WO2018150345A1

WO2018150345A1 - An expression vector

Info

Publication number: WO2018150345A1
Application number: PCT/IB2018/050919
Authority: WO
Inventors: Ram Shankar Upadhayaya; Suman DUTTA; Mohana VAMASY
Original assignee: De Vita Bio Life Sciences
Priority date: 2017-02-16
Filing date: 2018-02-15
Publication date: 2018-08-23

Abstract

The present invention relates to an expression vector useful for the expression of a polynucleotide sequence encoding a polypeptide. The present invention is also directed to vectors and host cells which comprise the expression cassette and uses of the expression cassette for the production of a polypeptide from a host cell and further comprises the sequence encodes shRNA to downregulate mRNA associated with apoptosis in host cell.

Description

AN EXPRESSION VECTOR

FIELD OF INVENION

The present invention relates to an expression vector useful for the expression of a polynucleotide sequence encoding a polypeptide. The present invention is also directed to vectors and host cells which comprise the expression cassette and uses of the expression cassette for the production of a polypeptide from a host cell.

BACKGROUND OF THE INVENTION

Expression systems for the production of recombinant polypeptides are well-known in the state of the art. Polypeptides for use in pharmaceutical applications are preferably produced in mammalian cells such as CHO cells, NSO cells, SP2/0 cells, COS cells, HEK cells, BHK cells. The essential elements of an expression vector used for this purpose are normally selected from a prokaryotic plasmid propagation unit, for example E.coli, comprising a prokaryotic origin of replication and a prokaryotic selection marker, optionally a eukaryotic selection marker, and one or more expression cassettes for the expression of the structural gene(s) of interest each comprising a promoter, a polynucleotide sequence encoding a polypeptide, and optionally a transcription terminator including a polyadenylation signal. For transient expression in mammalian cells a mammalian origin of replication, such as the SV40 Oriox OriP, can be included. As promoter a constitutive or inducible promoter can be selected. For optimized transcription a Kozak sequence may be included in the 5' untranslated region. For mRNA processing, in particular mRNA splicing and transcription termination, mRNA splicing signals, depending on the organization of the structural gene (exon/intron organization), may be included as well as a polyadenylation signal. Expression of a gene is performed either in transient or using a stable cell line. The level of stable and high expression of a polypeptide in a production cell line is crucial to the overall process of the production of recombinant polypeptides. The demand for biological molecules such as proteins and specifically antibodies or antibody fragments has increased significantly over the last few years. High cost and poor yield have been limiting factors in the availability of biological molecules and it has been a major challenge to develop robust processes that increase the yield of desirable biological molecules on an industrial scale. Thus there is still a need for improving the efficiency of expression vectors to obtain high expression in recombinant polypeptide production.

SUMMARY OF THE INVENTION

The present invention relates generally to expression systems comprising expression cassettes and expression vectors which can be used to obtain increased expression in recombinant polypeptide production.

In embodiment the present disclosure provides an expression cassette which comprises promoter, a polynucleotide sequence encoding polypeptide, intron, internal ribosome binding site (IRES), and a non-translated DNA sequences of Matrix Attachment Region (MARS). In embodiment the present disclosure provides an expression cassette which comprises promoter, a polynucleotide sequence encoding polypeptide, intron, internal ribosome binding site (IRES), short hairpin RNA (shRNA), DHFR and non-translated DNA sequences of Matrix Attachment Region (MARS).

In certain embodiment the present disclosure provides an expression cassette which comprises promoter, a polynucleotide sequence encoding polypeptide, intron, internal ribosome binding site (IRES), and a non-translated DNA sequence of MARS is selected from sequence ID 1 , sequence ID 2 and Sequence ID 26.

In embodiment the present disclosure provides an expression cassette which comprises promoter, a polynucleotide sequence encoding polypeptide, intron, internal ribosome binding site (IRES), and a non-translated DNA sequence of MARS is selected from sequence ID 26.

In embodiment the present disclosure provides an expression cassette which comprises promoter, a polynucleotide sequence encoding polypeptide, intron, internal ribosome binding site (IRES), and a non-translated DNA sequence of MARS is selected from sequence ID 1 , sequence ID 2 and Sequence ID 26. In embodiment the present disclosure provides an expression cassette which comprises promoter, a polynucleotide sequence encoding polypeptide, intron, internal ribosome binding site (IRES), and non-translated DNA sequences of MARS comprises sequence ID 26 located at upstream and/or downstream of promoter

In another embodiment, the present disclosure provides an expression cassette which comprises promoter, polynucleotide sequence encoding polypeptide, intron, internal ribosome binding site (IRES), short hairpin RNA (shRNA), DHFR fused with Furin recognition motif- Thoseaasigna virus 2A (T2A) peptide and non-translated DNA sequence of MARS is as set forth in sequence ID 26 and wherein the non-translated DNA sequence of MARS is located upstream of promoter.

In another embodiment, the present disclosure provides an expression cassette which comprises promoter, polynucleotide sequence encoding polypeptide, intron, internal ribosome binding site (IRES), short hairpin RNA (shRNA), DHFR fused with Furin recognition motif- Thoseaasigna virus 2A (T2A) peptide and non-translated DNA sequence of MARS is as set forth in sequence ID 26 and wherein the non-translated DNA sequence of MARS is located downstream of poly-adenylation

In another embodiment, the present disclosure provides an expression cassette which comprises promoter, polynucleotide sequence encoding polypeptide, intron, internal ribosome binding site IRES, and non-translated DNA sequence of MARS is as set forth in sequence ID 1 or sequence ID 26 and wherein the non-translated DNA sequence of sequence ID 26 is located at upstream of promoter and non-translated DNA sequence of sequence ID 1 is located downstream of promoter. In another embodiment, the present disclosure provides an expression cassette which comprises promoter, polynucleotide sequence encoding polypeptide, intron, internal ribosome binding site IRES, and non-translated DNA sequence of MARS is as set forth in sequence ID 2 or sequence ID 26 and wherein the non-translated DNA sequence of sequence ID 26 is located at upstream of promoter and non-translated DNA sequence of sequence ID 2 is located downstream of promoter.

In another embodiment, the present disclosure provides an expression cassette which comprises promoter, polynucleotide sequence encoding polypeptide, intron, internal ribosome binding site IRES, and non-translated DNA sequence of MARS is as set forth in sequence ID 2 or sequence ID 26 and wherein the non-translated DNA sequence of sequence ID 2 is located at upstream of promoter and non-translated DNA sequence of sequence ID 26 is located downstream of promoter.

In another embodiment, the present disclosure provides an expression cassette which comprises CMV enhancer, CMV promoter, polynucleotide(s) sequence(s) encoding polypeptide(s), intron, internal ribosome binding site IRES, short hairpin RNA (shRNA), DHFR fused with Furin recognition ναο ϊ-Thoseaasigna virus 2A (T2A) peptide,other regulatory units, non-translated DNA sequence of MARS is as set forth in sequence ID 26 or sequence ID 1 and wherein the non-translated DNA sequence of sequence ID 1 is located at upstream of promoter and non-translated DNA sequence of sequence ID 26 is located downstream of promoter.

In another embodiment, the present disclosure provides an expression cassette which comprises at least more than one CMV promoter, polynucleotide sequence encoding polypeptide, intron, IRES, short hairpin RNA (shRNA), DHFR fused with Furin recognition motif-Thoseaasigna virus 2A (T2A) peptide regulatory units, non-translated DNA sequence of MARS is as set forth in sequence ID 26 and wherein the non-translated DNA sequence of MARS are located upstream of CMV promoter.

In another embodiment, the present disclosure provides an expression cassette which comprises a promoter, a polynucleotide sequence encoding a polypeptide, intron, internal ribosome binding site (IRES), short hairpin RNA (shRNA), DHFR fused with Furin recognition motif Thoseaasigna virus 2A (T2A) peptide and a non-translated genomic DNA sequence of MARS is as set forth in sequence ID 26 and wherein the a non-translated genomic DNA sequence of MARS is located at both upstream and/or downstream of promoter. In certain embodiment the shRNA is complementary to at least one BAK or BAX mRNA that regulates apoptosis. In embodiment shRNA is complementary to Bak. In such embodiment the shRNA sequence is as set forth in Sequence ID 4 which is complementary to Sequence ID 5. In another embodiment shRNA is complementary to Bax. In such embodiment the shRNA sequence is as set forth in Sequence ID 6 which is complementary to Sequence ID 7. In preferred embodiment the anti-sense strand of shRNA is complementary to respective Bak and Bax mRNA.

