TW201144439A - Inhibition-based high-throughput screen strategy for cell clones - Google Patents

Abstract

A method for screening cells with high level expression of a target protein is disclosed. The method includes introducing into a plurality of host cells a DNA construct that encodes both a target protein and an inhibitor to an endogenous selectable marker in the host cells, screening host cells harboring the DNA construct for the expression of the endogenous selectable marker, and isolating cells with reduced expression of the selectable marker. Also disclosed is a DNA construct configured to express both the target protein and the inhibitor inside the host cell.

Description

201144439 VI. INSTRUCTIONS OF THE INVENTION: FIELD OF THE INVENTION The technology disclosed herein relates generally to biotechnology and molecular biology, and in particular to the extensive screening of cell lines. The present application claims priority to U.S. Provisional Application Serial No. 61/213,459, filed on Jun. [Prior Art] In the production of a cell strain producing a recombinant protein, a key step is to select an effective pure line after incorporating the relevant gene into the host cell. For industrial scale bioproduction, there is a great need for a pure line in which the product gene is stably chimeric and produces a large amount of protein product. In a heterogeneous population, the recombination of the recombinant gene into the host genome is highly random. Cells containing multiple copies of a stable chimeric gene are less abundant than those with a low copy number. Sub-selection lines with high yields are rare and are easily diluted by non-producing cells or low-yielding cells that grow faster. Therefore, multiple screening and testing are required to isolate high-productivity secondary colonies. In general, 'limited dilution methods' are too lengthy and time consuming. Screening methods using flow cytometry and cell sorting are generally considered to significantly increase the efficiency of screening cells. Millions of cells can be screened in a short period of time, and even if the frequency of occurrence in the mixed cell population is as low as 丨〇-6, subpopulations and single cells can be isolated therefrom. Flow cytometry with non-fluorescent reporter proteins to quickly identify early in the 150275.doc 201144439 production of a large number of target proteins. By the expression of cell surface proteins, antibodies and ligands bind to fluorescent dyes, making the technique of isolating cells easy. For example, cell surface proteins that are not normally expressed on host cells can be co-expressed with the target protein. And as a conductor. In the case where cell surface protein expression is not related to productivity, a reporter molecule such as green fluorescent protein (GF: P) can be used to separate cells based on the content of intracellular proteins. GFp has become an important reporter for gene expression and cell selection based on induced gene products. In mammalian cell lines, gfp has been used to co-exhibit with recombinant proteins to screen high yield pure lines based on the intensity of light. The correlation between GFP fluorescence intensity and recombinant protein production has been found in several cell lines expressing various recombinant proteins. However, the performance of such screening markers increases the load on the protein expression machinery in the cell and reduces the production of the target protein. SUMMARY OF THE INVENTION One aspect of the present invention relates to a method of screening cells having a high target protein expression amount. The method comprises introducing a DNA construct having both a protein encoding a target protein and a suppressor of an endogenous selection marker of a host cell into a plurality of host cells, and screening the host cell containing the DNA construct for expression of the endogenous screening marker And separating cells with low expression markers. The DNA construction system is configured to express both the target protein and the inhibitor in the host cell. In one embodiment, the inhibitor is selected from the group consisting of small interfering RNA (siRNA), small hairpin RNA (shRNA), microRNA (miRNA), a hybrid of mi:RNA and shRNA, and antisense RNA. 150275.doc 201144439 In another embodiment, the suppressor shRNA is selected. In another embodiment, the endogenous screening marker is fluorescently labeled and the separating step comprises sorting the cells with a fluorescence activated cell sorter (FACS) . In another embodiment, the DNA construct further encodes dihydrofolate reductase (DHFR) and the host cell is a DHFR deficient cell. Another aspect of the invention pertains to a high capacity screening method for selecting cells for expression of a transgenic gene. The method comprises transfecting a host cell expressing a fluorescent protein with a vector carrying at least one of a transgenic gene and an interfering RNA expressing a fluorescent protein; measuring the fluorescence intensity in the transfected cell; and separating the fluorescent intensity Cells that are not fluorescently transfected with the fluorescence intensity of the cells. In one embodiment, the fluorescent protein is green fluorescent protein (GFP). In another embodiment, the interfering RNA is a mir-30 based shRNA. In another embodiment, the separating step comprises sorting the cells with FACS. In another embodiment, the cell expressing the fluorescent protein is a DHFR deficient CHO cell. In another embodiment, at least one of the transgenic genes is linked to a gene encoding DHFR via an internal ribosome entry site (IRES). Another aspect of the invention pertains to an expression vector' for use in high throughput screening of cells containing an expression vector. The expression vector comprises a first nucleotide sequence encoding a protein of interest, a second nucleotide sequence encoding an exogenous screening marker of a host cell, a third nucleotide sequence encoding a repressor of a host cell endogenous selection marker, And one or more regulatory elements that control expression of the first nucleotide sequence, the second nucleotide sequence, and the third nucleotide sequence in the host cell. 150275.doc 201144439 The first nucleotide sequence is linked to the first nucleotide acid sequence via an internal ribosome entry site (IRES). In one embodiment, the expression vector additionally comprises one or more anti-repressor elements. In a related embodiment, the one or more anti-repressor elements comprise a portion of the mouse anti-repressor element 40. In another embodiment, the repressor is an interfering RNA. In a related embodiment, the interfering RNA is a miR-30 based shRNA. In another embodiment, the endogenous screening marker is a fluorescent protein <= In a related embodiment, the fluorescent protein is green fluorescent protein. In another embodiment, the exogenous screening