (GAPDH A(l), GAPDH_A(2), GAPDH B(l) and GAPDH_B(2)), the same vectors without the GAPDH upstream and downstream elements (A(l) and A(2)) and the pGLEX41 vector as a control (pGLEX41).
  • GAPDH A and GAPDH B vectors GAPDH A(l), GAPDH_A(2), GAPDH B(l) and GAPDH_B(2)
  • the same vectors without the GAPDH upstream and downstream elements A(l) and A(2)
  • the pGLEX41 vector as a control
  • Figure 5 shows an expression level study on populations generated by stable transfection and limiting dilution.
  • Cells were transfected using the GAPDH A and GAPDH B vectors (GAPDH A and GAPDH B), the same vectors without the GAPDH upstream and downstream elements (A and B) and the pGLEX41 vector as a control (pGLEX41).
  • GAPDH A and GAPDH B the same vectors without the GAPDH upstream and downstream elements
  • pGLEX41 the pGLEX41 vector as a control
  • the mean value of GFP fluorescence expressed by clones and minipools from stable transfections was read 14 days after transfection.
  • Figure 6 shows the effect of medium additives insulin and PMA (phorbol 12-myristate 13- acetate, a phorbol ester) on expression of IgGl antibody in the supernatant.
  • FIG 7 shows an overview of the human GAPDH locus.
  • the GAPDH gene is flanked by the genes NCAPD2 and IFFOl .
  • Figure 8 shows details of the human GAPDH gene, the GAPDH up- and downstream elements and the fragments created for the analysis of the GAPDH upstream fragmentation study.
  • the Nrul restriction site was introduced to facilitate cloning steps and is not part of the genomic 5' GAPDH upstream sequence (it is therefore highlighted using an asterisk).
  • Fragment 1 (SEQ ID NO: 9): 511 bps
  • Fragment 2 (SEQ ID NO: 10): 2653 bps
  • Fragment 3 (SEQ ID NO: 11): 1966 bps
  • Fragment 4 (SEQ ID NO: 12): 1198 bps
  • Fragment 8 (SEQ ID NO: 13): 259 bps
  • Fragment 9 (SEQ ID NO: 14): 1947 bps
  • Fragment 11 SEQ ID NO: 15
  • 1436 Fragment 17
  • Fragment 17 (SEQ ID NO: 16): 1177 bps.
  • Figure 9 shows expression results of fragmentation of the GAPDH upstream and downstream elements. Expression results were obtained in transient transfection in CHO cells on day 10 after transfection. The quantification was done using the Octet instrument.
  • Vector pGLEX41 serves as negative control.
  • pGLEX41-ampiA also is a negative control showing the basal expression of the vector without the GAPDH flanking elements.
  • pGLEX41-up/down contains the full length flanking (upstream and downstream) regions and serves as positive control.
  • pGLEX41-up contains only the upstream flanking region and pGLEX41-down contains only the downstream flanking region. All other constructs contain the fragments described in Figure 8.
  • the fragments 2 and 3 were either cloned in the same direction as IgGl LC and IgGl HC or in opposite direction in relation to IgGl LC and IgGl HC (AS).
  • Figure 10 shows transient expression of IgGl antibody in CHO-S cells on day 8 post- transfection (Mean of IgG titers are plotted for three independent transfections; error bars: SD +/-).
  • Cells were transfected using vectors with the Chinese hamster GAPDH upstream element in combination with the mouse CMV (A GAPDH UP) or the Chinese hamster GAPDH promoter (A G APDH UP PR) .
  • the plasmids having only the mouse CMV (A) or the Chinese hamster GAPDH promoter (A PR) were transfected as a control.
  • the concentration of the accumulated IgGl antibody in the supernatant was determined using the Octet QK instrument (Fortebio, Menlo, CA, USA). Detailed description of the invention
  • the present disclosure relates to expression cassettes and expression vectors which comprise a promoter, a polynucleotide sequence encoding a polypeptide, and a non-translated genomic DNA sequence downstream of a eukaryotic Glyceraldehyde 3 -phosphate dehydrogenase (GAPDH) promoter, wherein the polypeptide encoded by the polynucleotide sequence is not GAPDH, and wherein the non-translated genomic DNA sequence downstream of the eukaryotic GAPDH promoter starts within a region spanning from nucleotide position around + 1 to nucleotide position around +7000, wherein the nucleotide position is relative to the transcription start of the GAPDH mRNA, and wherein the length of the non-translated genomic DNA sequence downstream of the eukaryotic GAPDH promoter is from around 100 to around 15000 nucleotides.
  • GPDH Glyceraldehyde 3 -phosphate dehydrogenase
  • the present disclosure further relates to an expression cassette which comprises a promoter, a polynucleotide sequence encoding a polypeptide, and a non-translated genomic DNA sequence upstream of a eukaryotic GAPDH promoter, wherein the polypeptide encoded by the polynucleotide sequence is not GAPDH, and wherein the non-translated genomic DNA sequence upstream of the eukaryotic GAPDH promoter starts within a region spanning from around the 5' end of the eukaryotic GAPDH promoter to nucleotide position around -3500, wherein the nucleotide position is relative to the transcription start of the GAPDH mRNA, wherein the length of the non-translated genomic DNA sequence upstream of the eukaryotic GAPDH promoter is from 100 to around 15000 nucleotides, with the proviso that the expression cassette does not comprise a eukaryotic GAPDH promoter or fragments thereof.
  • expression cassette includes a polynucleotide sequence encoding a polypeptide to be expressed and sequences controlling its expression such as a promoter and optionally an enhancer sequence, including any combination of cis-acting transcriptional control elements.
  • sequences controlling the expression of the gene i.e. its transcription and the translation of the transcription product, are commonly referred to as regulatory unit. Most parts of the regulatory unit are located upstream of coding sequence of the gene and are operably linked thereto.
  • the expression cassette may also contain a downstream 3' untranslated region comprising a polyadenylation site.
  • the regulatory unit of the invention is either operably linked to the gene to be expressed, i.e.
  • the expression cassette is flanked by one or more suitable restriction sites in order to enable the insertion of the expression cassette into a vector and/or its excision from a vector.
  • the expression cassette according to the present invention can be used for the construction of an expression vector, in particular a mammalian expression vector.
  • the expression cassette of the present invention may comprise one or more e.g. two, three or even more non-translated genomic DNA sequences downstream of a eukaryotic
  • GAPDH promoter or fragments thereof and/or one or more e.g. two, three or even more non- translated genomic DNA sequences upstream of a eukaryotic GAPDH promoter or fragments thereof.
  • the expression cassette of the present invention comprises more than one DNA sequence downstream and/or upstream of a eukaryotic GAPDH promoter or fragments thereof these DNA sequences may be directly linked, i.e. may comprise linker sequences e.g. linker sequences containing restriction sites that are attached to the 5'- and 3'- ends and that allow comfortable sequential cloning of the sequences or fragments thereof.
  • the DNA sequences downstream and/or upstream of a eukaryotic GAPDH promoter or fragments thereof may be not directly linked, i.e. may be cloned with intervening DNA sequences.
  • polynucleotide sequence encoding a polypeptide includes DNA coding for a gene, preferably a heterologous gene expressing the polypeptide.
  • heterologous coding sequence refers to a DNA sequence that codes for a recombinant, in particular a recombinant heterologous protein product that is sought to be expressed in a host cell, preferably in a mammalian cell and harvested.
  • the product of the gene can be a polypeptide.
  • the heterologous gene sequence is naturally not present in the host cell and is derived from an organism of the same or a different species and may be genetically modified.
  • protein and “polypeptide” are used interchangeably to include a series of amino acid residues connected to the other by peptide bonds between the alpha-amino and carboxy groups of adj acent residues .
  • non-translated genomic DNA sequence includes DNA that constitutes genetic information of an organism.
  • the genome of almost all organisms is DNA, the only exceptions being some viruses that have a RNA genome.
  • Genomic DNA molecules in most organisms are organized into DNA-protein complexes called
  • chromosomes The size, number of chromosomes, and nature of genomic DNA varies between different organisms. Viral DNA genomes can be single- or double-stranded, linear or circular. All other organisms have double-stranded DNA genomes. Bacteria have a single, circular chromosome. In eukaryotes, most genomic DNA is located within the nucleus (nuclear DNA) as multiple linear chromosomes of different sizes. Eukaryotic cells additionally contain genomic DNA in the mitochondria and, in plants and lower eukaryotes, the chlorop lasts. This DNA is usually a circular molecule and is present as multiple copies within these organelles. A non-translated genomic DNA sequence is normally not operably linked to a promoter and thus is not translated. It may contain gene(s) which are not translated, thus gene(s) that encode e.g. a protein which is not expressed.
  • non-translated genomic DNA sequence downstream of a eukaryotic GAPDH promoter corresponds to non-translated eukaryotic genomic DNA 3' of a eukaryotic GAPDH promoter.
  • Non-translated genomic DNA sequence downstream of a eukaryotic GAPDH promoter normally starts at nucleotide position around +1 , preferably at nucleotide position +1, wherein the nucleotide position is relative to the transcription start of the GAPDH m NA i.e. is relative to the origin of the transcription start of the eukaryotic gene coding for GAPDH.
  • the non-translated genomic DNA sequence downstream of a eukaryotic GAPDH promoter is usually of the same origin as the eukaryotic GAPDH promoter, e.g. if the GAPDH promoter is of human origin the non-translated genomic DNA sequence downstream of the human GAPDH promoter is as well of human origin and corresponds to the naturally occurring human genomic DNA sequence downstream of the human GAPDH promoter.
  • non-translated genomic DNA sequence upstream of a eukaryotic GAPDH promoter corresponds to non-translated eukaryotic genomic DNA 5' of a eukaryotic GAPDH promoter.
  • Non-translated genomic DNA sequence upstream of a eukaryotic GAPDH promoter normally starts at a nucleotide position around the 5 ' end of the eukaryotic GAPDH promoter, preferably at the nucleotide position immediately after the 5' end of the eukaryotic GAPDH promoter.
  • the non-translated genomic DNA sequence upstream of a eukaryotic GAPDH promoter is usually of the same origin as the eukaryotic GAPDH promoter, e.g. if the GAPDH promoter is of human origin the non-translated genomic DNA sequence upstream of the human GAPDH promoter is as well of human origin and corresponds to the naturally occurring human genomic DNA sequence upstream of the human GAPDH promoter.
  • Positions of the eukaryotic GAPDH promoter, the non-translated genomic DNA sequence downstream or upstream of the eukaryotic GAPDH promoter and other DNA sequences as indicated herein are relative to the transcription start of the GAPDH mRNA e.g. are relative to the origin of the transcription start of the eukaryotic GAPDH if not specifically otherwise indicated.
  • non-translated genomic DNA sequence upstream of a eukaryotic GAPDH promoter extends to
  • non-translated genomic DNA sequence downstream of a eukaryotic GAPDH promoter extends to is used to define extension of the length of non-translated genomic DNA sequence upstream and/or downstream of a eukaryotic GAPDH promoter from the start to a particular genetic element e.g. extension to an intron. This extension includes the full length of the DNA sequence encoding the genetic element e.g. the intron or a part thereof.
  • the eukaryotic GAPDH promoter and the eukaryotic genomic DNA upstream and/or downstream of the GAPDH promoter can be found for human, rat and mouse in the NCBI public databank (Entries for human, mouse, rat and Chinese hamster GAPDH gene are Gene IDs 2597 (mRNA: NM_002046.3), 14433 (mRMA: NM_008084.2), 24383 (mRNA: NM_017008.3) and 100736557 (mR A: NM_001244854.2), respectively; National Center for Biotechnology Information (NCBI): http://www.ncbi.nlm.nih.gov/) and are exemplarily shown in Figure 7 and 8 for the human GAPDH gene.
  • NCBI National Center for Biotechnology Information
  • the eukaryotic GAPDH promoter is usually considered to stretch from around bps -500 to around +50 relative to the transcription start of the GAPDH mRNA.
  • the human GAPDH promoter is located on chromosome 12.
  • the human GAPDH promoter is considered by Graven et al. (Graven et al., (1999) Biochimica et Biophysics Acta, 147: 203-218) to stretch from bps -488 to +20 relative to the transcription start of the GAPDH mRNA based on a fragmentation study.
  • the human GAPDH promoter stretches from bps -462 to +46 relative to the transcription start of the GAPDH mRNA as defined by the NCBI public databank. If not specifically otherwise indicated, the human GAPDH promoter as referred to herein stretches from -462 to position +46 relative to the transcription start of the GAPDH mRNA which correspond to the sequence stretching from bps 4071 to 4578 of SEQ ID NO: 17.
  • the numbering used for the DNA of the GAPDH gene, the IFF01 gene and the NCAPD2 gene of human, mouse and rat origin as referred herein corresponds to the numbering used for these genes in the NCBI public databank (http://www.ncbi.nlm.nih.gov/).
  • promoter as used herein defines a regulatory DNA sequence generally located upstream of a gene that mediates the initiation of transcription by directing RNA polymerase to bind to DNA and initiating RNA synthesis.
  • the vectors of the present invention optionally include enhancers.
  • functionally linked and “operably linked” are used interchangeably and refer to a functional relationship between two or more DNA segments, in particular gene sequences to be expressed and those sequences controlling their expression.
  • a promoter and/or enhancer sequence including any combination of cis-acting transcriptional control elements is operably linked to a coding sequence if it stimulates or modulates the transcription of the coding sequence in an appropriate host cell or other expression system.
  • Promoter regulatory sequences that are operably linked to the transcribed gene sequence are physically contiguous to the transcribed sequence.
  • Orientation refers to the order of nucleotides in a given DNA sequence. For example, an orientation of a DNA sequence in opposite direction in relation to another DNA sequence is one in which the 5' to 3' order of the sequence in relation to another sequence is reversed when compared to a point of reference in the DNA from which the sequence was obtained. Such reference points can include the direction of transcription of other specified DNA sequences in the source DNA and/or the origin of replication of replicable vectors containing the sequence.
  • expression vector includes an isolated and purified DNA molecule which upon transfection into an appropriate host cell provides for a high-level expression of a recombinant gene product within the host cell.