In preferred embodiment the shRNA expression is regulated by U6 promoter comprising sequence as set forth in Sequence ID no. 3. In another embodiment, the present disclosure provides an expression vector comprising an expression cassette and a host cell comprising an expression cassette or an expression vector comprising an expression cassette.

In another embodiment, the present disclosure provides an in vitro method for the expression of a polypeptide, comprising transfecting a host cell with an expression cassette or an expression vector and recovering the polypeptide(s) and the use of an expression cassette or an expression vector for the expression of a heterologous polypeptide(s) from a mammalian host cell.

BRIEF DESCRIPTION OF FIGURES

Figure 1 depicts vector of nearly 10944 bp containing two tandem repeats of U6 promoter driving expression of Bak and Bax targeting shRNA interlinked by a spacer. This is followed by a 769 bp fragment of human beta globin MARS. The human CMV promoter/enhancer is immediately 3' of MARS. The CMV promoter drives the expression of a tri-cistronic mRNA. An intron and Kozak are signatures at 5' of the first ORF, which codes for the Trastuzumab light chain. The second ORF translation is driven by IRES and codes for Trastuzumab heavy chain. The third ORF translation is driven by IRES and codes for DHFR. A BGH polyA signal marks transcription stop. The vector also contains Ampilicilin and Neomycin resistance genes, SV40 promoter, SV40 polyA signal, lac operator, lac promoter and pUC origin.

Figure 2 depicts vector of nearly 10374 bp containing two tandem repeats of U6 promoter driving expression of Bak and Bax targeting shRNA interlinked by a spacer. This is followed by a 769 bp fragment of human beta globin MARS. The human CMV promoter/enhancer is immediately 3' of MARS. The CMV promoter drives the expression of a bi-cistronic mRNA. An intron and Kozak are signatures at 5' of the first ORF, which codes for the Trastuzumab light chain. The second ORF translation is driven by IRES and codes for DHFR tagged to Trastuzumab heavy chain and both linked with a Furin recognition motif and T2A self- cleavage signature. All are in frame with DHFR. A BGH polyA signal marks transcription stop. A BGH polyA signal marks transcription stop. The vector also contains Ampilicilin and Neomycin resistance genes, SV40 promoter, SV40 polyA signal, lac operator, lac promoter and pUC origin.

Figure 3 depicts confirmation of clone by Mfel digestion of sequentially cloned shRNA cassette as set forth in sequence 21 followed by Trastuzumab light chain as set forth in sequence 22 and short MARS as set forth in sequence 26 in pcDNA3.1. The shRNA cassette was cloned at Bglll site, the trastuzumab light chain was cloned at Nhel/Notl site and short MARS was cloned at Mfel site.

Figure 4 depicts confirmation of clone by Xhol/Hindlll and Xhol only digestion of sequentially cloned shRNA cassette as set forth in sequence 21 followed by Trastuzumab light chain as set forth in sequence 22, short MARS as set forth in sequence 26 and IRES- Trastuzumab heavy chain as set forth in sequence 23 in pcDNA3.1. The shRNA cassette was cloned at Bglll site, the trastuzumab light chain was cloned at Nhel/Notl site, short MARS was cloned at Mfel site and IRES -Trastuzumab heavy chain was cloned at Xhol site.

Figure 5 depicts confirmation of clone by Bglll digestion showing removal of shRNA cassette from C3 -Trastuzumab. The C3 -Trastuzumab contains sequentially cloned shRNA cassette as set forth in sequence 21 followed by Trastuzumab light chain as set forth in sequence 22, short MARS as set forth in sequence 26, IRES -Trastuzumab heavy chain as set forth in sequence 23 and IRES-DHFR as set forth in sequence 24 in pcDNA3.1. The shRNA cassette was cloned at Bglll site, the trastuzumab light chain was cloned at Nhel/Notl site, short MARS was cloned at Mfel site, IRES -Trastuzumab heavy chain was cloned at Xhol site and IRES-DHFR was cloned at Xbal site. Figure 6 depicts confirmation of clone by XhoI/XBal and digestion of D 3 -Trastuzumab. C3 Trastuzumab was digested with Xhol and Xbal and IRES-DHFR-T2A-Trastuzumab heavy chain construct as set forth in sequence 25 was cloned at that site. Figure 7 depicts expression of Trastuzumab from C3-Trastuzumab construct in transient transfection experiment using varying amount of Fugene transfection reagent. Culture supernatants were collected at different time points and subjected to ELISA.

Figure 8 depicts expression of Trastuzumab from D3 -Trastuzumab construct in transient transfection experiment using varying amount of Fugene transfection reagent. Culture supernatants were collected at different time points and subjected to ELISA.

Figure 9 depicts knock-down of BAK and BAX expression from RTPCR studies. CHO-K1 cells were transfected with either C3 -Trastuzumab or C3 Δ shRNA-Trastuzumab. Expression of BAK and BAX genes were analysed by RTPCR post 72 hours of transfection. Figure 10 depicts Trastuzumab expression titer after methotrexate treatment. Suspension culture of CHO DG44 cells stably transfected with C3-Trastuzumab were treated with increasing concentration of methotrexate. The culture supernatant from either pools or clonal selected line were assessed for Trastuzumab titer by ELISA.

DETAILED DESCRIPTION The term "polynucleotide sequence encoding a polypeptide" as used herein includes DNA coding for a gene, preferably a heterologous gene expressing the polypeptide.

The terms "heterologous coding sequence", "heterologous gene sequence", "heterologous gene", "recombinant gene" or "gene" are used interchangeably. These terms refer to a DNA sequence that codes for a recombinant, in particular a recombinant heterologous protein product that is sought to be expressed in a host cell, preferably in a mammalian cell and harvested. The product of the gene can be a polypeptide. The heterologous gene sequence is naturally not present in the host cell and is derived from an organism of the same or a different species and may be genetically modified.

The terms "protein" and "polypeptide" are used interchangeably to include a series of amino acid residues connected to the other by peptide bonds between the alpha- amino and carboxy groups of adjacent residues. The term "life span of cell" relates to increase or maintenance of cell viability during the culture. In certain embodiment the cell viability is at least 80% at 14 days. The expression vector increases the life span of mammalian cell at least by 1%, 3%, 5%, 7%, 10%, 15%, 20%, 30%, 40%, 50%.

In some embodiments, the promoter of the expression cassette is selected from the group consisting of SV40 promoter, human tk promoter, MPSV promoter, mouse CMV, human CMV, rat CMV, human EF 1 alpha, Chinese hamster EF 1 alpha, human GAPDH, MYC, HYK. The promoters for shRNA expression include but not limited to U6, HI.

In some embodiment the non-translated genomic DNA sequences of "matrix attachment regions" (MARS) selected from sequence ID 1 sequence ID 2 and sequence ID 26 and variant thereof are used to increase the expression of polypeptide. Besides, MARS help transgenes in anchoring to the nuclear scaffold and helps maintaining local open chromatin domain. MARS have been proposed and evaluated for their insulation property conferred to transgenes from repressive effects linked to their site of integration within the host cell genome. The increase in transgene expression has been attributed to the presence of full length MARS (2999 bp)as set forth in sequence ID 2or short MARS as set forth in sequence ID land sequence ID 26.

In certain embodiment variant of MARS shows at least 50% or preferably at least 60% or more preferably at least 80% and most preferably at least 95% identity to sequence ID 1 or sequence ID 2 or Sequence ID 26.