marker is dihydrofolate reductase. In another embodiment, the one or more regulatory elements comprise a CMV ΙΕ enhancer. [Embodiment] The present invention discloses a method for cultivating cells of the exogenous protein in the south. In one embodiment, the method comprises the steps of: introducing a DNA construct having both a protein encoding a target protein and a host cell endogenous screening marker into a plurality of host cells, wherein the construct is configured to be Both the target protein and the suppressor are expressed in the host cell; the host cell containing the DMA construct is screened for the expression of the endogenous screening marker; and the cell with low expression of the endogenous screening marker is isolated. As used hereinafter, the terms "cell" / "host cell" and "cell strain" / "host cell strain" are generally defined as eukaryotic cells and their homogeneous 150275.doc 201144439 population, which can be known by the art. It is maintained in cell culture and has the ability to express heterologous proteins. In the embodiment, the cells are CH〇 cells. In another embodiment, the cells are CHO cells that express GFP as an endogenous selection marker. In another embodiment, the cells are devoid of the DHFR gene and exhibit GFp as an endogenous screen, labeled ch〇 cell. As used hereinafter, the term "expression" is generally used to refer to the production of one or more specific RNA products or one or more specific proteins in a cell. In the case of an RNA product, it refers to the transcription process. In the case of a protein product, it refers to the process of transcription, translation, and, where appropriate, post-translational modification. In the case of a secreted protein, it refers to transcription, translation, and, where appropriate, post-translational modifications (e.g., glycosylation, disulfide bond formation, etc.) and subsequent secretion processes. In the case of a multimenc protein, it includes the assembly of a polypeptide monomer to form a multimeric structure. A verb corresponding to the noun "performance" has a meaning similar to a noun. As used hereinafter, the term "screening marker" is generally used to refer to a gene and/or protein that can detect its presence, either directly or indirectly, in a cell, such as inactivating a screening agent and protecting the host cell from the lethal effect of the screening agent. Or genes and/or proteins (eg, antibiotic resistance genes and/or proteins) that are affected by growth inhibition effects. Another possibility is a selection marker (e.g., green fluorescent protein and derivative, luciferase or alkaline phosphatase) that can induce fluorescence or color deposits. The term "endogenous screening marker" refers to a screening marker encoded by a polynucleotide that has been introduced into a host cell, i.e., a polynucleotide already present in the host cell. The coding sequence for the "endogenous selection marker" can be in an embedded form (i.e., embedded in 150275.doc 201144439 incorporated into the genome of the cell) or in free form. As used hereinafter, the term "face structure" means a performance or transformational structure, and the A structure contains at least one performance unit or performance card. The term performance unit or performance card is used herein to mean a unit that can express a sequence of compilation or open reading (4). "Expression unit or performance cut" typically comprises - or a plurality of regulatory elements operably linked to a transgenic gene encoding a related molecule, i.e., a polypeptide or a polynucleotide. A "regulatory element" is a nucleic acid sequence that regulates the expression of a transgene by being operably linked to a coding sequence. Examples of regulatory sequences include, but are not limited to, appropriate recurstor strands, termination sequences, initiation sequences, and enhancer sequences; efficient RNA processing signals, such as splicing signals and poly(s) genes; sequences that stabilize cytoplasmic mRNA a sequence that increases translation efficiency (ie, Kozak-induced sequence); a sequence that enhances protein stability; and a sequence that secretes protein secretion when needed. Regulatory sequences can be configured cis or in reverse, or at a distance to control the relevant genes. A "transgenic gene" is a nucleic acid sequence to be delivered or transferred to a mammalian cell. The transgene can encode a protein, peptide or polypeptide suitable for use as a marker, reporter or therapeutic molecule. The transgenic gene may also encode a protein f, a polypeptide or a peptide suitable for protein production, diagnostic assay or for any temporary or stable gene transfer in vitro or in vivo, and the transgene may be edited with a polynuclear acid. Such as miRNA, RNAi, shRNA, antisense Rna, ribonuclease or other regulatory nucleic acids. Transgenic genes also include DNA sequences for inducing recombination and gene repair. When a nucleic acid sequence is functionally related to another nucleic acid sequence, the former 150275.doc 201144439 is operatively linked to the latter. For example, if the DNA of the pro-sequence or secretory 刖V peptide is expressed as a protein involved in polymorphism, then the operably linked to the DNA of the polypeptide; if the promoter or enhancer affects the transcription of the coding sequence' It is operably linked to the sequence; or operably linked to the coding sequence if the ribosome binding site is positioned to facilitate translation. By "operably linked" is meant that the DNA sequences being linked are contiguous and, in the case of a secretory leader sequence, contiguous and in the reading phase. However, enhancers do not need to be continuous. The attachment is achieved by joining at suitable restriction sites. If the sites are not present, the synthetic nucleus f acid acceptor or linker is used in a conventional manner. A "strainer of a selection marker" can be a polypeptide or polynucleotide that directly or indirectly inhibits the expression or activity of a marker. In one embodiment, the inhibitor is a polynucleotide that inhibits the expression of a marker in a host cell, such as small interfering RNA (siRNA), small hairpin RNA (shRNA), microRNA (miRNA), miRNA, and shRNA A hybrid or antisense RNA molecule. In another embodiment, the 'inhibitor is a polypeptide that inhibits the expression of a selectable marker in a host cell, such as a transcriptional regulator. In another embodiment, the inhibitor is a polypeptide, such as an antibody, that inhibits the biological activity of the selectable marker. As used herein, the term 'siRNA' refers to a length of about 1 〇 5 5 nucleotides (the term "nucleotide" includes nucleotide analogs), preferably about 15-25 nucleotides, more preferably. An RNA agent of about 17, 18, 19, 20, 21, 22, 23, 24 or 25 nucleotides, preferably double-stranded, having, for example, 1, 2 or 3 overhang nucleosides The overhanging