WO2013063653A1 - High amylose wheat - ii - Google Patents
High amylose wheat - ii Download PDFInfo
- Publication number
- WO2013063653A1 WO2013063653A1 PCT/AU2012/001349 AU2012001349W WO2013063653A1 WO 2013063653 A1 WO2013063653 A1 WO 2013063653A1 AU 2012001349 W AU2012001349 W AU 2012001349W WO 2013063653 A1 WO2013063653 A1 WO 2013063653A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- grain
- starch
- wheat
- gene
- sbeiia
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
- C12N15/8218—Antisense, co-suppression, viral induced gene silencing [VIGS], post-transcriptional induced gene silencing [PTGS]
-
- A—HUMAN NECESSITIES
- A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
- A23L—FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES, NOT OTHERWISE PROVIDED FOR; PREPARATION OR TREATMENT THEREOF
- A23L7/00—Cereal-derived products; Malt products; Preparation or treatment thereof
- A23L7/10—Cereal-derived products
- A23L7/197—Treatment of whole grains not provided for in groups A23L7/117 - A23L7/196
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
- A01H5/00—Angiosperms, i.e. flowering plants, characterised by their plant parts; Angiosperms characterised otherwise than by their botanic taxonomy
- A01H5/10—Seeds
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
- A01H6/00—Angiosperms, i.e. flowering plants, characterised by their botanic taxonomy
- A01H6/46—Gramineae or Poaceae, e.g. ryegrass, rice, wheat or maize
- A01H6/4678—Triticum sp. [wheat]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P3/00—Drugs for disorders of the metabolism
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P3/00—Drugs for disorders of the metabolism
- A61P3/08—Drugs for disorders of the metabolism for glucose homeostasis
- A61P3/10—Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
-
- B—PERFORMING OPERATIONS; TRANSPORTING
- B02—CRUSHING, PULVERISING, OR DISINTEGRATING; PREPARATORY TREATMENT OF GRAIN FOR MILLING
- B02C—CRUSHING, PULVERISING, OR DISINTEGRATING IN GENERAL; MILLING GRAIN
- B02C9/00—Other milling methods or mills specially adapted for grain
-
- C—CHEMISTRY; METALLURGY
- C08—ORGANIC MACROMOLECULAR COMPOUNDS; THEIR PREPARATION OR CHEMICAL WORKING-UP; COMPOSITIONS BASED THEREON
- C08B—POLYSACCHARIDES; DERIVATIVES THEREOF
- C08B30/00—Preparation of starch, degraded or non-chemically modified starch, amylose, or amylopectin
- C08B30/04—Extraction or purification
- C08B30/042—Extraction or purification from cereals or grains
- C08B30/046—Extraction or purification from cereals or grains from wheat
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
- C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
- C12N15/8245—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine involving modified carbohydrate or sugar alcohol metabolism, e.g. starch biosynthesis
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y204/00—Glycosyltransferases (2.4)
- C12Y204/01—Hexosyltransferases (2.4.1)
- C12Y204/01018—1,4-Alpha-glucan branching enzyme (2.4.1.18), i.e. glucan branching enzyme
-
- A—HUMAN NECESSITIES
- A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
- A23L—FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES, NOT OTHERWISE PROVIDED FOR; PREPARATION OR TREATMENT THEREOF
- A23L7/00—Cereal-derived products; Malt products; Preparation or treatment thereof
- A23L7/10—Cereal-derived products
- A23L7/198—Dry unshaped finely divided cereal products, not provided for in groups A23L7/117 - A23L7/196 and A23L29/00, e.g. meal, flour, powder, dried cereal creams or extracts
-
- A—HUMAN NECESSITIES
- A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
- A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
- A23V2002/00—Food compositions, function of food ingredients or processes for food or foodstuffs
Definitions
- the specification describes methods of obtaining hexaploid wheat plants having high amylose starch and the use of such plants, and particularly grain or starch therefrom in a range of food and non-food products.
- Bread wheat (Triticum aeslivam) is a hexaploid having three pairs of homoeologous chromosomes defining genomes A, B and D.
- the endosperm of grain comprises 2 haploid complements from a maternal cell and 1 from a paternal cell.
- the embryo of wheat grain comprises one haploid complement from each of the maternal and paternal cells.
- Hexaploidy has been considered a significant obstacle in researching and developing useful variants of wheat. In fact, very little is known regarding how homoeologous genes of wheat interact, how their expression is regulated, and how the different proteins produced by homoeologous genes work separately or in concert.
- Cereal starch is made up of two glucose polymers, amylose and amylopectin.
- the ratio of amylose to amylopectin appears to be a major determinant in (i) the health benefit of wheat grain and wheat starch and (ii) the end quality of products comprising wheat starch.
- Amylose is an essentially linear polymer of a- 1 ,4 linked glucose units, while amylopectin is highly branched with a- 1 ,6 glucosidic unit bonds linking linear chains.
- High amylose starches are of particular interest for their health benefits.
- Foods comprising high amylose have been found inter alia to be naturally higher in resistant starch (RS), a form of dietary fibre.
- RS is starch or starch digestive products that are not digested or absorbed in the small intestine.
- Resistant starch is increasingly seen to have an important role in promoting intestinal health and in protecting against diseases such as colorectal cancer, type II diabetes, obesity, heart disease arid osteoporosis.
- High amylose starches have been developed in certain grains such as maize and barley for use in foods as a means of promoting bowel health.
- resistant starch results from the provision of a nutrient to the large bowel wherein the intestinal microflora are given an energy source which is fermented to form inter alia short chain fatty acids.
- These short chain fatty acids provide, nutrients for the colonocytes, enhance the uptake of certain nutrients across the large bowel and promote physiological activity of the colon.
- resistant starches or other dietary fibre are not provided to the colon it becomes metabolically relatively inactive.
- high amylose products have the potential to facilitate increased consumption of fibre.
- Some of the potential health benefits of consuming high amylose wheat grains or their products such as starch include its role in regulating sugar and insulin and lipid levels, promoting intestinal heath, producing food of lower calorie value that promote satiety, improving taxation, water volume of faeces, promoting growth of probiotic bacteria, and enhancing faecal bile acid excretion.
- Most processed starchy foods contain very little RS.
- the breads made using wild- type wheat flour and a conventional formulation and baking process contained ⁇ 1 % RS. In comparison, breads baked using the same process and storage conditions but containing the modified high amylose wheats had levels of RS as much as 10-fold higher (see International Publication No. WO 2006/069422).
- Legumes which are one of the few rich sources of RS in the human diet, contain levels of RS that are normally ⁇ 5%. Therefore, consumption of the high amylose wheat bread in amounts normally consumed by adults (e.g. 200 g/d) would readily supply at least 5-12 g of RS. Thus, incorporation of the high amylose wheat into food products has the potential to make a considerable contribution to dietary RS intakes of developed " nations, where average daily intakes of RS arc estimated to be only about 5g.
- Starch is widely used in the food, paper and chemical industries.
- the physical structure of starch can have an important impact on the nutritional and handling properties of starch for food or non-food or industrial products.
- Certain characteristics can be taken as an indication of starch structure including the distribution of amylopectin chain length, the degree and type of crystallinity, and properties such as gelatinisation temperature, viscosity and swelling volume. Changes in amylopectin chain length may be an indicator of altered crystallinity, gelatinisation or retrogradation of the amylopectin.
- Starch is initially synthesized in plants in chloroplasts of photosynthesizing tissues such, as leaves, in the form of transitory starch. This is mobilized during subsequent dark periods to supply carbon for export to sink organs and energy metabolism, or for storage in organs such as seeds or tubers. Synthesis and long-term storage of starch occurs in the amyloplasts of the storage organs, such as the endosperm, where the starch is deposited as semicrystalline granules up to ⁇ ⁇ in diameter.
- Granules contain both amylose and amylopectin, the former typically as amorphous material in the native starch granule while the latter is semicrystalline through stacking of the linear glucosidic chains. Granules also contain some of the proteins involved in starch biosynthesis.
- ADP-glucose pyrophosphorylase catalyses the synthesis of ADP-glucose from glucose- 1 -phosphate and ATP. Starch synthases then promote the transfer of ADP-glucose to the end of an a- 1 ,4 linked glucose unit.
- starch branching enzymes SBE
- SBE starch branching enzymes
- SDBE Starch debranching enzymes
- ADGP ADP-glucose pyrophosphorylase
- SS starch synthase
- GBSS granule-bound starch synthase
- [00181 A mutant wheat plant entirely lacking the SGP-1 (SSIIa) protein was produced by crossing lines which were lacking the A, B and D genome specific forms of SGP- 1 (SSII ) protein (Yamamori et ai, 2000). Examination of the SSII null seeds showed that the mutation resulted in alterations in amylopectin structure, deformed starch granules, and an elevated relative amylose content to about 30-37% of the starch, which was an increase of about 8%o over the wild-type level (Yamamori et al., 2000). Amylose was measured by colorimetric measurement, amperometric titration (both for iodine binding) and a concanavalin A method. Starch from the SSIl null mutant exhibited a decreased gelatinisation temperature compared to starch from an equivalent, non-mutant plant. Starch content was reduced from 60% in the wild-type to below 50% in the SSII-null grain.
- the dulll mutation causes decreased starch content and increased amylose levels in endosperm, with the extent of the change depended on the genetic background, and increased degree of branching in the remaining amylopectin.
- the gene corresponding to the mutation was identified and isolated by a transposon-tagging strategy using the transposon mutator (Mu) and shown to encode the enzyme designated starch synthase I I (SSIl).
- the enzyme is now recognized as a member of the SSIII family in cereals. Mutant endosperm had reduced levels of SBEIla activity associated with the dull l mutation. It is not known if these findings are relevant to other cereals.
- Lines of barley having an elevated proportion of amylose in grain starch have been identified. These include High Amylose Glacier (AC38) which has a relative amylose content of about 45%, and chemically induced mutations in the SSIIa gene of barley which raised levels of amylose in kernel starch to about 65-70% (WO 02/37955 A I ; Morell et at. , 2003). The starch showed reduced gelatinisation temperatures.
- AC38 High Amylose Glacier
- SSIIa gene of barley which raised levels of amylose in kernel starch to about 65-70%
- SBEI Two main classes of SBEs are known in plants, SBEI and SBEII .
- SBEI1 can be further categorized into two types in cereals, SBEIla and SBITIb. Additional forms of SBEs are also reported in some cereals, a putative 149 kDa SBEI from wheat and a 50/51 kDa SBE from barley.
- Sequence alignment reveals a high degree of sequence similarity at both the nucleotide and amino acid levels and allows the grouping into the SBEI, SBEIla and SBEIIb classes.
- SBEIla and SBEIIb generally exhibit around 80% nucleotide sequence identity to each other, particularly in the central regions of the genes.
- SBEIla, SBEIIb and SB EI may also be distinguished by their expression patterns, both temporal and spatial, in endosperm and in other tissues.
- S BEI is expressed from mid- endosperm development onwards in wheat and maize (Morell et al, 1997).
- SBEIla and SBEIIb are expressed from an early stage of endosperm development.
- SBEIIb is the predominant form in the endosperm whereas SBEIla is present at high expression levels in the leaf (Gao el al. , 1997).
- SB EIla and S BEIIb are found in the endosperm in approximately equal amounts. However, there are differences in timing and tissues of expression.
- SBEIla is expressed at an earlier stage of seed development, being detected at 3 days after flowering, and was expressed in leaves, while SBEIIb was not detectable at 3 days after flowering and was most abundant in developing seeds at 7- 10 days after flowering and was not expressed in leaves.
- SBEI (Morell et al, 1997) is found exclusively in the soluble fraction, while SBEIla and SBEIIb are found in both soluble and starch-granule associated fractions (Rahman et al.. 1995).
- Genes and other genetic material are represented in italics and their proteinaceous expression products are represented in non-italicised form.
- SBEIfa is an expression product oi ' SBEIIa.
- SEQ ID NO: correspond numerically to the sequence identifiers ⁇ 400> 1 (SEQ ID NO: l ), ⁇ 400>2 (SEQ ID NO:2), etc.
- SEQ ID NO: l correspond numerically to the sequence identifiers ⁇ 400> 1 (SEQ ID NO: l ), ⁇ 400>2 (SEQ ID NO:2), etc.
- a sequence listing is provided after the claims.
- a table describing the sequences in the sequence listing is provided after the Examples.
- the present invention provides a range of wheat plants having modified starch characteristics.
- the present specification describes wheat grain (Triticum aestivum) comprising an embryo and starch.
- the embryo comprises two identical alleles of an SBEIIa-A gene, two identical alleles of an SBEJ/a-B gene and two identical alleles of an SBEHa-D gene, wherein each of the SBEUa genes gives rise to an amount of protein (w/w) or a protein having SBEIIa activity which is lower than the corresponding wild-type gene, preferably where one or two or three of the SBEIIa genes give rise to no protein having SBEIIa activity, and at least one of said genes comprises a point mutation, wherein the starch comprises amylose such that the grain has an amylose content of at least 50% (w/w) as a proportion of the extractable starch of the grain.
- the wheat grain is homozygous for mutant alleles at each of the three SBEIla genes.
- the grain comprises at least one SBEIla protein which has starch branching activity when expressed in developing endosperm, the protein being present in an amount or having starch branching enzyme activity of between 2% to 60%, or between 1 0% to 50%, or between 2% to 30%, or between 2% to 15%, or between 3% to 10%), or between 2% to 20% or between 2% to 25% of the amount or activity of the corresponding protein in a wild-type wheat grain.
- the SBEIla protein which is a SBEIla-A protein, a SBEIIa-B protein or a SBEIIa-D protein, has an amino acid substitution relative to the corresponding wild-type SBEIla protein. It may additionally exhibit an altered affinity for binding to starch. The altered affinity may be an increase in affinity or, preferably, a decreased affinity for starch.
- the amount or activity of the SBEIla protein in the grain is less than 2% of the amount or activity of SBEIla protein in a wild-type wheat grain, and is preferably essentially absent, such as for example, is undetectable by a Western blot assay.