Apoptosis is the major cause of cell death in bioreactors. Cells at terminal stage of batch culture readily undergo apoptosis due to the lack of nutrients. In contrast, fed-batch culture cells are exposed to continuous supply of nutrients and the major causes for apoptosis are increase in osmolality of medium, hypoxia and exposure to shear stress. Additionally accumulation of secondary metabolites is also a reason for apoptosis in fed-batch culture. Apoptosis is the programmed deconstruction and death of the cell upon reaching physiological senescence. The signal to initiate apoptosis can arise from cues like nutrient deficiency and hypoxia and apoptosis proceeds through either extrinsic or intrinsic pathways. FasL, TNF-a, and TRAIL are examples of extrinsic pathway inducers that upon binding to cell surface receptors trigger apoptosis. Intrinsic apoptotic stimuli classically encompass heat stress, starvation, hypoxia and is more pertinent in case of large scale cultures. Intrinsic pathway involves the expression of mitochondrialfactors such as cytochrome c and the SMAC proteins. Cytochrome c and the SMAC proteins work concertedly in initiation of apoptosis via the intrinsic pathway. Central to the intrinsic pathway is the mitochondrial permeabilization and this phenomenon is finely balanced by the Bcl-2 family of pro and anti-apoptotic proteins. Under normal physiological conditions, Bcl-2 family members form hetero-multimers with Bak on the outer membrane of mitochondria. Subsequent to apoptotic induction, Bax localises to the outer membrane and forms homo-multimers together with Bak. These Bax and Bak multimers trigger mitochondrial membrane permeabilization directly through pore formation. Notably, either Bak or Bax is sufficient to effect mitochondrial permeabilization and hence, suppression of both is required to rescue cells from apoptotic progression.

RNA interference (RNAi) is an importance mechanism whereby target genes can be silenced by exploiting the intrinsic cellular machinery. Synthetic short interfering RNA (siRNA), micro-interfering RNA (miRNA) and short hairpin RNA (shRNA) are examples of tools used for RNAi. In case of shRNA it is typically delivered by using an expression vector. Ideally, a RNA Poylmerase III promoter is used to drive the expression of shRNA owing to the fact that RNA Polymerase III driven transcription is independent of polyA signal and that no polyA tail is added to transcript. The primary transcript resembles a pri-microRNA (pri-miRNA) and is processed by Drosha to produce pre-shRNA. Subsequently, the pre-shRNA is exported from the nucleus and is processed in the cytoplasm by Dicer and loaded into the RNA-induced silencing complex (RISC). The sense (passenger) strand is degraded. The antisense (guide) strand directs RISC to bind to mRNA that has a complementary sequence. Upon perfect base pairing Argonaute2 (Ago2), a constituent of RISC, cleaves the mRNA. In the case of partial complementarity, RISC represses translation of the mRNA. In either case, the shRNA leads to target gene silencing.

In some embodiments, the polypeptide encoded by the expression cassette can be a non- glycosylated and glycosylated polypeptide. Glycosylated polypeptides refer to polypeptides having at least one oligosaccharide chain. Examples for non-glycosylated proteins are e. g. non-glycosylated hormones; non- glycosylated enzymes; non-glycosylated growth factors of the nerve growth factor (NGF) family, of the epithelial growth factor (EGF) and of the fibroblast growth factor (FGF) family and non-glycosylated receptors for hormones and growth factors. Examples for glycosylated proteins are hormones and hormone releasing factors, clotting factors, anti-clotting factors, receptors for hormones or growth factors, neurotrophic factors cytokines and their receptors, T-cell receptors, surface membrane proteins, transport proteins, homing receptors, addressins, regulatory proteins, antibodies, chimeric proteins, such as immunoadhesins, and fragments of any of the glycosylated proteins. Preferably the polypeptide is selected from the group consisting of antibodies, antibody fragments or antibody derivates (e.g. Fc fusion proteins and particular antibody formats like bispecific antibodies). Preferably antibodies o fragment thereof are selected from but not limited to Trastuzumab, Bevacizumab, Pertuzumab, Ofatuzumab, Ranibizumab, Aflibercept, Etanercept etc.

The expression cassette further comprises a genetic element selected from the group consisting of an additional promoter, an enhancer, transcriptional control elements, and a selectable marker, preferably a selectable marker which is expressed in animal cells, like Neomycin resistance and Puromycin resistance.

In preferred embodiment, the present disclosure provides an expression vector, preferably a mammalian expression vector comprising an expression cassette as described supra.

In some embodiments, the expression vector comprises at least two separate translational units transcribed as a single mRNA (bi-cistronic). An expression vector with two separate transcription units is also referred to as a double-gene vector. An example thereof is a vector, in which the first transcription unit encodes the heavy chain of an antibody or a fragment thereof and the second transcription unit encodes the light chain of an antibody. However, it is also possible that the expression vector of the present invention comprises more than two separate translational units, for example three, four or even more separate translational units each of which comprises a different nucleotide sequence encoding a different polypeptide chain but transcribed as a single mRNA. In certain embodiment, the present disclosure provides an expression cassette where polypeptides are expressed as part of bi-cistronic expression cassette. In certain embodiment the bi-cistronic expression cassette comprises at least two open reading frames (ORF) each having distinct translation initiation from the same mRNA. Translation of the upstream ORF is driven by Kozak whereas the translation of downstream ORF is driven by IRES; each ORF having its respective stop codon.

In certain embodiment the expression vector of the present invention comprises more than two separate translational units, for example three separate translational units each of which comprises a different nucleotide sequence encoding a different polypeptide chain but transcribed as a single mRNA. When three such polypetides are translated from one mRNA it is referred to as tri-cistronic element. The said vector comprises the light and heavy chain nucleotide sequence of antibody under the control of EMCV IRES and DHFR nucleotide sequence under the control of EMCV IRES. These three coding units make up the three cistrons.

In certain embodiments, the expression vector further comprises a genetic element selected from the group consisting of an additional promoter, an enhancer, transcriptional control elements, an origin of replication and a selectable marker.

Any selection marker commonly employed such as Thymidine Kinase (TK), Dihydrofolatereductase (DHFR), Puromycin, Neomycin, Gentamycin, Hygromycin or Glutamine Synthetase (GS) may be used for the expression cassette or the expression vector of the present invention. Preferably, the expression vectors of the invention may also comprise a limited number of useful restriction sites for insertion of the expression cassette for the secretion of a heterologous protein of the present invention. In certain embodiment the restriction sites are selected from Bglll, Dralll, Mfel, Nhel, Notl, Xhol and Xbal.

The expression vectors of the invention may further comprise an origin of replication such as the oriP origin of Epstein Barr Virus (EBV) or SV40 virus for autonomous replication/episomal maintenance in eukaryotic host cells but may be devoid of a selectable marker. The expression vector harbouring the expression cassette may further comprise an expression cassette coding for a fluorescent marker or an expression cassette coding for a protein increasing the capacity of the secretary pathway.

In certain embodiment the invention provides an expression cassette to express the gene of interest and to increase the life span of host cell in which it is expressed. The expression cassette provides desirable expression of gene of interest because of the selection of effective combinations of elements and further comprises nucleotide sequence encodes shRNA which inhibits apoptosis inducing genes such as BAK and/or BAX in host cell and thereby increase the life span of host cell.

The invention provides an expression vector which expresses the therapeutic proteins with desired yield and therefore overcome the problem associated with the biological manufacturing of therapeutic proteins at low or poor yield. Biological therapeutics demand have been increased drastically in decades and many attempts have been made to improve vector and culture conditions of cells. Cell culture conditions maintenance at large scale is very cumbersome as cells are susceptible to apoptosis and thereby reduce the yield of proteins. The present invention provides a unique combination of vector's elements such as short MARs as set forth in Sequence ID 26 at 5 'end in combination with chimeric intron and sense sh RNA which are complementary to BAK and BAX sequence of host mammalian cell which delayed or reduce the apoptosis rate of mammalian cell and thereby said unique combination of these elements provides a synergistic expression of proteins. The expression vector increases the life span of mammalian cell at least by 1%, 3%, 5%, 7%, 10%, 15%, 20%, 30%, 40%, 50%.

In embodiment the present disclosure provides an expression cassette which comprises promoter, a polynucleotide sequence encoding polypeptide, intron, internal ribosome binding site (IRES), anda non-translated DNA sequences of Matrix Attachment Region (MARS). In embodiment the present disclosure provides an expression cassette which comprises promoter, a polynucleotide sequence encoding polypeptide, intron, internal ribosome binding site (IRES), short hairpin RNA (shRNA), DHFR and non-translated DNA sequences of Matrix Attachment Region (MARS).

In embodiment the present disclosure provides an expression cassette which comprises promoter, a polynucleotide sequence encoding polypeptide, intron, internal ribosome binding site (IRES), and a non-translated DNA sequence of MARS is selected from sequence ID 1 , sequence ID 2 and Sequence ID 26.