  • the expression vector comprises regulatory DNA sequences that are required for an efficient transcription of the DNA coding sequence into mRNA and for an efficient translation of the mRNAs into proteins in the host cell line.
  • host cell or “host cell line” as used herein include any cells, in particular mammalian cells, which are capable of growing in culture and expressing a desired recombinant product protein.
  • fragment includes a portion of the respective nucleotide sequence e.g. a portion of the non-translated genomic DNA sequence downstream and/or upstream of a eukaryotic GAPDH promoter or a portion of the nucleotide sequence encoding a particular genetic element such as a promoter. Fragments of a non-translated genomic DNA sequence downstream and/or upstream of a eukaryotic GAPDH promoter may retain biological activity and hence alter e.g. increase the expression patterns of coding sequences operably linked to a promoter.
  • Fragments of a non-translated genomic DNA sequence downstream and/or upstream of a eukaryotic GAPDH promoter may range from at least about 100 to about 3000 bp, preferably from about 200 to about 2800 bp, more preferably from about 300 to about 2000 bp nucleotides, in particular from about 500 to about 1500 bp nucleotides.
  • usually linker sequences containing restriction sites that allow comfortable cloning are attached to the 5'- and 3'- ends of the fragments.
  • nucleotide sequence identity or “identical nucleotide sequence” as used herein include the percentage of nucleotides in the candidate sequence that are identical with the nucleotide sequence of e.g. the non-translated genomic DNA sequence downstream and/or upstream of a eukaryotic GAPDH promoter, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity.
  • sequence identity can be determined by standard methods that are commonly used to compare the similarity in position of the nucleotides of two nucleotide sequences.
  • nucleotide sequence identity of the candidate sequence to the non-translated genomic DNA sequence downstream and/or upstream of a eukaryotic GAPDH promoter is at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95%, in particular 96%, more particular 97%, even more particular 98%>, most particular 99%, including for example, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, and 100%.
  • CpG site as used herein include regions of DNA where a cytosine nucleotide occurs next to a guanine nucleotide in the linear sequence of bases along its length.
  • CpG is shorthand for "— C— phosphate— G— ", that is, cytosine and guanine separated by only one phosphate; phosphate links any two nucleosides together in DNA.
  • the "CpG” notation is used to distinguish this linear sequence from the CG base-pairing of cytosine and guanine.
  • alternative codon usage as used herein includes usage of alternative codons coding for the same amino acid in order to avoid the CpG sequence motif.
  • codons not having an internal CpG site for example GCG coding for Alanine and containing a CpG site, might be replaced by either GCT, GCC or GCA
  • around in relation to the length of a DNA sequence and in relation to a nucleotide position which is relative to the transcription start of the GAPDH mRNA e.g. is relative to the origin of the transcription start of the eukaryotic GAPDH includes values with deviations of a maximum of ⁇ 50 % , usually of a maximum of ⁇ 10 % of the stated values e.g. "around 3000 nucleotides” includes values of 2700 to 3300 nucleotides, preferably 2900 to 3100 nucleotides, more preferably 2995 to 3005 nucleotides, "around 100
  • nucleotides includes values of 50 to 150 nucleotides, preferably 90 to 110 nucleotides, more preferably 95 to 105 nucleotides, "around 15000 nucleotides” includes values of 13500 to 16500 nucleotides, preferably 14500 to 15500 nucleotides, more preferably 14990 to 15010 nucleotides, most preferably 14995 to 15005 nucleotides, "around 200 nucleotides” includes values of 150 to 250 nucleotides, preferably 190 to 210 nucleotides, more preferably 195 to 205 nucleotides, "around 8000 nucleotides” includes values of 7200 to 8800, preferably 7500 to 8500 nucleotides, more preferably 7990 to 8010 nucleotides, most preferably 7995 to 8005 nucleotides, "around 500 nucleotides” includes values of 450 to 550 nucleotides, preferably 475 to 525, more preferably 490 to
  • nucleotides includes values of 900 to 1100 nucleotides, preferably 950 to 1050, more preferably 990 to 1010, most preferably 995 to 1005 nucleotides
  • around 4500 nucleotides includes values of 4050 to 4950 nucleotides, preferably 4250 to 4750, more preferably 4490 to 4510, most preferably 4495 to 4505 nucleotides
  • around 1500 nucleotides includes values of 1350 to 1650 nucleotides, preferably 1450 to 1550, more preferably 1490 to 1510, most preferably 1495 to 1505 nucleotides
  • "around 4000 nucleotides” includes values of 3600 to 4400 nucleotides, preferably 3800 to 4200, more preferably 3990 to 4010, more preferably 3995 to 4005 nucleotides
  • around 2000 nucleotides includes values of 1800 to 2200 nucleotides, preferably 1900 to 2100, more preferably 1990 to 2010, most preferably 1995 to
  • the term "around" as used herein in relation to the numbering used for the DNA of the GAPDH gene, the IFFOl gene and the NCAPD2 gene of human, mouse and rat origin as referred herein or used herein in relation to a position in a sequence of a SEQ ID number includes values with deviations of a maximum of ⁇ 500 bps, preferably ⁇ 100 bps, more preferably ⁇ 10 bps, most preferably ⁇ 5 bps.
  • the present disclosure provides an expression cassette which comprises a promoter, a polynucleotide sequence encoding a polypeptide, and a non-translated genomic DNA sequence downstream of a eukaryotic GAPDH promoter, wherein the polypeptide encoded by the polynucleotide sequence is not GAPDH, and wherein the non-translated genomic DNA sequence downstream of the eukaryotic GAPDH promoter starts within a region spanning from nucleotide position around +1 to nucleotide position around +7000, wherein the nucleotide position is relative to the transcription start of the GAPDH mRNA, and wherein the length of the non-translated genomic DNA sequence downstream of the eukaryotic GAPDH promoter is from around 100 to around 15000 nucleotides.
  • the length of the non-translated genomic DNA sequence downstream of a eukaryotic GAPDH promoter is at least around 100 nucleotides and extends at its maximum to the second last intron of the IFFOl gene or to a part thereof. In one embodiment, the length of the non-translated genomic DNA sequence downstream of a eukaryotic GAPDH promoter is at least around 100 nucleotides and extends at its maximum to the last intron of the IFFOl gene.
  • the human IFFOl gene is located in human DNA around bps 6665249 to 6648694 of chromosome 12 (NCBI gene ID: 25900).
  • the length of the non-translated genomic DNA sequence downstream of a eukaryotic GAPDH promoter extending at its maximum to the last intron of the IFFOl gene in human stretches at its maximum to around bps 6650677 of chromosome 12 coding for the IFFOl gene in human (position +7021). In one embodiment, the length of the non-translated genomic DNA sequence downstream of a eukaryotic GAPDH promoter extending at its maximum to the second last intron of the IFFOl gene in human stretches at its maximum to around bps 6657230 of chromosome 12 coding for the IFFOl gene in human (position + 13574).
  • the non-translated genomic DNA sequences downstream of a eukaryotic GAPDH promoter extending at its maximum to the last intron of the IFFOl gene in human and to the second last intron of the IFFOl gene in human, respectively , are included in SEQ ID NO: 17 which shows bps 6657230 to 6639125 of chromosome 12 (NCBI gene ID: 25900).
  • the non-translated genomic DNA sequence downstream of a eukaryotic GAPDH promoter extending to the last intron stretches to around bps 11553 of the nucleotide sequence as shown by SEQ ID NO: 17 and the non-translated genomic DNA sequence downstream of a eukaryotic GAPDH promoter extending to the second last intron stretches to around bps 18106 of the nucleotide sequence as shown by SEQ ID NO: 17.
  • the mouse IFFOl gene (NCBI gene ID: 320678) is located in mouse DNA around bps 125095259 to 125111800 of chromosome 6.
  • the length of the non- translated genomic DNA sequence downstream of a eukaryotic GAPDH promoter extending at its maximum to the last intron of the IFFOl gene in mouse stretches at its maximum to around bps 125109211 of chromosome 6 coding for the IFFOl gene in mouse (position + 6391).
  • the length of the non-translated genomic DNA sequence downstream of a eukaryotic GAPDH promoter extending at its maximum to the second last intron of the IFFOl gene in mouse stretches at its maximum to around bps 125103521 of chromosome 6 coding for the IFFOl gene in mouse (position +12081).
  • the non-translated genomic DNA sequences downstream of a eukaryotic GAPDH promoter extending at its maximum to the last intron and to the second last intron of the IFFOl gene in mouse, respectively are included in SEQ ID NO: 18 which shows bps 125103521 to 125119832 of chromosome 6 (NCBI gene ID: 320678).
  • the non-translated genomic DNA sequence downstream of a eukaryotic GAPDH promoter extending to the last intron of the IFFOl gene in mouse stretches to around bps 10622 of the nucleotide sequence as shown by SEQ ID NO: 18 and the non-translated genomic DNA sequence downstream of a eukaryotic GAPDH promoter extending to the second last intron of the IFFOl gene in mouse stretches to around bps 16312 of the nucleotide sequence as shown by SEQ ID NO: 18.
  • the rat IFFOl gene (NCBI gene ID: 362437) is located in rat DNA around bps 161264966 to 161282150 of chromosome 4.
  • the length of the non-translated genomic DNA sequence downstream of a eukaryotic GAPDH promoter extending at its maximum to the last intron of the IFFOl gene in rat stretches at its maximum to around bps 161280937 of the chromosome 4 coding for IFFOl gene in rat (position + 5154).
  • the length of the non-translated genomic DNA sequence downstream of a eukaryotic GAPDH promoter extending at its maximum to the second last intron of the IFFOl gene in rat stretches at its maximum to around bps 161279451 of chromosome 4 coding for the IFFOl gene in rat (position +6640).
  • the non-translated genomic DNA sequences downstream of a eukaryotic GAPDH promoter extending at its maximum to the last intron and to the second last intron of the IFFOl gene in rat, respectively are included in SEQ ID NO: 19 which shows bps 161279451 to 161290508 of chromosome 4 (NCBI gene ID: 362437).
  • the non-translated genomic DNA sequence downstream of a eukaryotic GAPDH promoter extending to the last intron of the IFFOl gene stretches to around bps 9572 of the nucleotide sequence as shown by SEQ ID NO: 19 and the non-translated genomic DNA sequence downstream of a eukaryotic GAPDH promoter extending to the second last intron of the IFFOl gene stretches to around bps 11058 bps of the nucleotide sequence as shown by SEQ ID NO: 19.
  • the Chinese hamster IFFOl gene (NCBI gene ID: 100753382) is located in Chinese hamster DNA around bps 3577293 to 3593683.
  • the length of the non-translated genomic DNA sequence downstream of a eukaryotic GAPDH promoter extending at its maximum to the last intron of the IFFOl gene in Chinese hamster stretches at its maximum to around bps 3579014 coding for IFFOl gene in Chinese hamster (position +6883).
  • the length of the non-translated genomic DNA sequence downstream of a eukaryotic GAPDH promoter extending at its maximum to the second last intron of the IFFOl gene in Chinese hamster stretches at its maximum to around bps 3585061 coding for the IFFOl gene in Chinese hamster (position +12930).
  • the chromosomal location is not yet annotated in the NCBI databank and the current sequence information contains many unknown bases. Therefore the precise annotation of the limits may change with the availability of more accurate sequence information.
  • the non-translated genomic DNA sequences downstream of a eukaryotic GAPDH promoter extending at its maximum to the last intron and to the second last intron of the IFFOl gene in Chinese hamster, respectively are included in SEQ ID NO: 29 which shows bps 3567932 to 3585061.
  • the non-translated genomic DNA sequence downstream of a eukaryotic GAPDH promoter extending to the last intron of the IFFOl gene stretches to around bps 11083 of the nucleotide sequence as shown by SEQ ID NO: 29 and the non-translated genomic DNA sequence downstream of a eukaryotic GAPDH promoter extending to the second last intron of the IFFOl gene stretches to around bps 17130 bps of the nucleotide sequence as shown by SEQ ID NO: 29.
  • the non-translated genomic DNA sequence downstream of a eukaryotic GAPDH promoter starts at the eukaryotic GAPDH polyadenylation site e.g. starts at the first nucleotide encoding the eukaryotic GAPDH polyadenylation site.
  • the non-translated genomic DNA sequence downstream of the eukaryotic GAPDH promoter starts downstream of the eukaryotic GAPDH polyadenylation site e.g. starts immediately after the last nucleotide encoding the eukaryotic GAPDH polyadenylation site.
  • the non-translated genomic DNA sequence downstream of the eukaryotic GAPDH promoter starts downstream of the eukaryotic GAPDH polyadenylation site and the length of the non-translated genomic DNA sequence downstream of the eukaryotic GAPDH promoter is at least around 100 nucleotides and extends at its maximum to the second last intron of the IFFOl gene.
  • the non-translated genomic DNA sequence downstream of the eukaryotic GAPDH promoter starts within a region spanning from nucleotide position around +3881 to nucleotide position around +5000, preferably within a region spanning from nucleotide position around +3931 to nucleotide position around +5000, more preferably within a region spanning from nucleotide position around +4070 to nucleotide position around +5000, wherein the nucleotide position is relative to the transcription start of the GAPDH mRNA.
  • downstream of the eukaryotic GAPDH polyadenylation site used in the present invention usually starts at a nucleotide position around position +3931 , preferably at a nucleotide position around +4070, wherein the nucleotide position is relative to the transcription start of the GAPDH mRNA.
  • the non-translated genomic DNA sequence downstream of the GAPDH polyadenylation site starts at around +3931 (relative to the transcription start of the GAPDH mRNA; which corresponds to bp 8463 as shown in SEQ ID NO: 17) and its length is around 3357 bps corresponding to the sequence from around bps 8463 to around 11819 as shown in SEQ ID NO: 17, more preferably it starts at around +4070 (relative to the transcription start of the GAPDH mRNA which corresponds to bp 8602 as shown in SEQ ID NO: 17) and its length is around 3218 bps corresponding to the sequence from around bps 8602 to around 11819 as shown in SEQ ID NO: 17 .
  • the non-translated genomic DNA sequence downstream of a eukaryotic GAPDH promoter comprises the nucleotide sequence selected from the group consisting of SEQ ID NOs: 8 and 21 or fragments thereof.
  • the non-translated genomic DNA sequence downstream of the eukaryotic GAPDH promoter comprises a nucleotide sequence complementary to the nucleotide sequence selected from the group consisting of SEQ ID NOs: 8 and 21 or fragments thereof.