- Such wheat grain is referred to herein as being a ''triple null SBEIla mutant".
- the grain comprises an SBEIla protein which is inactive due to an amino acid substitution in the protein relative to the corresponding wild-type protein, but which protein is present in the grain at a level of at least 50% relative to the wild-type. Alternatively, such a protein may be present at a level of less than 50% relative to the wild- type.
- the protein is a truncated polypeptide relative to the wild-type. Such a polypeptide may be produced from a mutant SBEIla gene comprising a premature translation termination (nonsense) codon.
- the grain may comprise 2 or even 3 such proteins.
- the grain may further comprise only one or only two SBEllb proteins, or only one or only two active SBEIIb proteins.
- the embryo has only 1 null SBEIla gene.
- the embryo has only 2 null SBEIla genes
- the embryo has 3 null SBEIla genes.
- the grain is essentially lacking SBEIla protein.
- each of the null SBEIla genes consists of alleles which comprise. independently, a deletion in part or in whole of the SBEI!a gene or a point mutation such as a premature translation termination mutation, a splice site mutation, an insertion or an amino acid substitution mutation which inactivates the encoded SBEIla polypeptide, so long as at least one of the SBEIla genes comprises a point mutation.
- one, two, or not more than one or not more than two SBEIla genes in the embryo are deleted in whole.
- the embryo is homozygous not only for the 3 null SBEIla genes but also for one (but not more than one) or two (but not more than two) null alleles of SBEIIb genes which may each be, independently, a deletion of an SBEIIb gene, in part or in whole, or a point mutation such as a premature translation termination mutation, a splice site mutation, an insertion or an amino acid substitution mutation which inactivates the encoded SBEIIb polypeptide.
- the embryo may comprise one (but not more than one), or two (but not more than two) Type I mutations as described hereinafter.
- Such grain comprises at least one SBEIIb protein.
- the grain has only one SBEIla protein as determined by Western blot analysis, and the protein is encoded by one of the SBEIla- A, SBEIIa-B and SBEIla-D genes and has reduced starch branching enzyme activity, preferably no SBE activity, when produced in developing endosperm when compared to an SBEIla protein encoded by the corresponding wild-type gene.
- at least one and preferably both of the other two SBEIla genes may be deleted in part or in whole.
- the second SBEIla gene may be deleted in part and the third SBEIla gene deleted in whole.
- one of the second or third SBEIla genes has a point mutation, which is preferably a null mutation such as a premature translation tennination mutation, a splice site mutation, an insertion, or an amino acid substitution mutation which inactivates the encoded SBEIla polypeptide.
- a point mutation which is preferably a null mutation such as a premature translation tennination mutation, a splice site mutation, an insertion, or an amino acid substitution mutation which inactivates the encoded SBEIla polypeptide.
- one, two, or not more than one or not more than two SBEIla genes in the embryo are deleted in whole.
- the deletions may also delete the linked SBEIIb gene on the same genome in part or in whole.
- the embryo is homozygous not only for the alleles of the 3 SBEIla genes, one of which encodes the one SBEIla protein as determined by Western blot analysis, but also for one (but not more than one) or two (but not more than two) null alleles of SBEIIb genes which may each be, independently, a deletion of a SBEIlh gene, in part or in whole, or a point mutation such as a premature translation termination mutation, a splice site mutation, an insertion or an amino acid substitution mutation which inactivates the encoded SBEIIb polypeptide.
- the embryo may comprise one (but not more than one), or two (but not more than two) Type I mutations as described hereinafter.
- Such grain comprises at least one SBEIIb protein.
- the amount or activity of SBEIIa-A protein is less than 60%. less than 50%. less than 40%. less than 35% less than 30%. less than 20%, less than 1 0%, less than 5%, less than 2% of the amount or activity of the corresponding protein in a wild type wheat grain. In some embodiments, there is no detectable SBEIla-A protein in the grain.
- the amount or activity of SBEIIa-B protein is less than 60%, .less than 50%, less than 40%, less than 35% less than 30%, less than 20%, less than 10%. less than 5%, less than 2% of the amount or activity of the corresponding protein in a wild type wheat grain. In some embodiments, there is no detectable SBEIia-B protein in the grain.
- the amount or activity of SBEIIa-D protein is less than 60%, less than 50%, less than 40%, less than 35% less than 30%, less than 20%, less than 10%. less than 5%, less than 2% of the amount or activity of the corresponding protein in a wild type wheat grain. In some embodiments, there is no detectable SBEI Ia-D protein in the grain.
- the SBElIa protein which is the SBEI Ia-A protein, the SBEI Ia- B protein, or the SBEIIa-D protein, has an altered mobility relative to its corresponding wild-type SBElIa protein, as determined by affinity gel electrophoresis on gels containing starch.
- the altered mobility is an indication of an altered binding affinity to starch, which may be an increased affinity or preferably a decreased binding affinity to starch.
- the binding affinity is decreased by at least 30% or at least 50%.
- the altered affinity is due to the presence of one or more amino acid substitutions, preferably only one substitution, in the polypeptide relative to the corresponding wild-type protein.
- the SBEIla protein with altered mobility may have some SBEl Ia activity, preferably a reduced activity relative to the corresponding wild-type SBElIa protein, or it may be kicking SBEI Ia activity.
- the grain lacks detectable SBEI Ia protein, such as determined by Western blot analysis.
- At least one of the SBEIIa genes namely the SBEl la-A gene, the SBEIIa-B gene and/or the SBEIIa-D gene, of the grain has a point mutation.
- the gene(s) having the point mutation encode a polypeptide which has an amino acid substitution relative to the corresponding wild-type polypeptide. That is. the encoded protein has the same number of amino acids as the wild-type polypeptide.
- the amino acid substitution is a non-conservative amino acid substitution.
- the wild-type amino acid sequences are as described herein, such as SEQ ID Nos: 1 , 2 and 3.
- the point mutation is a single nucleotide change which generates a premature translation termination codon (nonsense codon) in the protein coding region of the gene.
- the nucleotide change generating the nonsense codon may be in exon 1 , exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8. exon 9, exon 10, exon 1 1 , exon 12, exon 1 3. exon 14, exon 15, exon 16, exon 1 7, exon 1 8, exon 1 9, exon 20 or exon 21 of the gene.
- the point mutation is a splice site mutation which reduces or prevents normal splicing of the transcript of the SBEIIa gene.
- the point mutation may be at the 5'- or 3 '-splice site of intron 1 , intron 2, intron 3, intron 4.
- one of the SBEHa-A, SBEIIa-B or SBE a-D genes in the embryo comprises a point mutation such that the protein encoded by said gene lacks starch branching enzyme activity.
- the grain embryo comprises null alleles which are deletion mutations in the B and D genomes which delete at least part of the SBEIIa- B and SBEUa-D genes, respectively and wherein the SBElla-A gene comprises the point mutation: or having null alleles which are deletion mutations in the A and D genomes which delete at least part of the SBEIla-A and BEUa-D genes, respectively and wherein the SBEII -B gene comprises the point mutation; or having null alleles which are deletion mutations in the A and B genomes which delete at least part of the SBEUa-A and SBEHa-B genes, respectively and wherein the S EIIa-D gene comprises the point mutation.
- the embryo comprises 6 SBEIlb alleles of which at least one has a loss of function mutation.
- the embryo of the grain has no null alleles of SBEIlb genes, or only 2, only 4 or 6 null alleles of SBEIlb genes.
- the embryo is homozygous for each of the three SBEIIa genes and each of the three SBEIlb genes.
- the embryo comprises only one or only two SBEJIb proteins which have starch branching enzyme activity when produced in developing endosperm, or only one or only two SBEIlb proteins which are detectable by Western blot analysis.
- the grain comprises an SBEI lb protein which is inactive due to an amino acid substitution in the protein relative to the corresponding wild-type protein, but which protein is present in the grain at a level of at least 50% relative to the wild-type. Alternatively, such a protein may be present at a level of less than 50% relative to the wild- type.
- the protein is a truncated polypeptide relative to the wild-type. Such a polypeptide may be produced from a mutant SBEIlb gene comprising a premature- translation termination (nonsense) codon.
- the grain may comprise 2 or even 3 such proteins.
- the grain embryo comprises a null mutation which is a deletion mutation in the B genome which deletes at least part of the SBEIIa-B gene and at least a part of the SBEIIb-B gene, preferably which deletes the whole of the SBEIIa-B gene and/or the SBEIIb-B gene: or comprising a null mutation which is a deletion mutation in the D genome which deletes at least part of the SBEIIa-D gene and at least a part of an SBEHb-D gene, preferably which deletes the whole of the SBEIIa-D gene and/or the SBEHb-D gene; or comprising a null mutation which is a deletion mutation in the B genome which deletes at least part of the SBEUa-A gene and at least a part of the SBEIlh-A gene, preferably which deletes the whole of the SBEI!a-A gene and/or the SBEIIb-A gene.
- the grain embryo comprises point mutations in both of the SBEIIa-B and SBEIIb-B genes, both of the SBEIIa-D and SBEIIb-D genes, or both of the S EUa-A and SBEIlb- A genes.
- the wheat grain (Triticum aestivum) comprises (i) starch whose amylose content is about 60% (w/w) to about 90% (w/w) of the starch of the grain as determined by an iodometric method, or preferably about 67% (w/w) to about 90% (w/w) amylose, or preferably about 70% (w/w) to about 90% (w/w) amylose, (ii) an embryo which is homozygous for one or two different SBEIIa alleles each of which comprises a deletion of part or all of the SBEIIa gene relative to the corresponding wild- type SBEIIa gene, is homozygous for one or two different SBEIIa genes which each comprise a point mutation, the point mutation preferably being a splice site mutation or a single nucleotide polymorphism which generates a nonsense codon or a non-conservative amino acid substitution, and is homozygous for one or
- the one or two SBEIIa proteins and the one or two SBEIIb proteins may each independently have no activity, be a truncated protein relative to the corresponding wild-type protein, or be a starch binding affinity variant relative to the corresponding wild-type protein.
- the embryo may comprise deletions of the SBEIIa- A.
- SBEIIa-B genes and a point mutation in the SBEIIa- ⁇ gene or deletions of the SBEIIa- A and SBEIIa- ⁇ genes and a point mutation in the SBEIIa-B gene, or deletions of the SBEIIa-D and SBEIIa- genes and a point mutation in the SBEIla-A gene, in combination with a deletion in the SBEIIb-A gene, SBEHb-B gene or the SBEIIb-D gene or two thereof.
- the invention also provides for a wheat plant capable of producing the grain of the aforesaid embodiment, and methods of producing and using the grain, and products produced from the grain. It is understood that the wheat plant of the invention and the wheat grain embryo from which it is produced have the same genotype, and therefore of the wheat grain of the invention as described herein.
- the amount or activity of total SBEII protein in the grain is less than 60%, or less than 2%, of the amount or acti vity of total SBEII protein in a wild-type wheat grain.
- the present specification provides grain which is viable, which germinates at essentially the same rate as wild-type grain, which germinates at a rate equal to at least 80% relative to the wild-type grain when measured in the time period of 7- 14 days post-imbibition, and/or which produces phenotypical ly normal plants that arc male and female fertile and grow at essentially the same rate as a corresponding wild-type plant and/or produces essentially the same grain yield as the corresponding wild-type plant.
- the grain has a germination rate of about 70% to about 90%, or about 90% to about 100%, relative to the germination rate of a wild-type grain, preferably measured in the time period of 7-14 days post-imbibition.
- At least one, more than one, or all of the mutations are i) introduced mutations, ii) were induced in a parental wheat plant or seed by mutagenesis with a mutagenic agent such as a chemical agent, biological agent or irradiation, or iii ) were introduced in order to modify the plant genome.
- a mutagenic agent such as a chemical agent, biological agent or irradiation, or iii ) were introduced in order to modify the plant genome.
- the irradiation is preferably heavy ion bombardment (HIR), and the chemical agent is preferably an azide.
- the chemical agent is not EMS and/or the wheat variety that was mutagenised is not Cadenza.
- the starch of the grain has an amylose content of at least about 60% (w/w) or at least about 67% (w/w), or at least about 70% (w/w), or at least about 75% (w/w). or at least about 79% (w/w), or at least about 82% (w/w), or at least about 85% (w/w), as a proportion of the extraclable starch of the grain.
- the amylose content of the grain starch may be ⁇ o a maximum of about 90% ( w/w).
- the amylose content of the grain starch is about 80% (w/w) or about 85% (w/w) or about 90% (w/w).
- the amylose content is defined as a percentage on a weight basis of the starch of the grain.
- the grain provided herein is non-transgenic or is free of any exogenous nucleic acid that encodes an RNA which reduces expression of an SttEl!a gene.
- S EIIa activity and/or SBEll b activity may be determined by assaying the enzymatic activity in developing endosperm, or by assaying the amount of SBEIIa protein and/or SBEllb protein in harvested grain by immunological or other means known to the skilled artisan.
- the starch of the grain is characterised by one or more of properties selected from the group consisting of: (i) comprising at least 2% resistant starch, preferably at least about 3% RS. more preferably at least about 6% or about 8% RS. or about 6% or about 8% or about 1 0% RS;
- the grain as described herein is comprised in a wheat plant.
- the grain is developing grain.
- the grain is mature, harvested grain, preferably grain harvested from field-grown plants.
- the quantity of grain is at least 1 kg weight or at least 1 tonne weight.
- the grain is processed so that it is no longer capable of germinating, such as being kibbled, cracked, par-boiled, rolled, pearled, milled or ground grain.
- the invention also provides a process for producing a milled product, comprising the steps of obtaining the grain of the invention and milling the grain.
- the present invention includes a wheat plant (Triiicum estiviim) hich is capable of producing grain as described herein.
- the grain comprises an embryo and starch wherein the embryo comprises two identical alleles of an SBElla-A gene, two identical alleles of an SBEfla-B gene and two identical alleles of an SBElIa-D gene, wherein each of the SBEIIa genes gives rise to an amount of protein (w/w) or a protein having SBEIIa activity which is lower than the corresponding wild-type gene, and at least one of said genes comprises a point mutation, wherein the starch comprises amvlose such that the starch of the grain has an amylose content of at least 50% (w/w) as a proportion of the extractable starch of the grain.