In embodiment the present disclosure provides an expression cassette which comprises promoter, a polynucleotide sequence encoding polypeptide, intron, internal ribosome binding site (IRES), and non-translated DNA sequences of MARS is selected from sequence ID 1 , sequence ID 2 and sequence ID 26.

In another embodiment, the present disclosure provides an expression cassette which comprises promoter, polynucleotide sequence encoding polypeptide, intron, internal ribosome binding site (IRES), and non-translated DNA sequence of MARS is as set forth in sequence ID 26 and wherein the non-translated DNA sequence of MARS is located upstream of promoter.

In another embodiment, the present disclosure provides an expression cassette which comprises promoter, polynucleotide sequenceencoding polypeptide, intron, internal ribosome binding site (IRES), and non-translated DNA sequence of MARS is as set forth in sequence ID 26 and wherein the non-translated DNA sequence of MARS is located downstream of poly-adenylation signal. In another embodiment, the present disclosure provides an expression cassette which comprises promoter, polynucleotide sequence encoding polypeptide, intron, internal ribosome binding site (IRES), short hairpin RNA (shRNA), DHFR fused with Furin recognition motif-Thoseaasigna virus 2A (T2A) peptide, and non-translated DNA sequence of MARS is as set forth in sequence ID 26 and wherein the non-translated DNA sequence of MARS is located upstream of promoter.

In another embodiment, the present disclosure provides an expression cassette which comprises promoter, polynucleotide sequence encoding polypeptide, intron, internal ribosome binding site (IRES), short hairpin RNA (shRNA), DHFR fused with Furin recognition motif-Thoseaasigna virus 2A (T2A) peptide and non-translated DNA sequence of MARS is as set forth in sequence ID 26 and wherein the non-translated DNA sequence of MARS is located downstream of poly-adenylation.

In certain embodiment the distance between the non-translated region (3') and the CMV promoter (5') is around 465 bp and the distance between the non-translated region (5') and poly adenylation signal (3') is around 284 bp. In another embodiment, the present disclosure provides an expression cassette which comprises promoter, polynucleotide sequence encoding polypeptide, intron, internal ribosome binding site IRES, and non-translated DNA sequence of MARS is as set forth in sequence ID 1 or sequence ID 2 and wherein the non-translated DNA sequence of sequence ID 2 is located at upstream of promoter and non-translated DNA sequence of sequence ID 1 is located downstream of promoter.

In another embodiment, the present disclosure provides an expression cassette which comprises of at least two promoters operably linked to a polynucleotide sequence encoding a polypeptide and sh RNA respectively. In another embodiment, the present disclosure provides an expression cassette which comprises at least more than one CMV promoter, polynucleotide sequence encoding polypeptide, intron, IRES, short hairpin RNA (shRNA), DHFR fused with Furin recognition motif-Thoseaasigna virus 2A (T2A) peptide, regulatory units, non-translated DNA sequence of MARS is as set forth in sequence ID 26 and wherein the non-translated DNA sequence of MARS are located upstream of CMV promoter.

In certain embodiment the distances between the said non-translated regions (3') and the CMV promoter (5') is around 572 bp and the distance between the said non-translated regions (3') and the CMV promoter (5') is around 668 bp.

In another embodiment, the present disclosure provides an expression cassette which comprises of at least two promoters operably linked with a polynucleotide spacer sequence and each drives transcription of shRNA respectively. In such embodiment the promoters are selected from U6, HI. In certain embodiment the U6 promoter comprises sequence ID 3.

In embodiment, the present disclosure provides an expression cassette which comprises of CMV promoter, polynucleotide sequence(s) encoding polypeptide(s), intron, IRES, shRNA, DHFR and a non-translated genomic DNA sequence either derived from MARS set forth in sequence ID 2 or sequence ID 26 and wherein the non-translated genomic DNA sequence is located at upstream and downstream of CMV promoter.

In another embodiment, the present disclosure provides an expression cassette which comprises promoter, polynucleotide sequence encoding polypeptide, intron, internal ribosome binding site (IRES), short hairpin RNA (shRNA), DHFR fused with Furin recognition motif- Thoseaasigna virus 2A (T2A) peptide, and non-translated DNA sequence of MARS is as set forth in sequence ID 2 or sequence ID 26 and wherein the non-translated DNA sequence of MARS is located upstream of promoter.

In another embodiment, the present disclosure provides an expression cassette which comprises promoter, polynucleotide sequence encoding polypeptide, intron, internal ribosome binding site (IRES), short hairpin RNA (shRNA), DHFR fused with Furin recognition motif- Thoseaasigna virus 2A (T2A) peptide and non-translated DNA sequence of MARS is as set forth in sequence ID 2 or sequence ID 26 and wherein the non-translated DNA sequence of MARS is located downstream of poly-adenylation.

In certain embodiment the distance between the non-translated region (3') and the CMV promoter (5') is around 465 bp and the distance between the non-translated region (5') and poly adenylation signal (3') is around 284 bp.

In another embodiment, the present disclosure provides an expression cassette which comprises a promoter, a polynucleotide sequence encoding a polypeptide, intron, internal ribosome binding site (IRES), short hairpin RNA (shRNA), DHFR fused with Furin recognition motif-Thoseaasigna virus 2 A (T2A) peptide and a non-translated genomic DNA sequence of MARS as set forth in sequence ID 2 or sequence ID 26 and wherein the a non- translated genomic DNA sequence is located at both upstream and downstream of CMV promoter. In another embodiment, the present disclosure provides an expression cassette which comprises a promoter, a polynucleotide sequence encoding a polypeptide, intron, internal ribosome binding site (IRES), short hairpin RNA (shRNA), DHFR fused with Furin recognition motif- Thoseaasigna virus 2A (T2A) peptide and a non-translated genomic DNA sequence of MARS is as set forth in sequence ID 1 and/or sequence ID 26 and wherein the a non-translated genomic DNA sequence is located at upstream or downstream of promoter.

In certain embodiment there is fusion of hamster DHFR coding sequence with Furin recognition motif- Thoseaasigna virus 2A (T2A) peptide followed by Heavy Chain signal peptide and heavy chain coding sequence. This is driven by IRES mediated translation as the second cistron. The 2A self-cleaving peptide (2A), which was discovered in the foot-and- mouth-disease virus (FMDV) in 1991, is an oligopeptide (usually 18-22 amino acids) located between two proteins in some members of the picornavirus family3. The 2 A self-cleaving peptide of FMDV might undergo self-cleavage to generate mature viral proteins by a translational effect that is known as "stop-go" or "stop-carry". The 2A sequence, rather than signifying a proteolytic element, modifies the activity of the ribosome to promote hydrolysis of the peptidyl(2A)-tRNAGly ester linkage, thereby releasing the polypeptide from the translational complex, in a mode that allows the synthesis of a discrete downstream translation product to proceed. This process produces a ribosomal 'skip' from one codon to the next without the formation of a peptide bond. Hence equi molar proportion of two gene products is formed. "Self-cleavage" of 2A peptides occurs between the last 2 amino acids, G and P. The P attached to the Heavy Chain or Light Chain will be removed together with the signal peptide. Cleavage at the furin recognition site occurs in the middle of RRKR. RR residues left after furin cleavage together with the last K on the C-terminus of Heavy Chain or Light Chain will be removed by carboxy-peptidases, although this removal is inefficient.

In certain embodiment the shRNA targets at least one gene that regulates apoptosis. Apoptosis regulating genes are selected from Caspase 3, Caspase 7, Caspase 9, Bak, Bax.

In certain embodiment the shRNA is complementary to at least one gene that regulates apoptosis. In embodiment shRNA is complementary to Bak. In another embodiment shRNA is complementary to Bax. In preferred embodiment the anti-sense strand of shRNA is complementary to respective Bak and Bax mRNA. In embodiment MARS is located at least only one end of expression cassette. In another embodiment MARS is located at both end of expression cassette.

In embodiment MARS is located at both end of expression cassette have same length. In another embodiment full length MARS is located at least at only one end of expression cassette; either 5' of promoter or 3' of polyA signal.

In embodiment MARS is located at both end of expression cassette wherein at least one MARS is comparatively longer than other MARS.