  • the non-translated genomic DNA sequence downstream of the eukaryotic GAPDH promoter comprises a nucleotide sequence at least 80% identical to the nucleotide sequence selected from the group consisting of SEQ ID NOs: 8 and 21 or fragments thereof.
  • the nucleotide sequence selected from the group consisting of SEQ ID NOs: 8 and 21 or fragments thereof comprises five or less, preferably four or less, more preferably three or less, most preferred two or less, in particular one nucleic acid
  • nucleic acid modification(s) are preferably a nucleic acid substitution.
  • the length of the non-translated genomic DNA sequence downstream of the eukaryotic GAPDH promoter is preferably from around 200 to around 8000 nucleotides, more preferably from around 500 to around 5000 nucleotides, even more preferably from around 1000 to around 4500 nucleotides, most preferably from around 1500 to around 4000 nucleotides, in particular from around 2000 to around 3500 nucleotides, more particular from around 2700 to around 3300, even more particular around 3200, most particular 3218 nucleotides.
  • the length of the non-translated genomic DNA sequence downstream of the eukaryotic GAPDH promoter as defined herein does not include any linker sequences added to the non-translated genomic DNA sequence.
  • the non-translated genomic DNA sequence downstream of the eukaryotic GAPDH promoter is orientated in the same direction as the polynucleotide sequence encoding a polypeptide.
  • non-translated genomic DNA sequence downstream of the eukaryotic GAPDH promoter is orientated in opposite direction in relation to the
  • polynucleotide sequence encoding a polypeptide
  • the expression cassette which comprises a promoter, a polynucleotide sequence encoding a polypeptide, and a non-translated genomic DNA sequence downstream of a eukaryotic GAPDH promoter further comprises a non-translated genomic DNA sequence upstream of a eukaryotic GAPDH promoter, wherein the non-translated genomic DNA sequence upstream of the eukaryotic GAPDH promoter starts within a region spanning from around the 5' end of the eukaryotic GAPDH promoter to nucleotide position around -3500, wherein the nucleotide position is relative to the transcription start of the GAPDH mRNA, and wherein the length of the non-translated genomic DNA sequence upstream of the eukaryotic GAPDH promoter is from around 100 to around 15000 nucleotides.
  • the expression cassette comprises a promoter, a polynucleotide sequence encoding a polypeptide, and a non-translated genomic DNA sequence upstream of a eukaryotic GAPDH promoter, wherein the polypeptide encoded by the polynucleotide sequence is not GAPDH, and wherein the non-translated genomic DNA sequence upstream of the eukaryotic GAPDH promoter starts within a region spanning from around the 5 ' end of the eukaryotic GAPDH promoter to nucleotide position around -3500, wherein the nucleotide position is relative to the transcription start of the GAPDH mRNA, wherein the length of the non-translated genomic DNA sequence upstream of the eukaryotic GAPDH promoter is from 100 to around 15000 nucleotides, with the proviso that the expression cassette does not comprise a eukaryotic GAPDH promoter or fragments thereof.
  • the expression cassette further comprises a non-translated genomic DNA sequence downstream of a eukaryotic GAPDH promoter, wherein the non-translated genomic DNA sequence downstream of the eukaryotic GAPDH promoter starts within a region spanning from nucleotide position around +1 to nucleotide position around +7000, wherein the nucleotide position is relative to the transcription start of the GAPDH mRNA, and wherein the length of the non-translated genomic DNA sequence downstream of the eukaryotic GAPDH promoter is from around 100 to around 15000 nucleotides.
  • the non-translated genomic DNA sequence downstream of a eukaryotic GAPDH promoter starts within a region spanning from nucleotide position around +1 to nucleotide position around +7000, wherein the nucleotide position is relative to the transcription start of the GAPDH mRNA, and wherein the length of the non-translated genomic DNA sequence downstream of the eukaryotic GAPDH promoter is from around 100 to around
  • GAPDH promoter used is e.g. as described supra.
  • the length of the non-translated genomic DNA sequence upstream of the eukaryotic GAPDH promoter is preferably from around 200 to around 8000 nucleotides, more preferably from around 500 to around 5000 nucleotides, even more preferably from around 1000 to around 4500 nucleotides, most preferably from around 1500 to around 4000 nucleotides, in particular from around 2000 to around 3500 nucleotides, more particular from around 2700 to around 3300, even more particular around 3200, most particular 3158 nucleotides in length.
  • the length of the non-translated genomic DNA sequence upstream of the eukaryotic GAPDH promoter as defined herein does not include any linker sequences added to the non-translated genomic DNA sequence.
  • the length of the non-translated genomic DNA sequence upstream of the eukaryotic GAPDH promoter is at least around 100 nucleotides and extends at its maximum to the start codon of the NCAPD2 gene. In a further embodiment, the length of the non-translated genomic DNA sequence upstream of the eukaryotic GAPDH promoter is at least around 100 nucleotides and extends at its maximum to the third last intron of the NCAPD2 gene. In a further embodiment, the length of the non-translated genomic DNA sequence upstream of the eukaryotic GAPDH promoter is at least around 100 nucleotides and extends at its maximum to the second last intron of the NCAPD2 gene. In a further embodiment, the length of the non-translated genomic DNA sequence upstream of the eukaryotic GAPDH promoter is at least around 100 nucleotides and extends at its maximum to the last intron of the NCAPD2 gene.
  • the human NCAPD2 gene (NCBI gene ID: 9918) is located in human DNA around bps 6603298 to 6641132 of chromosome 12.
  • the length of the non-translated genomic DNA sequence upstream of a eukaryotic GAPDH promoter extending at its maximum to the last intron of the NCAPD2 gene in human stretches at its maximum to around 6640243 bps of chromosome 12 coding for the NCAPD2 gene in human (position -3414 relative to the transcription start of the GAPDH gene which corresponds to bp 1119 in SEQ ID NO: 17).
  • the length of the non-translated genomic DNA sequence upstream of a eukaryotic GAPDH promoter extending at its maximum to the second last intron of the NCAPD2 gene in human stretches at its maximum to around 6639984 bps of chromosome 12 coding for the NCAPD2 gene in human (position -3673 relative to the transcription start of the GAPDH gene which corresponds to bp 860 in SEQ ID NO : 17).
  • the length of the non-translated genomic DNA sequence upstream of a eukaryotic GAPDH promoter extending at its maximum to the third last intron of the
  • NCAPD2 gene in human stretches at its maximum to around 6639125 bps of chromosome 12 coding for the NCAPD2 gene in human (position -4532 relative to the transcription start of the GAPDH gene; which corresponds to bp 1 in SEQ ID NO: 17).
  • the non-translated genomic DNA sequence upstream of a eukaryotic GAPDH promoter extending at its maximum to the last intron, to the second last intron and to the third last intron of the NCAPD2 gene in human, respectively are included in SEQ ID NO: 17, which shows bps 6657230 to 6639125 of chromosome 12 (NCBI gene ID: 9918).
  • the mouse NCAPD2 gene (Gene ID: 68298) is located in mouse DNA around position 125118025 to 125141604 of chromosome 6.
  • the length of the non- translated genomic DNA sequence upstream of a eukaryotic GAPDH promoter (estimated to have a a length of 500 bps upstream of the transcription start) extending at its maximum to the last intron of the NCAPD2 gene in mouse stretches at its maximum to around bps 125118607 of chromosome 6 coding for the NCAPD2 gene in mouse.
  • the length of the non-translated genomic DNA sequence upstream of a eukaryotic GAPDH promoter extending at its maximum to the second last intron of the NCAPD2 gene in mouse stretches at its maximum to around 125118880 bps of chromosome 6 coding for the NCAPD2 gene in mouse. In one embodiment, the length of the non-translated genomic DNA sequence upstream of a eukaryotic GAPDH promoter extending at its maximum to the third last intron of the
  • NCAPD2 gene in mouse stretches at its maximum to around 125119832 bps of chromosome 6 coding for the NCAPD2 gene in mouse.
  • the non-translated genomic DNA sequence upstream of a eukaryotic GAPDH promoter extending at its maximum to the last intron, to the second last intron and to the third last intron of the NCAPD2 gene in mouse, respectively are included in SEQ ID NO: 18, which shows bps 125103521 to 125119832 of chromosome 6 (NCBI gene ID: 68298).
  • the non- translated genomic DNA sequence upstream of a eukaryotic GAPDH promoter extending to the last intron stretches to around bps 1226 of the nucleotide sequence as shown by SEQ ID NO: 18 (-3006 relative to the transcription start of the mouse GAPDH mRNA).
  • the non- translated genomic DNA sequence downstream of a eukaryotic GAPDH promoter extending to the second last intron stretches to around bps 953 of the nucleotide sequence as shown by SEQ ID NO: 18 (-3279 relative to the transcription start of the mouse GAPDH mRNA).
  • the non-translated genomic DNA sequence downstream of a eukaryotic GAPDH promoter extending to the third last intron stretches to around bp 1 of the nucleotide sequence as shown by SEQ ID NO: 18 (-4231 relative to the transcription start of the mouse GAPDH mRNA).
  • the rat NCAPD2 gene (Gene ID: 362438) is located in eukaryotic DNA around position 161288671 to 161310417 of chromosome 4.
  • the length of the non- translated genomic DNA sequence upstream of a eukaryotic GAPDH promoter extending at its maximum to the last intron of the NCAPD2 gene in rat stretches at its maximum to around 161289191 bps of chromosome 4 coding for the NCAPD2 gene in rat.
  • the length of the non-translated genomic DNA sequence upstream of a eukaryotic GAPDH promoter extending at its maximum to the second last intron of the NCAPD2 gene in rat stretches at its maximum to around 161289446 bps of chromosome 4 coding for the NCAPD2 gene in rat.
  • the length of the non-translated genomic DNA sequence upstream of a eukaryotic GAPDH promoter extending at its maximum to the third last intron of the NCAPD2 gene in rat stretches at its maximum to around 161290508 bps of
  • chromosome 4 coding for the NCAPD2 gene in rat.
  • the non-translated genomic DNA sequence upstream of a eukaryotic GAPDH promoter extending at its maximum to the last intron, to the second last intron and to the third last intron of the NCAPD2 gene in rat, respectively are included in SEQ ID NO: 19, which shows bps 161279451 to 161290508 of chromosome 4 (NCBI gene ID: 362438).
  • the non-translated genomic DNA sequence upstream of a eukaryotic GAPDH promoter extending to the last intron stretches to around bps 1318 of the nucleotide sequence as shown by SEQ ID NO: 19 (-3101 relative to the transcription start of rat GAPDH mRNA).
  • the non-translated genomic DNA sequence downstream of a eukaryotic GAPDH promoter extending to the second last intron stretches to around bps 1063 of the nucleotide sequence as shown by SEQ ID NO: 19 (position -3356 relative to the transcription start of rat GAPDH mRNA).
  • the non-translated genomic DNA sequence downstream of a eukaryotic GAPDH promoter extending to the third last intron stretches to around bp 1 of the nucleotide sequence as shown by SEQ ID NO: 19 (position -4418 relative to the transcription start of rat GAPDH mRNA).
  • the Chinese hamster NCAPD2 gene (Gene ID: 100753087) is located in eukaryotic DNA around position 3544184 to 3569879.
  • the chromosomal location is not available on the NCBI database.
  • the length of the non-translated genomic DNA sequence upstream of a eukaryotic GAPDH promoter extending at its maximum to the last intron of the NCAPD2 gene in Chinese hamster stretches at its maximum to around 3569380 bps in Chinese hamster.
  • the length of the non-translated genomic DNA sequence upstream of a eukaryotic GAPDH promoter extending at its maximum to the second last intron of the NCAPD2 gene in Chinese hamster stretches at its maximum to around 3569131 bps in Chinese hamster.
  • the length of the non-translated genomic DNA sequence upstream of a eukaryotic GAPDH promoter extending at its maximum to the third last intron of the NCAPD2 gene in Chinese hamster stretches at its maximum to around 3567932 bps in Chinese hamster.
  • the non-translated genomic DNA sequence upstream of a eukaryotic GAPDH promoter extending at its maximum to the last intron, to the second last intron and to the third last intron of the NCAPD2 gene in Chinese hamster, respectively are included in SEQ ID NO: 29, which shows bps 3567932 to 3585061.
  • the non-translated genomic DNA sequence upstream of a eukaryotic GAPDH promoter extending to the last intron stretches to around bps 1449 of the nucleotide sequence as shown by SEQ ID NO: 29 (-2752 relative to the transcription start of Chinese hamster GAPDH mRNA).
  • the non-translated genomic DNA sequence downstream of a eukaryotic GAPDH promoter extending to the second last intron stretches to around bps 1200 of the nucleotide sequence as shown by SEQ ID NO: 29
  • the non-translated genomic DNA sequence upstream of a eukaryotic GAPDH promoter starts usually within a region spanning from nucleotide position around -500 to a nucleotide position around -3500, preferably within a region spanning from nucleotide position around -576 to nucleotide position around -3500, wherein the nucleotide position is relative to the transcription start of the GAPDH mRNA.
  • the non-translated genomic DNA sequence upstream of the eukaryotic GAPDH promoter starts usually at a nucleotide position around position -500, preferably at a nucleotide position around -576, wherein the nucleotide position is relative to the transcription start of the GAPDH mRNA.
  • the non-translated genomic DNA sequence upstream of the human GAPDH promoter starts at around nucleotide position -463 (relative to the transcription start of the GAPDH mRNA which corresponds to bp 4533 as shown in SEQ ID NO: 17).
  • the non-translated genomic DNA sequence upstream of the GAPDH promoter starts at around -500 (relative to the transcription start of the GAPDH mRNA; which corresponds to bp 4533 as shown in SEQ ID NO: 17).
  • the non-translated genomic DNA sequence upstream of the GAPDH promoter starts at around -576 (relative to the transcription start of the GAPDH mRNA; which corresponds to bp 4533 as shown in SEQ ID NO: 17) and its length is around 3158 bps corresponding to the sequence from around bps 800 to around 3957 as shown in SEQ ID NO: 17.
  • the non-translated genomic DNA sequence upstream of the eukaryotic GAPDH promoter comprises a nucleotide sequence selected from the group consisting of SEQ ID NOs: 7, 9, 10, 11, 12, 13, 14, 15, 16, 20, 22, 23, 24, 25, 26, 27 and 28 or fragments thereof, preferably a nucleotide sequence selected from the group consisting of SEQ ID NOs: 7, 9, 10, 11, 12, 13, 14, 15 and 16 or fragments thereof, or a nucleotide sequence selected from the group consisting of SEQ ID NOs: 20, 22, 23, 24, 25, 26, 27, 28 and 16 or fragments thereof.