end of an acid (or nucleotide analog) that can signal or mediate RNA interference. The naturally occurring siRNA is produced by the cell's 150275.doc • 10· 201144439 RNA interference (RNAi) machinery from longer dsRNA molecules (e.g., length > 25 nucleotides). As used herein, the term "RNA interference" or "RNAi" generally refers to a sequence-specific or selective process that results in downregulation of a target molecule (e.g., a target gene, protein, or RNA). In a particular embodiment, the "RNA interference" or "RNAi" process is characterized by degradation of an RNA molecule (e.g., an RNA molecule within a cell) that is triggered by an RNA agent. Degradation is catalyzed by the enzyme RNA-induced silencing complex (RISC). RNAi is naturally present in cells to remove foreign RNA (eg, viral RNA). Native RNAi is derived from fragments of free dsRNA that can be introduced into other similar RNA sequences by degradation mechanisms. Alternatively, RNAi can be initiated by introducing small interfering RNA molecules into the cell to render the target gene unexpressed. As used hereinafter, the term "shRNA" refers to an RNA agent having a stem-loop structure comprising a first region and a second region of a complementary sequence, the regions of which are complementary to each other in such an extent as to occur between the regions. Pairing, the first region and the second region are joined via a loop region resulting from the lack of base pairing between nucleotides (or nucleotide analogs) within the loop region. The shRNA hairpin structure is broken down into siRNA by cellular machinery, which in turn binds to RNA-induced silencing complex (RISC). This complex binds to and decomposes mRNA that is paired with and bound to siRNA. The DNA construct may additionally contain plastid elements for replication and screening in bacteria during its construction. DNA constructs may also contain additional screening markers to facilitate amplification of the DNA construct within the host cell. Screening markers encoded by DNA constructs are considered exogenous screening markers. An example set of exogenous selectable markers 150275.doc 201144439 includes, but is not limited to, antibiotic resistance (eg, neomycin gene encoding G418 resistance) or enzyme analog resistance (eg, encoding methotrexate resistance) Sex dihydrofolate reductase gene). In one embodiment, the DNA construct contains a double-effect (b. icistr〇nic) expression cassette in which an open reading frame of the associated protein is linked to an exogenous screening marker via an internal ribosome entry site (IRES) or The coding sequence of the endogenous screening inhibitor is such that it is transcribed in the same mRNA but independently translated. Because they are all derived from a common mRNA, the amount of expression of the exogenous screening marker or repressor accurately predicts the relative amount of protein associated with each pure line. Preferably, the open reading frame of the protein associated with the double-effected cassette is located upstream of the coding sequence of the exogenous screening marker or the endogenous screening marker repressor. For example, to improve the accuracy and yield of multi-round methotrexate (ΜΤχ) amplification, a gene encoding a therapeutic protein (such as an antibody light chain) is linked to an exogenous screening marker (such as DHFR) via the IRES at the 3' end. ) to transcribe in the same mRNA but independently translated. Relatively low, IRES-mediated translation relative to 5, 5i cap-mediated translation ensures that cellular resources are primarily used to produce therapeutic proteins rather than DHFR proteins. However, because it is derived from the same mRNA, the amount of DHFR amplification can accurately predict the relative amount of therapeutic protein for each pure line. In another embodiment, the DNA construct additionally comprises one or more anti-repressor elements that are resistant to chromatin-related repression (ARE, as used hereinafter, ARE (or anti-repressor sequences, which are used interchangeably herein) as having The ability to block the ability of the transgene to repress, and the natural DNA of 150275.doc -12- 201144439 isolated from the eukaryotic genome. ARE has the effect of affecting the cis transcription of the gene and/or providing a stabilizing and/or enhancing effect. Capacity. It has been confirmed that when the ARE is flanked by the transgenic gene, the transgenic gene expression of the randomly selected recombinant cell line can be increased to the maximum possible expression of the promoter of the transgenic gene. In addition, the expression of the transgenic gene has been experienced. Cell generations remain stable and do not exhibit random silencing. Therefore, ARE confers positional independence that the transgenic genes are not possible in the case of conventional transgenic gene systems. Positional independence means transgenic embedding To the genomic location that can cause the transgenic gene to be silent, maintain the transcriptional activity state under the protection of ARE. In the real part of the mouse ~. In the other - implement the wealth, let the structure contain Multiple partial mouse ARE40 fragments. Methods for introducing DNA constructs into cells are well known in the art. Examples of such methods include, but are not limited to, electroporation, lipofection, sulphuric acid or gas. Recombination and DEAE-dextran-mediated transfection. DNA constructs can also be used to (4) face human to cell towels. Common viral vectors include, but are not limited to, adenoviral vectors, adeno-associated viral vectors, and vesicular viruses. Vectors and retroviral vectors ^ for the expression of exogenous and (10) sex-selective markers "cells transfected with warship constructs. (4) high expression of marker suppressors in DNA constructs can lead to endogenous screening markers The amount of expression and/or activity is reduced. The cells with reduced expression are then screened and sub-selected to determine the amount and stability of the transgenic gene expression. In some embodiments, endogenous ke. * n You are born as a protein that can be induced to emit fluorescence. In these examples, the 'screening step and the separation step can be performed using the 150275.doc 201144439 fluorescence activated cell sorter (FACS). In the other In the embodiment, the cells transfected with the DNA construct are first screened by one or more rounds (for example, screening for anti-G418 and/or anti-amidoxime pure lines) with exogenous markers. The selected cells are then screened out. The present invention also discloses a DNA construct that is configured to allow high yield screening of cells containing the DNA construct. In one embodiment, the construct contains the protein of interest. The coding sequence and the coding sequence of the host cell endogenously screened for the marker repressor, wherein the DNA