- the starch of the grain has an amylose content of at least about 67% (w/w), or at least about 75% (w/w), or at least about 79% (w/w), or at least about 82% (w/w), or at least about 85% (w/w), as a proportion of the extractable starch of the grain.
- the amylose content of the grain starch may be to a maximum of about 90% (w/w).
- the amylose content of the grain starch is about 80% (w/w) or about 85% (w/w) or about 90% (w/w).
- the grain of the wheat plant comprises at least one SBEIla protein which has starch branching activity when expressed in developing endosperm, the protein being present in an amount or having starch branching enzyme activity of between 2% to 60%, or between 10% to 50%, or between 2% to 30%, or between 2% to 1 5%, or between 3% to 10%, or between 2% to 20% or between 2% to 25% of the amount or activity of the corresponding protein in a wild-type wheat grain.
- the amount or activity of at least one SBEIla protein is less than 60%, less than 50%, less than 40%, less than 35% less than 30%, less than 20%, less than 10%, less than 5%, less than 2% of the amount or activity of the corresponding protein in a wild type wheat grain. In some embodiments, there is no detectable SBEIla protein activity in the grain.
- the amount or activity of SBEIla- A protein is less than 60%, less than 50%, less than 40%, less than 35% less than 30%, less than 20%, less than 10%. less than 5%, less than 2% of the amount or activity of the corresponding protein in a wild type wheat grain. In some embodiments, there is no detectable SB EI la- A protein activity in the grain.
- the amount or activity of SBEIla-B protein is less than 60%, less than 50%, less than 40%, less than 35% less than 30%, less than 20%, less than 10%, less than 5%, less than 2% of the amount or activity of the corresponding protein in a wild type wheat grain. In some embodiments, there is no detectable SBEIIa-B protein activity in the grain.
- the amount or activity of SBEIIa-D protein is less than 60%, less than 50%, less than 40%, less than 35% less than 30%, less than 20%, less than 10%. less than 5%, less than 2% of the amount or activity of the corresponding protein in a wild type wheat grain. In some embodiments, there is no detectable SBEIIa-D protein activity in the grain.
- the wheat plant is male and female fertile, or preferabl has a level of both male and female fertility that is essentially the same a a corresponding wild-type plant.
- the present specification describes wholemeal or flour produced from the grain described herein, and the use of the grain to produce such wholemeal or flour.
- the grain comprises an embryo and starch wherein the embryo comprises two identical alleles of an SBEIIa-A gene, two identical alleles of an SBElI -B gene and two identical alleles of an SBEIIa-D gene, wherein each of the SBElla genes gives rise to an amount of protein (w/w) or a protein having SBElla activity which is lower than the corresponding wild-type gene, and at least one of said genes comprises a point mutation, wherein the starch comprises amylose such that the grain has 'an amylose content of at least 50% (w/w) as a proportion of the extractable starch of the grain.
- the starch of the grain has an amylose content of at least about 60% (w/w) or at least about 67% (w/w), or at least about 75% (w/w). or at least about 79% (w/w), or at least about 82%> (w/w), or at least about 85% (w/w), as a proportion of the extractable starch of the grain.
- the amylose content of the grain starch may be to a maximum of about 90% (w/w).
- the amylose content of the grain starch is about 80% (w/w) or about 85% (w/w) or about 90% (w/w).
- the amylose content of the starch of the flour or wholemeal is the same as the amylose content of the starch of the grain.
- the wholemeal or Hour comprises at least about 3. preferably at least about 6, more preferably at least about 8 g resistant starch per l OOg wholemeal or flour.
- the starch of the Hour or wholemeal preferably has an increased gelatinisation temperature relative to the starch of wild-type flour or wholemeal.
- the wholemeal, flour or food ingredient produced therefrom may be refined by fractionation, bleaching, heat treatment to stabilise the ingredient, treated with enzymes or blended with other food ingredients such as wholemeal or flour from a wild- type wheat.
- the flour is preferably white flour, having specifications as known in the art of baking.
- the wholemeal, flour or other food is packaged ready for sale as a food ingredient, which package may include instructions of recipes for its use.
- the specification describes wheat starch granules or wheat starch produced from the grain as described herein.
- the grain comprises an embryo and starch wherein the embryo comprises two identical alleles of an SB El la- A gene, two identical alleles of an SBEIIa-B gene and two identical alleles of an SBEIfa-D gene, wherein each of the SBEIIa genes gives rise to an amount of protein (w/w) or a protein having SBEIIa activity which is lower than the corresponding wild-type gene, and at least one of said genes comprises a point mutation, wherein the starch comprises amylose such that the grain has an amylose content of at least 50% (w/w) as a proportion of the extractable starch of the grain.
- the starch granules or starch of comprise at least 50% (w/w), or at least 60%> (w/w), or at least 67% (w/w), or at least 70%> (w/w), or at least 75% (w/w), or at least 79% (w/w), or at least 82% (w/w), or at least 85% (w/w) amylose as a proportion of the starch.
- the amylose content may be to a maximum of about 90%) (w/w).
- the amylose content is about 80%> (w/w) or about 85% (vv/w) or about 90% (w/w).
- amylose content of the starch is the same as the amylose content of the starch of the grain from which it is produced, and is preferably determined by an iodometric method.
- the starch granules or starch is characterised by one or more of:
- starch granules comprising less than 2%>. or 2% to 30% of the amount of total SBEII or SBEIIa relative to wild-type wheat starch granules, preferably comprising an SBEIIa protein with an altered affinity for starch; or
- the present specification provides a food ingredient that comprises the grain, the wholemeal or flour, or the starch granules or starch as described herein.
- the grain comprises an embryo and starch wherein the embryo comprises two identical alleles of an SBEIIa-A gene, two identical alleles of an SBEIJa-B gene and two identical alleles of an SBElIa-D gene, wherein each of the SBElla genes gives rise to an amount of protein (w/vv) or a protein having SBElla activity which is lower than the corresponding wild-type gene, and at least one of said genes comprises a point mutation, wherein the starch comprises amylose such that the grain has an amylose content of at least 50% (w/w) as a proportion of the extractable starch of the grain.
- the starch of the grain, wholemeal or flour has an amylose content of at least about 60% (w/w) or at least about 67%o (w/w), or at least about 75% (w/w), or at least about 79% (w/w), or at least about 82% (w/w). or at least about 85%> (w/w), as a proportion of the extractable starch of the grain.
- the amylose content of the grain starch may be to a maximum of about 90% (w/vv).
- the amylose content of the grain starch is about 80% (w/w) or about 85% (w/w) or about 90% (w/w).
- the grain is processed such as kibbled, cracked, par-boiled, rolled, pearled, milled or ground grain or any combination of these.
- the food or drink product comprises a food or drink ingredient at a level of at least 10% on a dry weight basis, wherein the ingredient is wheat grain, the wholemeal or flour, or the starch granules or starch as described herein.
- the grain comprises an embryo and starch wherein the embryo comprises two identical alleles of an SBEIla-A gene, two identical alleles of an SBEIla-B gene and two identical alleles of an SBEIIa-D gene, wherein each of the SBElla genes gives rise to an amount of protein (w/w) or a protein having SBElla activity which is lower than the corresponding wild-type gene, and at least one of said genes comprises a point mutation, wherein the starch comprises amylose such that the grain has an amylose content of at least 50% (w/w) as a proportion of the extractable starch of the grain.
- the starch of the ingredient has an amvlose content of at least about 60% (w/w) or at least about 67% (w/w), or at least about 75% (w/w), or at least about 79% (w/w), or at least about 82% (w/w), or at least about 85%) (w/w), as a proportion of the extractable starch of the grain.
- the amylose content of the starch may be to a maximum of about 90% (w/w).
- the amylose content of the starch is about 80% (w/w) or about 85% (w/w) or about 90% (w/w),
- compositions or blends comprising the grain, or the wholemeal or flour, or the wheat starch granules or wheat starch at a level of at least 10% by weight, and wheat grain having a level of amylose lower than about 50% (w/w) or flour, wholemeal, starch granules or starch obtained therefrom.
- the present specification described a process of producing a wheat plant that produces grain comprising an amylose content of at least 50% (w/w), or at least 60% (w/w), or at least 67% (w/w) as a proportion of the total starch in the grain, or at least about 75% (w/w), or at least about 79% (w/w),or at least about 82% (w/w), or at least about 85% (w/w), as a proportion of the extractable starch of the grain.
- the amylose content of the grain starch may be to a maximum of about 90% (w/w).
- the amylose content of the grain starch is about 80% (w/w) or about 85% (w/w) or about 90% (w/w).
- the process comprises the steps of (i) crossing two parental wheat plants each comprising a point mutation in each of one, two or three SBEIIa or SBEIIb genes selected from the group consisting of SBEIIa- A.
- step (ii) screening plants or grain obtained from the cross or mutagenesis, or progeny plants or grain obtained therefrom, by analysing DNA, RNA, protein, starch granules or starch from the plants or grain, and step (iii) selecting a fertile plant that lacks SBEIIa or SBEIIa starch branching activity.
- a preferred method of mutagenesis is heavy ion bombardment or another irradiation method, or the use of zinc finger nucleases or TAL effectors, as known in the art.
- the grain of the selected fertile wheat plant is characterised by one of the features as described herein above.
- the specification provides a method of screening a wheat plant or grain, the method comprising (i) determining the amount or activity of SBEIla and/or SBEIIb relative to the amount or activity in a wild-type or control plant or grain and selecting a plant which produces grain, or selecting grain as described herein, wherein the grain comprises an embryo and starch and wherein the embryo comprises two identical alleles of an SBEIIa-A gene, two identical alleles of an SBEIIa-B gene and two identical alleles of an SBEIIa-D gene, wherein each of the SBEIla genes gives rise to an amount of protein (w/w) or a protein having SBEIla activity which is lower than the corresponding wild-type gene, and at least one of said genes comprises a point mutation, wherein the starch comprises amylose such that the grain has
- the starch of the grain has an amylose content of at least about 75% (w/w). or at least about 79% (w/w). or at least about 82% (w/w). or at least about 85% (w/w), as a proportion of the extractable starch of the grain.
- the amylose content of the grain starch may be to a maximum of about 90%) (w/w).
- the amylose content of the grain starch is about 80% (w/w) or about 85% (w/w) or about 90% (w/w).
- the invention comprises a process of producing a food or a drink comprising the following steps: (i) obtaining grain as described herein, or an ingredient comprising flour, wholemeal, starch granules or starch obtained therefrom, (ii) optionally processing the grain to produce a food or drink ingredient, and (iii) adding a food or drink ingredient from (i) or (ii) to another food or drink ingredient, thereby producing the food or drink.
- the present invention contemplates a method for improving one or more parameters of metabolic health, bowel health or cardiovascular health in a subject in need thereof, or of preventing or reducing the severity or incidence of a metabolic disease such as diabetes, bowel disease or cardiovascular disease, the method comprising providing to the subject the grain, or the food or drink product as described herein.
- the present specification contemplates a grain, or food or drink product as described herein for use in improving one or more parameters of metabolic health, bowel health or cardiovascular health, or of preventing or reducing the severity or incidence of metabolic, bowel or cardiovascular disease in a subject.
- the present invention further contemplates a process of producing grain, comprising the steps of i) obtaining a wheat plant as described herein, ii) harvesting wheat grain from the plant, and iii) optionally, processing the grain, such as by milling the grain, preferably so as to render the grain unable to germinate.
- the invention includes a process of producing starch, comprising the steps of i) obtaining wheat grain according to the present description, and ii) extracting the starch from the grain, thereby producing the starch.
- the invention includes a method of trading wheat grain, comprising obtaining the wheat grain as described herein, and trading the obtained wheat grain for pecuniary gain.
- the obtaining the wheat grain comprises cultivating or harvesting the wheat grain.
- the step of obtaining the wheat grain further comprises storing the wheat grain.
- the step of obtaining the wheat grain further comprises transporting the wheat grain to a different location.
- the specification provides a process of producing bins of wheat grain comprising:
- step b) threshing and/or winnowing the stalks to separate the grain from the chaff; and c) sifting and/or sorting the grain separated in step b), and loading the sil ' led and/or sorted grain into bins, thereby producing bins of wheat grain.
- Methods are provided for obtaining or identifying or selecting or producing a wheat plant that produces grain comprising an amvlose content of at least 50% (w/w), or at least 60% (w/w), or at least 67% (w/w) or about 80% (w/w). or between about 60%> (w/w) and about 90% (w/w) as a proportion of the total starch in the grain.
- the wheat plant may be identified or selected from a population of multiple candidate plants, such as a mutagenised population or a population of plants resulting from a crossing process or a back-crossing/breeding process.
- the method comprises: (i) crossing two parental wheat plants each comprising a loss of function mutation in each of one, two or three SBEIIa or SBEIIb genes selected from the group consisting of SBEIIa-A, SBEIIa-B, SBEIIa-D, SBEIIb-A, SBEHb-B and SBEIIb- ⁇ , or of mutagenising a parental plant comprising said loss of function mutations; and (ii) screening plants or grain obtained from the cross or mutagenesis, or progeny plants or grain obtained therefrom, by analysing DNA, R.
- A, protein, starch granules or starch from the plants or grain and (iii) selecting a fertile plant that exhibits a level or activity of SBEIla in its grain that is less than 2% relative to the level or activity of the respective protein in a wild-type grain.
- the method comprises steps (ii) and (iii) above, with step (i) being optional, such as when selecting or identifying a plant from a population of multiple candidate plants.
- the grain of the selected fertile wheat plant is characterised by one or more features as defined herein.
- the invention provides a method of screening a wheat plant or grain, the method comprising (i) determining the level or activity of SBEIla relative to the level or activity in a wild type or control plant or grain and selecting plant or grain having less than 2% of the level or activity of total SBEIla protein in a wild-type plant.