  • nucleotide sequence selected from the group consisting of SEQ ID NOs: 10, 12, 15 and 16 or fragments thereof More preferred is a nucleotide sequence selected from the group consisting of SEQ ID NOs: 10, 12, 15 and 16 or fragments thereof, more preferably a nucleotide sequence selected from the group consisting of SEQ ID NOs: 10, 12, 15 and 16 or fragments thereof, wherein nucleotide sequences comprising SEQ ID NOs: 10 and/or 16 are orientated in opposite direction in relation to the polynucleotide sequence encoding a polypeptide, and nucleotide sequences comprising SEQ ID NOs: 12 and/or 15 are orientated in the same direction as the polynucleotide sequence encoding a polypeptide.
  • nucleotide sequence selected from the group consisting of SEQ ID NOs: 23, 25, 28 and 16 or fragments thereof more preferably a nucleotide sequence selected from the group consisting of SEQ ID NOs: 23, 25, 28 and 16 or fragments thereof, wherein nucleotide sequences comprising SEQ ID NOs: 23 and/or 16 are orientated in opposite direction in relation to the polynucleotide sequence encoding a polypeptide, and nucleotide sequences comprising SEQ ID NOs: 25 and/or 28 are orientated in the same direction as the
  • polynucleotide sequence encoding a polypeptide
  • the non-translated genomic DNA sequence upstream of the eukaryotic GAPDH promoter comprises a nucleotide sequence complementary to the nucleotide sequence selected from the group consisting of SEQ ID NOs: 7, 9, 10, 11, 12, 13, 14, 15, 16, 20, 22, 23, 24, 25, 26, 27 and 28 or fragments thereof, preferably a nucleotide sequence complementary to the nucleotide sequence selected from the group consisting of SEQ ID NOs: 7, 9, 10, 11, 12, 13, 14, 15 and 16 or fragments thereof, or a nucleotide sequence complementary to the nucleotide sequence selected from the group consisting of SEQ ID NOs: 20, 22, 23, 24, 25, 26, 27, 28 and 16 or fragments thereof.
  • nucleotide sequence complementary to the nucleotide sequence selected from the group consisting of SEQ ID NOs: 10, 12, 15 and 16 or fragments thereof is more preferred.
  • nucleotide sequence complementary to the nucleotide sequence selected from the group consisting of SEQ ID NOs: 23, 25, 28 and 16 or fragments thereof is more preferred.
  • the non-translated genomic DNA sequence upstream of the eukaryotic GAPDH promoter comprises a nucleotide sequence at least 80% identical to the nucleotide sequence selected from the group consisting of SEQ ID NOs: 7, 9, 10, 11, 12, 13, 14, 15, 16, 20, 22, 23, 24, 25, 26, 27 and 28 or fragments thereof, preferably a nucleotide sequence at least 80%> identical to the nucleotide sequence selected from the group consisting of SEQ ID NOs: 7, 9, 10, 11, 12, 13, 14, 15 and 16 or fragments thereof, or a nucleotide sequence at least 80% identical to the nucleotide sequence selected from the group consisting of SEQ ID NOs: 20, 22, 23, 24, 25, 26, 27, 28 and 16 or fragments thereof.
  • nucleotide sequence at least 80%> identical to the nucleotide sequence selected from the group consisting of SEQ ID NOs: 10, 12, 15 and 16 or fragments thereof more preferably a nucleotide sequence at least 80%> identical to the nucleotide sequence selected from the group consisting of SEQ ID NOs: 10, 12, 15 and 16 or fragments thereof, wherein nucleotide sequences comprising SEQ ID NOs: 10 and/or 16 are orientated in opposite direction in relation to the polynucleotide sequence encoding a polypeptide, and nucleotide sequences comprising SEQ ID NOs: 12 and/or 15 are orientated in the same direction as the
  • nucleotide sequence encoding a polypeptide is a nucleotide sequence at least 80%> identical to the nucleotide sequence selected from the group consisting of SEQ ID NOs: 23, 25, 28 and 16 or fragments thereof, more preferably a nucleotide sequence at least 80%> identical to the nucleotide sequence selected from the group consisting of SEQ ID NOs: 23, 25, 28 and 16 or fragments thereof, wherein nucleotide sequences comprising SEQ ID NOs: 23 and/or 16 are orientated in opposite direction in relation to the polynucleotide sequence encoding a polypeptide, and nucleotide sequences comprising SEQ ID NOs: 25 and/or 28 are orientated in the same direction as the polynucleotide sequence encoding a polypeptide.
  • the nucleotide sequence selected from the group consisting of SEQ ID NOs: 7, 9, 10, 11, 12, 13, 14, 15, 16, 20, 22, 23, 24, 25, 26, 27 and 28 or fragments thereof comprises five or less, preferably four or less, more preferably three or less, most preferred two or less, in particular one nucleic acid modification, wherein the nucleic acid
  • modification(s) are preferably a nucleic acid substitution.
  • the nucleotide sequence selected from the group consisting of SEQ ID NOs: 7, 9, 11, 14, 20, 22, 24 and 27 or fragments thereof comprises five or less, preferably four or less, more preferably three or less, most preferred two or less, in particular one nucleic acid modification, wherein the nucleic acid modification(s) are preferably a nucleic acid substitution.
  • the nucleotide sequence selected from the group consisting of SEQ ID NOs: 7, 9, 11, 14, or fragments thereof comprises one nucleic acid substitution at position 16 relative to the start of the nucleotide sequence of SEQ ID NOs: 1, 9, 11, 14.
  • G at position 16 relative to the start of the nucleotide sequence is replaced with T.
  • the nucleotide sequence selected from the group consisting of SEQ ID NOs: 20, 22, 24 and 27 or fragments thereof comprises one nucleic acid substitution at position 13 relative to the start of the nucleotide sequence of SEQ ID NOs: 20, 22, 24 and 27.
  • G at position 13 relative to the start of the nucleotide sequence is replaced with T.
  • the non-translated genomic DNA sequence upstream of the eukaryotic GAPDH promoter is orientated in the same direction as the polynucleotide sequence encoding a polypeptide.
  • non-translated genomic DNA sequence upstream of the eukaryotic GAPDH promoter is orientated in opposite direction in relation to the
  • polynucleotide sequence encoding a polypeptide
  • the expression cassette comprises a promoter, a polynucleotide sequence encoding a polypeptide, and a non-translated genomic DNA sequence downstream of a eukaryotic GAPDH promoter and a non-translated genomic DNA sequence upstream of a eukaryotic GAPDH promoter as described supra.
  • the origin of the non-translated genomic DNA sequence downstream of a eukaryotic GAPDH promoter and the non- translated genomic DNA sequence upstream of a eukaryotic GAPDH promoter is the same i.e. is of the same species.
  • the origin of the non-translated genomic DNA sequence downstream of a eukaryotic GAPDH promoter, the non-translated genomic DNA sequence upstream of a eukaryotic GAPDH promoter and the host cell is the same i.e. is of the same species, e.g. the origin of the non-translated genomic DNA sequence downstream of a eukaryotic GAPDH promoter, the non-translated genomic DNA sequence upstream of a eukaryotic GAPDH promoter and the host cell is from the same mammal e.g. from human.
  • the promoter of the expression cassette is not a GAPDH promoter from the same species. In some embodiments, if the non-translated genomic DNA sequence downstream and/or upstream of the eukaryotic GAPDH promoter is non-translated genomic DNA sequence downstream and/or upstream of human origin, the promoter of the expression cassette is not a human GAPDH promoter.
  • the promoter of the expression cassette is not a GAPDH promoter.
  • the expression cassette comprises a promoter, a polynucleotide sequence encoding a polypeptide, and a non-translated genomic DNA sequence downstream of a eukaryotic Glyceraldehyde 3 -phosphate dehydrogenase (GAPDH) promoter, wherein the polypeptide encoded by the polynucleotide sequence is not GAPDH, and wherein the non- translated genomic DNA sequence downstream of the eukaryotic GAPDH promoter starts within a region spanning from nucleotide position around +1 to nucleotide position around +7000, wherein the nucleotide position is relative to the transcription start of the GAPDH mRNA, and wherein the length of the non-translated genomic DNA sequence downstream of the eukaryotic GAPDH promoter is from around 100 to around 15000 nucleotides and wherein the expression cassette further comprises a non-translated
  • the non-translated genomic DNA sequence upstream of the eukaryotic GAPDH promoter starting within a region spanning from around the 5 ' end of the eukaryotic GAPDH promoter to nucleotide position around -3500 is preferably located directly upstream of the eukaryotic GAPDH promoter, more preferably in this embodiment the expression cassette comprises the naturally occurring genomic DNA sequence comprising the eukaryotic GAPDH promoter and extending to nucleotide position around -3500, wherein the nucleotide position is relative to the transcription start of the GAPDH mRNA.
  • the non-translated genomic DNA sequence downstream and/or upstream of the eukaryotic GAPDH promoter is of mammalian origin, e.g. the eukaryotic GAPDH promoter is a mammalian GAPDH promoter and non-translated genomic DNA sequence downstream and/or upstream of the mammalian GAPDH promoter is used as described herein.
  • the non-translated genomic DNA sequence downstream and/or upstream of the eukaryotic GAPDH promoter is of rodent or human origin, e.g. the eukaryotic GAPDH promoter is a rodent or human GAPDH promoter and non-translated genomic DNA sequence downstream and/or upstream of the rodent or the human GAPDH promoter is used as described herein.
  • the non-translated genomic DNA sequence downstream and/or upstream of the eukaryotic GAPDH promoter is selected from human, rat or mouse origin, more preferably from human or mouse origin, most preferably from human origin.
  • the non-translated genomic DNA sequence downstream and/or upstream of the eukaryotic GAPDH promoter is not operably linked to the polynucleotide sequence encoding the polypeptide.
  • the expression cassette comprises a polyadenylation site.
  • the polyadenylation site is selected from the group consisting of SV40 poly(A) and BGH (Bovine Growth Hormone) poly(A).
  • the promoter and the polynucleotide sequence encoding a polypeptide of the expression cassette are operably linked.
  • the promoter of the expression cassette is selected from the group consisting of SV40 promoter, human tk promoter, MPSV promoter, mouse CMV, human CMV, rat CMV, human EF 1 alpha, Chinese hamster EF 1 alpha, human GAPDH, hybrid promoters including MYC, HYK and CX promoter.
  • the polypeptide encoded by the expression cassette can be a non- glycosylated and glycosylated polypeptide.
  • Glycosylated polypeptides refer to polypeptides having at least one oligosaccharide chain. Examples for non-glycosylated proteins are e. g.
  • non-glycosylated hormones include nerve growth factor (NGF) family, of the epithelial growth factor (EGF) and of the fibroblast growth factor (FGF) family and non-glycosylated receptors for hormones and growth factors.
  • GNF nerve growth factor
  • EGF epithelial growth factor
  • FGF fibroblast growth factor
  • glycosylated proteins are hormones and hormone releasing factors, clotting factors, anti-clotting factors, receptors for hormones or growth factors, neurotrophic factors cytokines and their receptors, T-cell receptors, surface membrane proteins, transport proteins, homing receptors, addressins, regulatory proteins, antibodies, chimeric proteins, such as immunoadhesins, and fragments of any of the glycosylated proteins.
  • the polypeptide is selected from the group consisting of antibodies, antibody fragments or antibody derivates (e.g. Fc fusion proteins and particular antibody formats like bispecific antibodies).
  • Antibody fragment as used herein includes, but is not limited to, (i) a domain, (ii) the Fab fragment consisting of VL, VH, CL or CK and CHI domains, including Fab' and Fab'-SH, (iii) the Fd fragment consisting of the VH and CHI domains, (iv) the dAb fragment (Ward ES et al, (1989) Nature, 341(6242): 544-6) which consists of a single variable domain (v) F(ab')2 fragments, a bivalent fragment comprising two linked Fab fragments (vi) single chain Fv molecules (scFv), wherein a VH domain and a VL domain are linked by a peptide linker which allows the two domains to associate to form an antigen binding site (Bird RE et
  • the expression cassette further comprises a genetic element selected from the group consisting of an additional promoter, an enhancer, transcriptional control elements, and a selectable marker, preferably a selectable marker which is expressed in animal cells.
  • Transcriptional control elements are e.g. Kozak sequences or transcription terminator elements.
  • the genetic element is a selectable marker wherein the content of CpG sites contained in the polynucleotide sequence encoding the selectable marker is 45 or less, preferably 40 or less, more preferably 20 or less, in particular 10 or less, more particular 5 or less, most particular 0 (CpG sites have been completely removed).
  • the present disclosure provides an expression vector, preferably a mammalian expression vector comprising an expression cassette as described supra.
  • the expression vector comprises at least two separate transcription units.
  • An expression vector with two separate transcription units is also referred to as a double-gene vector.
  • An example thereof is a vector, in which the first transcription unit encodes the heavy chain of an antibody or a fragment thereof and the second transcription unit encodes the light chain of an antibody.
  • Another example is a double-gene vector, in which the two transcription units encode two different subunits of a protein such as an enzyme.
  • the expression vector of the present invention comprises more than two separate transcription units, for example three, four or even more separate transcription units each of which comprises a different nucleotide sequence encoding a different polypeptide chain.
  • An example therefore is a vector with four separate transcription units, each of which contains a different nucleotide sequence encoding one subunit of an enzyme consisting of four different subunits.
  • the expression vector further comprises a genetic element selected from the group consisting of an additional promoter, an enhancer, transcriptional control elements, an origin of replication and a selectable marker.
  • the expression vector further comprises an origin of replication and a selectable marker wherein the content of the CpG sites contained in the polynucleotide sequence of the expression vector encoding the origin of replication and the selectable marker is 200 or less, preferably 150 or less, in particular 100 or less, more particular 50 or less, most particular 30 or less.
  • any selection marker commonly employed such as thymidine kinase (tk), dihydrofolate reductase (DHFR), puromycin, neomycin or glutamine synthetase (GS) may be used for the expression cassette or the expression vector of the present invention.
  • the expression vectors of the invention also comprise a limited number of useful restriction sites for insertion of the expression cassette for the secretion of a heterologous protein of the present invention.