construct is configured to express both the target protein and the inhibitor in the host cell. In one embodiment, the inhibitor is an inhibitory host Endogenous screening markers for small interfering RNA (siRNA), small hairpin RNA (shRNA), microRNA (miRNA), hybrids of miRNA and shRNA, or antisense RNA molecules. In another embodiment, the inhibitor is a polypeptide, such as a transcriptional regulator, that inhibits expression of the host cell endogenously screened for expression. In another embodiment the 'inhibitor is a polypeptide, such as an antibody, that inhibits the biological activity of the endogenous screening marker. In another embodiment, the endogenous selection marker is a protein that induces fluorescence. In another embodiment, the DNA construct further comprises one or more anti-repressor elements. The technique of the present invention is capable of rapidly identifying and isolating high yield pure lines from heterogeneous populations of transfected cells, thereby reducing the work and time of the standard limiting dilution method 150275.doc -14- 201144439. In addition, because this technique can identify rare cells in a population, it can reduce the number of rounds of pool amplification before separating high-yield pure lines or by first separating for drug amplification and secondary selection. The high yield of the colony is pure to shorten the development time. EXAMPLES The simplicity and effectiveness of the screening method for green fluorescent protein (GFP)/fluorescent activated cell sorter (FACS) has been confirmed in previous studies. In these previous reports, 'GFP is incorporated using an internal ribosome entry site (IRES) or a two promoter system, either as part of a fusion protein or as part of a double-effect construct. Cells with high GfP levels are associated with high levels of related protein products. This can be attributed to the stable chimerization of a high copy number recombinant gene or the fact that the gene has been chimeric to a site having extremely high transcriptional activity. While these methods have been shown to be effective, there may be some concerns regarding the use of Gpp-containing cell lines to make human therapeutics. Furthermore, it does not seem necessary to impose a burden on the GFp production after the separation of the subpopulations by the metabolic machinery of the cells. This cellular resource can potentially be converted to increase cell growth or recombinant protein production. The following example describes a novel technique for the reverse use of GFp as a screening target and FACS sorting to screen high yielding cell lines. Figure 1 is a schematic diagram showing a GFP-based screening process. Briefly, a plastid vector containing cDNA encoding GFP was transfected into DHFR-deficient CH〇 cells. The cells that successfully obtained the desired vector have fluorescence. GFp expressing cells are set as parental host cells for recombinant protein expression. To produce the desired recombinant protein, the parental host cell was transfected with a vector containing shRNAmireGFP' followed by FACS sorting to select cells with a low fluorescence intensity of 150275.doc •15·201144439. After several rounds of increasing sputum challenge, the cell culture was subjected to multiple rounds of sorting and amplification. The cell line with the lowest GFP fluorescence intensity corresponds to the pure line with the highest expression of the transgenic gene. Finally, the selected pure lines are amplified and tested for yield and stability. Because FACS can easily screen large numbers of cells, the chances of obtaining a high-yield pure line will be greatly improved compared to the limit dilution method. In addition, the procedure is less labor intensive and can significantly reduce the time required to produce a pure line for biological production. Example 1: Establishment of CHO+GFP/-dhfr cell line Chinese hamster ovary dihydrofolate reductase-deficient cell line (CH〇/dhfr-) was cultured with 111'(0.1111)^hypoxanthine and 0.016 111] ^Thymidine,

Gibco' catalog number 11067), 10% FBS (Biological Industries, catalog 04-001·1A) and 2 μM methylamine hydrazine hydrate (ΜΤΧ, Sigma, SI-M8407) I think Fu's modified Durbec Medium (Isc〇ve, s modified Dulbecco's medium, IMDM, Gibco, Cat. No. 12200). CHO/cells were transfected with 5 pg of plastid vector containing GFP-encoding cDNA (pFLAg-eGFP-IRES-Puro) and lipfectamine (LipofectamineTM Invitrogen PulsTM Reagent (Cat. No. 11514-015) instructions. Use 5 pg/ml D votes. Transfected cells were screened by pUromyCin dihydrochloride (Sigma, SI-P8833). The cells were cultured in the above medium after 10 days of screening in IMDM medium supplemented with HT, 10% FBS, 2 μM MTX and screening antibiotics. CHO·· cells (CHO+GFP/-_ cells) expressing GFP were selected and set as parental hosts of recombinant protein expression. 150275.doc •16· 201144439 Example 2: Construction of expression vector (1) pScinoDP-DHFR vector by replacing the EGFP gene in the plastid backbone of pEGFP-Nl (Clontech) with the IRES-DHFR fusion gene, and adding additional SV40 polyglycans The polyA tail and the CMV-IE promoter were inserted into the pEGFP-Nl (Clonlech) plastid skeleton to construct the pScinoDP-DHFR plastid. Briefly, the polyadenylation tail and the CMV-IE promoter 'sequence were obtained by PCR amplification using pCEP4 plastid (Invetrogen) as a template. The fusion poly(A) tail-promoter fusion sequence J SV40polA-CMV-IE (about 1.2 kb) was established by overlap extension PCR (OL-PCR). The fusion sequence was digested with Xhol/Bglll and inserted into the XH/Bglll-digested pEGFP-Nl vector. The resulting construct was named pScinoDP. The IRES sequence and the DHFR gene were obtained by PCR amplification using PIRES2-EGFP and pSV2-DHFR plastids as templates. Hybrids of the IRES sequence fragment and the DHFR gene fragment (IRES2-DHFR) were generated by overlap extension PCR (OL-PCR). The hybrid fragment (about 1.1 kb) was digested with Agel/Notl and inserted into the Agel/Notl-digested pEGFP-N1 to replace the EGFP gene in the pEGFP-Nl vector. The resulting construct was named pIRES2-DHFR. Site-directed mutagenesis was performed to eliminate the ApaLI site in the IRES sequence. The plastid PIRES2-DHFR having the mutation restriction enzyme ApaLI site in the IRES sequence was digested with Agel/Notl, and the 1.2 kb fragment containing the IRES sequence and the entire DHFR coding region gene was ligated to the Agel/Notl-digested pScinoDP to generate pScinoDP. -DHFR (Figure 2). All constructs were verified by enzyme assays and/or by nucleotide sequencing. (2) pScinoDP3-DHFR vector The pScinoDP3-DHFR vector was designed as a vector based on pScinoDP-DHFR carrying the hEFla promoter and the CMV-IE enhancer. Briefly, the hEFla promoter was amplified from the pBudCE4.1 vector (Invitrogen) by sub-selecting the hEFla promoter after the CMV-IE enhancer on pEGFP-N1 to form the pCMVe-hEFla-EGFP