In certain embodiment an expression vector expressing a therapeutic proteins in mammalian cell comprising; a) a non-translated genomic DNA sequence selected from sequence ID no.l or sequence ID no.2 or sequence ID no.26;

b) first expression cassette comprising promoter operably linked to nucleotide sequence which encodes short hairpin RNA (sh RNA) which is complementary to sequence Id no 5 or sequence Id no 7;

c) optionally second expression cassette comprising promoter operably linked to nucleotide sequence which encodes short hairpin RNA (sh RNA) which is complementary to sequence Id no 5 or sequence Id no 7;

d) third expression cassette comprising promoter operably linked to nucleotide sequence which encodes a therapeutic protein;

e) bovine growth hormone polyA signal;

f) regulatory elements.

In certain embodiment an expression vector expressing a therapeutic proteins in mammalian cell comprising; a. U6 promoter as set forth in sequence ID no.3;

b. polynucleotide sequence encoding shRNA complimentary to sequence ID no 5. c. U6 promoter as set forth in sequence IDno.3;

d. polynucleotide sequence encoding shRNA complimentary to sequence ID no 7.

e. a non-translated genomic DNA sequence selected from sequence ID no.2 or sequence ID no.26;

f. CMV promoter;

g. optionally enhancer;

h. a polynucleotide sequence encoding a polypeptide of therapeutic protein; i. bovine growth hormone polyA signal;

j. optionally a non-translated genomic DNA sequence selected from sequence id no 2 or sequence id no.2 downstream of a eukaryotic promoter;

k. regulatory elements.

In certain embodiment an expression vector expressing a therapeutic proteins in mammalian cell comprising;

a. U6 promoter as set forth in sequence ID no.3;

b. polynucleotide sequence encoding shRNA complimentary to sequence ID no 5.

c. U6 promoter as set forth in sequence ID no.3;

d. polynucleotide sequence encoding shRNA complimentary to sequence ID no 7.

f. CMV promoter

g. Optionally enhancer;

h. chimeric intron as set forth in Sequence ID no.8

i. a polynucleotide sequence encoding a polypeptide of heavy chain of antibody j. IRES

k. a polynucleotide sequence encoding a polypeptide of light chain of antibody; 1. bovine growth hormone polyA signal;

m. IRES

n. DHFR o. Sv40 promoter;

p. Sv40 poly A;

q. Selectable marker selected from ampicillin kanamycin and neomycin.

In certain embodiment the expression vector comprising a nucleotide sequence encoding a short hairpin RNA molecule consists of 19 nucleotides which is complementary to sequence Id no 5 or sequence Id no 7.

In certain embodiment the expression vector comprising a nucleotide sequence encoding a short hairpin RNA molecule consists of 19 nucleotides comprise sequence ID no.4 and Sequence ID no.6 which is complementary to sequence Id no 5 or sequence Id no 7.

In certain embodiment the expression vector comprises first and second expression cassette which encodes the heterologous sh RNA.

In certain embodiment the expression vector comprises first and second expression cassette which encodes the homologous sh RNA.

In certain embodiment the expression vector comprises the first expression cassette encodes short hairpin RNA (sh RNA) which is complementary to the sequence Id no 5 and second expression cassette encodes short hairpin RNA (sh RNA) which is complementary to the sequence Id no 7.

In certain embodiment the expression vector expresses the shRNA which downregulate the expression of B AK or B AX mRNA which cause apoptosis to mammalian cell.

In certain embodiment the expression vector comprise a regulatory elements selected from chimeric intron as set forth in Sequence ID no. 8, selectable marker, dihydrofolate reductase (DHFR), sv40 promoter, sv40 polyA and CAP binding site.

In certain embodiment the selectable marker is ampicillin, kanamycin and neomycin.

In certain embodiment the expression vector provides high expression of therapeutic proteins. In certain embodiment the expression of therapeutic protein is at least 4g/L. In certain embodiment the expression level is 6g/L. In another embodiment MARS is located at 5 'end of promoter is longer than MARS located at 3' end of polyA signal.

In another embodiment MARS is juxtaposed between two promoters.

In preferred embodiments, the present disclosure provides an expression vector, which comprises: a) a non-translated genomic DNA sequence as set forth in sequence IDno.2 b) CMV promoter c) Optionally enhancer d) a polynucleotide sequence encoding a polypeptide e) bovine growth hormone polyA signal e) U6 promoter f) a polynucleotide sequence encoding shRNA complimentary to Bak and/or Bax. f) Optionally a non-translated genomic DNA sequence selected from sequence id no 2 or sequence id no.26 downstream of a eukaryotic promoter.

In another preferred embodiments, the present disclosure provides an expression vector, which comprises: a) a non-translated genomic DNA sequence as set forth in sequence ID no.2 b) CMV promoter c) Optionally enhancer d) a polynucleotide sequence encoding a polypeptide of heavy chain of trastzumab e) IRES f) a polynucleotide sequence encoding a polypeptide of light chain of trastzumab g) bovine growth hormone polyA signal h) U6 promoter i) a polynucleotide sequence encoding shRNA complimentary to Bak and/or Bax. g) Optionally a non-translated genomic DNA sequence selected from sequence ID no. 2 or sequence ID no.26 downstream of a eukaryotic promoter. In preferred embodiments, the present disclosure provides an expression vector, which comprises in order: a) U6 promoter

b) Bak shRNA cassette

c) U6 promoter

d) Bax shRNA cassette

e) MARS having sequence ID 2

f) CMV enhancer

g) CMV promoter

h) intron

i) Kozaksequence

j) Signal Peptide

k) Light Chain of antibody

1) IRES

m) Signal Peptide

n) Heavy Chain of antibody

o) bGH poly(A) signal

p) optionally MARS having sequence ID lor sequence ID 2

q) SV40 promoter

r) SV40 ori

s) NeomycinR/KanamycinR

t) SV40 poly(A) signal

u) Optionally Ampicillin R v) AmpR promoter

In certain embodiments, the present disclosure provides an expression vector, which comprises in order:

MARS 860..3858 2999

CMV enhancer 3942..4321 380

CMV promoter 4322..4525 204

chimeric intron 4608..4740 133

Kozak 4785..4793 9

Sig Pep 4794..4850 57

Light Chain 4851..5492 642

IRES 5553..6126 574

Sig Pep 6127..6183 57

Heavy Chain 6184..7533 1350

bGH poly(A) signal 7580..7804 225

SV40 promoter 8292..8621 330

SV40 ori 8472..8607 136

NeoR/KanR 8688..9482 795

SV40 poly(A) signal 9656.-9777 122

lac operator 9850..9866 17

lac promoter 9874..9904 31

CAP binding site 9919..9940 22

ori 10228..10813 586

AmpR 10984..11844 861

AmpR promoter 11845..11949 105

T2A 6709..6762 54

Sig Pep 6763..6819 57

Heavy Chain 6820..8169 1350

bGH poly(A) signal 8210..8434 225

MARS 8717..11715 2999

SV40 promoter 11930..12259 330

SV40 ori 12110..12245 136

NeoR/KanR 12326..13120 795

SV40 poly(A) signal 13294..13415 122

lac operator 13488..13504 17

lac promoter 13512..13542 31

CAP binding site 13557..13578 22

ori 13866..14451 586

AmpR 14622..15482 861

AmpR promoter 15483..15587 105

NeoR/KanR 9714..10508 795

SV40 poly(A) signal 10682..10803 122

lac operator 10876..10892 17

lac promoter 10900..10930 31

CAP binding site 10945..10966 22

ori 11254..11839 586

AmpR 12010..12870 861

AmpR promoter 12871..12975 105

In certain embodiments, the present disclosure provides an expression vector, which comprises in order: Elements (C3- Size

From..To (bp)

Trastuzumab) (bp)

U6 promoter 18..274 257

Bak shRNA cassette 275..321 47

U6 promoter 382..638 257

Bax shRNA cassette 639..685 47

Short MARS 851..1619 769

CMV enhancer 1694..2073 380

CMV promoter 2074..2277 204 chimeric intron 2360..2492 133

Kozak 2537..2545 9

Signal Peptide 2546..2602 57

Light Chain 2603..3244 642

IRES 3305..3893 589

Signal Peptide 3891..3947 57

Heavy Chain 3948..5297 1350

IRES 5357..5945 589

DHFR 5946..6503 558 bGH poly(A) signal 6544.-6768 225 fl ori 6814..7242 429

SV40 promoter 7256..7585 330

SV40 ori 7436..7571 136

NeoR/KanR 7652.-8446 795

SV40 poly(A) signal 8620..8741 122 lac operator 8814..8830 17 lac promoter 8838..8868 31