  • the expression vectors of the invention may further comprise an origin of replication such as the oriP origin of Epstein Barr Virus (EBV) or SV40 virus for autonomous replication/episomal maintenance in eukaryotic host cells but may be devoid of a selectable marker. Transient expression in cell lacking relevant factors to facilitate replication of the vector is also possible.
  • the expression vector harbouring the expression cassette may further comprise an expression cassette coding for a fluorescent marker, an expression cassette coding for an ncR A, an expression cassette coding for an antiapoptotic protein, or an expression cassette coding for a protein increasing the capacity of the secretory pathway.
  • an expression vector which comprises in order:
  • the polypeptide encoded by the polynucleotide sequence is not GAPDH
  • the non-translated genomic DNA sequence downstream of the eukaryotic GAPDH promoter starts within a region spanning from nucleotide position around +1 to nucleotide position around +7000, wherein the nucleotide position is relative to the transcription start of the GAPDH mRNA
  • the length of the non-translated genomic DNA sequence downstream of the eukaryotic GAPDH promoter is from around 100 to around 15000 nucleotides and wherein the non- translated genomic DNA sequence upstream of the eukaryotic GAPDH promoter starts within a region spanning from around the 5 ' end of the eukaryotic GAPDH promoter to nucleotide position around -3500, wherein the nucleotide position is relative to the transcription start of the GAPDH mRNA, and wherein the length of the non-translated genomic DNA sequence upstream of the
  • the present disclosure provides an expression vector, which comprises in order:
  • the present disclosure provides an expression vector, which comprises in order: a) a non-translated genomic DNA sequence upstream of a eukaryotic GAPDH promoter b) an enhancer
  • an expression vector which comprises in order:
  • an expression vector which comprises in order:
  • an expression vector which comprises in order:
  • an expression vector which comprises in order:
  • Non-translated genomic DNA sequence upstream of a eukaryotic GAPDH, enhancer, promoter, polynucleotide sequence encoding a polypeptide, polyadenlyation site and non- translated genomic DNA sequence downstream of a eukaryotic GAPDH promoter of the expression vectors are e.g. as described supra.
  • the present disclosure provides a host cell comprising an expression cassette or an expression vector as described supra.
  • the host cell can be a human or non- human cell.
  • Preferred host cells are mammalian cells. Preferred examples of mammalian host cells include, without being restricted to, Human embryonic kidney cells (Graham FL et al., J. Gen. Virol.
  • MRC5 human fibroblasts 983M human melanoma cells
  • MDCK canine kidney cells RF cultured rat lung fibroblasts isolated from Sprague-Dawley rats, B16BL6 murine melanoma cells, P815 murine mastocytoma cells, MTl A2 murine mammary adenocarcinoma cells, PER:C6 cells (Leiden, Netherlands) and Chinese hamster ovary (CHO) cells or cell lines (Puck et al, 1958, J. Exp. Med. 108: 945-955).
  • the host cell is a Chinese hamster ovary (CHO) cell or cell line.
  • CHO cell lines include e.g. CHO-S (Invitrogen, Carlsbad, CA, USA), CHO Kl (ATCC CCL-61), CHO pro3-, CHO DG44, CHO P12 or the dhfr- CHO cell line DUK-BII (Chasin et al, PNAS 77, 1980, 4216-4220), DUXBI 1 (Simonsen et al, PNAS 80, 1983, 2495-2499), or CHO-K1SV (Lonza, Basel, Switzerland).
  • the present disclosure provides an in vitro method for the expression of a polypeptide, comprising transfecting a host cell with the expression cassette or an expression vector as described supra and recovering the polypeptide.
  • the polypeptide is preferably a heterologous, more preferably a human polypeptide.
  • the expression cassette or the expression vector into a host cell for transfecting the expression cassette or the expression vector into a host cell according to the present invention any transfection technique such as those well-known in the art, e.g. electoporation, calcium phosphate co-precipitation, DEAE-dextran transfection, lipofection, can be employed if appropriate for a given host cell type.
  • the host cell transfected with the expression cassette or the expression vector of the present invention is to be construed as being a transiently or stably transfected cell line.
  • the present expression cassette or the expression vector can be maintained episomally i.e. transiently transfected or can be stably integrated in the genome of the host cell i.e. stably transfected.
  • a transient transfection is characterised by non-appliance of any selection pressure for a vector borne selection marker.
  • the transfected expression cassette or expression vector are maintained as episomal elements and are not yet integrated into the genome. That is the transfected DNA does not usually integrate into the host cell genome.
  • the host cells tend to lose the transfected DNA and overgrow transfected cells in the population upon culture of the transiently transfected cell pool. Therefore expression is strongest in the period immediately following transfection and decreases with time.
  • a transient transfectant according to the present invention is understood as a cell that is maintained in cell culture in the absence of selection pressure up to a time of 2 to 10 days post transfection.
  • the host cell e.g. the CHO host cell is stably transfected with the expression cassette or the expression vector of the present invention.
  • Stable transfection means that newly introduced foreign DNA such as vector DNA is becoming incorporated into genomic DNA, usually by random, non-homologous
  • the copy number of the vector DNA and concomitantly the amount of the gene product can be increased by selecting cell lines in which the vector sequences have been amplified after integration into the DNA of the host cell. Therefore, it is possible that such stable integration gives rise, upon exposure to further increases in selection pressure for gene amplification, to double minute chromosomes in CHO cells. Furthermore, a stable transfection may result in loss of vector sequence parts not directly related to expression of the recombinant gene product, such as e.g. bacterial copy number control regions rendered superfluous upon genomic integration. Therefore, a transfected host cell has integrated at least part or different parts of the expression cassette or the expression vector into the genome.
  • the present disclosure provides the use of the expression cassette or an expression vector as described supra for the expression of a heterologous polypeptide from a mammalian host cell, in particular the use of the expression cassette or an expression vector as described supra for the in vitro expression of a heterologous polypeptide from a mammalian host cell.
  • Expression and recovering of the protein can be carried out according to methods known to the person skilled in the art.
  • the non-translated genomic DNA sequence downstream and/or upstream of a eukaryotic GAPDH promoter of the expression cassette or of the expression vector as described supra and the host cell as described supra are used and are usually of the same origin.
  • an increase of expression is obtained if the non-translated genomic DNA sequence downstream and/or upstream of a eukaryotic GAPDH promoter of the expression cassette or of the expression vector and the host cell are of different origin e.g. if human DNA sequences downstream and/or upstream of a eukaryotic GAPDH promoter are used in CHO cells.
  • the present disclosure provides the use of the expression cassette or the expression vector as described supra for the preparation of a medicament for the treatment of a disorder.
  • the present disclosure provides the expression cassette or the expression vector as described supra for use as a medicament for the treatment of a disorder. In a further aspect, the present disclosure provides the expression cassette or the expression vector as described supra for use in gene therapy.
  • PCR were performed using 1 ⁇ of dNTPs (10 mM for each dNTP; Invitrogen, Carlsbad, CA, USA), 2 units of Phusion® DNA Polymerase (Finnzymes Oy, Espoo, Finland), 25 nmol of Primer A (Mycrosynth, Balgach, Switzerland), 25 nmol of Primer B (Mycrosynth, Balgach, Switzerland), 10 ⁇ of 5X HF buffer (7.5 mM MgCl 2 , Finnzymes, Espoo, Finland), 1.5 ⁇ of Dimethyl sulfoxide (DMSO, Finnzymes, Espoo, Finland) and 1-3 ⁇ of the template (1-2 ⁇ g) in a 50 ⁇ final volume. All primers used are listed in Table 1.
  • the PCR were started by an initial denaturation at 98°C for 3 minutes, followed by 35 cycles of 30 sec denaturation at 98°C, 30 sec annealing at a primer-specific temperature (according to CG content) and 2 min elongation at 72°C. A final elongation at 72°C for 10 min was performed before cooling and keeping at 4°C.
  • Table 1 Summary of primers used in PCRs.
  • GAPDH Glyceraldehyde 3-phosphate dehydrogenase sequence
  • 5' upstream sequence
  • 3 downstream sequence.
  • the "T” (underlined) in primer GlnPrl 172 was introduced in order to avoid the formation of primer dimers.
  • CIP Calf Intestinal Alkaline Phosphatase
  • insert 4 ⁇ of insert were mixed to 1 ⁇ of vector, 400 units of ligase (T4 DNA ligase, NEB, Ipswich, MA, USA), 1 ⁇ of 10X ligase buffer (T4 DNA ligase buffer; NEB, Ipswich, MA, USA) in a 10 ⁇ volume. The mix was incubated for 1-2 h at RT.
  • ligase T4 DNA ligase, NEB, Ipswich, MA, USA
  • 10X ligase buffer T4 DNA ligase buffer; NEB, Ipswich, MA, USA
  • TOP 10 One Shot ® TOP 10 Competent E. coli; Invitrogen, Carlsbad, CA, USA
  • the ⁇ protein is expressed by One Shot® PIR1 competent E. coli (Invitrogen, Carlsbad, CA, USA). These bacteria were used for all vectors containing the R6K sequence.
  • Plasmid DNA from minipreparations was quantified once with the NanoDrop ND-1000 Spectrophotometer (Thermo Scientific, Wilmington, DE, USA) by measuring the absorbance at 260 nm and assessing the ratio of the OD260 nm/OD280 nm that had to be between 1.8 and 2. A control digestion was performed before sending the sample to Fasteris SA (Geneva, Switzerland) for sequence confirmation.
  • the QuickPure kit (Macherey Nagel, Oensingen, Switzerland) was used with the following modification of the protocol: 10 ml of LB and chloramphenicol (12.5 ⁇ g/ml) (Sigma-Aldrich, St. Louis, MO, USA) were seeded with bacteria containing pBACe3.6 vector. After incubation on a shaking platform at 37°C over night, the culture was centrifuged for 5 min at 13 300 rpm before being resuspended in 500 ⁇ of Al Buffer. 500 ⁇ of A2 Lysis Buffer were added and the solution was incubated 5 min at RT. Then, it was neutralized with 600 ⁇ of A3 buffer and centrifuged 10 min at 13 300 rpm. The supernatant was loaded on a column and from this step onwards the standard protocol of QuickPure miniprep kit was used.
  • midipreparation transformed bacteria were grown at 37°C overnight in 200 to 400 ml of LB and ampicillin (or kanamycin). Then, the culture was centrifuged 20 min at 725 g and the plasmid was purified using a commercial kit (NucleoBond Xtra Midi; Macherey Nagel, Oensingen, Switzerland) following the low plasmid protocol provided in the manual of the manufacturer.
  • Plasmid-DNA from midipreparation was quantified three times with the NanoDrop ND-1000 Spectrophotometer, confirmed by restriction digest and finally sent for sequencing (Fasteris SA, Geneva, Switzerland). II. Results and Discussion
  • the BAC clone RPCIB753F11841Q was ordered at Imagene (Berlin, Germany). This clone contains the human GAPDH sequence in a pBACe3.6 vector backbone, containing a chloramphenicol resistance gene. After DNA extraction by minipreparation, the vector concentration was determined by Nanodrop to 27 ng/ ⁇ .
  • DNA sequences immediately surrounding the GAPDH expression cassette upstream of the promoter and downstream of the poly-adenylation site were amplified by PCR using 27 ng of the purified clone RPCIB753F11841Q as template.
  • the 3 kb fragment upstream of the promoter was amplified with primers GlnPrl 171 (SEQ ID NO: 1) and GlnPrl 172 (SEQ ID NO: 2) leading to the amplicon with SEQ ID No. 5.
  • primer GlnPrl 172 SEQ ID NO: 2
  • primer GlnPrl 172 carries a base change (G to T) relative to the template sequence, all sequences derived from this PCR reaction will carry this base change, too.
  • the change is located in position -3721 relative to the transcription start of the GAPDH gene (bp 812 of SEQ ID NO: 17, position 23 relative to the start of SEQ ID NO: 5).
  • the 3kb fragment downstream of the polyadenlyation site was amplified with primers GlnPrl 173 (SEQ ID NO: 3) and GlnPrl 174 (SEQ ID NO: 4) leading to the amplicon with SEQ ID NO: 6 (Table 1).
  • the annealing temperature used for these PCRs was 72°C.
  • the 5'and 3 'GAPDH fragments (SEQ ID NOs: 5 and 6) were cloned in pCR-Blunt, a commercially available PCR-product cloning vector (pCR-Blunt, PCR Zero Blunt cloning kit, Invitrogen).
  • the ligation products were transformed into TOP 10 competent bacteria and plated on kanamycin LB-agar plates. Colonies were amplified and plasmids were isolated by minipreps. Control digests were performed to identify positives clones yielding pCR-Blunt- 5 'GAPDH and pCR-Blunt-3 'GAPDH constructs.
  • the reporter construct (REP) used in the present work consisted in a polycistronic gene: IgGl monoclonal antibody light chain (LC)-IRES- IgGl monoclonal antibody heavy chain(HC)- IRES- green fluorescent protein (GFP).
  • IRES Internal Ribosomal Entry Sites derived from Encephalomyocarditis virus
  • Transfected cells will therefore secrete the IgGl monoclonal antibody and accumulate intracellular GFP in a dependent manner.
  • polycistronic mRNAs are not common in eukaryotic cells and their translation is not very efficient, leading to relative low titers of IgGl and GFP expression.
  • a vector containing the REP construct was digested using the restriction enzymes Nhel and BstBI (BstBI is used at 65°C).
  • the REP fragment containing the expression construct was cut out, purified and used for further cloning steps.
  • the vector pGLEX41 an expression vector derived from pcDNA3.1 (+) (Invitrogen, Carlsbad, CA) was used for stable cell line production. It was used as initial backbone that had been modified to generate the second generations of vectors A and B with and without the GAPDH sequences. For all vectors the same promoter-intron combination (mCMV and a donor-acceptor fragment coding for the first intron (IgDA)) was used (Gorman et al., (1990) Proc Natl Acad Sci USA, 87: 5459-5463). Cloning of intermediate vector pGLEX41-HM-MCS-ampiA:
  • the development of the new vector generation was started from pGLEX41.
  • This vector was cut using the restriction enzymes Nrul and BspHI in order to release the ampicillin resistance cassette.
  • the backbone fragment was CIPed and purified by gel electrophoresis.
  • the DNA fragment coding for a codon optimized (for expression in E. coli) version of the ampicillin resistance gene (including the bla promoter) has been ordered from GeneArt.
  • the insert was cut out of the GeneArt cloning vector #1013237 using the restriction enzymes Nrul and BspHI (the same enzymes as used for the backbone), purified and cloned into the backbone. Minipreps were analyzed by restriction digest.
  • the clone pGLEX41-HM-MCS-ampiA#2 had the expected restriction profile and the integration of the correct fragment was confirmed by sequencing.