vector. A hybrid containing the hEFla promoter and the CMV-IE enhancer sequence was obtained. The CMVe-hEF 1 a fragment was PCR amplified from the pCMVe-hEFla-EGFP vector and used to replace the two CMV promoters in the pScionDP-DHFR vector. The resulting vector was named pScinoDP3-DHFR (Fig. 3) ° (3) pScinoDP3mir-DHFR vector The single-strand 97 nt "mir30-like" shRNAiGFP oligomer was generated using the PCR using the following synthetic backbone DNA and primer: Single-stranded 97 nt "shRNAiGFP" DNA oligo y-TGCTGTTGACAGTGAGCGAGCXCAAGOTGGXGTACAACTATAGTGAAGCCAC AGATGTATAGTTGTACTCCAGCnGTGCCTGCCTACTGCCTCGGA-3' (SEQ Π) ΝΟ: 1) The underlined italic sequence indicates the mir30 sequence, and the un-underlined italic sequence indicates the mir30 loop structure. Targets for sense and antisense screening Sequence samples are shown in bold and underlined bold, respectively. The mir3-like shRNAiGFP line was synthesized as a single-stranded DNA oligonucleotide having a common terminus corresponding to one of the endogenous mir30 miRNA flanking sequences. mirFWD-Agel bow I subsequence (40 matrices): 150275.doc -18· 201144439

S,-CAGAXGGACCGGTAAGGTXYXTTaCTGTTGACAGTGAGCG-Zi (SEQ ED NO:2) mirREV-Hindlll arch I subsequence (37 matrices): S^CrAAAGTAGCCCCTTAAGCTTTCCGAGGCAGTAGGCA^ (SEQ ID NO: 3) used to display the flanking region in underlined italic sequence A universal flanking sequence is made to initiate the reaction whereby the entire mir30-like shRNAiGFP is amplified, resulting in a PCR product that is optionally colonized into the receiving vector. PCR was performed using Platinum® Pfx DNA polymerase and the following profile: 95*t for 3 minutes, followed by 95 °C for 30 seconds, 54 °C for 30 seconds, and 75 °C for 30 seconds for a total of 35 cycles. The resulting PCR product (AgeI-shRNAiGFP) was cloned into the modified pEGFP-Nl vector (the Agel site was disrupted and there were other Agel sites and EcoRV sites after the neomycin gene). The resulting construct was named pEGFP-Nl-shRNAiGFP. These columns are also verified by DNA sequencing. The pEGFP-Nl-shRNAiGFP vector was digested with ApaLI-Notl. The CMV-IE-GFP fragment was replaced with a ScinoDP3-DHFR fragment from pScinoDP3-DHFR. The resulting construct was named pScinoDP3mir-DHFR (Fig. 4). (4) pScinoDP8mir-DHFR vector The pScinoDP8mir-DHFR vector contains a regulatory DNA element mARE40 调控 A regulatory element such as an anti-repressor element derived from a housekeeping gene has been shown to positively affect the specific productivity of a recombinant protein produced by a cell line. The plastid pEGFP-Nl was used as the backbone of this construct. Briefly, a partial mouse anti-repressor element 40 fragment was generated using the overlapping synthetic DNA using the following synthetic backbone DNA and primers: 150275.doc •19· 201144439 mARE40-Ll(+) backbone DNA; 5'-TTGCTCTGAGCCAGCCCACCAGTTTGGAATGACTCCTTTTTATGACTTGAATT TTCAAGTATAAAGTCTAGTGCTAAATTTAATTTGAACAACTGTATAGTTTTTG-3 , (SEQ ID NO: 4) mARE40-Ll (-) backbone DNA: 5'-TTAGAAATCCTCACACACAACAAGTTTTCATTTCACTTCTAATTCTGAAAAAA ACACTGCCACCATTTTTTTTCCTTCCCCCAACCAGCAAAAACTATACAGTTGT-3, (SEQ ID NO: 5) mARE40-Rl (+) backbone DNA: 5, -GTGTGTGAGGATTTCTAATGACATGTGGTGGTTGCATACTGAGTGAAGCCGG TGAGCATTCTGCCATGTCACCCCCTCGTGCTCAGTAATGTACTTTACAGAAATC -3, ( SEQ ID NO: 6) mARE40-Rl(-) backbone DNA: 5'-TGGCAGAAATGCAGGCTGAGTGAGACTACCCAGAGAAGAGACCGGATATA CACAAGAAGCATGGTTTATATCAATCnTTGAGTTTAGGATTTCTGTAAAGTAC AT-3J (SEQ ID NO: 7) mARE40-5' primer:

5'-TTGCTCTGAGCCAGCCCACCAGTTT-3' (SEQ ID NO: 8) mARE40-3'AseI primer: 5'-GTTATTAATTGGCAGAAATGCAGGCTGAGT-3' (SEQ ID NO: 9) mARE40-3, AflII primer: 5'-CCCACATGTTGGCAGAAATGCAGGCTGAGT-3' ( SEQ ID NO: 10) mARE40-3'SpeI primer: 5,-GGACTAGTTGGCAGAAATGCAGGCTGAGTG-3, 150275.doc •20- 201144439 (SEQ ID NO: 11) PCR using Platinum® Pfx DNA polymerase and the following profile: 95° C lasted for 3 minutes, followed by 95 ° C for 30 seconds, 58 ° C for 30 seconds, and 75 ° C for 30 seconds for a total of 35 cycles. The resulting PCR products (mARE40-AseI and mARE40-AflII) were separately selected to the modified pEGFP-Nl (AgeI site was disrupted and there were other EcoRVs before Agel, and there was a Seal site before the Aflll site) vector Medium to form pmARE40-EGFP-N1, and (mARE40-SpeI) was cloned into pScinoDP3-DHFR (other EcoRV sites before the Spel site) vector to form pScinoDP3-DHFR-F2. The pmARE40-EGFP-N1 vector was digested with Asel-BamHI, and the CMV-IE promoter was replaced with the approximately 1.6 kb AseI-CMVe-hEFla-BamHI fragment from the pScinoDP3-DHFR vector. The resulting construct was named pFmARE40ScinoDP3-EGFP-Nl. The pFmARE40ScinoDP3-EGFP-N1 vector was digested with BamHI-Nc, tI, and the EGFP gene was replaced with the about 1.6 kb BamHI-SV40polA-mARE40-DP3_IRES-DHFR-Notl fragment from pScinoDP3-DHFR-F2. The resulting construct was named pScinoDP8-DHFR. The pEGFP-Nl_shRNAiGFP vector was digested with ApaLI-Notl, and the CMV-IE-GFP fragment was replaced with the ScinoDP8-DHFR fragment from pScinoDP8-DHFR. The resulting construct was named pScinoDP8mir-DHFR (Fig. 5). The complete sequence of the mouse anti-repressor element 40 fragment that has been cloned is shown below:

5,-TTgCTCTgAgCCAgCCCACCAgTTTggAATgACTCCrmTATgACTTgAATTTTC AAgTATAAAgTCTAgTgCTAAATTTAATTTgAACAACTgTATAgTTTTTgCTggTTgg

gggAAggAAAAAAAATggTggCAgTgTTTTTTTCAgAATTAgAAgTgAAATgAAAACT

. TGTTgTgTgTgAggATTTCTAATgACATgTggTggTTgCATACTgAgTgAAgCCggTgAgC 150275.doc -21 - 201144439 ATTCTgCCATgTCACCCCCTCgTgCTCAgTAATgTACTTTACAgAAATCCTAAACT CAAAAgATTgATATAAACCATgCTTCTTgTgTATATCCggTCTCTTCTCTGGGTAgT CTCACTCAgCCTgCATTTCTgCCA-3, (SEQ ID NO: 12) (5) pScinoDP9mir-DHFR vector constructed using similar procedures pScinoDP8mir-DHFR vector of the wearer, and with the CAG promoter (chicken The CMV-IE enhancer of the β-actin promoter fusion) replaced the two CMV enhancers in pScinoDP8mir-DHFR to construct the pScinoDP9mir-DHFR vector (Fig. 6). The complete sequence of pScinoDP9mir-DHFR is shown as SEQ ID NO: 13. pScinoDP9mir-DHFR contains an internal ribosome entry site (IRES) of encephalomyocarditis virus (ECMV) between the MCSII and dihydrofolate reductase (DHFR) coding regions. This feature allows for the translation of related genes (e.g., the light chain in MCSII) and the DHFR gene from a single double-effect mRNA. The sequence flanking DHFR has been translated into a Kozak-positive translation initiation site to further improve translation efficiency in eukaryotic cells. The MCSI in pScinoDP9mir-DHFR is located between the immediate early promoter of CMV (PCMV IE) and the SV40 polyadenylation signal sequence. The SV40 polyadenylation signal downstream of MCSI directs the correct processing of the 3' end of the first transcription. The MCSII in pScinoDP-dhfr is located between the second immediate early promoter (PCMV IE) of the cellular giant virus and the IRES sequence. The SV40 polyadenylation signal downstream of the DHFR gene directs the correct processing of the 3' end of the double effect mRNA.