CAP binding site 8883..8904 22 ori 9192..9777 586

AmpR 9948..10,808 861

AmpR promoter 10,809.-10,913 105

In certain embodiments, the present disclosure provid comprises in order:

Elements (D3- Size

From..To (bp)

Trastuzumab) (bp)

U6 promoter 18..274 257

Bak shRNA cassette 275..321 47

U6 promoter 382..638 257

Bax shRNA cassette 639..685 47

Short MARS 851..1619 769 CMV enhancer 1694..2073 380

CMV promoter 2074..2277 204

T7 promoter 2322..2340 19

chimeric intron 2360..2492 133

Kozak 2537..2545 9

Signal Peptide 2546..2602 57

Light Chain 2603..3244 642

IRES 3305..3893 589

DHFR 3894..4451 558

Furin Recognization site 4473..4526 54

T2A 4473..4526 54

Signal Peptide 4527.-4583 57

Heavy Chain 4584..5933 1350

bGH poly(A) signal 5974..6198 225

fl ori 6244..6672 429

SV40 promoter 6686..7015 330

SV40 ori 6866..7001 136

NeoR/KanR 7082..7876 795

SV40 poly(A) signal 8050..8171 122

lac operator 8244..8260 17

lac promoter 8268..8298 31

CAP binding site 8313..8334 22

ori 8622..9207 586

AmpR 9378.-10,238 861

AmpR promoter 10,239.-10,343 105

In embodiment, the present disclosure provides a host cell comprising an expression cassette or an expression vector as described supra. The host cell can be a human or non-human cell. Preferred host cells are mammalian cells. Preferred example of mammalian host cells isChinese hamster ovary (CHO) cell or cell line. Suitable CHO cell lines include e.g. CHO-S (Invitrogen, Carlsbad, CA, USA), CHO Kl (ATCC CCL-61), CHO pro3-, CHO DG44, CHO P12 or the dhfr- CHO cell line DUK-BII (Chasin et al, PNAS 77, 1980, 4216-4220), DUXBI 1 (Simonsen et al, PNAS 80, 1983, 2495-2499), or CHO-K1SV (Lonza, Basel, Switzerland).

In another embodiment, the present disclosure provides an in vitro method for the expression of a polypeptide, comprising transfecting a host cell with the expression cassette or an expression vector as described supra and recovering the polypeptide. The polypeptide is preferably a heterologous, more preferably a human polypeptide.

For transfecting the expression cassette or the expression vector into a host cell according to the present invention any transfection technique such as those well-known in the art, e.g. electoporation, calcium phosphate co-precipitation, DEAE-dextran transfection, lipofection, can be employed if appropriate for a given host cell type. It is to be noted that the host cell transfected with the expression cassette or the expression vector of the present invention is to be construed as being a transiently or stably transfected cell line. Thus, according to the present invention the present expression cassette or the expression vector can be maintained episomally i.e. transiently transfected or can be stably integrated in the genome of the host cell i.e. stably transfected.

In a further aspect, the present disclosure provides the use of the expression cassette or an expression vector as described supra for the expression of a heterologous polypeptide from a mammalian host cell, in particular the use of the expression cassette or an expression vector as described supra for the in vitro expression of a heterologous polypeptide from a mammalian host cell. Expression and recovering of the protein can be carried out according to methods known to the person skilled in the art.

The present invention provides various illustrative examples but scope of invention is not limited to said examples and any modification including addition or deletion of any elements will be considered within the scope of invention. Vector construction is well known in the art and skilled person can design primers and can clone the below mentioned elements through molecular biology techniques known in the art.

Example 1:

Cloning of Sequence 21 (shRNA cassette) in pcDNA3.1 vector:

pMK containing Sequence 21 (shRNA cassette comprises U6 promoter, Bak Sense, loop, BaklAnti Sense, terminator, linker, BaxSense, BaxAnti Sense) is synthesized from GeneArt (Life Technologies) and pcDNA3.1 vector were digested by Bglll restriction enzyme at 37°C for overnight. Digested vector was treated by SAP and deactivated at 65°C before ligation. Digested products of pMK-Sequence 21 was ligated with digested pcDNA3.1 vector followed by transformation into E. coli DH5a chemical competent cell. Positive colonies were screened by colony PCR by using forward primer (5' GGT TAT TGT CTC ATG AGC G 3') and reverse primer (5' GGA ATC ATG GGA AAT AGG C 3'). PCR positives colonies with expected PCR product of -500 bp and -200 bp were inoculated overnight in LB broth with with 100 μg/ml Ampicillin. For further confirmation of clone digestion was performed with Bglll. As expected digested products were observed at -5428 and -684 bp. Hence, pcDNA3.1-shRNA clone was obtained (6112 bp).

Cloning of Sequence 22 (Trastuzumab Light Chain) into pCDNA3.1-shRNA vector: pMK containing Sequence 22 (chimeric intron, linker, KOZAK, Signal peptide, Light Chain, Stop codon Trastuzumab Light Chain) is synthesized from GeneArt (Life Technologies) and pcDNA3.1-shRNA vector were digested with Nhel and NotI restriction enzyme at 37 °C for overnight. Digested products of pMK-Sequence 2 (-984 bp) was ligated in pcDNA3.1- shRNA vector followed by transformation into E. coli DH5a chemical competent cell. Positive colonies were screened by colony PCR by using forward primer (5' ACC AAG TCC TTC AAC CGG G 3') and reverse primer (5' AAA GCA TGT GCA CCG AGG C 3'). PCR positives colonies with expected Colonies were inoculated overnight in LB broth with with 100 μg/ml Ampicillin and subsequently mini-prep of plasmid was done. For confirmation of clone digestion was performed with Dralll and double digestion with Nhel and NotI restriction enzyme. As expected the product size of Nhel and NotI digest was observed at -6028 and -895 bp and the product sizes of Dralll digestion was observed at -6294 and -629 bp. Hence, pcDNA3.1-shRNA-Trastu LC clone was obtained (6923 bp).

Cloning of Sequence 26 (Short MARS) into pcDNA3.1-shRNA-Trastu LC Vector:

Short MARS was amplified from Human Genomic DNA (780bp), Both forward primer (5' CCGCCGCAATTGTTAGTAAGACATCACCTTGCATTT 3') and reverse primer (5' CGGCGGCAATTGAGCCATAGTTTGAGTTACCCTTT) had Mfel restriction sites at both ends. Amplicon product was purified by PCR purification kit (Qiagen). Subsequently, purified PCR product and pcDNA3.1-shRNA-Trastu LC vector were digested with Mfel restriction enzyme. Mfel digested vector was further treated with Shrimp alkaline phosphatase (SAP) for 1 hour at 37°C followed by deactivation of SAP at 65°C for 10 minutes. Mfel digested PCR product was ligated into Vector in 3 : 1 ratio for overnight at 22°C followed by transformation into E. coli DH5a chemical competent cell. Colonies were screened for positive clone by colony PCR using forward primer (5' CTT GTG TGT TGG AGG TCG C 3') and reverse primer (5' CGG CGG CAA TTG AGC CAT AGT TTG AGT TAC CCT TT 3'). PCR positives colonies with expected PCR product of -780 bp were inoculated overnight at 37°C in LB broth with 100 μg/ml Ampicillin. For further confirmation of clone, plasmid was digested with Mfel restriction enzyme and analyzed in agarose gel. As expected digested products were observed at -6923 bp and -775 bp (Fig 3). Hence, pcDNA3.1-shRNA-Trastu LC-shMARS clone was obtained (7698 bp). Cloning of Sequence 23 (EMCV IRES fused with Trastuzumab Heavy Chain) into pcDNA3.1-shRNA-Trastu LC-shMARS vector: pMS containing Sequence 23 (EMCV IRES, Signal Peptide, Heavy Chain, Stop codon and Trastuzumab Heavy chain) ) is synthesized from GeneArt (Life Technologies) and pcDNA3.1-shRNA-Trastu LC-shMARS vector were digested with Xhol restriction enzyme at 37°C for overnight. Digested vector was treated by SAP and deactivated at 65°C before ligation. Digested products of pMS-Sequence 23 was ligated in pcDNA3.1-shRNA-Trastu LC-shMARS vector followed by transformation into E. coli DH5a chemical competent cell. Positive colonies were screened by colony PCR by using forward primer (5' ACC AAG TCC TTC AAC CGG G 3') and reverse primer (5' AAA GCA TGT GCA CCG AGG C 3'). PCR positives colonies with expected PCR product of -680 bp were inoculated overnight in LB broth with with 100 μg/ml Ampicillin. For further confirmation of clone digestion was performed with Xhol and double digestion with Xhol and Hindlll restriction enzyme. As expected digested product was observed at -7698 bp and -2046 bp for Xhol single digestion (Fig 4a) and -274 bp, -1772 bp and -7698 bp was observed for Xhol and Hindlll double digestion (Fig 4b). Hence, pcDNA3.1 -shRNA-Trastu LC-shMARS-Trastu HC-C3 clone was obtained (9744).