  • the vector was digested using Pvul and BspHI.
  • the backbone fragment was CIPed and purified.
  • the new insert fragment contains the R6K origin of replication and a modified SV40 poly(A) sequence as part of the expression cassette. Unnecessary bacterial or viral backbone sequences around the SV40 poly(A) had been eliminated (see Table 2 below).
  • the insert fragment has been ordered from GeneArt; it was cut out of the GeneArt cloning vector #1013238 using the enzymes Pvul and BspHI (the same as used for the backbone), purified and cloned into the backbone fragment. Minipreps were prepared and were confirmed by sequence analysis.
  • the clone pGLEX41-MCS-R6K-ampiA#l had the correct sequence.
  • the vector pGLEX41- MCS-R6K-ampiA#l was opened using the restriction enzyme BspHI and CIPed in order to release the ampicillin resistance.
  • the new insert fragment contains the ampicillin resistance codon optimized for expression in E. coli, but all the CpG sequences that could be eliminated by alternative codon usage had been replaced (see Table 2 above).
  • This fragment was ordered at GeneArt.
  • the GeneArt cloning vector #1016138 was digested using BspHI. After purification of both insert and backbone fragments by gel electrophoresis, they were ligated and transformed into PIR1 bacteria. The minipreps were directly sent for sequencing.
  • pGLEX41-R6K-MCS-ampiB#l has the correct sequence and was used for further cloning steps.
  • the vectors were cut using the restriction enzymes Nhel and Clal.
  • the expression vector pGLEX41-HM-MCS was opened using the restriction enzymes Nhel and BstBI (at 65°C). All vector backbones were treated with CIP after digestion and the backbones purified by gel electrophoresis. The backbones were ligated with the Nhel/BstBI (BstBI is compatible with Clal) fragment coding for the reporter construct REP.
  • the ligation products were transformed into PIR1 or TOP 10 competent bacteria and plated on ampicillin LB-agar plates. Colonies were amplified and plasmids were isolated by minipreps. Positive clones could be identified by restriction digest of minipreps and subsequent sequence confirmation by Fasteris SA.
  • 5 'GAPDH sequence (SEQ ID NO: 7) was excised from pCR-blunt-5' GAPDH using the restriction enzyme Nrul and ligated in the expression vectors pGLEX41-R6K-ampiA-[REP] and pGLEX41-R6K-ampiB-[REP] which were linearized using Nrul and treated with CIP in order to avoid re-circularization.
  • pGLEX41-R6K-ampiA-[REP] and pGLEX41-R6K-ampiB-[REP] which were linearized using Nrul and treated with CIP in order to avoid re-circularization.
  • minipreps were analyzed by restriction digest.
  • Clones pGLEX41-R6K-ampiA-5'GAPDH-[REP] #2 and pGLEX41-R6K-ampiB-5'GAPDH-[REP] #1 showed bands of the expected size in the restriction analysis, were subsequently confirmed by sequencing and used for further cloning steps. These new vectors were then opened with Seal and treated with CIP.
  • the 3 'GAPDH fragment (SEQ ID NO: 8) was excised from pCR- Blunt-3 'GAPDH using the same enzyme and ligated into the two backbones in order to generate pGLEX41-R6K-ampiA-GAPDH-[REP] and pGLEX41-R6K-ampiB-GAPDH-[REP] expression vectors.
  • the vector pGLEX41- MCS-R6K-ampiA#l was opened using the restriction enzymes Nrul and Xbal followed by treatment with CIP.
  • the insert fragment was ordered from GeneArt and was provided as insert in GeneArt cloning vector #1013239. It contains the SV40 promoter and the codon optimized gene for the puromycin resistance (for codon usage of CHO cells).
  • the insert was cut out of the GeneArt cloning vector using the enzymes Nrul and Xbal (the same as used for the backbone), purified and cloned into the backbone fragment. Minipreps were prepared and analyzed by restriction digest.
  • the clone pGLEX-MCS-R6K-ampiA-puroA#l showed the correct profile and could be confirmed by sequencing.
  • This vector was used for the cloning of the vector pGLEX-MCS-R6K-ampiA-puroB by exchange of the coding region for the puromycin resistance gene, while leaving the SV40 promoter.
  • the new insert fragment contains a codon-optimized version of the puromycin gene, where all the CpG sequences that could be eliminated due to alternative codon usage had been replaced.
  • the fragment has been ordered by GeneArt and was delivered in the cloning vector # 1016139. In order to release the insert fragment, the GeneArt vector was digested using the restriction enzymes Xbal and Notl.
  • the insert fragment was purified by gel electrophoresis and cloned into the backbone of pGLEX-MCS-R6K-ampiA-puroA, after release of the puromycin open reading frame by restriction digest using Xbal and Notl, followed by CIP treatment.
  • the resulting vector pGLEX-MCS-R6K-ampiA-puroB#l was confirmed directly by sequence analysis.
  • the vector pGLEX-R6K- puroA#l was opened using the restriction enzymes Xbal and Notl, followed by treatment with CIP.
  • the insert fragments were ordered from GeneArt and were provided as inserts in GeneArt cloning vectors #1013242 (neoA) and #1026894 (neoB). They contain the codon optimized gene for the neomycin resistance for codon usage of CHO cells and the CpG reduced version of the neomycin resistance, respectively.
  • the vector pGLEX41-R6K-puroB#l was opened using the restriction enzyme BspHI and subsequently CIPed.
  • the insert fragment contains the ampicillin resistance gene that was codon optimized for expression in E. coli, while all CpG sequences that could be eliminated due to alternative codon usage had been replaced.
  • This fragment has been ordered at GeneArt and arrived in the cloning vector #1016138.
  • the GeneArt cloning vector was digested using BspHI. After purification of both insert and backbone fragment by gel electrophoresis, they were ligated and transformed into PIR1 bacteria. The minipreps were directly sent for sequencing and could be confirmed (pGLEX41- ampiB-R6K-puroB# 1 ) .
  • the cloning leading to vector pGLEX-R6K-neoB-ampiB was done by opening pGLEX-R6K- neoB-ampiA using the restriction enzymes BspHI in order to create the backbone fragment. Digestion of pGLEX-R6K-ampiB-hygroB using the same restriction enzyme combination yielded the insert fragment coding for ampiB. The ampiB insert was cloned into the pGLEX- R6K-neoB-ampiA backbone.
  • the vector pCR-blunt-5 'GAPDH was digested with Nrul in order to obtain the 5 'GAPDH insert (3164 bps).
  • the vectors coding for resistance genes were digested with Nrul, subsequently treated with CIP (Calf intestinal phosphatase, NEB, Ipswich, MA) in order to prepare the backbone fragments.
  • the 4 different backbone fragments (pGLEX-R6K-neoA- ampiA, pGLEX-R6K-neoB-ampiB, pGLEX-R6K-puroA-ampiA and pGLEX-puroB-ampiB) were ligated with the 3164 bps 5 'GAPDH insert and transformed into PIR1 competent bacteria.
  • the vector carrying the second insert fragment, pCR-Blunt-3 'GAPDH was cut using Seal in order to release the insert fragment (3224 bps) the GAPDH downstream flanking region.
  • the four different backbone molecules were ligated with the purified 3224 bps insert fragment and transformed into PIR1 competent cells. Minipreps were analyzed by restriction digest. Clones showing restriction fragments of the expected size were pGLEX-R6K-neoB-ampiB-GAPDH #8, pGLEX-R6K-neoA-ampiA- GAPDH #1, pGLEX-R6K-puroA-ampiA-GAPDH #1 and pGLEX-puroB-ampiB-GAPDH #4. The clones were subsequently confirmed by sequencing analysis (Fasteris, Geneva,
  • midipreps were prepared using the
  • Table 3 Summary of plasmids cloned. Concentration of DNA midipreparation and linearized midipreparation (with the corresponding enzyme). The GSC number codes for the respective plasmid and allows to identify relevant sequencing files.
  • Mammalian cells are the preferred host to express proteins because they are capable of correct folding, assembly and post-transcriptional modification of recombinant proteins.
  • the CHO cell line was used because they are well characterized and do not serve as a host for most human pathogenic viruses, making them a relatively safe host for stable therapeutic protein production.
  • Chinese Hamster Ovary cells (CHO-S, Invitrogen, Carlsbad, CA, USA) were cultured in suspension in PowerCHO-2 CD medium (Lonza, Venders, Belgium),
  • HEK293 cells are used because they are easy to transfect and allow rapid production of recombinant proteins up to lower gram amounts.
  • the cells used are HEK293-EBNA cells (ATCC, Manassas, VA) and are routinely cultured in suspension in Ex-cell 293 medium (Sigma-Aldrich, St. Louis, MI).
  • Subcultures of CHO-S and HEK293 EBNA cells were routinely carried out every 3-4 days using a seeding density of 0.5xl0 6 viable cells/ml in fresh medium.
  • the cells were cultivated using 10 ml of medium in 50 ml bioreactor tubes (Tubespin Bioreactor 50; TPP, Trasadingen, Switzerland) containing a permeable filter allowing gas exchange.
  • the cell viability and concentration were determined with the Countess automated cell counter (Invitrogen, Carlsbad, CA, USA) using the trypan blue cell exclusion method. Cell concentration was confirmed by determination of the packed cell volume (PCV) method using PCV tubes (TPP, Trasadingen, Switzerland) for CHO-S cells.
  • PCV packed cell volume
  • PCV Packed cell volume
  • the PCV method is based on the centrifugation of a specific volume of culture liquid in a mini-PCV tube (PCV Packed Cell Volume Tube; TPP, Trasadingen, Switzerland) for 1 min at 5000 rpm. During centrifugation, the cells are pelleted in the graduated capillary at the base of the tube. The percentage of packed cell volume is then determined by assessing the volume of the pellet in relationship to the amount of cell culture fluid centrifuged. For example, 1% PCV indicated that 10 ⁇ of cell pellet was present in 1 ml of culture fluid.
  • Flow Cytometry is a technique for the analysis of multiple parameters of individual cells. This technique allows the quantitative and qualitative analysis of cells that are phenotypically different from each other, for instance dead from viable cells (according to the size and the granularity of cells). It also allows the quantification of cells which express a protein of interest, such as GFP.
  • Cells were collected from the culture by sterile pipetting 300 ⁇ of samples and were analyzed with a Fluorescence- Associated Cell Sorting (FACS) Calibur flow cytometer (Becton, Dickinson and Company, Franklin Lakes, NJ, USA) equipped with an air- cooled argon laser emitting at 488 nm. The analyses were made with the CellQuest software. GFP emission was detected with the FL-1, using a 530/30-nm band pass filter. In the first gate, cell debris as well as dead cells were excluded from the analysis in a
  • FACS Fluorescence- Associated Cell Sorting
  • the Octet QK system (ForteBio, Menlo Park, CA, USA) performs label-free quantitation of antibodies, proteins, peptides, DNA and other biomolecules and provides kinetic
  • a correlation between the binding rate (nm) and the accumulated IgGl concentration ⁇ g/ml) of the sample allows quantification of the IgG titer with a calibration curve.
  • PEI polyethyleneimine
  • JetPEI Polyplus-transfection, Illkirch, France
  • PEI polyethyleneimine
  • the positive charged DNA-PEI complex binds to the negatively charged cell surface and is internalized by endocytosis. It reaches the lysosome compartment from where it is released by lysis to the nucleus.
  • the high transfection efficiency with DNA-PEI complexes is due to the ability of PEI to protect DNA from lysosomal degradation.
  • the cells were transfected according to the manual provided by the manufacturer.
  • Stable CHO-S clones expressing IgGl and GFP were obtained by co-transfecting one expression vector and two resistance vectors (coding for puromycin or neomycin resistance, respectively).
  • Transfection efficiency was determined 24h after transfection by Flow Cytometry (BD FACS Calibur cytometer, #1293) by analysing the intracellular GFP expression. If the percentage of GPF positive cells was higher than 20 %, the transfected cells were diluted with selective medium and distributed into 96 well plates (for limiting dilution to generate isolated stable minipools) or in T-Flasks (to generate stable pools).
  • the selective medium used was PowerCHO-2, 4 mM glutamine, supplemented with different concentrations of geneticin and puromycin.
  • the selection stringency was renewed by adding selection medium to the cells. As soon as colonies in 96 well plates were confluent, the plates were read using a fluorescence reader.
  • the pools in T-Flasks were expanded to tubespin scale using antibiotic-free PowerCHO-2, 4 mM L-glutamine. Their viability and concentration were evaluated with the Countess automated cell counter (Invitrogen, Carlsbad, CA, USA). As soon as the cell density allowed it, a seed train was started for every pool by seeding cells at a density of 0.5xl0 6 cells/ml in 10 ml medium in 50 ml bioreactor tubes (incubated in a shaker (200 rpm) at 5% C0 2 , 37°C and 80% humidity). Each seed train was passaged twice a week by seeding the cells at 0.5xl0 6 cells/ml in growth medium (cell concentration was determined by PCV analysis). The seed train was used for the inoculum of all productions runs (batches).
  • the batch runs of cell pools were seeded at a concentration of 0.5xl0 6 cells/ml using the seed train for inoculation and cells were then cultured for 7 days in Feed media. On day 4 and 8, 200 ⁇ of cells were centrifuged for 5 min at 300 g and the supernatant was analyzed for accumulated IgG using the Octet. In addition, the GFP expression of each batch was analyzed by FACS.
  • the vectors compared in this study differ mainly in their backbone.
  • the entire expression cassette (Promoter, first intron, expression construct, poly (A)) is exactly the same for all vectors.
  • the vectors are derived from the vector pGLEX41 as described in Example 1.
  • the ampicillin resistance gene was codon optimized for expression in E. coli and the bacterial backbone was reduced to a minimum: pGLEX41-R6K-AmpiA-[REP] (in short A).
  • the ampicillin resistance gene was codon optimized for expression in E.
  • This vector is called pGLEX41-R6K-AmpiB-[REP] (in short B).
  • the third modification included the use of the GAPDH flanking sequences that were cloned upstream and downstream of the expression cassette of the vectors A and B giving the vectors pGLEX41-R6K-AmpiA-[REP]- GAPDH (in short GAPDH A) and pGLEX41-R6K-AmpiB- [REP] -GAPDH (in short GAPDH B).
  • Transient transfections of CHO-S cells were done in order to compare the expression level of the reporter proteins expressed in the context of the different plasmid backbones.
  • the transfections (in duplicate) were performed in 50 ml bioreactor tubes (TPP, Trasadingen, Switzerland) using 10 ml of final medium volume and analyzed on day 5 after transfection by Octet (Fig. 2).
  • Transient transfections of HEK293 EBNA cells were done in order to compare the expression level of the reporter proteins expressed in the context of the different plasmid backbones.
  • the transfections (in duplicate) were performed in 50 ml bioreactor tubes (TPP, Trasadingen, Switzerland) using 10 ml of final medium volume and were analyzed on day 10 after transfection by Octet (Fig. 3).