Since pScinoDP9mir-DHFR is derived from the pEGFP-N1 vector, it contains the origin of SV40 replication in mammalian cells expressing the SV40 T antigen. Consisting of the SV40 early promoter, the tn5 neomycin/canamycin resistance gene and the polyadenylation signal of the sore-type virus thymidine kinase (HSV-22-150275.doc 201144439 TK) gene Neomycin-resistant cassette (Neof) allows the use of G41 8 to screen for stably transfected eukaryotic cells. The bacterial promoter upstream of this cassette exhibited benzimycin resistance in E. coli. The pScinoDP-DHFR backbone also contains a pUC origin of replication for amplification in E. coli and a starting point for fl production for single-strand DNA production. (6) pGFP/puromycin vector The IRES sequence and the DHFR gene were obtained by PCR amplification using PIRES2-EGFP and pLKO-AS3w-puro plasmid as templates. A hybrid of the IRES sequence fragment and the puromycin gene fragment (IRES2-puromycin) was obtained by overlap extension PCR (OL-PCR). The IRES2-puromycin fragment was inserted into a Sall-BamHI digested pFLAG-CMV2 vector (Kodak). The resulting construct was named pIRES2-Puro. The EGFP gene was obtained from the pEGFP-N1 vector and inserted into the pIRES-Puro vector to form a pGFP/paumycin carrier. (7) Construction of pScinoDP9mir-Herceptin-DHFR-loaded Zhao pScinoDP9mir-Hepato-DHFR vector is shown in Fig. 7. Briefly, self-polymerization into a backbone fragment PCR amplification of the 4-1 leader sequence and the 4-2 leader sequence, while obtaining a heavy chain constant region sequence of human IgG! from a recombinant plastid containing human IgG, sequence (hlgG/H) And the light chain constant region sequence (hlgG/L) of human IgG丨. The leader sequence and the hlgG, constant region sequence vector hybrid are obtained by ligating the hlgG] constant region to the vector containing the leader sequence by directional linkage. Next, the heavy chain variable region (VH) and the light chain variable region (VL) are generated by repeated overlapping PCR from the oligomeric polymerization into a backbone fragment, and the second is selected to p4-150275.doc • 23- 201144439 1 lead Sequence-hlgG^H vector or ρ4·2 leader sequence-hlgG/L vector. After correcting for PCR errors and removing additional sequences introduced during the selection process, the correctness of the leader sequence-peptide-hepatoma VC sequence was verified by sequencing. Finally, the 4-1 leader sequence-Hepatoa heavy chain hybrid (4-1-Hejiaping VCh) and the 4-2 leader sequence-He Cancer Ping light bond (4-2-He cancer flat VCl) were individually The MCSI site and the MCSII site in the pScinoDP9mir-DHFR vector were selected to form the pScinoDP9mir-hepatoma-DHFR vector (Fig. 7). The amino acid sequence and nucleotide sequence of the variable region of the anti-HER2 heavy chain 1 are shown as SEQ ID NOS: 14 and 15, respectively. The backbone fragment and PCR primer for the heavy chain variable region (VH) have the following sequences: Skeleton fragment: Hepatoma ΗVΗ-Ι^(+) (108 substrates) 55-gAggTgCAgCTCgTggAgAgTggTggCgggTTggTCCAgCCAggCgggTCTCTgCgATTg AgCTgTgCTgCCTCTggATTTAACATCAAAgACACgTACATCCATTgg-3, (SEQ Π) ΝΟ :16) He Cancer Ping VH-L2(-) (105 substrates)

5, -TTTAACgCTATCAgCgTATCTggTgTAgCCgTTAgTgggATAgATTCTAgCTACCCA TTCAAggCCCTTgCCgggggCCTgTCTCACCCAATggATgTACgTgTC-3, (SEQ JD NO: 17) Herceptin VH-R1 (+) (105 mer units) 5'-TACgCTgATAgCgTTAAAggAAggTTTACTATTTCTgCCgACACCTCCAAgAATA CCgCATATCTACAgATgAACTCCCTgCgCgCTgAggACACCgCTgTgTAT-3, (SEQ Π) NO: 18) Herceptin VH- R2(-)(108 matrices) 5'-CTTAgTAgAgCACTgCTAACTgTCACTAAggTACCCTggCCCCAgTAgTCCATTgC gTAgAATCCgTCTCCCCCCCAACgTgAgCAgTAATACACAgCggTgTCCTC-35 (SEQ roNO:19) 150275.doc • 24· 201144439 Primer for amplification: Hepatic-VH-5HindIII (30 matrices) 5)-gCCAAgCTTgAggTgCAgCTCgTggAgAgT-3, (SEQ Π) ΝΟ:20) Hepatic-VH-3 Apal (30 matrices) (antisense) 5,-AgggggCCCTTAgTAgAggCACTgCTAACT-3, (SEQ Π) NO:21) The amino acid sequence and nucleotide sequence of the variable region of HER2 light chain 1 are shown as SEQ ID NOS: 22 and 23, respectively. The backbone fragment and PCR primer for the light chain variable region (VL) have the following sequence: backbone fragment: Hepatic Vl-L1(+) (93 substrates) 5,-gATATACAgATgACACAgTCTCCgTCAAgTCTgAgCgCAAgCgTgggCgACCggGTA ACAATTACCTgTAgAgCCAgCCAggACgTAAATACA-3, (SEQ Π) ΝΟ :24) He Cancer Ping Vl-L2(-)(95 substrates) S'-CCgCTATAAAggAACgAggCAgAgTAgATCAgAAgCTTAggAGCTTTACCAggTTT TTgCTgATACCAggCCACggCTgTATTTACgTCCTggCT-3, (SEQ Π) NO:25) He Cancer Ping Vl-R1(+)(94 substrates) 5'- CTCgTTCCTTTATAgCggggTgCCAAgCCgCTTCTCCggATCTAggTCTggAACAgA CTTTACTCTgACCATTTCCAgTCTCCAgCCCgAAgAC-3, (SEQ ID NO: 26) Herceptin VL-R2 (-) (93 mer units) 5'-CTTgATCTCgACCTTggTgCCCTgCCCAAATgTgggTggAgTCgTgTAATgTTgCTggC AATAgTAggTAgCAAAgTCTTCgggCTggAgACT-3 '(SEQ ED NO: 27) primers used for amplification Herceptin -VL-5HindIII (30 matrices) (sense) 5'-gCCAAgCTTgATATACAgATgACACAgTCT-3' (SEQ ID NO: 28) Hepatic-VL-3HindIII (30 matrices) (antisense) 5,-CgCggATTCCTTgATCTCgACCTTggTgCC-3, (SEQ Π) NO: 29) 150275.doc -25- 201144439 Example 3: Establishing Hepao Ping/CHO+GFP"d Hf|·cell strain CHO/+GFP"dhff cells were suspended in PBS buffer. 40 pg of linearized plastid (pScinoDP9mir-Hepatotine-DHFR) DNA was added to the cells and incubated on ice for 10 minutes. The cells were then electroporated by two pulses (a Gene Pulser II with a capacitive expander and a pulse controller from Bio-Rad) with a voltage setting of 750 V and a capacitance setting of 25 pF. The electroporated cells were plated in T-175 flasks containing 25 mL of medium (IMDM supplemented with HT, 10% FBS, 2 μM MTX and 5 pg/ml puromycin dihydrochloride) for 24 hours. Then use 800 gg/ml G418 sulfate (Calbiochem, Cat. No. 345810) for minimum replenishment with 10% D-FBS (Gibco, Cat. No. 30067-334) and 5 pg/m. Cells were screened in medium alpha medium (α-ΜΕΜ, Gibco, Cat. No. 12000). After 14 days of screening in α-ΜΕΜ medium supplemented with 10% D-FBS and selected antibiotics, the cells were subjected to increasing concentration ΜΤΧ treatment to amplify the gene. Cells were sorted by FACS to screen for cells with low GFP fluorescence intensity. Since