- the grain may be further characterized by other features of the grain of the invention.
- Figure 1 is a representation showing an alignment of SB E I la protein alignment (AA 26821 .1 is from the D genome, CAR95900. I from the B genome and CAA7-2154 from the A genome). Dots in the alignment indicate the identical amino acid is present as in the uppermost sequence.
- Figure 2 is a representation showing an alignment of SBEHb amino acid sequences encoded by exons 1 to 3 from the A, B and D genomes of wheat. Dashes indicate amino acids are present in the protein but the sequence not known, dots in the alignment indicate the identical amino acid is present as in the uppermost sequence.
- Figure 3 is a representation of an alignment of SBE 1 l b amino acid sequences.
- Figure 4 is a graphical representation showing a scatter plot of amylose content of transgenic mutant lines (see Example 5).
- Figure 5 is a graphical representation of data showing an amylose model derived from behaviour of SBEII transgenic lines.
- Figure 6 is a graphical representation of data showing an amylose model derived from behaviour of SBEIJ transgenic line.
- Figure 7 is a representation showing an alignment of DNA sequences of the exons 12 to 14 region of homoeologous SBEIIa genes obtained from the wheat variety Chara.
- the nucleotide sequence for the Chara B genome fragment is shown in its entirety, while the corresponding nucleotides for the homoeologous A and D genome fragments are shown only where there are polymorphisms. Dots indicate the corresponding nucleotides are identical to the Chara B genome fragment. Dashes indicate that the corresponding nucleotide is absent from the sequence.
- Figure 8 is a representation showing an alignment of DNA sequences of the intron 3 region of SBEIIa genes obtained from the wheat varieties Sunco and Tasman.
- the nucleotide sequence for the Tasman D genome fragment is shown in its entirety, while the corresponding nucleotides for the homoeologous fragments are shown only where there are polymorphisms. Dots indicate the corresponding nucleotides are identical to the Tasman D genome fragment. Dashes indicate that the corresponding nucleotide is absent from the sequence.
- Figure 9 is a representation showing an alignment of DNA sequences of the exon 3 region of homoeologous SBEIIa genes obtained from the wheat variety Chinese Spring.
- nucleotide sequence for the Chinese Spring D genome fragment is shown in its entirety, while the corresponding nucleotides for the homoeologous A and B genome fragments are shown only where there are polymorphisms. Dots indicate the corresponding nucleotides are identical to the Chinese Spring D genome fragment.
- Figure 10 is an alignment of exon 1 nucleotide sequences from cDNAs from SBEIIa genes of wheat variety Chinese Spring.
- the nucleotide sequence lor the Chinese Spring B genome fragment is shown in its entirety, while the corresponding nucleotides for the homoeologous A and D genome fragments are shown only where there are polymorphisms. Dots indicate the corresponding nucleotides are identical to the Chinese Spring B genome fragment..
- Figure 11 is a representation showing a PCR amplification of the region spanning exons 12-14 of SBEIIa genes from CS nullisomic-tetrasomic lines.
- the line designated BDD is null for A genome
- ADD is a null for B genome
- ⁇ is a null for D genome.
- Figure 12 is photographic representation of a Western blot showing SBEIIa protein expression in developing endosperms from the line S28. Protein extracts from endosperms were assayed by Western blot analysis as described in Example 1. using SBEIIa-speci flc antibodies. The last lane on the right-hand side shows the bands appearing from wild-type endosperm (variety NB 1 ). The positions of SBEIIa proteins encoded by the A, B and D genomes are indicated.
- Figure 13 is a plot of mobility ratio of interacting SBEI Ia in the absence (mO) and presence (m) of ⁇ -limit dextrin in 1 -D Native PAGE against the concentration of ⁇ -limit dextrin (S).
- the dissociation constant ( d) is derived from the equation mO'm 1 + [S
- Figure 14 shows the relationship of amylose content and enzyme resistant starch in pooled wheat starch samples derived from transgenic wheat lines described in Example 2.
- Figure 16 is a graphical representation showing apparent amylose content distribution on WM and WMC populations as determined by NIRS.
- 1 1 1 J Figure 17 (a) and (b) are graphical representations of data showing the effect of adding increasing quantities of wheat lines on water absorption (a) and Mixograph mixing times (b).
- Figure 18 (a) and (b) are graphical representations of data illustrating the effect of adding increasing quantities of high amylose wheat flour on Resistant Starch (a) and predicted GI (b) (HI%) of small scale bread loaves.
- FIG 19 is a photograph of a Western blot analysis of SBEIla proteins isolated from wild-type wheat endosperms (variety Sunstate, lanes indicated as SirnS) and mutant endosperms from the lines as indicated. The bands corresponding to the SBEHa-A, -B, and -D proteins of Sunstate are arrowed.
- Figure 20 is an alignment of nucleotide sequences of cDNAs from wild-type SBEIla genes of wheat.
- the nucleotide sequence for the cDNA corresponding to SBElki-D (Accession No. AF338431 .1) from A. tauschii is shown in its entirety in the top line of each panel, while the corresponding nucleotides for the homoeOlogous cDNAs for SBElIa- A (Accession No. Y l 1282, Nair et al,, 1997) and SBElIa-B (derived from the genomic sequence in Accession No. FM865435, Botticella et al., 201 1 ) are shown only where there are polymorphisms.
- cDNA sequences are likely from SBEIIa-A, as they are closer to the A genome sequence than the B or D genomes, but from naturally occurring variants in cultivars Chinese Spring and Cheyenne, respectively.
- Table A provides a description of the sequences in the sequence listing.
- Table 1 provides starch branching enzyme genes characterized from cereals.
- Table 2 provides an amino acid sub-classification.
- Table 3 provides exemplary amino acid substitutions.
- Table 4 provides genome specific primers for wheat SBEIla gene.
- Table 5 provides nucleotide sequences of genome specific primers for SBEIla.
- Table 6 provides primers designed to amplify parts of the SBEIla gene specifically from the A genome of wheat.
- Table 7 provides primers designed to amplify parts of the SBEIIa gene speci ficall from the B genome of wheat.
- Table 8 provides primers designed to amplify parts of the SBEIIa gene specifically from the D genome of wheat.
- Table 9 provides genome specific primers for wheat SBEIIb gene.
- Table 10 provides nucleotide sequences of genome specific primers for SBEIIb.
- Table 11 provides total SBEII and SBEIIa and SBEIIb expression and amylose content of RNAi lines of wheat as described in Example 4.
- Table 12 provides a list of microsatellitc markers tested in the mutants as described in Example 5.
- Table 13 provides mutants identified from HUB population and microsatellitc mapping data as described in Example 5.
- Table 14 provides a description of double null mutants of SBEII identified as described in Example 5.
- Table 15 provides a description of crosses performed between double and single null mutants as described in Example 5.
- Table 16 provides tabulation of amylose content in grain starch of triple nulls mutants as described in Example 5.
- Table 17 provides fertility observations on F2 progeny plants.
- Table 18 provides SBEII allelic composition and amylose proportion data for double nulls identified.
- Table 19 provides a summary of the SNF mutants identified from the azide- mutagenised population of wheat (cv. Sunstate)
- Table 20 provides the amylose content of the SBEIIa triple null mutants as determined by an iodometric method
- Table 21 provides amylose content of SBEIIa triple null mutants.
- Table 22 provides amylose content of SBEIIa triple null mutants.
- Table 23 provides preliminary agronomic data on the triple null plants
- Table 24 provides starch characterisation of grain starch from transgenic wheat lines.
- Table 25 provides molecular weight distribution of starch fractions from wheat transgenic lines.
- Table 26 provides RVA parameters of hp5'-SBEIIa transgenic wheat starch.
- Table 27 provides DSC parameters of gelatinisation peak of hpS'-SBEHa transgenic wheat starch compared to the control NB 1.
- Table 28 provides RS content in rolled and flaked grain products.
- Table 29 provides resistant starch content in food products at varying level of incorporation of high amylose wheat (HAW).
- HAW high amylose wheat
- Table 30 provides genome-specific primers referred to in Example 1 8.
- Tabic 31 provides details of selected print mutants from Arche and Apache populations.
- Tabel 32 provides details of selected print mutant plants for crosses with double null (HIB deletions) mutants.
- Table 33 provides details of results of crosses (F l seed population) from crosses between single SBEIIa point mutant and double null (deletion) mutants.
- Table 34 provides provides results of NIRS screening of F2 seeds from crosses between single SBEIIa point mutants and double null (HIB deletions) mutants.
- Table 35 provides amylose levels and thousand kernel weight (T W) for HAW
- the present invention is based in part on the observations made in the experiments described herein that mutant plants and grain comprising at least one point mutation in an SBEIIa gene were favoured over plants and grain which had deletions in each of the SBEIIa genes for combining mutant SBEIIa genes, in particular to obtain phenotypical ly normal, male and female fertile plants and grain which germinated at rates similar to wild- type grain.
- deletions tend to remove important genetic elements adjacent to the SBEIIa genes.
- SBEIIa expressed from the A genome or "SBEIla-A” means a starch branching enzyme whose amino acid sequence is set forth in SEQ ID NO: 1 or which is at least 99% identical to the amino acid sequence set forth in SEQ ID NO: 1 or comprising such a sequence.
- the amino acid sequence of SEQ ID NO: 1 (Genbank Accession No.
- CAA72154 corresponds to an SBEIIa expressed from the A genome of wheat, which is used herein as the reference sequence for wild-type SBEHa-A.
- the protein of SEQ ID NO: 1 is 823 amino acids long. Active variants of this enzyme exist in wheat, for example in cultivar Cheyenne, see Accession No. AF286319 which is 99.88% (822/823) identical to SEQ ID NO. 1 . or for Accession No. AK335707 (Chinese Spring). Such variants are included in "SBElIa-A" provided they have essentially wild-type starch branching enzyme activity as for SEQ ID NO: 1 .
- SBEIIa expressed from the B genome or "SBEI Ia-B” means a starch branching enzyme whose amino acid sequence is set forth in SEvQ ID NO: 2 or which is at least 99% identical to the amino acid sequence set forth in SEQ ID NO: 2 or comprising such a sequence.
- the amino acid sequence of SEQ ID NO: 2 (Genbank Accession No. CAR95900) corresponds to the SBElla expressed from the B genome of wheat variety Chinese Spring, which is used herein as the reference sequence for wild-type SBEIIa-B.
- the protein of SEQ ID NO: 2 is 823 amino acids long.
- Active variants of this enzyme may exist in wheat and are included in SBEIIa-B provided they have essentially wild-type starch branching enzyme activity as for SEQ ID NO: 2.
- SEQ ID NO: 2 is 98.42% (81 1/824) identical to SEQ ID NO: 1 .
- the alignment of the amino acid sequences in Figure 1 shows the amino acid differences which may be used to distinguish the proteins or to classify variants as SBEIIa-A or SBEIla-B.
- SBEIIa expressed from the D genome or "SBEIIa-D” means a starch branching enzyme whose amino acid sequence is set forth in SEQ ID NO: 3 or which is at least 98%> identical to the amino acid sequence set forth in SEQ I D NO: 3 or comprising such a sequence.
- the amino acid sequence of SEQ I D NO: 3 (Genbank Accession No. AAK26821 ) corresponds to the SBEIIa expressed from the D genome in A. ta schii, a likely progenitor of the D genome of hexaploid wheat, which is used herein as the reference sequence for wild-type SBEIIa-D.
- the protein of SEQ I D NO: 3 is 8 1 amino acids long. Active variants of this enzyme may exist in wheat and are included in SBEIIa-D provided they have essentially wild-type starch branching enzyme activity as for SEQ ID NO: 3.
- SEQ ID NO: 3 is 97.57% (803/823) identical to SEQ ID NO: 1 and 97.81%o (805/823) identical to SEQ ID NO: 2.
- the alignment of the amino acid sequences in Figure 1 shows amino acid differences which may be used to distinguish the proteins or to classify variants as SB Ella- A, SBEIIa-B or SBEIIa-D.
- an "SBEIIa protein” includes protein variants which have reduced or no starch branching enzyme activity, as well as the proteins having essentially wild-type enzyme activity. It is also understood that SBEIIa proteins may be present in grain, particularly dormant grain as commonly harvested commercially, but in an inactive state because of the physiological conditions in the grain. Such proteins are included in '"SBEIIa proteins” as used herein.
- the SBEIIa proteins may be enzymatically active during only part of grain development, in particular in developing endosperm when storage starch is typically deposited, but in inactive state otherwise. Such SBElla protein may be detected and quantitated readily using immunological methods such as Western blot analysis.
- An "SBEIIb protein” as used herein has an analogous meaning.
- SBEIIb expressed from the A genome or "SBEl.lb-A” means a starch branching enzyme comprising the amino acid sequence set forth in SEQ ID NO: 4 or which is at least 98% identical to the amino acid sequence set forth in SEQ ID NO: 4 or comprising such a sequence.
- the amino acid sequence of SEQ ID NO: 4 corresponds to the amino terminal sequence of SBEIIb expressed from the A genome of wheat, which is used herein as the reference sequence for wild-type SBEIIb-A.
- SBEIIb expressed from the B genome or "SBEIIb-B” means a starch branching enzyme comprising the amino acid sequence set forth in SEQ I D NO: 5 or which is at least 98% identical to the amino acid sequence set forth in S EQ ID NO: 5 or comprising such a sequence.
- the amino acid sequence SEQ ID NO: 5, which is used herein as the reference sequence for wild-type SBEIIb-B, is a partial amino acid sequence encoded by exons 2-3 of the SBEIIb-B gene in wheat.
- a variant SBEIIb-B sequence is the amino acid sequence encoded by the nucleotide sequence of Accession No. A 335378 isolated from cv. Chinese Spring.
- SBEIIb expressed from the D genome or "SBEIIb-D” means a starch branching enzyme whose amino acid sequence is set forth in SEQ ID NO: 6 or which is at least 98% identical to the amino acid sequence set forth in SEQ ID NO: 6 or comprising such a sequence.