  • the results shown in figure 3 show a significant increase in expression that can be obtained using the GAPDH flanking regions in HEK293 EBNA cells.
  • the GAPDH-B vector is showing a threefold increase in expression, whereas the GAPDH-A vector shows an even higher increase in expression of 5 -fold.
  • These vectors do not contain the oriP element and might therefore have a potential for even higher titers.
  • Stable populations were generated by co-transfecting an expression vector and vectors coding for resistance genes, followed by selection pressure mediated by antibiotics. The selection pressure was removed 14 days after transfection. These steps allowed the generation of stable minipools and stable pools which were cultured in regular intervals in production runs in order to compare the expression levels of the reporter proteins (IgGl antibody and GFP) of the different constructs and the stability of expression.
  • the reporter proteins IgGl antibody and GFP
  • Pools were generated by stable transfection. During the selection procedure (the first 14 days after transfection) the pools were analyzed by FACS. An increase of the GFP positive cell fraction together with the viability of the culture could be observed over the time. The selection pressure mediated by the antibiotics was removed from the pools after 14 days. Using this approach no cell pools transfected with the "B" plasmids could be obtained. The expression level of the generated pools was assayed as soon as the cells could be cultured in 50 ml bioreactor tubes. Batches were done in duplicates. The cells were analyzed by FACS for GFP expression and the accumulation of IgG in the supernatant was assayed by Octet after 8 days of expression.
  • the 5 ' region of the GAPDH promoter harbours a potential insulin as well as a phorbol ester response element (Alexander-Bridges et al, (1992) Advan Enzyme Regul, 32: 149-159).
  • the phorbol ester response element (-1040 -1010 bps) is situated upstream of what is usually referred to as the GAPDH promoter (-488 - +20).
  • the authors were not able to demonstrate a significant effect of the deletion of basepairs -1200 to -488 (relative to the transcription starting point). Therefore the phorbol ester response element might not be functionally linked to the expression driven from the GAPDH promoter.
  • PowerCH02 was prepared from powder medium and no insulin was added.
  • PMA was purchased from Sigma (St. Louis, MO), and was dosed at a final concentration of 1.6 ⁇ (corresponding to the concentration used by Alexander-Bridges on H35 Hepatoma cell lines) in PowerCH02 (+/- Insulin).
  • Transfections were performed in 50 ml bioreactor tubes (Tubespins, TPP, Trasadingen, Switzerland) as described previously.
  • the transfection medium was changed to RPMI1640 (PAA, Pasching, Austria) supplemented with 4 mM Gin and 25 mM HEPES.
  • the cells were distributed in 12 well plates and 1 ml of the four different media was added (PowerCH02, 4mM Gin, +/-insulin; PowerCH02, 4mM Gin, 1.6 ⁇ PMA, +/- insulin).
  • the reporter construct expressing IgGl and GFP using two IRES was used (described in example 2). This vector allowed verification of the transfection efficiency. The percentage and the viability of transfected cells were found similar in all four different media preparations.
  • the human GAPDH locus is located on chromosome 12 of the human genome. GAPDH is described to be constitutively active in all cells of mammalian origin, as the enzyme is a key player in the metabolism of glucose. Upstream of the promoter, the GAPDH gene is flanked by NCAPD2, a gene that stretches over more than 30000 bps. Downstream of the
  • the GAPDH gene is flanked by IFFOl (see figure 7 for details). Not only GAPDH and the promoter, but also the flanking regions are well conserved between different species (see Table 4).
  • Table 4 Stretches of high homologies between human, rat and mouse GAPDH flanking regions. Analysis was done using clone manager 9 (ScieED, Cary, NC, USA). The numbering is relative to the first base of the upstream or the downstream flanking element, respectively (Sequence ID NO: 7 and Sequence ID NO: 8, respectively). Sequences used for alignment were for mouse bases 532-3731 (upstream) and 8164-1 1364 (downstream) of Sequence ID No 18 and for rat bases 719-3918
  • a comparison of the DNA homology between rodent and human shows a minimum of DNA conservation of 38%.
  • the presence of a conserved stretch of DNA outside of a promoter region or a region coding for a gene indicates that there might be a selection pressure on the cell to maintain the DNA sequence or to allow only certain/minor changes.
  • the GAPDH flanking regions might be important for the cells because they maintain a high expression level of the GAPDH genes. Changes in the DNA sequence leading to decrease of expression would be selected against.
  • constructs were made containing only the upstream GAPDH flanking region (SEQ ID NO: 7), fragments of the upstream GAPDH flanking region or the downstream GAPDH flanking region (SEQ ID NO: 8).
  • the reporter IgGl type antibody was expressed by an IRES construct (Light chain-IRES -heavy chain), therefore avoiding co-transfection of multiple plasmids. Details on the fragmentation of the GAPDH upstream fragment are shown in figure 8.
  • fragment 1 (SEQ ID NO: 9), fragment 2 (SEQ ID NO: 10), fragment 3 (SEQ ID NO: 11), fragment 4 (SEQ ID NO: 12), fragment 8 (SEQ ID NO: 13), fragment 9 (SEQ ID NO: 14), fragment 11 (SEQ ID NO: 15), fragment 17 (SEQ ID NO: 16).
  • the upstream GAPDH flanking region (SEQ ID NO: 7) used does contain 2 times 3 (in total 6) nucleotides of the Nrul restriction site of which three are linked to the genomic DNA at its 5 ' and three are linked to the genomic DNA its 3 ' end.
  • the downstream GAPDH flanking region (SEQ ID NO: 8) used does contain two times 3 (in total 6) nucleotides of the Seal restriction site of which three are linked to the genomic DNA at its 5 ' and three are linked to the genomic DNA its 3 ' end.
  • upstream GAPDH flanking region and the downstream GAPDH flanking region without the nucleotides of the respective restriction site are shown in SEQ ID NO: 20 (upstream GAPDH flanking region without restriction sites) and SEQ ID NO: 21 (downstream GAPDH flanking region without restriction sites).
  • fragments of the upstream GAPDH flanking region used does each contain 3 nucleotides of the respective restriction site at its 5' and/or its 3' end linked to the genomic DNA (Fragment 1 contains 3 nucleotides of the Nrul restriction site at its 5 'end; Fragment 2 contains 3 nucleotides of the Nrul restriction site at its 3 'end; Fragment 3 contains 3 nucleotides of the Nrul restriction site at its 5 'end: Fragment 4 contains 3 nucleotides of the Nrul restriction site at its 3 'end;
  • the fragments of the upstream GAPDH flanking region without the nucleotides of the respective restriction site are shown in SEQ ID NO: 22 (fragment 1 without restriction site), SEQ ID NO: 23 (fragment 2 without restriction site) SEQ ID NO: 24 (fragment 3 without restriction site), SEQ ID NO: 25
  • fragment 4 without restriction site SEQ ID NO: 26 (fragment 8 without restriction site), SEQ ID NO: 27 (fragment 9 without restriction sites), SEQ ID NO: 28 (fragment 11 without restriction site).
  • the effect of the upstream and the downstream GAPDH elements on expression was assessed on day 10 after transfection using the Octet (Fortebio, Menlo, CA, USA) in order to quantify the amount of secreted IgGl in the supernatant (see figure 9).
  • pGLEX41 the original vector is giving lower expression results (80%) compared to the improved new vector design used in the pGLEX41-ampiA backbones.
  • the new design includes codon optimization of the ampiA gene necessary for ampicillin resistance in E. coli, a different origin of replication (R6K instead of pUC origin of replication) and elimination of unnecessary linker (or spacer) sequences of bacterial origin. Both vectors have approximately the same size.
  • pGLEX41 -ampiA including the upstream (SEQ ID NO: 7) and downstream element (SEQ ID NO: 8), (named pGLEX41-up/down in figure 9 showing the expression results) is giving higher expression (factor 1.5) compared to the same vector without the upstream and downstream sequences. If one considers the difference in size (up/down fragments increase the size of the plasmid by approximately 6000 bps) and therefore the differences in delivered plasmid copies during transfection, the effect might even more important on a per plasmid basis.
  • the vector containing only the upstream fragment (up) is showing an expression level similar to the original expression construct pGLEX41 -ampiA.
  • the vector containing only the downstream fragment (down) is showing a significant increase (factor 1.2) in expression compared to the original expression construct pGLEX41 -ampiA.
  • a further increase in expression can be observed if both, the up- and the downstream fragment are present. This is confirmed by the fragmentation of the upstream fragments.
  • Fragment 9 and the promoter proximal fragment 8 do not show any difference in expression compared to pGLEX41- ampiA.
  • Fragment 1, 11 and 17 show an increase in expression. The highest increase was observed for fragment 4. It should be highlighted that the promoter proximal fragment 8 is not showing any effect.
  • fragment 9 which is the entire upstream region without the BstBI-BstBI fragment does not show increased expression compared to the entire GAPDH upstream flanking region (nevertheless, fragment 9 includes the EcoRV-BstBI fragment which is part of fragment 2 and 3 and might have a negative effect on expression). It can only be speculated about the mechanism behind the observed effects.
  • the orientation dependency of the negative effect on expression observed with fragments 2 and 3 excludes the expression of non-identified open reading frames (for example expression of an ncRNA), because there are no surrounding promoters that could trigger the expression of only one orientation.
  • the fact that the expression is reduced below the basal level shows not only the absence of a positive effect (for example an enhancer activity), but rather the presence of an orientation dependent negative effect.
  • Example 5 Cloning of the non-translated genomic DNA sequence upstream of the Chinese hamster GAPDH gene and the Chinese hamster promoter
  • the non-translated genomic DNA sequence upstream of the Chinese hamster GAPDH gene was amplified from genomic DNA of CHO-S (Life Technologies) cells by PCR. Genomic DNA was extracted as described in Example 1. Constructs were prepared using the mouse CMV promoter or the Chinese hamster GAPDH promoter for the expression of the reporter gene construct [REP] described in Example 1.
  • primers GlnPrl896 and GlnPrl897 were used for amplification of the 3 kbs fragment (bps 672 to 3671 of SEQ ID No 29) using the PCR protocol described in Example 1 and leading to the amplicon with the SEQ ID No 30.
  • the amplicon contains the genomic DNA sequence upstream of the Chinese hamster GAPDH gene and 5' and 3' restriction sites that were introduced by the primers.
  • primers GlnPrl902 and GlnPrl905 were used in order to amplify the 3508 bps fragment containing the genomic DNA sequence including the genomic DNA sequence upstream of the Chinese hamster GAPDH gene and the GAPDH promoter (bps 672 to 4179 of SEQ ID No 29) leading to the amplicon with the SEQ ID No 31.
  • GlnPrl901 and GlnPrl902 were used for amplification of the 508 bps fragment containing only the promoter region (bps 3672 to 4179 of SEQ ID No 29), leading to the SEQ ID No 32.
  • the intron used in the vector "A" (described in Example 1) was amplified using primers GlnPrl903 and GlnPrl904.
  • a first fusion PCR was performed with primers GlnPrl904 and GlnPrl901 using the amplicon with SEQ ID NO: 32 and the amplicon with the intron sequence as templates.
  • the amplicon contains the Chinese hamster GAPDH promoter, an intron and 5 ' and 3 ' restriction sites that were introduced by the primers. All primers are shown in Table 5.
  • a second fusion PCR was performed with primers GlnPrl905 and GlnPrl904 using the amplicon with SEQ ID No. 31 and the amplicon with the intron sequence as templates.
  • the amplicon contains the genomic DNA sequence upstream of the Chinese hamster GAPDH gene, the Chinese hamster GAPDH promoter, an intron and 5 ' and 3 ' restriction sites that were introduced by the primers.
  • the vector "A” (described in Example 1) was used.
  • the expression cassette used in this vector contains a polycistronic gene coding for a secreted IgGl and GFP (see Example 1).
  • Trans fected cells will therefore secrete the IgGl monoclonal antibody and accumulate intracellular GFP in a dependent manner.
  • the plasmid pCR_Blunt[CHO-upstreamGAPDH] was digested using the restriction enzyme Nael. This insert was cloned in the backbone of "A”, digested using the restriction enzyme Nrul and CIPed (CIP; NEB, Ipswich, MA, USA).
  • T4 DNA ligase T4 DNA ligase, NEB
  • the insert fragments were released from plasmids pCR_Blunt[CHO-upstreamGAPDH_GAPDH promoter] and pCR_Blunt[CHO-GAPDHpromoter] by digestion using the restriction enzymes Nhel and Nrul. The resulting fragments were cloned in the backbone of vector "A”, opened using the same enzymes and CIPed. After ligation with T4 DNA ligase and transformation into competent E.coli PIR1, clones were picked for miniprep restriction analysis.
  • the resulting plasmids were called "A GAPDH UP Prom” (plasmid with non- translated genomic DNA sequence upstream of the Chinese hamster GAPDH and the promoter) and "A PR” (plasmid with only the promoter) confirmed by sequencing analysis and produced in midiprep scale using the kit NucleoBond Xtra Midi (Macherey Nagel, Oensingen, Switzerland).
  • CHO-S cells were transfected in tubespins bioreactors using 10 ml of medium volume (as described in Example 2). The transfected cells were incubated in a shaking incubator with 200 rpm agitation at 37°C, 5 % C02 and 80 % humidity. The supernatants of the cells were analyzed for IgGl expression using the Octet QK system with Protein A biosensors,
  • the expression level of the plasmid containing the GAPDH promoter ("A PR") compared to the mouse CMV promoter (A) is reduced by 50 %, indicating that the Chinese hamster GAPDH promoter is not as strong as the viral promoter.
  • the plasmid containing the non- translated genomic DNA sequence upstream of the Chinese hamster GAPDH gene in combination with the Chinese hamster GAPDH promoter ("A GAPDH UP Prom") shows a two fold increase in expression compared to the construct having only the GAPDH promoter ("A PR").
  • the plasmid containing the non-translated genomic DNA sequence upstream of the Chinese hamster GAPDH gene and the mouse CMV promoter "(A GAPDH UP") shows the highest expression and an increase of more than 40% over the plasmid containing only the mouse CMV promoter ("A"). This confirms that the non-translated genomic DNA sequence upstream of the Chinese hamster GAPDH gene has an enhancer effect on the expression of the reporter protein.
  • GlnPr SEQ ID TACGGCCGGCTTCACTGTACAGTGGCACAT forward Nael 1896 No 33
  • GlnPr SEQ ID TACTCGCGAAGAAGATCCTCAACTTTTCCACAGCC forward Nrul 1901 No 35
  • GlnPr SEQ ID GTTCACTAAACGAGCTCTGCTATTTATAGGAACTGGGGTG reverse / 1902 No 36
  • GlnPr SEQ ID CACCCCAGTTCCTATAAATAGCAGAGCTCGTTTAGTGAAC forward / 1903 No 37