the expression of the target gene and shRNAGFP resulted in a decrease in GFP production in CHO+GFP"dhf' cells, the green fluorescent least (GFP-negative) cells had the highest target gene expression. FACS sorting was performed using a MoF1otm XDP (Beckman Coulter) equipped with Summit software, a laser emitted at 488 nm, and a cell storage unit. Low-fluorescence and high-fluorescence cell populations were sorted by FACS using a single cell in a 96-well cell culture dish containing 220 μL supplemented with 10% 〇-FBS, G418, puromycin dihydrochloride and αα-ΜΕΜ. . The pure line was incubated for 12 days in a moisture-containing incubator at 37 ° C and 150275.doc -26- 201144439 5% carbon dioxide. Example 4: Characterization of Hepatic/CH〇+GFP/-dhfr Cell Line (1) Trypsin-treated Hepatocarcin/CH0+GFp/-dhfr cells were detected by immunostaining. Centrifuge at rpm for 5 minutes. The cells were washed twice with pBS and resuspended in pbs to a final concentration of about 1 X 1 7 cells/ml. Then use phycoerythrin (PE),,'. Mouse anti-human (Fc) (Beckman Coulter, Cat. No. 736007) 'at various dilutions according to the manufacturer's recommendations. (: cells were incubated in the dark for 30 minutes' washed twice with PBS and kept on ice for FACS analysis. (2) Detection of secreted antibodies by ELISA Briefly used in 〇.〇5 Μ carbonate - An anti-human IgG antibody (Sigma: I 1886) diluted in bicarbonate buffer (pH 9.7) was plated in a 96-well plate and incubated at 4 C for 16 hours. At 37 ° C with blocking buffer (1 〇 mM : Tris, 〇·15 M NaCl, 1% skim milk, pH 8_0) Block the wells for 30 minutes. Add the culture supernatant to the wells and incubate for 2 hours at 37 ° C. Horseradish peroxidation % binding Human IgG-F(c) antibody (Abeam: ab7499), diluted in dilution buffer (10 mM Tris, 0.15 M NaCl, 0.05% Tween 20, pH 8.0) according to the manufacturer's recommendations and incubated at 37 ° C One hour. The reaction was detected using a substrate (l-stepTM ultra TMB-ELISA, Pierce, Cat. No. 34029) and the well plate was read on a microplate reader (Bio-Rad). (3) Results Figure 8 presents utilization Histogram plot of FACS (CHO/+GFP/_dh〃) cells sorted by FACS at different fluorescence intensities. Figure A shows Hepatic Ping 150275.doc •27· 201144439 CHO/+GFP&quo t; GFP fluorescence in dh〃 cell population. Cells are divided into several subpopulations based on fluorescence intensity (R2, R3 and R4). Figure BD shows the amount of GFP expression in each subpopulation. Figure E shows the population and subgroups The anti-hepatoma antibody titer in the data. The data showed that the cells with the lowest GFP fluorescence content (Hejiaping/R4/(CHO/+GFP/_dhfD) have the highest anti-cancer efficacy price. Figure 9 shows the target with the target. The expression of GFP in CHO/+GFP"dh〃 cells was decreased when transfected with the protein (He Cancer) and shRNAiGFP DNA constructs. The FACS curve showed that the GFP expression decreased further after two rounds of MTX challenge (Figure C and D) These results indicate that the amount of target gene amplification is related to the amount of GFP expression and the intensity of gene amplification. Figure 10 shows the combination of PE-conjugated mouse anti-human IgG (Fc) staining of Hepatic/CHO/+GFP/'dhf Representative FACS analysis of cells. The results show that antibody-producing cells (i.e., cells stained with deeper PE) exhibit low GFP expression. Figure 11A shows histogram curves of CHO/+GFP & dhff cells. Strips and shaded areas indicate low fluorescence and high fluorescence cell populations for single cell analysis. Figure 11B shows 18 Cell fluorescence inbred Eight of producing greater than 0.3 of ELISA value, 18 and the high fluorescence cell only 2 inbred ELIS A in a large value of 0.3. These results show that the low-fluorescence cell population contains high-frequency, high-yield antibody-producing cells and demonstrates a GFP-based reverse screening strategy. Figure 12 shows that the GFP expression in the CH0+GFP/_dhf3s cells was reduced by transfection of the DNA construct encoding the Hepato (Fig. A-C) and shRNAGFP. (4) Conclusions The use of shRNAmireGFP and flow cytometry can substantially improve the accuracy and efficiency of two key points in the development of cell lines 150275.doc •28- 201144439. First, in terms of early pure line screening, the FACS method is a better pure line productivity predictor than the therapeutic protein titer in the assay medium. Secondly, the pure line in which the transgene expression is unstable can be easily identified by the increase in fluorescence observed during the amplification phase. Thus, the method of the present invention provides a novel benefit of the precise 96-well pure line screening method over conventional methods: it can identify good candidates at an earlier stage of the development process for further development and removal of unstable pure lines. These results show that the DNA constructs and screening methods of the present invention reliably yield a pure homologous protein preparation. Since a plurality of individual pure lines are not screened by a limiting dilution technique to isolate a mammalian cell line capable of expressing recombinant antibodies in high yield, the procedure is less labor intensive and can significantly shorten the production of pure lines required for biological production. time. This procedure does not require additional reagents to select pure lines and additionally provides the benefit of monitoring genomic stability. The amount of expression of the target gene is also more correlated with the intensity of the amplified gene. The double-effect design allows two foreign genes to be expressed simultaneously on the same chromosome. The inhibitory method enhances the intensity of target gene amplification by reducing the intensity of reporter gene amplification. The use of ARE can increase the expression of foreign recombinant proteins by eliminating the differences caused by the inhibition of insertion of foreign genes into different chromosome regions. [Simplified Schematic] Figure 1 is a diagram showing the high-transfer gene expression cell