Cloning of Sequence 24 (EMCV IRES fused with DHFR) into pcDNA3.1 -shRNA -Trastu LC-shMARS-Trastu HC-C3 vector: pMK containing Sequence 24 (linker, EMCV IRES, DHFR) ) is synthesized from GeneArt (Life Technologies) and pcDNA3.1 -shRNA-Trastu LC-shMARS-Trastu HC-C3 vector were digested with Xbal restriction enzyme. Digested vector was treated by SAP and deactivated at 65 °C before ligation. Digested fragment of pMK-Sequence 4 (-1200 bp) was ligated in vector in 3: 1 ratio. Digested products of pMK-Sequence 4 was ligated in pcDNA3.1-shRNA-Trastu LC-shMARS-Trastu HC-C3 vector followed by transformation into E. coli DH5a chemical competent cell. Positive colonies were screened by colony PCR by using forward primer (5' GCA CAA CCA CTA CAC CCA G 3') and reverse primer (5' CCA CGA TGC AGT TCA GCG G 3'). PCR positives colonies with expected PCR product of -580 bp were inoculated overnight in LB broth with with 100 μg/ml Ampicillin. For further confirmation of clone digestion was performed with Hindlll and EcoRl restriction enzyme. As expected digested product was observed at -8440 bp, -2052 bp and -452 bp. Hence, final clone C3-Tratuzumab was obtained (10944 bp). Maxi prep was done of clone C3-Tratuzumab and further validated by Hindlll and EcoRl double digest which yielded fragments at -8441 bp, -2052 bp and -452 bp.

Example 2

Removal of shRNA cassette for constructing C3-AshRNA-Trastuzumab clone:

Clone C3-Trastuzumab was digested with Bglll restriction enzyme overnight t 37°C. Digested vector was purified from agarose gel and ligation reaction was set at 22°C for overnight. Ligated product was transformed in E. coli DH5a chemical competent cell. Colonies were inoculated overnight in LB broth with 100 μg/ml Ampicillin. Mini prep was done and digestion was performed by using Bglll restriction enzyme. No release of fragment was observed on agarose gel (Fig. 5) confirming the removal of shRNA cassette (Sequence 1). Hence, clone C3-AshRNA-Trastuzumab was obtained (10260 bp).

Example 3

Cloning of Sequence 27 (DHFR fused with Trastuzumab heavy chain) into pcDNA3.1- shRNA-Trastu LC-shMARS:

Vector construct prepared in the present example is only different from example 1 in DHFR fused with Trastuzumab heavy chain as mentioned in sequence 27. pMA containing Sequence 7 (EMCV IRES, DHFR, Furin cleavage motif, GSG linker, T2A sequence, signal peptide, Trastuzumab heavy chain DHFR fused with Trastuzumab heavy chain) is synthesized from Gene Art (Life Technologies) and pcDNA3.1-shRNA-Trastu LC- shMARS vector were digested with Xhol and Xbal restriction enzymes. Digested fragment of pMA-Sequence 7 (-1200 bp) was ligated in vector in 3: 1 ratio. Digested products of pMK- Sequence 7 was ligated in pcDNA3.1-shRNA-Trastu LC-shMARS vector followed by transformation into E. coli DH5a chemical competent cell. Positive colonies were screened by colony PCR by using forward primer (5' CAA GGC CGA CTA CGA GAA G 3') and reverse primer (5' GTA AAG CAT GTG CAC CGA G 3'). PCR positives colonies with expected PCR product of -649 bp were inoculated overnight in LB broth with with 100 μg/ml Ampicillin. For further confirmation of clone digestion was performed with Xhol and Xbal restriction enzymes. As expected digested product was observed at - 7692bp and -2682 bp (Fig. 6). Hence, final clone -Tratuzumab was obtained (10374 bp). Maxi prep was done of clone D3 -Tratuzumab and further validated by Xhol and Xbal double digest which yielded fragments at - 7692bp and -2682 bp.

Example 4

Validation of expression of C3-Trastuzumab and D3-Trastuzumab constructs

CHO-K1 cells were grown in DMEM supplemented with 10% FBS and 1 mM sodium pyruvate at 37°C with 5% C0₂. Cells were seeded one day prior to transfection at 40-50% cell density in 3 ml culture medium in 6 well plates. Fugene HD (Promega) was used to confirm the expression of Trastuzumab from C3 and D3 constructs. On the day of transfection, the culture medium was replaced with fresh medium. C3 -Trastuzumab and D3 -Trastuzumab were diluted to 20 ng/μΐ in sterile water. Transfection complexes were prepared at different ratios as given below

The complexes were incubated for 15 minutes at room temperature. Subsequently 150 μΐ were added to each well of 6 well plates. 100 μΐ of culture supernatants were harvested 24, 48, 72 hours post transfection and ELISA was performed. For ELISA each well was coated with 8 ng per well with Her-2 protein (Novus bio). Vivitra was used as standard from 12.5 ng/ml and diluted at 1: 1 for total seven concentration points. Secondary goat an ti -human IgG-HRP antibody (Abeam) was used at 1:40000 dilution.

Expression of Trastuzumab was observed for both C3-Trastuzumab and D3-Trastuzumab, thereby validating the design of constructs. While for C3-Trasuzumab highest expression was observed for 2: 1 ratio at 72 hours post transfection (Fig.7), for D3 -Trastuzumab the highest expression was observed for 4: 1 ratio at 72 hours post transfection (Fig. 8).

Example 5

C3- Trastuzumab downregulates Bak and Bax gene in CHO cells

CHO-K1 cells were grown in DMEM supplemented with 10% FBS and 1 mM sodium pyruvate at 37°C with 5% C0₂. Cells were seeded one day prior to transfection at 40-50% cell density in 3 ml culture medium in 6 well plates. Xfect (Takara) transfection reagent was used for transfection. In a microcentrifuge tube, 7.5 μg of either C3 -Trastuzumab or C3-AshRNA- Trastuzumab plasmid DNA was diluted with Xfect Reaction Buffer to a final volume of 100 μΐ and vortexed for 5 seconds at high speed. 1.5 μΐ Xfect Polymer was added to the diluted plasmid DNA and mixed well by vortexing for 10 seconds at high speed. This was incubated for 10 minutes at room temperature to allow nanoparticle complexes to form. The entire 100 μΐ of nanoparticle complex solution was added drop wise to the cell culture medium and the plate was rocked gently back and forth to mix. The plate was incubated at 37°C for 4 hours. Subsequently, the nanoparticle complexes were removed from cells by aspiration and replaced with 3 ml fresh complete growth medium. The cells were allowed to grow for further 72 hours following which RNA isolation was performed using Trizol reagent (Life Technologies).

C3 -Trastuzumab and C3-AshRNA-Trastuzumab transfected CHOK1 cells were collected in 1.5 ml centrifuge tubes. 200 μΐ of Trizol was added along with 100 μΐ of chloroform and mixed it gently by inverting. Samples were kept for incubation for 10 minutes at room temperature. Tubes were centrifuged at 12000 rpm for 15 minutes at 4°C. 150 μΐ of supernatant was transferred to fresh tube. ΙΟΟμΙ of isopropanol was added in each sample tube and centrifuged at 12000 rpm for 15 minutes at 4°C. Supernatant was discarded form each tube and pellet was washed twice with 75% Molecular grade ice-chilled ethanol at 12000 rpm for 15 minutes at 4°C. The pellet was air dried and finally suspended in 20 μΐ DNAse RNAse free water (Sigma).