- the amino acid sequence of SEQ ID NO: 6 (Genbank Accession No. AAW80631 ) corresponds to the SBEIIb expressed from the D genome of i. tauschii, a likely progenitor of the D genome of hexaploid wheat, and is used herein as the reference sequence for wild-type SBEIIb-D.
- SBEIIb-D Active variants of this enzyme exist in wheat and are included in SBEIIb-D provided they have essentially wild-type starch branching enzyme activity as for SEQ ID NO: 6.
- SEQ ID NO: 4 of US patent application publication No. 20050074891 shows the amino acid sequence of a SBEIIb-D protein which is 99.5% identical to SEQ ID NO: 6 in this application.
- the alignment of the amino acid sequences in Figure 2 shows amino acid differences which may be used to distinguish SBEIlb proteins or to classify variants as SBElIb-A, SBEIIb-B or SBEIIb-D.
- wild-type as used herein when referring to SBEIIa-A means a starch branching enzyme whose amino acid sequence is set forth in SEQ I D NO: 1 ;
- wi ld-type as used herein when referring to SBElIa-B means a starch branching enzyme whose amino acid sequence is set forth in SEQ ID NO: 2;
- wild-type as used herein when referring to SBEIla-D means a starch branching enzyme whose amino acid sequence is set forth in SEQ ID NO: 3;
- wild-type as used herein when referring to SBEIIb-A means a starch branching enzyme whose amino acid sequence comprises the sequence set forth in SEQ ID NO: 4;
- wild-type as used herein when referring to SBEIIb-B means a starch branching enzyme whose amino acid sequence comprises the sequence set forth in SEQ ID NO: 5 : and, "wild-type” as used herein when referring to SBEIIb-B
- the terms"SBEIIa gene", “SBEIIa-B gene” “wheat SBElla gene” and “wheat SBEHb gene” and the like refer to the genes that encode functional SBEl la or SBEIlb enzymes, respectively, in wheat, including homologous genes present in other wheat varieties, and also mutant forms of the genes which encode enzymes with reduced activity or undetectable activity. These include, but are not limited to, the wheat SB II genes which have been cloned, including the genomic and cDNA sequences listed in Table 1 or described in the Figures.
- the genes as used herein encompasses mutant forms which do not encode any proteins at all, in which case the mutant forms represent null alleles of the genes. Alleles of the genes include mutant alleles where at least part of the gene is deleted, including where the entire gene is deleted, which alleles also represent null alleles of the genes.
- an "endogenous SBEII gene” refers to an SBEII gene which is in its native location in the wheat genome, including wild-type and mutant forms.
- isolated SBEII gene and “exogenous SBEII gene” refer to an SBETI gene which is not in its native location, for example having been cloned, synthesized, comprised in a vector or in the form of a transgene in a cell, preferably as transgene in a transgenic wheat plant .
- the SBEII gene in this context may be any of the specific forms as described as follows.
- the SBE!Ia gene on the A genome of wheat or "SBEIIa-A gene” means any polynucleotide which encodes SBEIIa-A as defined herein or which is derived from a polynucleotide which encodes SBEIIa-A, including naturally occurring polynucleotides, sequence variants or synthetic polynucleotides, including "wi ld-type SBEIIa-A gene(s)" which encode an SBEIIa-A with essentially wild-type activity, and "mutant SBEIIa-A gene(s)” which do not encode an SBEIla-A with essentially wild-type activity but are recognizably derived from a wild-type SBEIIa-A gene.
- a mutant SBEII gene is considered to be a mutant SBEIIa-A gene if its nucleotide sequence is more closely related, i.e. having a higher degree of sequence identity, to a wild-type SBEIIa-A gene than to any other SBEII gene.
- a mutant SBEIIa-A gene encodes a SBE with reduced starch branching enzyme activity (partial mutant), or a protein which lacks SBE activity or no protein at all (null mutant gene).
- SBEIIa-A Genbank Accession No. Y l 1282.
- Other exemplary nucleotide sequences are provided in Accession No. AF286319 (SBEIIa-A).
- SBEIIa-A A 335707 (SBEIIa-A), a partial cDNA sequence in Accession No. EU670724. a genomic SBE!Ia-B sequence in Accession No. FM865435. and a cDNA corresponding to a splicing variant for an SBEIIa-A protein in Accession No. AF338432.
- Sequences of parts of SBEIla-A genes are also given herein as referred to in Figures 7, 8. 9 and 10 and SEQ ID NOs 13, 14 and 15.
- the terms "SBEIIa expressed from the B genome” or “SBEIIa-B”, “SBEIIa expressed from the D genome” or “SBEIIa-D”, “SBEIIb expressed from the A genome” or “SBEIIb-A”, “SBEIIb expressed from the B genome” or “SBEIIb-B” and “SBFJlb expressed from the D genome” or “SBEIIb-D” have corresponding meanings to that for SBEIIa-A in the previous paragraph.
- Illustrative partial SBEIIb-A, SBEIIb-B and SBEIIb-D protein sequences are provided in Figure 2.
- Illustrative SBEIIb-A amino acid sequences are set out in SEQ ID NO: 4 (amino terminal sequence encoded by exon 1 -3).
- Illustrative SBEIIb-B amino acid sequences are set out in SEQ ID NO: 5.
- Illustrative SBEI lb-D amino acid sequences arc set out in SEQ ID NO: 6, SEQ ID NO: 7 and SEQ ID No: 9.
- the SBEII genes as defined above include any regulatory sequences that are 5' or 3' of the transcribed region,- including the promoter region, that regulate the expression of the associated transcribed region, and introns within the transcribed regions.
- Figure 20 provides an alignment of cDNA sequences for wild-type SBEIIa genes of wheal.
- the homologous genes arc readily recognizable by the skilled artisan on the basis of sequence identity.
- the degree of sequence identity between homologous SBEIIa genes or the proteins is thought to be at least 90%. similarly for SBEIIb genes or proteins.
- Wheat SBEIIa genes are about 80% identical in sequence lo wheat SBEIIb genes.
- the encoded proteins arc also about 80% identical in sequence.
- An allele is a variant of a gene at a single genetic locus.
- a diploid organism has two sets of chromosomes.
- Bach chromosome has one copy of each gene (one al lele). I f both alleles are the same the organism is homozygous with respect to that gene, i f the alleles are different, the organism is heterozygous with respect to that gene.
- the interaction between alleles at a locus is generally described as dominant or recessive.
- Reference to a null mutation includes a null mutation independently selected from the group consisting of a deletion mutation, an insertion mutation, a splice-site mutation, a premature translation termination mutation, and a frameshi ft mutation.
- one or more of the null mutations are non-conservative amino acid substitution mutations or a nul mutation has a combination of two or more non-conservative amino acid substitutions.
- non-conservative amino acid substitutions are as defined herein.
- a loss of function mutation which includes a partial loss of function mutation in an allele as well as complete loss of function mutation, means a mutation in the allele leading to a reduced level or activity of SBEII, SBEIIa or SBEIIb enzyme in the grain.
- the mutation in the allele may mean, for example, that less protein having wild-type or reduced activity is translated or that wild-type or reduced levels of transcription arc followed by translation of an enzyme with reduced enzyme activity.
- the mutation may mean, for example, that no or less RNA is transcribed from the gene comprising the mutation or that the protein produced has no or reduced activity.
- a "point mutation” refers to a single nucleotide base change which includes a deletion, substitution or insertion.
- the mutation may further be a splice-site mutation, a premature translation termination mutation, a frame shift mutation or other loss of function mutation wherein the mutation results in no protein being produced or the protein is produced in lower amounts or the protein produced has lower SBE activity.
- the point mutation results in a conservative or preferably a non- conservative amino acid substitution as described herein.
- a “reduced” or “lower” amount or level of protein means reduced or lower relative to the amount or level produced by the corresponding wild-type allele. Typically, the reduction is by at least 40%, preferably at least 50% or at least 60%, more preferably at least 80% or 90% relative to the wild-type, in a most preferred embodiment, the protein is not detected, such as for example in a Western blot assay as described herein.
- a “reduced” activity means reduced relative to the corresponding wild-type SBEIL SBEIIa or SBEIIb enzyme.
- SBE activity refers to SBE activity which may be measured directly or indirectly by various means known in the art and as described herein. For example SBE activity may be measured directly by phosphorylation stimulation assay or by iodine stain assay. Binding to starch may be determined by measuring SBE affinity for starch by. for example, affinity gel electrophoresis as described herein. The affinity of binding to starch provides an indirect measure of SBE activity. As described herein, partial loss of function mutants include mutants expressing an SBEIIa protein having modified, including reduced or increased, affinity for starch. Such mutants expressing at least one SBEIIa protein exhibiting reduced (lower) affinity for starch by approximately (about) one third (30%) would be expected to exhibit a greater reduction or lowering of SBE protein activity when measured directly.
- the amount of SBEIla protein or SBEIIb protein is reduced because there is less transcription or translation of the SBEIla gene or SBEIIb gene, respectively.
- the amount by weight of SBEIla protein or SBEIIb protein is reduced even though there is a wild-type number of SBEIla protein molecules or SBEI Ib protein molecules in the grain, because some of the proteins produced are shorter than wild-type SBEIla protein or SBEIIb protein, e.g. the mutant SBEIla protein or SBEIIb protein is truncated due to a premature translation termination signal.
- two identical alleles of an SBEUa-A gene means that the two alleles of the SBEIIa-A gene are identical to each other; "two identical alleles of an SBElla-B gene ', means that the two alleles ol the SBEIIci-B gene are identical to each other; "two identical alleles of an SBEIIa-D gene " ', means that the two alleles of the SBEIIa-D gene are identical to each other; "two identical alleles of an SBEIIh-A gene”, means that the two alleles of the SBElIb-A gene are identical to each other; “two identical alleles of an SBEIIb-B gene”, means that the two alleles of the SBEIIb-B gene are identical to each other; and, "two identical alleles of an SBEllb-D gene * ', means that the two alleles of the SBE/Ib-D gene are identical to each
- the wheat plants of the invention can be produced and identified after mutagenesis.
- the wheat plant is non-transgenic, which is desirable in some markets, or which is free of any exogenous nucleic acid molecule which reduces expression of an SBEIla gene.
- the wheat plant is transgenic, for example it comprises an exogenous nucleic acid molecule other than one which reduces expression of an SBEIla gene, such as for example, an exogenous nucleic acid molecule which encodes a polypeptide that confers herbicide tolerance to the plant.
- Mutant wheat plants having a mutation in a single SBEII gene which can be combined by crossing and selection with other SBEII mutations to generate the wheat plants of the invention can be either synthetic, for example, by performing site-directed mutagenesis on the nucleic acid, or induced by mutagenic treatment, or may be naturally occurring, i.e. isolated from a natural source.
- a progenitor plant cell, tissue, seed or plant may be subjected to mutagenesis to produce single or multiple mutations, such as nucleotide substitutions, deletions, additions and/or codon modification.
- Preferred wheat plants and grain of the invention comprise at least one introduced SBEII mutation, more preferably two or more introduced SBEII mutations, and may comprise no mutations from a natural source i.e. all of the mutant SBE!Ia and SBElIb alleles in the plant were obtained by synthetic means or by mutagenic treatment.
- Mutagenesis can be achieved by chemical or radiation means, for example EMS or sodium azide (Zwar and Chandler, 1995) treatment of seed, or gamma irradiation, well know in the art. Chemical mutagenesis tends to favour nucleotide substitutions rather than deletions. Heavy ion beam (HIB) irradiation is known as an effective technique for mutation breeding to produce new plant cultivars, see for example Hayashi et al, 2007 and Kazama et al, 2008.
- chemical or radiation means for example EMS or sodium azide (Zwar and Chandler, 1995) treatment of seed, or gamma irradiation, well know in the art. Chemical mutagenesis tends to favour nucleotide substitutions rather than deletions. Heavy ion beam (HIB) irradiation is known as an effective technique for mutation breeding to produce new plant cultivars, see for example Hayashi et al, 2007 and Kazama et al, 2008.
- Ion beam irradiation has two physical factors, the dose (gy) and LET (linear energy transfer, keV/um) for biological effects that determine the amount of DN.A damage and the size of DNA deletion, and these can be adjusted according to the desired extent of mutagenesis.
- HIB generates a collection of mutants, many of them comprising deletions that may be screened for mutations in specific SBEII genes as shown in the Examples. Mutants which are identified may be backcrossed with non-mutated wheat plants as recurrent parents in order to remove and therefore reduce the effect of unlinked mutations in the mutagenised genome, see Example 9.
- Biological agents useful in producing site-specific mutants include enzymes that include double stranded breaks in DNA that stimulate endogenous repair mechanisms. These include endonucleases, zinc finger nucleases, TAL effector proteins, transposases and site-specific recombinases. Zinc finger nucleases (ZFNs), for example, facilitate site- specific cleavage within a genome allowing endogenous or other end-joining repair mechanisms to introduce deletions or insertions to repair the gap. Zinc finger nuclease technology is reviewed in Le Provost et al, 2009, See also Durai et al, 2005 and Liu et al , 2010.
- Isolation of mutants may be achieved by screening mutagenised plants or seed.
- a mutagenized population of wheat may be screened directly for the SBEIIa and/or SBEIIb genotype or indirectly by screening for a phenotype that results from mutations in the SBEII genes.
- Screening directly for the genotype preferably includes assaying for the presence of mutations in the SBEII genes, which may be observed in PCR assays by the absence of specific SBEIIa or SBEIIb markers as expected when some of the genes are deleted, or heteroduplex based assays as in Tilling.
- Screening for the phenotype may comprise screening for a loss or reduction in amount of one or more SBEIIa or SBEllb proteins by ELISA or affinity chromatography, or increased amylose content in the grain starch.
- screening is preferably done in a genotype that already lacks one or two of the SBEII activities, for example in a wheat plant already mutant in the SBEIIa or SBEllb genes on two of the three genomes, so that a mutant further lacking the functional activity is sought.