lineage based on the GFP-based screening strategy. Figure 2 is a map showing the vector pScinoDP-DHFR. Figure 3 is a representation of the representation vector pScinoDP3-DHFR. 150275.doc -29- 201144439 Figure 4 is a map of the expression vector pScinoDP3mir-DHFR. Figure 5 is a map showing the vector pScinoDP8mir-DHFR. Figure 6 is a map showing the expression vector pScinoDP9mir-DHFR. Fig. 7 is a view showing the construction of the expression vector pScinoDP9mir-HECD-DHFR. Fig. 8 is a composite diagram showing the expression of GFP and the expression of antibodies in Hepatic-CHO+gfp/·· cells. Panel A is a FACS histogram plot of Hepatic-CHO/+GFP/-dhff cells. Panel B_C is a FACS histogram plot of Hepato-CHO/+GFP/_dhff cells sorted at different fluorescence intensities. Panel E is an ELISA analysis of antibody production from cells sorted from different fluorescent populations. Figure 9 is a composite diagram showing the expression of GFP in Hepatot-CHO+GFPrdhff cells after multiple rounds of screening. Panel A is a FACS histogram of CHO"dhf cells after GFP expression. Panel B is a FACS histogram of Hepato-CHO/+GFP "dh〃 cells after G418 selection. Panel C is a FACS histogram of Hepato-CHO/+GFP "dhfr cells after the first round of MTX (100 nM) amplification. Panel D is a FACS histogram of Hepato-CHO/+GFP "dh〃 cells after a second round of MTX (200 nM) amplification. Figure 10 is a graph showing FACS analysis of Hepato-PHO+GFP/_dh' cells stained with PE-conjugated anti-human IgG (Fc) antibody. According to the experimental design, the cells secreting the antibody were PE positive and GFP negative, and were shown in the upper left panel. The fluorescent signal is measured by FACS and corrected by a standard compensation scheme. Figure 11 shows the main features of the FACS sorting procedure of the Hepatotine-CHO+GFP plant dhf' cells, and the ELISA results. Panel A is a FACS histogram of Hepatic (CHO/+GFP/-dhfr) cells. The horizontal and gray areas indicate low fluorescence and high fluorescence cell populations for single fine 150275.doc -30- 201144439 cell analysis. Panel B is the amount of antibody expression detected by ELIS A for each individual selected from the group consisting of low fluorescence or high fluorescence populations. Figure 12 is a composite diagram showing FACS analysis of GFP expression in cells transfected with DNA constructs encoding shRNAGFP and Hepatic (Figure C). 150275.doc -31 -

Claims (1)

201144439 VII. Patent application scope: 1 . A method for screening cells with high expression amount of a target protein, comprising: introducing a DNA construct having both a target protein and a suppressor of an endogenous screening marker of a host cell into a plurality of In the host cell, wherein the DNA construct is configured to display both the target protein and the suppressor in the host cell; and to screen the host cell containing the DNA construct for the expression of the endogenous screening marker; The cells in which the screening marker is expressed in a low amount are isolated. 2. The method of claim 1, wherein the inhibitor is selected from the group consisting of a small interfering rNa (siRNA), a small hairpin RNA (shRNA), a microRNA (miRNA), a hybrid of miRNA and shRNA, and an antisense RNA. group. 3. The method of claim 1, wherein the inhibitor is a shRNA. 4. The method of claim 1 wherein the endogenous selection marker is a fluorescent cursor' and wherein the separating step comprises sorting the cells with a fluorescence activated cell sorting (FACS). 5) The method of claim 1, wherein the DNA construct further encodes dihydrofolate reductase (DHFR), and wherein the host cells are dhfr-deficient cells. 6. A high-capacity screening method for screening a gene for expressing a gene, comprising: transfecting the cells with a vector carrying at least one of a transgenic gene and an interfering RNA that inhibits expression of a fluorescent protein; Fluorescence intensity in transfected cells; and 150275.doc 201144439 Knife-out camp light intensity is lower than that of untransfected cells. 7. The method of claim 1, wherein the fluorescent protein is green fluorescent protein (GFP). 8. The method of claim 6, wherein the interfering RNA is mir-30-baesd shRNA. 9. The method of claim 5, wherein the separating step comprises sorting the cells using FACS. 10. The method of claim 6, wherein the cells expressing the fluorescent protein are dihydrofolate reductase (DHFR)-deficient CHO cells. 11. The method of claim 6 wherein the at least one transgene is linked to the gene encoding Dhfr via an internal ribosome entry site (IRES). 12. An expression vector for high throughput screening of a cell comprising the expression vector comprising: a first nucleotide sequence encoding a protein of interest; a second nucleotide sequence encoding an exogenous selection marker of the host cell; a third nucleotide sequence encoding a suppressor of the endogenous screening marker of the host cell; and one or more controls the first nucleotide sequence, the second nucleotide sequence, and the third nucleotide sequence A regulatory element expressed in a host cell, wherein the first nucleotide sequence is linked to the second nucleotide sequence via an internal ribosome entry site (IRES). 13. The expression vector of § § 12, which additionally comprises one or more anti-repressor elements. 14. The expression vector of claim 13, wherein the one or more anti-repressor elements 150275.doc 201144439 comprises a portion of the mouse anti-repressor element 40. 15. The expression vector of claim 12, wherein the inhibitor is an interfering rna. 16. The expression vector of claim 15, wherein the interfering RNA is a miR-30-based shRNA. 1 7. The expression vector of claim 12, wherein the endogenous selection marker is a fluorescent protein. 18. The expression vector of claim 17, wherein the fluorescent protein is a green fluorescent protein. 19. The expression vector of claim 12, wherein the exogenous screening marker is dihydrofolate reductase. 20. The performance vector of claim 12, wherein the one or more regulatory elements comprise a CMV IE enhancer. 150275.doc