2.0 ug of RNA was treated with RNAse free DNAsel (Takara) for 10 minutes at 37°C. 0.25 μΜ EDTA was added and heated at 70°C.

The RNA mix was assembled as follows:

RNA: 1 μ_β

dNTP mix (lO mM): 1 μΐ

Random hexamer (50 μΜ): 1 μΐ

DNAse RNAse free water: up to final 10 μΐ

The RNA mix was incubated at 65°C for 5 minutes, then quick chilled on ice for 1 minute. The 2X RT mix was assembled as follows:

5X RT buffer: 4 μΐ

RNase OUT (40U/ μΐ): 1 μΐ

Primescript Reverse Transcriptase: 1 μΐ

DNAse RNAse free water: 4 μΐ

The RNA mix was added to 2X RT mix. The complete reaction mix was incubated at 42°C for 1 hour followed by incubation at 70°C for 15 minutes. Multiplex PCR with Actin with BAK and Actin with BAX primers were setup as follows.

5

PCR products were analyzed on 2% agarose gel. More than 70 % knockdown of BAK (amplicon size 464 bp) and BAX (amplicon size 424 bp) gene expression was observed for C3-Trastuzumab transfected cells (Fig. 9) proving the efficacy of the vector design C3- Trastuzumab.

Example 6

Stable cell line generation with C3-Trastuzumab construct To generate the stable CHO-DG44 cell line Xfect transfection reagent was used. Prior to the day of transfection 0.3 x 10° CHO-DG44 cells were seeded in 6 well plate in complete growth medium (AlphaMEM with nucleotide and nucleosides and supplemented with 4 mM L- Glutamine ,lx HT supplement , 10 % FBS). In a microcentrifuge tube, 7.5 μg of C3- Trastuzumab plasmid DNA was diluted with Xfect Reaction Buffer to a final volume of 100 μΐ and vortexed for 5 seconds at high speed. 1.5 μΐ Xfect Polymer was added to the diluted plasmid DNA and mixed well by vortexing for 10 seconds at high speed. This was incubated for 10 minutes at room temperature to allow nanoparticle complexes to form. The entire 100 μΐ of nanoparticle complex solution was added dropwise to the cell culture medium and the plate was rocked gently back and forth to mix. The plate was incubated at 37°C for 4 hours. Subsequently, the nanoparticle complexes were removed from cells by aspiration and replaced with 3 ml fresh complete growth medium. The stable pools were generated after G418 (1 mg/ml) selection for 3 weeks in selective medium lacking deoxy nucleotides and nucleosides. In every media change the floating cells were collected and seeded in chemically defined medium (BalanCD CHO growth A medium supplemented with 4 mM L-Glutamine, Irvine Scientific) without serum for direct suspension adaptation. After few days the cells were adapted for suspension culture in presence of G418. The serum free suspension cultures were seeded for methotrexate (MTX) amplification at 5 μΜ and 10 μΜ concentrations. After two weeks of methotrexate amplification the ELISA was performed to check the Trastuzumab expression after four days of last media change.

All the culture supernatants were collected four days after the last media change. For ELISA each well was coated with 8 ng per well with Her-2 protein (Novus bio). Vivitra was used as standard from 12.5 ng/ml and diluted at 1 : 1 for total seven concentration points. The samples were diluted with PBS in a range of 1:2000 to 1:6000 and added to respective wells. Secondary goat anti-human IgG-HRP antibody (Abeam) was used at 1:40000 dilution.

The Trastuzumab expression was higher in 10 μΜ MTX concentrations at -30 μg/ml (Fig. 10) at a cell density of ~5 x 10⁵ cells/ml. These cells were further seeded in 96 well plates for limiting dilution cloning at 0.3 cells per well seeding density supplemented with 20 μΜ MTX. After two weeks of methotrexate amplification the ELISA was performed to check the Trastuzumab expression after four days of last media change. The highest expression was -100 μg/ml (Fig. 10) observed in single cell clone growing at 20 μΜ MTX with a cell density of ~6 x 10⁵ cells/ml.

Claims

We claim:

1. An expression vector expressing a therapeutic proteins in mammalian cell comprising;

a) a non-translated genomic DNA sequence as set forth in sequence ID no.l or sequence ID no.2 or sequence ID no.26;

b) first expression cassette comprising promoter operably linked to nucleotide sequence which encodes short hairpin RNA (sh RNA) which is complementary to sequence Id 5 or sequence Id no 7;

e) bovine growth hormone polyA signal;

f) regulatory elements.

2. The expression vector according to claim 1 wherein a nucleotide sequence encoding a short hairpin RNA molecule consists of 19 nucleotides which is complementary to sequence Id no 5 or sequence Id no 7.

3. The expression vector according to claim 1 wherein the first and second expression cassette encodes the heterologous sh RNA.

4. The expression vector according to claim 1 wherein the first and second expression cassette encodes the homologous sh RNA.

5. The expression vector according to claim 1 wherein the first expression cassette encodes short hairpin RNA (sh RNA) which is complementary to the sequence Id no 5 and second expression cassette encodes short hairpin RNA (sh RNA) which is complementary to the sequence Id no 7.

6. The expression vector according to claim 1 wherein the sh RNA downregulate the expression of sequence Id no 5 and sequence Id no 7 which cause apoptosis to mammalian cell. The expression vector according to claim 1 wherein the first promoter is U6 promoter.

The expression vector according to claim 1 wherein the second promoter is CMV promoter.

The expression according to claim 1 wherein therapeutic proteins are antibodies or fusion proteins selected from Trastuzumab, Bevacizumab, Pertuzumab, Ofatuzumab, Ranibizumab, Aflibercept and Etanercept.

An expression vector according to claim 1 comprises:

a. U6 promoter as set forth in sequence IDno.3;

b. polynucleotide sequence encoding shRNA complimentary to sequence ID no 5;

c. U6 promoter as set forth in sequence IDno.3;

d. polynucleotide sequence encoding shRNA complimentary to sequence ID 7; e. a non-translated genomic DNA sequence as set forth in sequence IDno. l or sequence ID no.26;

f. CMV promoter;

g. optionally enhancer;

h. a polynucleotide sequence encoding a polypeptide of therapeutic protein;

i. bovine growth hormone polyA signal;

j. optionally a non-translated genomic DNA sequence as set forth in sequence id no 1 or sequence id no.2 downstream of a eukaryotic promoter;

k. regulatory elements.

The expression vector according to preceding claims comprises a regulatory elements selected from chimeric intron as set forth in Sequence ID no. 8, selectable marker, dihydrofolate reductase (DHFR), sv40 promoter and sv40 polyA.

The expression vector according to claim 12 wherein the selectable marker is ampicillin kanamycin and neomycin.

The expression vector according to claim 12 wherein the DHFR is fused with Furin recognition motif-Thoseaasigna virus 2A (T2A) peptide.

14. The expression vector according to claim 1 comprises:

a. U6 promoter as set forth in sequence IDno.3;

b. polynucleotide sequence encoding shRNA complimentary to sequence ID no 5;

c. U6 promoter as set forth in sequence IDno.3;

d. polynucleotide sequence encoding shRNA complimentary to sequence ID no 7;

e. a non-translated genomic DNA sequence as set forth in sequence IDno.l or s equence ID no.26;

f. CMV promoter

g. Optionally enhancer;

h. chimeric intron as set forth in Sequence ID no.

i. a polynucleotide sequence encoding a polypeptide of heavy chain of antibody

j. IRES

k. a polynucleotide sequence encoding a polypeptide of light chain of antibody;

1. bovine growth hormone polyA signal;

m. IRES

n. DHFR

o. Sv40 promoter;

p. Sv40 poly A;

q. Selectable marker selected from ampicillin kanamycin and neomycin.

16. The expression vector according to claim 1 increase the life span of mammalian cell at least by 1%, 3%, 5%, 7%, 10%, 15%, 20%, 30%, 40%, 50% in which it is transfected.

17. The expression vector according to preceding claim wherein the sh RNA sequence is selected from sequence ID 4 and Sequence ID 6.

18. The expression vector according to claim 1 provides at least 4g/L expression of therapeutic protein.