- screening is preferably done in a genotype that already lacks one SBEII activity, on either the A or B genome, and identifying a mutant which is reduced in the SBEII from the second genome.
- Affinity chromatography may be carried out as demonstrated in Example 1 1 .
- Large populations of mutagenised seeds may be screened for high amylose phenotypes using near infra-red spectroscopy (NIR) as demonstrated in Example 10.
- NIR near infra-red spectroscopy
- a sub-population enriched for high amylose candidates was obtainable. By these means, high throughput screening is readily achievable and allows the isolation of mutants at a frequency of approximately one per several hundred seeds.
- Plants and seeds of the invention can be produced using the process known as TILLING (Targeting Induced Local Lesions IN Genomes), -in that one or more of the mutations in the wheat plants or grain may be produced by this method.
- TILLING Targeting Induced Local Lesions IN Genomes
- introduced mutations such as novel single base pair changes are induced in a population of plants by treating seeds or pollen with a chemical or radiation mutagen, and then advancing plants to a generation where mutations will be stably inherited, typically an 2 generation where homozygotes may be identified.
- DNA is extracted, and seeds are stored from all members of the population to create a resource that can be accessed repeatedly over time.
- PGR primers are designed to specifically ampli fy a single gene target of interest.
- dye-labeled primers can be used to amplify PGR products from pooled DNA of multiple individuals. These PCR products are denatured and reannealed to allow the formation of mismatched base pairs. Mismatches, or heteroduplexes, represent both naturally occurring single nucleotide polymorphisms (SNPs) (i.e., several plants from the population are likely to carry the same polymorphism) and induced SNPs (i.e., only rare individual plants are likely to display the mutation).
- SNPs single nucleotide polymorphisms
- induced SNPs i.e., only rare individual plants are likely to display the mutation.
- an endonuclease such as Cel I, that recognizes and cleaves mismatched DNA, or the use of High Resolution Melting, is used to discovering novel SNPs within a TILLING population. For example, see Botticella el al.. 201 1.
- Genomic fragments being assayed can range in size anywhere from 0.3 to 1.6 kb.
- this combination allows up to a million base pairs of genomic DNA to be screened per single assay, making TILLING a high-throughput technique. TILLING is further described in Slade and nauf, 2005. and Henikoff et at, 2004.
- Identified mutations may then be introduced into desirable genetic backgrounds by crossing the mutant with a plant of the desired genetic background and performing a suitable number of backcrosses to cross out the originally undesired parent background.
- an "induced mutation” or “introduced mutation” is an artificially induced genetic variation which may be the result of chemical, radiation or biologically-based mutagenesis, for example transposon or T-DNA insertion.
- mutations are null mutations such as nonsense mutations, frameshift mutations, deletions, insertional mutations or splice-site variants which completely inactivate the gene.
- mutationations are partial mutations which retain some SBEll activity, but less than wild-type levels of the enzyme.
- Nucleotide insertional derivatives include 5' and 3' terminal fusions as well as intra-sequence insertions of single or multiple nucleotides,
- Insertional nucleotide sequence variants are those in which one or more nucleotides are introduced into a site in the nucleotide sequence, either at a predetermined site as is possible with zinc finger nucleases (ZFN) or other homologous recombination methods, or by random insertion with suitable screening of the resulting product.
- ZFN zinc finger nucleases
- Deletional variants are characterised by the removal of one or more nucleotides from the sequence.
- a mutant gene has only a single insertion or deletion of a sequence of nucleotides relative to the wild-type gene.
- the deletion may be extensive enough to include one or more exons or introns, both exons and introns. an intron-exon boundary, a part of the promoter, the translational start site, or even the entire gene.
- Deletions may extend far enough to include at least part of, or the whole of, both the SB Ella and SB EI lb genes on the A. B or D genome, based on the close genetic linkage of the two genes.
- Insertions or deletions within the exons of the protein coding region of a gene which insert or delete a number of nucleotides which is not an exact multiple of three, thereby causing a change in the reading frame during translation, almost always abolish activity of the mutant gene comprising such insertion or deletion.
- substitutional nucleotide variants are those in which at least one nucleotide in the sequence has been removed and a different nucleotide inserted in its place.
- the number of nucleotides affected by substitutions in a mutant gene relative to the wild-type gene is a maximum of ten nucleotides, more preferably a maximum of 9. 8, 7, 6, 5, 4, 3, or 2, or most preferably only one nucleotide.
- Substitutions may be "silent" in that the substitution does not change the amino acid defined by the codon. Nucleotide substitutions may reduce the translation efficiency and thereby reduce the .S7i/iY/ expression level, for example by reducing the mR!
- Silent substitutions that do not alter the translation efficiency of a SBEIIa or SBElIb gene are not expected to alter the activity of the genes and are therefore regarded herein as non-mutant, i.e. svich genes are active variants and not encompassed in "mutant alleles".
- the nucleotide substitution(s) may change the encoded amino acid sequence and thereby alter the activity of the encoded enzyme, particularly if conserved amino acids are substituted for another amino acid which is quite different i.e. a non-conservative substitution.
- Typical conservative substitutions are those made in accordance with Table 3.
- mutation does not include silent nucleotide substitutions which do not affect the activity of the gene, and therefore includes only alterations in the gene sequence which affect the gene activity.
- polymorphism refers to any change in the nucleotide sequence including such silent nucleotide substitutions. Screening methods may first involve screening for polymorphisms and secondly for mutations within a group of polymorphic variants.
- hexaploid wheats such as bread wheat comprise three genomes which are commonly designated the A. B and D genomes, while tetraploid wheats such as durum wheat comprise two genomes commonly designated the A and B genomes.
- Each genome comprises 7 pairs of chromosomes which may be observed by cytological methods during meiosis and thus identified, as is well known in the art.
- plant(s) and “wheat plant(s)” as used herein as a noun generally refer to whole plants, but when “plant” or “wheat” is used as an adjective, the terms refer to any substance which is present in, obtained from, derived from, or related to a plant or a wheat plant, such as for example, plant organs (e.g. leaves, stems, roots, flowers), single cells (e.g. pollen), seeds, plant cells including for example tissue cultured cells, products produced from the plant such as "wheat flour", "wheat grain”, “wheat starch”, “wheat starch granules” and the like.
- plant organs e.g. leaves, stems, roots, flowers
- single cells e.g. pollen
- Plantlets and germinated seeds from which roots and shoots have emerged are also included within the meaning of "plant”.
- plant parts refers to one or more plant tissues or organs which are obtained from a whole plant, preferably a wheat plant. Plant parts include vegetative structures (for example, leaves, stems), roots, floral organs/structures, seed (including embryo, endosperm, and seed coat), plant tissue (for example, vascular tissue, ground tissue, and the like), cells and progeny of the same.
- plant cell refers to a cell obtained from a plant or in a plant, preferably a wheat plant, and includes protoplasts or other cells derived from plants, gamete-producing cells, and cells which regenerate into whole plants.
- Plant cells may be cells in culture.
- plant tissue is meant differentiated tissue in a plant or obtained from a plant (“explant”) or undifferentiated tissue derived from immature or mature embryos, seeds, roots, shoots, fruits, pollen, and various forms of aggregations of plant cells in culture, such as calli.
- Plant tissues in or from seeds such as wheat seeds are seed coat, endosperm, scutellum, aleurone layer and embryo.
- Cereals as used herein means plants or grain of the monocotyledonous families Poaceae or Graminae which are cultivated for the edible components of their seeds, and includes wheat, barley, maize, oats, rye, rice, sorghum, triticale, millet, buckwheat.
- the cereal plant or grain is wheat or barley plant or grain, more preferably wheat plant or grain. In a further preferred embodiment, the cereal plant is not rice or maize or both of these.
- the term “wheat” refers to any species of the Genus Triticum, including progenitors thereof, as well as progeny " thereof produced by crosses with other species.
- Wheat includes "hexaploid wheat” which has genome organization of AABBDD, comprised of 42 chromosomes, and "tetraploid wheat” which has genome organization of AABB, comprised of 28 chromosomes.
- Hexaploid wheat includes T. aestivum, T. spelta. T. macha, T. compactum, T. sphaerococcum, T. vavilovii, and interspecies cross thereof.
- Tetraploid wheat includes T.
- durum also referred to as durum wheat or Triticum turgidum ssp. durum
- T. dicoccoides T. dicoccum, T. polonicum, and interspecies cross thereof.
- the term "wheat” includes possible progenitors of hexaploid or tetraploid Trilicum sp. such as T. uartu, T. monococcum or T. boeoticum for the A genome, Aegilops speltoides for the B genome, and T. (2004)ii (also known as Aegilops squarrosa or Aegilops tauschii) for the D genome.
- a wheat cultivar for use in the present invention may belong to, but is not limited to, any of the above-listed species. Also encompassed are plants that are produced by conventional techniques using Triticum sp. as a parent in a sexual cross with a non-Triticum species, such as rye Secede cereale, including but not limited to Triticale.
- the wheat plant is suitable for commercial production of grain, such as commercial varieties of hexaploid wheat or durum wheat, having suitable agronomic characteristics which are known to those skilled in the art. More preferably the wheat is Triticum aestivum ssp. aestivum or Triticum turgidum ssp. durum, and most preferably the wheat is Triticum aestivum ssp. aestivum, herein also referred to as "breadwheat”.
- the term "barley” refers to any species of the Genus Hordeum, including progenitors thereof, as well as progeny thereof produced by crosses with other species. It is preferred that the plant is of a Hordeum species which i commercially cultivated such as, for example, a strain or cultivar or variety of Hordeum vulgare or suitable for commercial production of grain.
- aspects of the invention provide methods of planting and harvesting wheat grain of the invention, and methods of producing bins of wheat grain of the invention. For instance, after the ground is prepared by plowing and/or certain other methods, the seeds (kernels) are planted either by sowing them broadcast (i.e.. by distributing them on the surface of the ground) or by drilling furrows and planting the seeds in rows. To prevent scattering of the kernels, wheat is often harvested before it is fully ripe. There are several steps in harvesting: cutting, or reaping, the stalks; threshing and winnowing, to separate the kernels from the spikes, glumes, and other chaff; sifting and sorting the grain: loading the grain into trucks; and binding the straw.
- harvested wheat grain may be be stored in dry, we 11- ventilated buildings that keep out insect pests. In some embodiments, harvested wheat grain may be stored for a short time in bins or granaries. The wheat grain may then by hauled to country elevators, tall structures where the grain is dried and stored until it is sold or shipped to terminal elevators.
- embodiments of the invention provide a process of producing bins of wheat grain comprising: a) reaping wheat stalks comprising wheat grain as defined herein; b) threshing and/or winnowing the stalks to separate the grain from the chaff; and c) sifting and/or sorting the grain separated in step b), and loading the sifted and/or sorted grain into bins, thereby producing bins of wheat grain.
- the wheat plants of the invention may have many uses other than uses for food or animal feed, for example uses in research or breeding.
- the plants can be self-crossed to produce a plant which is homozygous for the desired genes, or haploid tissues such as developing germ cells can be induced to double the chromosome complement to produce a homozygous plant.
- the inbred wheat plant of the invention thereby produces seed containing the combination of mutant SBEII alleles which may be homozygous.
- These seeds can be grown to produce plants that would have the selected phenotype such as, for example, high amylose content in its starch.
- the wheat plants of the invention may be crossed with plants containing a more desirable genetic background, and therefore the invention includes the transfer of the low SBEIi trait to other genetic backgrounds. After the initial crossing, a suitable number of backcrosses may be carried out to remove a less desirable background.
- SBEII allele- specific PCR-based markers such as those described herein may be used to screen for or identify progeny plants or grain with the desired combination of alleles, thereby tracking the presence of the alleles in the breeding program.
- the desired genetic background may include a suitable combination of genes providing commercial yield and other characteristics such as agronomic performance or abiotic stress resistance.
- the genetic background might also include other altered starch biosynthesis or modi fication genes, for example genes from other wheat lines.
- the genetic background may comprise one or more transgenes such as, for example, a gene that confers tolerance to a herbicide such as glyphosatc.
- the desired genetic background of the wheat plant will include considerations of agronomic yield and other characteristics. Such characteristics might include whether it is desired to have a winter or spring types, agronomic performance, disease resistance and abiotic stress resistance.
- agronomic yield For Australian use, one might want to cross the altered starch trait of the wheat plant of the invention into wheat cultivars such as Baxter, Kennedy, Janz. Frame. Rosella, Cadou , Diamondbird or other commonly grown varieties. Other varieties will be suited for other growing regions. It is preferred that the wheat plant of the invention provide a grain yield of at least 80% relative to the yield of the corresponding wild-type variety in at least some growing regions, more preferably at least 85% or at least 90%.
- the grain yield of the wheat plant of the invention is at least as great as the yield of the wi ld-type wheat plant having about the same genetic background, grown under the same conditions.
- the yield can readily be measured in controlled field trials, or in simulated field trials in the greenhouse, preferably in the field.
- (02 ⁇ I Marker assisted selection is a well recognised method of selecting for heterozygous plants obtained when backcrossing with a recurrent parent in a classical breeding program.
- the population of plants in each backcross generation will be heterozygous for the gene(s) of interest normally present in a 1 : 1 ratio in a backcross population, and the molecular marker can be used to distinguish the two alleles of the gene.
- the molecular marker can be used to distinguish the two alleles of the gene.
- Procedures such as crossing wheat plants, self- ferti lising wheat plants or marker- assisted selection are standard procedures and well known in the art. Transferring alleles from tetraploid wheat such as durum wheat to a hexaploid, or other forms of hybridisation, is more difficult but is also known in the art.
- wheat plants that contain a combination of mutant SBEIla and SBEIih alleles or other desired genes are typically compared to control plants.
- a phenotypic characteristic associated with enzyme activity such as amylose content in the grain starch
- the plants to be tested and control plants are grown under growth chamber, greenhouse, open top chamber and/or field conditions. Identification of a particular phenotypic trait and comparison to controls is based on routine statistical analysis and scoring. Statistical differences between plants lines can be assessed by comparing - enzyme activity between plant lines within each tissue type expressing the enzyme.