Landscapes

  • Genetics & Genomics (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Organic Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biophysics (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Apparatus Associated With Microorganisms And Enzymes (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Enzymes And Modification Thereof (AREA)
PCT/IB2012/056977 2011-12-07 2012-12-05 Expression cassette Ceased WO2013084157A1 (en)

Priority Applications (18)

Application Number Priority Date Filing Date Title
BR112014013597-5A BR112014013597A2 (pt) 2011-12-07 2012-12-05 cassete de expressão, vetor de expressão, célula hospedeira, método in vitro para expressão de um polipeptídeo e uso de um cassete de expressão ou vetor de expressão
ES12816132.0T ES2679291T3 (es) 2011-12-07 2012-12-05 Casete de expresión
CA2856479A CA2856479A1 (en) 2011-12-07 2012-12-05 Expression cassette
EP12816132.0A EP2788483B1 (en) 2011-12-07 2012-12-05 Expression cassette
MX2014006869A MX362393B (es) 2011-12-07 2012-12-05 Cassette de expresion.
JP2014545423A JP2015501642A (ja) 2011-12-07 2012-12-05 発現カセット
US14/003,410 US20130344604A1 (en) 2011-12-07 2012-12-05 Expression Cassette
NZ626252A NZ626252B2 (en) 2011-12-07 2012-12-05 Expression cassette
EA201491034A EA037273B1 (ru) 2011-12-07 2012-12-05 Экспрессионная кассета
AU2012348558A AU2012348558A1 (en) 2011-12-07 2012-12-05 Expression cassette
KR1020147018672A KR102135745B1 (ko) 2011-12-07 2012-12-05 발현 카세트
HK15102932.0A HK1202578A1 (en) 2011-12-07 2012-12-05 Expression cassette
SG11201402477VA SG11201402477VA (en) 2011-12-07 2012-12-05 Expression cassette
CN201280069001.0A CN104093834A (zh) 2011-12-07 2012-12-05 表达盒
IL232845A IL232845A0 (en) 2011-12-07 2014-05-28 expression cassette
US15/653,243 US20180163225A1 (en) 2011-12-07 2017-07-18 Expression cassette
AU2018204332A AU2018204332B2 (en) 2011-12-07 2018-06-18 Expression cassette
US16/397,006 US20200087679A1 (en) 2011-12-07 2019-04-29 Expression cassette

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201161567675P 2011-12-07 2011-12-07
US61/567,675 2011-12-07

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US14/003,410 A-371-Of-International US20130344604A1 (en) 2011-12-07 2012-12-05 Expression Cassette
US15/653,243 Continuation US20180163225A1 (en) 2011-12-07 2017-07-18 Expression cassette

Publications (1)

Publication Number Publication Date
WO2013084157A1 true WO2013084157A1 (en) 2013-06-13

Family

ID=47561694

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/IB2012/056977 Ceased WO2013084157A1 (en) 2011-12-07 2012-12-05 Expression cassette

Country Status (15)

Country Link
US (3) US20130344604A1 (https=)
EP (1) EP2788483B1 (https=)
JP (3) JP2015501642A (https=)
KR (1) KR102135745B1 (https=)
CN (1) CN104093834A (https=)
AU (2) AU2012348558A1 (https=)
BR (1) BR112014013597A2 (https=)
CA (1) CA2856479A1 (https=)
EA (1) EA037273B1 (https=)
ES (1) ES2679291T3 (https=)
HK (1) HK1202578A1 (https=)
IL (1) IL232845A0 (https=)
MX (1) MX362393B (https=)
SG (1) SG11201402477VA (https=)
WO (1) WO2013084157A1 (https=)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2016061240A1 (en) * 2014-10-15 2016-04-21 Amgen Inc. Promoter and regulatory elements for improved expression of heterologous genes in host cells

Families Citing this family (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2016074016A1 (en) * 2014-11-10 2016-05-19 Murdoch Childrens Research Institute Vectors and methods for targeted integration in loci comprising constitutively expressed genes
CN106868044A (zh) * 2017-02-15 2017-06-20 扬州大学 一种转基因动物毛色报告基因表达盒、表达载体及应用
WO2019183248A1 (en) 2018-03-21 2019-09-26 Nature Technology Corporation Viral and non-viral nanoplasmid vectors with improved production
CN114540352A (zh) * 2022-02-16 2022-05-27 艾瑞生命科学技术(常州)有限公司 一种多核苷酸、载体元件及表达载体和宿主细胞及应用

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1308510A1 (en) * 2000-08-10 2003-05-07 Ono Pharmaceutical Co., Ltd. Glycerylaldehyde-3-phosphate dehydrogenase promoter inducing cell death

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0173552B1 (en) * 1984-08-24 1991-10-09 The Upjohn Company Recombinant dna compounds and the expression of polypeptides such as tpa
KR20000006334A (ko) * 1998-06-26 2000-01-25 이선경 바이러스코딩염기서열이전혀없는고효율레트로바이러스벡터
WO2007068265A1 (en) * 2005-12-12 2007-06-21 Research Corporation Technologies, Inc. Hybrid 3’ untranslated regions suitable for efficient protein expression in mammalian cells

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1308510A1 (en) * 2000-08-10 2003-05-07 Ono Pharmaceutical Co., Ltd. Glycerylaldehyde-3-phosphate dehydrogenase promoter inducing cell death

Non-Patent Citations (20)

* Cited by examiner, † Cited by third party
Title
ALEXANDER-BRIDGES ET AL., ADVAN ENZYME REGUL, vol. 32, 1992, pages 149 - 159
BIRD RE ET AL., SCIENCE, vol. 242, no. 4877, 1988, pages 423 - 6
CHASIN ET AL., PNAS, vol. 77, 1980, pages 4216 - 4220
ERCOLANI L ET AL: "ISOLATION AND COMPLETE SEQUENCE OF A FUNCTIONAL HUMAN GLYCERALDEHYDE-3-PHOSPHATE DEHYDROGENASE GENE", JOURNAL OF BIOLOGICAL CHEMISTRY, AMERICAN SOCIETY FOR BIOCHEMISTRY AND MOLECULAR BIOLOGY, US, vol. 263, no. 30, 25 October 1988 (1988-10-25), pages 15335 - 15341, XP000020878, ISSN: 0021-9258 *
GOEDDEL DV ET AL., METHODS ENZYMOL, vol. 185, 1990, pages 3 - 7
GORMAN ET AL., PROC NATL ACAD SCI USA, vol. 87, 1990, pages 5459 - 5463
GRAHAM FL ET AL., J. GEN. VIROL., vol. 36, pages 59 - 74
GRAVEN ET AL., BIOCHIMICA ET BIOPHYSICS ACTA, vol. 147, 1999, pages 203 - 218
GRAVEN KRISTA K ET AL: "Identification of an oxygen responsive enhancer element in the glyceraldehyde-3-phosphate dehydrogenase gene", BIOCHIMICA ET BIOPHYSICA ACTA, vol. 1447, no. 2-3, 28 October 1999 (1999-10-28), pages 208 - 218, XP002694451, ISSN: 0006-3002 *
GURTU ET AL., BIOCHEM BIOPHYS RES COMMUN., vol. 229, no. 1, 1996, pages 295 - 298
HOLLIGER P ET AL., METHODS ENZYMOL, vol. 326, 2000, pages 461 - 79
HOLLIGER P ET AL., PROC NATL ACAD SCI U S A, vol. 90, no. 14, 1993, pages 6444 - 8
HUSTON JS ET AL., PROC NATL ACAD SCI U S A, vol. 85, no. 16, 1988, pages 5879 - 83
LIMA JULIANA O ET AL: "The glyceraldehyde-3-phosphate dehydrogenase gene of Moniliophthora perniciosa, the causal agent of witches' broom disease of Theobroma cacao", GENETICS AND MOLECULAR BIOLOGY, vol. 32, no. 2, 2009, pages 362 - 366, XP002694452, ISSN: 1415-4757 *
MARINO MH, BIOPHARM, vol. 2, 1989, pages 18 - 33
PUCK ET AL., J. EXP. MED., vol. 108, 1958, pages 945 - 955
SEIDLER NORBERT W: "Basic biology of GAPDH.", ADVANCES IN EXPERIMENTAL MEDICINE AND BIOLOGY 2013, vol. 985, 2013, pages 1 - 36, XP009168347, ISSN: 0065-2598 *
SIMONSEN ET AL., PNAS, vol. 80, 1983, pages 2495 - 2499
WARD ES ET AL., NATURE, vol. 341, no. 6242, 1989, pages 544 - 6
WURM F; BERNARD A, CURR OPIN BIOTECHNOL, vol. 10, 1999, pages 156 - 159

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2016061240A1 (en) * 2014-10-15 2016-04-21 Amgen Inc. Promoter and regulatory elements for improved expression of heterologous genes in host cells
JP2017530718A (ja) * 2014-10-15 2017-10-19 アムジエン・インコーポレーテツド 宿主細胞における異種由来遺伝子の発現を改善するためのプロモーター及び調節エレメント
US10202616B2 (en) 2014-10-15 2019-02-12 Amgen Inc. Promoter and regulatory elements for improved expression of heterologous genes in host cells
EP3722433A1 (en) * 2014-10-15 2020-10-14 Amgen Inc. Promoter and regulatory elements for improved expression of heterologous genes in host cells
AU2015332577B2 (en) * 2014-10-15 2021-12-23 Amgen Inc. Promoter and regulatory elements for improved expression of heterologous genes in host cells

Also Published As

Publication number Publication date
AU2018204332A1 (en) 2018-07-05
EA037273B1 (ru) 2021-03-02
AU2018204332B2 (en) 2020-09-10
MX362393B (es) 2019-01-15
US20180163225A1 (en) 2018-06-14
KR20140113666A (ko) 2014-09-24
CN104093834A (zh) 2014-10-08
JP2015501642A (ja) 2015-01-19
JP2017200476A (ja) 2017-11-09
CA2856479A1 (en) 2013-06-13
ES2679291T3 (es) 2018-08-23
EP2788483B1 (en) 2018-06-27
IL232845A0 (en) 2014-07-31
EP2788483A1 (en) 2014-10-15
JP7096790B2 (ja) 2022-07-06
US20130344604A1 (en) 2013-12-26
SG11201402477VA (en) 2014-09-26
AU2012348558A1 (en) 2014-07-10
NZ626252A (en) 2016-06-24
KR102135745B1 (ko) 2020-07-21
MX2014006869A (es) 2014-07-14
US20200087679A1 (en) 2020-03-19
JP2019193659A (ja) 2019-11-07
EA201491034A1 (ru) 2015-04-30
HK1202578A1 (en) 2015-10-02
BR112014013597A2 (pt) 2020-08-18
AU2012348558A2 (en) 2014-07-24

Similar Documents

Publication Publication Date Title
US20200087679A1 (en) Expression cassette
JP4489424B2 (ja) 染色体に基くプラットホーム
AU2008339985C1 (en) Mammalian expression vector
AU2024220126A1 (en) Compositions and methods for making antibodies based on use of an expression-enhancing locus
AU2024220124A1 (en) Compositions and methods for making antibodies based on use of expression-enhancing loci
EP2711428A1 (en) Site-specific integration
EP2898077B1 (en) Expression vectors comprising chimeric cytomegalovirus promoter and enhancer sequences
AU2004295590B2 (en) Expression systems using mammalian beta-actin promoter
EP2938725A1 (en) Heterologous intron within an immunoglobulin domain
EP2938728A1 (en) Artificial introns
WO2018150345A1 (en) An expression vector
WO2014102101A1 (en) Novel intron sequences
WO2024068995A1 (en) Novel transposase system
NZ626252B2 (en) Expression cassette
JP4958905B2 (ja) ペプチド鎖発現を増大させるための物質および方法
JP2026512866A (ja) 遺伝子発現構築物のためのスペーサー
HK40032919A (en) Multi-site specific integration cells for difficult to express proteins

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 12816132

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 14003410

Country of ref document: US

ENP Entry into the national phase

Ref document number: 2856479

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 232845

Country of ref document: IL

ENP Entry into the national phase

Ref document number: 2014545423

Country of ref document: JP

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: MX/A/2014/006869

Country of ref document: MX

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 201491034

Country of ref document: EA

ENP Entry into the national phase

Ref document number: 20147018672

Country of ref document: KR

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 2012816132

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 2012348558

Country of ref document: AU

Date of ref document: 20121205

Kind code of ref document: A

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112014013597

Country of ref document: BR

REG Reference to national code

Ref country code: BR

Ref legal event code: B01E

Ref document number: 112014013597

Country of ref document: BR

Free format text: SOLICITA-SE APRESENTAR ESCLARECIMENTOS RELATIVOS A DIVERGENCIA NO NOME DE INVENTOR CONSTANTE DA PUBLICACAO INTERNACIONAL WO2013/084157, DE 13/06/2013, "CHRISTEL AEBISCHER-GUMY? E O CONSTANTE DO FORMULARIO DE ENTRADA NA FASE NACIONAL, "CHRISTEL CHER-GUMY".

ENP Entry into the national phase

Ref document number: 112014013597

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20140605