- the wheat plants of the invention differ from wild-type plants in one or more of these parameters by less than 50%, more preferably less than 40%, less than 30%, less than 20%, less than 15%, less than 10%, less than 5%, less than 2% or less than 1 % when grown under the same conditions.
- the term "linked” refers to a marker locus and a second locus being sufficiently close on a chromosome that they will be inherited together in more than 50% of meioses. e.g., not randomly.
- This definition includes the situation where the marker locus and second locus form part of the same gene.
- this definition includes the situation where the marker locus comprises a polymorphism that is responsible for the trait of interest (in other words the marker locus is directly "linked” to the phenotype).
- the term “genetically linked” as used herein is narrower, only used in relation to where a marker locus and a second locus being sufficiently close on a chromosome that they will be inherited together in more than 50% of meioses.
- the percent of recombination observed between the loci per generation will be less than 50.
- genetically linked loci may be 45, 35, 25, 1 5, 10, 5, 4, 3, 2, or 1 or less cM apart on a chromosome.
- the markers are less than 5 cM or 2c apart and most preferably about 0 cM apart.
- the SBEIIa and SBEllb genes are genetically linked on the long arm of chromosome 2 of each of the wheat genomes, being about 0.5cM apart, which corresponds to about 100- 200kb in physical distance.
- the "other genetic markers” may be any molecules which are linked to a desired trait in the wheat plants of the invention. Such markers are well known to those skilled in the art and include molecular markers linked to genes determining traits such disease resistance, yield, plant morphology, grain quality, other dormancy traits such as grain colour, gibberellic acid content in the seed, plant height. Hour colour and the like. Examples of such genes are stem-rust resistance genes Sr2 or Sr38. the stripe rust resistance genes YrlO or Yrl l, the nematode resistance .genes such as ( ' re J and Cre3.
- Rht genes that determine a semi-dwarf growth habit and therefore lodging resistance (Eagles et al., 2001 ; Langridge el al., 2001 ; Sharp el al. , 2001 ).
- the wheat plants, wheat plant parts and products therefrom of the invention are preferably non-transgenic for genes that inhibit expression of SBEIIa i .e. they do not comprise a transgene encoding an RNA molecule that reduces expression of the endogenous SBEIIa genes, although in this embodiment they may comprise other transgenes, eg. herbicide tolerance genes. More preferably, the wheat plant, grain and products therefrom are non-transgenic, i.e. they do not contain any transgene. which is preferred in some markets. Such products are also described herein as "non-transformed" products. Such non-transgenic plants and grain comprise the multiple mutant SBEIJ alleles as described herein, such as those produced after mutagenesis.
- transgenic plant and “transgenic wheat plant” as used herein refer to a plant that contains a gene construct ("transgene") not found in a wild-type plant of the same species, variety or cultivar. That is, transgenic plants (transformed plants) contain genetic material that they did not contain prior to the transformation.
- a "transgene” as referred to herein has the normal meaning in the art of biotechnology and refers to a genetic sequence which has been produced or altered by recombinant DNA or RNA technology and which has been introduced into the plant cell.
- the transgene may include genetic sequences obtained from or derived from a plant cell, or another plant cell, or a non-plant source, or a synthetic sequence.
- the transgene has been introduced into the plant by human manipulation such as, for example, by transformation but any method can be used as one of skill in the art recognizes.
- the genetic material is typically stably integrated into the genome of the plant.
- the introduced genetic material may comprise sequences that naturally occur in the same species but in a rearranged order or in a different arrangement of elements, for example an antisense sequence. Plants containing such sequences are included herein in "transgenic plants".
- Transgenic plants as defined herein include all progeny of an initial transformed and regenerated plant (TO plant) which has been genetically modified using recombinant techniques, where the progeny comprise the transgene.
- transgenic plants are homozygous for each and every gene that has been introduced (transgene) so that their progeny do not segregate for the desired phenotype.
- Transgenic plant parts include all parts and cells of said plants which comprise the transgene such as. for example, seeds, cultured tissues, callus and protoplasts.
- a "non-transgenic plant”, preferably a non-transgenic wheat plant, is one which has not been genetically modified by the introduction of genetic material by recombinant DNA techniques.
- the term "corresponding non-transgenic plant” refers to a plant which is the same or similar in most characteristics, preferably isogenic or near-isogenic relative to the transgenic plant, but without the transgene of interest.
- the corresponding non-transgenic plant is of the same cultivar or variety as the progenitor of the transgenic plant of interest, or a sibling plant line which lacks the construct, often termed a "segregant", or a plant of the same cultivar or variety transformed with an "empty vector” construct, and may be a non-transgenic plant.
- "Wild-type" refers to a cell, tissue or plant that has not been modified according to the invention.
- "'wild-type wheat grain" means a corresponding non-mutagenized, non-transgenic wheat grain.
- Specific wild-type wheat grains as used herein include but are not limited to Sunstate and Cadoux. The Sunstate wheat cultivar is described in: Ellison et al., ( 1994) Triticum aeslivum spp. vulgare (bread wheat) cv. Sunstate, Australian Journal of Experimental Agriculture, 34(6):869-869, the entire contents of which are incorporated herein by reference.
- PCR polymerase chain reaction
- DNA may be extracted from the plants using conventional methods and the PCR reaction carried out using primers that will distinguish the transformed and non-transformed plants.
- An alternative method to confirm a positive transformant is by Southern blot hybridization, well known in the art.
- Wheat plants which are transformed may also be identified i .e. distinguished from non- transformed or wild-type wheat plants by their phenotype. for example conferred by the presence of a selectable marker gene, or by immunoassays that detect or quantify the expression of an enzyme encoded by the transgene. or any other phenotype conferred by the transgene.
- the wheat plants of the present invention may be grown or harvested for grain, primarily for use as food for human consumption or as animal feed, or for fermentation or industrial feedstock production such as ethanol production, among other uses. Alternatively, the wheat plants may be used directly as feed.
- the plant of the present invention is preferably useful for food production and in particular for commercial food production. Such food production might include the making of flour, dough, semolina or other products from the grain that might be an ingredient in commercial food production.
- the term "grain” generally refers to mature, harvested seed of a plant but can also refer to grain after imbibition or germination, according to the context. Mature cereal grain such as wheat commonly has a moisture content of less than about 1 8- 20%.
- seed includes harvested seed but also includes seed which is developing in the plant post anthesis and mature seed comprised in the plant prior to harvest.
- Germination refers to the emergence of the root tip from the seed coat after imbibition.
- Germination rate refers to the percentage of seeds in a population which have germinated over a period of time, for example 7 or 10 days, after imbibition: Germination rates can be calculated using techniques known in the art. For example, a population of seeds can be assessed daily over several days to determine the germination percentage over time. With regard to grain of the present invention, as used herein the term "germination rate which is substantially the same" means that the germination rate of the grain is at least 90%, that of corresponding wild-type grain.
- Starch is readily isolated from wheat grain using standard methods, for example the method of Schulman and ammiovirta, 1991 . On an industrial scale, wet or dry milling can be used. Starch granule size is important in the starch processing industry where there is separation of the larger A granules from the smaller B granules.
- Wild-type wheat grown commercially has a starch content in the grain which is usually in the range 55-65%, depending somewhat on the cultivar grown.
- the seed or grain of the invention has a starch content of at least 90% relative to that of wild-type grain, and preferably at least 93%, at least 95%, or at least 98% relative to the starch content of wild-type grain when the plants are grown under the same conditions.
- the starch content of the grain is at least about 25%, at least about 35%, at least about 45%, or at least about 55% to about 65% as a percentage of the grain weight (w/w).
- Other desirable characteristics include the capacity to mill the grain, in particular the grain hardness.
- Grain shape is also another feature that can impact on the commercial usefulness of a plant, thus grain shape can have an impact on the ease or otherwise with which the grain can be milled.
- the invention provides starch granules or starch obtained from the grain of the plant as described above, having an increased proportion of amylose and a reduced proportion of amylopectin.
- Purified starch may be obtained from grain by a milling process, for example a wet milling process, which involves the separation of the starch from protein, oil and fibre.
- the initial product of the milling process is a mixture or composition of starch granules, and the invention therefore encompasses such granules.
- the starch granules from wheat comprise starch granule-bound proteins including GBSS.
- the starch from starch granules may be purified by removal of the proteins after disruption and dispersal of the starch granules by heat and/or chemical treatment.
- the starch granules from the wheat grain of the invention are typically distorted in shape and surface morphology, when observed under light microscopy, as exemplified herein, particularly for wheat grain having an amylose content of at least 50% as a percentage of the total starch of the grain.
- At least 50%, preferably at least 60% or at least 70% of the starch granules obtained from the grain show distorted shape or surface morphology.
- the starch granules also show a loss of birefringence when observed under polarised light.
- the starch of the grain, the starch of the starch granules, and the purified starch of the invention may be further characterized by one or more of the following properties: i) at least 50% (w/w), or at least 60% (w/w), or at least 67% (w/w) amylose as a proportion of the total starch;
- ix comprising a low relative glycaemic index (GI).
- the starch may also be characterized by its swelling volume in heated excess water compared to wild-type starch. Swelling volume is typically measured by mixing either a starch or flour with excess water and heating to elevated temperatures, typically greater than 90°C The sample is then collected by centri ugation and the swelling volume is expressed as the mass of the sedimented material divided by the dry weight of the sample. A low swelling characteristic is useful where it is desired to increase the starch content of a food preparation, in particular a hydrated food preparation.
- amylopectin structure is the distribution of chain lengths, or the degree of polymerization, of the starch.
- the chain length distribution may be determined by using fluorophore-assisted carbohydrate electrophoresis (FACE) following isoamylose de-branching.
- FACE fluorophore-assisted carbohydrate electrophoresis
- the amylopectin of the starch of the invention may have a distribution of chain length in the range from 5 to 60 that is greater than the distribution of starch from wild-type plants upon debranching. Starch with longer chain lengths will also have a commensurate decrease in frequency of branching. Thus the starch may also have a distribution of longer amylopectin chain lengths in the amylopectin still present.
- the amylopectin of the grain may be characterised in comprising a reduced proportion of the 4 - 12 dp chain length fraction relative to the amylopectin of wild-type grain, as measured after isoamylase debranching of the amylopectin.
- the wheat starch may have an altered gelatinisation temperature, which may be readily measured by differential scanning calorimetry (DSC).
- DSC differential scanning calorimetry
- Gelatinisation is the heat-driven collapse (disruption) of molecular order within the starch granule in excess water, with concomitant and irreversible changes in properties such as granular swelling, crystallite melting, loss of birefringence, viscosity development and starch solubilisation.
- the gelatinisation temperature may be either increased or decreased compared to starch from wild-type plants, depending on the chain length of the remaining amylopectin.
- the gelatinisation temperature in particular the temperature of onset of the first peak or the temperature for the apex of the first peak, may be elevated by at least 3°C. preferably at least 5°C or more preferably at least 7°C as measured by DSC compared to starch extracted from a similar, but unaltered grain.
- the starch may comprise an elevated level of resistant starch, with an altered structure indicated by specific physical characteristics including one or more of the group consisting of physical inaccessibility to digestive enzymes which may be by reason of having altered starch granule morphology, the presence of appreciable starch associated lipid, altered crystallinity, and altered amylopectin chain length distribution. The high proportion of amy lose also contributes to the level of resistant starch.
- the starch structure of the wheat of the present invention may also differ in that the degree of crystallinity is reduced compared to normal starch isolated from wheat.
- the reduced crystallinity of a starch is also thought to be associated with enhance organoleptic properties and contributes to a smoother mouth feel.
- the starch may additionally exhibit reduced crystallinity resulting from reduced levels of activity of one or more amylopectin synthesis enzymes. Crystallinity is typically investigated by X-ray crystallography.
- the present starch provides modified digestive properties such as increased resistant starch including between 1 % to 20%. 2% to 1 8%, 3% to 1 8% or 5% to 15% resistant starch and a decreased Glycaemic I ndex (Gl).
- modified digestive properties such as increased resistant starch including between 1 % to 20%. 2% to 1 8%, 3% to 1 8% or 5% to 15% resistant starch and a decreased Glycaemic I ndex (Gl).
- the invention also provides Hour, meal or other products produced from the grain. These may be unprocessed or processed, for example by fractionation or bleaching.
- the invention also provides starch from grain of the exemplified wheat plants comprising increased amounts of dietary fibre, preferably in combination with an elevated level of resistant starch. This increase is also at least in part a result of the high relative level of amylose.
- dietary fibre includes the carbohydrate and carbohydrate digestion products which are not absorbed in the small intestine of healthy humans but which enter the large bowel. This includes resistant starch and other soluble and insoluble carbohydrate polymers. It is intended to comprise that portion of carbohydrates that are fermentable, at least partially, in the large bowel by the resident microflora.
- the starch of the invention contains relatively high levels of dietary fibre, more particularly amylose.
- the dietary fibre content of the grain of the present invention results at least in part from the increased amylose content in the starch of the grain, and also, or in combination with an increased resistant starch content as a percentage of the total starch.
- Resistant starch is defined herein as the sum of starch and products of starch digestion not absorbed in the small intestine of healthy humans but entering into the large bowel. This is defined in terms of a percentage of the total starch of the grain, or a percentage of the total starch content in the food, according to the context. Thus, resistant starch excludes products digested and absorbed in the small intestine. Resistant starches include physical ly inaccessible starch (RS I form), resistant native starch granules (RS2). retrograded starches (RS3), and chemically modified starches (RS4). The altered starch structure and in particular the high amylose levels of the starch of the invention give rise to an increase in resistant starch when consumed in food. The starch may be in an RS I form, being somewhat inaccessible to digestion. Starch-lipid association as measured by V-complex crystallinity is also likely to contribute to the level of resistant starch.
- the invention may be particularly useful in the treatment or prophylaxis of humans, it is to be understood that the invention is also applicable to non-human subjects including but not limited to agricultural animals such as cows, sheep, pigs and the like, domestic animals such as dogs ' or cats, laboratory animals such as rabbits or rodents such as mice, rats, hamsters, or animals that might be used for sport such as horses.
- the method may be particularly applicable to non-ruminant mammals or animals such as mono-gastric mammals.
- the invention may also be applicable to other agricultural animals for example poultry including, for example, chicken, geese, ducks, turkeys, or quails, or fish.
- the method of treating the subject, particularly humans may comprise the step of administering altered wheat grain, flour, starch or a food or drink product as defined herein to the subject, in one or more doses, in an amount and for a period of time whereby the level of the one or more of the bowel health or metabolic indicators improves.
- the indicator may change relative to consumption of non-altered wheat starch or wheat or product thereof, within a time period of hours, as in the case of some of the indicators such as pH.
- Dosages may vary depending on the condition being treated or prevented but are envisaged for humans as being at least l g of wheat grain or starch of the invention per day, more preferably at least 2g per day, preferably at least 10 or at least 20g per day. Administration of greater than about 100 grams per day may require considerable volumes of delivery and reduce compliance. Most preferably the dosage for a human is between 5 and 6()g of wheat grain or starch per day, or for adults between 5 and l OOg per day.
- Glycaemic Index relates to the rate of digestion of foods comprising the starch, and is a comparison of the effect of a test food with the effect of white bread or glucose on excursions in blood glucose concentration.
- the Glycaemic Index is a measure of the likely effect of the food concerned on post prandial serum glucose concentration and demand for insulin for blood glucose homeostasis.
- One important characteristic provided by foods of the invention is a reduced glycaemic index. Serum glucose levels were lower 30 min after ingestion of high amylose wheat products by human volunteers compared to low amylose wheat (Goddard et ai, 1 984). Furthermore, the foods may have a low level of final digestion and consequently be relatively low-calorie.
- a low calorific product might be based on inclusion of Hour produced from milled wheat grain. Such foods may have the effect of being filling, enhancing bowel health, reducing the post-prandial serum glucose and lipid concentration as well as providing for a low calorific food product.
- the indicators of improved bowel health may comprise, but are not necessari ly- limited to:
- the indicators of improved metabolic health may comprise, but are not necessarily limited to:
- one benefit of the present invention is that it provides for products such as bread that are of particular nutritional benefit, and moreover it does so without the need to post-harvest modify the starch or other constituents of the wheat grain.
- Methods of modification are well known and include the extraction of the starch or other constituent by conventional methods and modification of the starches to increase the resistant form.
- the starch may be modified by treatment with heat and/or moisture, physically (for example ball milling), enzymatically (using for example a- or ⁇ -amylase, pullalanase or the like), chemical hydrolysis (wet or dry using liquid or gaseous reagents), oxidation, cross bonding with difunctional reagents (for example sodium trimetaphosphate, phosphorus oxychloride), or carboxymethylation.
- heat and/or moisture physically (for example ball milling), enzymatically (using for example a- or ⁇ -amylase, pullalanase or the like), chemical hydrolysis (wet or dry using liquid or gaseous reagents), oxidation, cross bonding with difunctional reagents (for example sodium trimetaphosphate, phosphorus oxychloride), or carboxymethylation.
- the wheat starch of the present invention will be a suitable substrate for fermentation for ethanol (biofuel) or ethanol-containing beverages and the wheat grain or wheat starch for other fermentation products such as foods, nutraceuticals (insoluble or soluble fibre), enzymes and industrial materials.
- the methods for fermentation using plant- derived starch are well known to those skilled in the art. with established processes for various fermentation products (see for example Vogel el al., 1996 and references cited therein).
- the starch carbohydrates may be extracted by crushing the wheat plant parts of the invention such as grain, or by diffusion from the plant tissues into water or another suitable solvent. Wheat tissues or starch of the invention may be used directly as a substrate for fermentation or bioconversion in a batch, continuous; or immobilized-cell process.
- polypeptide and protein are generally used interchangeably herein.
- proteins and polypeptides as used herein also include variants, mutants, modifications and/or derivatives of the polypeptides of the invention as described herein.
- substantially purified polypeptide refers to a polypeptide that has been separated from the lipids, nucleic acids, other peptides and other molecules with which it is associated in its native state.
- the substantially purified polypeptide is at least 60% free, more preferably at least 75% free, and more preferably at least 90% free from other components with which it is naturally associated.
- recombinant polypeptide is meant a polypeptide made using recombinant techniques, i.e., through the expression of a recombinant polynucleotide in a cell, preferably a plant cell and more preferably a wheat cell.
- the polypeptide has starch branching enzyme activity, particularly SBEII activity, and is at least 90% identical to a SBEII described herein.
- a "biologically active" fragment is a portion of a polypeptide of the invention which maintains a defined activity of the full-length polypeptide.
- the biologically active fragment has starch branching enzyme activity.
- Biologically active fragments can be any size as long as they maintain the defined activity, but are preferably at least 700 or 800 amino acid residues long.
- the query sequence is at least 50 amino acids in length, and the GAP analysis aligns the two sequences over a region of at least 50 amino acids. More preferably, the query sequence is at least 100 amino acids in length and the GAP analysis aligns the two sequences over a region of at least 100 amino acids. Even more preferably, the query sequence is at least 250 amino acids in length and the GAP analysis aligns the two sequences over a region of at least 250 amino acids. Most preferably, two SBE1I polypeptides are aligned over their full length amino acid sequences.
- the polypeptide comprises an amino acid sequence which is at least 75%, more preferably at least 80%, more preferably at least 85%, more preferably at least 90%, more preferably at least 91 %, more preferably at least 92%, more preferably at least 93%, more preferably at least 94%, more preferably at least 95%, more preferably at least 96%, more preferably at least 97%, more preferably at least 98%, more preferably at least 99%, more preferably at least 99.
- Amino acid sequence deletions or insertions generally range from about 1 to 15 residues, more preferably about 1 to 10 residues and typically about 1 to 5 contiguous residues.
- Substitution mutants have at least one amino acid residue in the polypeptide molecule removed and a different residue inserted in its place.
- the sites of greatest interest for substitutional mutagenesis for reduced activity of the polypeptide include sites identi fied as the active site(s).
- Other sites of interest are those in which particular residues obtained from various strains or species are identical i.e. conserved amino acids. These positions may be important for biological activity.
- These amino acids, especially those falling within a contiguous sequence of at least three other identically conserved amino acids are preferably substituted in a relatively conservative manner in order to retain function such as SBEII activity, or in a non-conservative manner for reduced activity.
- Conservative substitutions are shown in fable 1 under the heading of "exemplary substitutions" .
- Non-conservative amino acid substitutions are defined herein as substitutions other than those listed in Table 3 (Exemplary conservative substitutions). Non-conservative substitutions in an SBEII are expected to reduce the activity of the enzyme and many will correspond to an SBEII encoded by a "partial loss of function mutant SBEII gene".
- polypeptides of the present invention which are differentially modified during or after synthesis, e.g.. by phosphorylation, as has been shown for SBEI, SBEIIa and SBElfb in am ' yloplasts of wheat (Tetlow el al, 2004). These modifications may serve to regulate the activity of the enzyme, for example by regulating the formation of protein complexes in amyloplasts during starch synthesis (Tetlow et al, 2008), or to increase the stability and/or bioactivity of the polypeptide of the invention, or serve as a ligand for binding of another molecule.
- the present invention involves modification of gene activity, particularly of SBEII gene activity, combinations of mutant genes, and the construction and use of chimeric genes.
- gene includes any deoxyribonucleotide sequence which includes a protein coding region or which is transcribed in a cell but not translated, together with associated non-coding and regulatory regions. Such associated regions arc typically located adjacent to the coding region on both the 5' and 3' ends for a distance of about 2 kb on either side.
- the gene includes control signals such as promoters, enhancers, transcription termination and/or polyadenylation signals that are naturally associated with a given gene, or heterologous control signals in which case the gene is referred to as a "chimeric gene".
- the sequences which are located 5' of the protein coding region and which are present on the mRNA are referred to as 5' non-translated sequences.
- the sequences which are located 3' or downstream of the protein coding region and which are present on the mRNA are referred to as 3' non-translated sequences.
- the term “gene” encompasses both cDNA and genomic forms of a gene.
- the term “gene” includes synthetic or fusion molecules encoding the proteins of the invention described herein.
- Genes arc ordinarily present in the wheat genome as double-stranded DNA.
- a chimeric gene may be introduced into an appropriate vector for extrachromosomal maintenance in a cell or for integration into the host genome.
- Genes or genotypes as referred to herein in italicised form (e.g. SBEIIa) while proteins, enzymes or phenotypes are referred to in non-italicised form (SBEIIa).
- a genomic form or clone of a gene containing the coding region may be interrupted with non-coding sequences termed “introns” or “intervening regions” or “intervening sequences.”
- An "intron” as used herein is a segment of a gene which is transcribed as part of a primary RNA transcript but is not present in the mature mRNA molecule. Introns are removed or “spliced out” from the nuclear or primary transcript; introns therefore are absent in the messenger RNA (mRNA). Introns may contain regulatory elements such as enhancers.
- Exons refer to the DNA regions corresponding to the RNA sequences which are present in the mature mRNA or the mature RNA molecule in cases where the RNA molecule is not translated.
- An mRNA functions during translation to specify the sequence or order of amino acids in a nascent polypeptide.
- a "polynucleotide” or “nucleic acid” or “nucleic acid molecule” means a polymer of nucleotides, which may be DNA or RNA or a combination thereof, for example a heteroduplex of DNA and RNA, and includes for example mRNA, cRNA, cDNA, tRNA, siRNA, shRNA, hpRNA, and single or double-stranded DNA. It may be DNA or RNA of cellular, genomic or synthetic origin.
- the polynucleotide is solely DNA or solely RNA as occurs in a cell, and some bases may be methylated or otherwise modified as occurs in a wheat cell.
- the polymer may be single-stranded, essentially double-stranded or partly double-stranded.
- An example of a partly-double stranded RNA molecule is a hairpin RNA (hpRNA), short hairpin RNA (shRNA) or self-complementary RNA which include a double stranded stem formed by basepairing between a nucleotide sequence and its complement and a loop sequence which covalently joins the nucleotide sequence and its complement.
- Basepairing refers to standard basepairing between nucleotides, including G:U basepairs in an RNA molecule. "Complementary" means two polynucleotides are capable of basepairing along part of their lengths, or along the full length of one or both.
- isolated is meant material that is substantially or essentially free from components that normally accompany it in its native state.
- an "isolated polynucleotide” or “isolated nucleic acid molecule” means a polynucleotide which is at least partially separated from, preferably substantially or essentially free of, the polynucleotide sequences of the same type with which it is associated or linked in its native state.
- an "isolated polynucleotide” includes a polynucleotide which has been purified or separated from the sequences which flank it in a naturally occurring state, e.g., a DNA fragment which has been removed from the sequences which are normally adjacent to the fragment.
- the isolated polynucleotide is also at least 90% free from other components such as proteins, carbohydrates, lipids etc.
- the term "recombinant polynucleotide” as used herein refers to a polynucleotide formed in vitro by the manipulation of nucleic acid into a form not normally found in nature.
- the recombinant polynucleotide may be in the form of an expression vector.
- expression vectors include transcriptional and translational regulatory nucleic acid operably connected to the nucleotide sequence to be transcribed in the cell.
- oligonucleotides are polynucleotides up to 50 nucleotides in length. They can be RNA, DNA. or combinations or derivatives of either. Oligonucleotides are typically relatively short single stranded molecules of 10 to 30 nucleotides, commonly 1 5-25 nucleotides in length, typically comprised of 10-30 or 1 5-25 nucleotides which are identical to, or complementary to, part of an SBElla or SBEl!b gene or cDNA corresponding to an SBElla or SBEIlb gene.
- the minimum size of such an oligonucleotide is the size required for the formation of a stable hybrid between the oligonucleotide and a complementary sequence on a target nucleic acid molecule.
- the oligonucleotides are at least 15 nucleotides, more preferably at least 1 8 nucleotides, more preferably at least 19 nucleotides, more preferably at least 20 nucleotides, even more preferably at least 25 nucleotides in length.
- Polynucleotides used as a probe are typically conjugated with a detectable label such as a radioisotope, an enzyme, biotin, a fluorescent molecule or a chemiluminescent molecule.
- a detectable label such as a radioisotope, an enzyme, biotin, a fluorescent molecule or a chemiluminescent molecule.
- Oligonucleotides and probes of the invention are useful in methods of detecting an allele of a SBElla, SBEHb or other gene associated with a trait of interest, for example modified starch.
- Such methods employ nucleic acid hybridization and in many instances include oligonucleotide primer extension by a suitable polymerase, for example as used in PGR for detection or identification of wild-type or mutant alleles.
- Preferred oligonucleotides and probes hybridise to a SBElla or SBEIlb gene sequence from wheat, including any of the sequences disclosed herein, for example SF.Q ID NOs: 36 to 149.
- Preferred oligonucleotide pairs are those that span one or more introns. or a part of an intron and therefore may be used to amplify an intron sequence in a PCR reaction. Numerous examples are provided in the Examples herein.
- polynucleotide variant and “variant” and the like refer to polynucleotides displaying substantial sequence identity with a reference polynucleotide sequence and which are able to function in an analogous manner to. or with the same activity as, the reference sequence. These terms also encompass polynucleotides that are , distinguished from a reference polynucleotide by the addition, deletion or substitution of at least one nucleotide, or that have, when compared to naturally occurring molecules, one or more mutations.
- polynucleotide variant and “variant” include polynucleotides in which one or more nucleotides have been added or deleted, or replaced with different nucleotides.
- certain alterations inclusive of mutations, additions, deletions and substitutions can be made to a reference polynucleotide whereby the altered polynucleotide retains the biological function or activity of the reference polynucleotide.
- these terms encompass polynucleotides that encode polypeptides that exhibit - enzymatic or other regulatory activity, or polynucleotides capable of serving as selective probes or other hybridising agents.
- polynucleotide variant and variant also include naturally occurring allelic variants. Mutants can be either naturally occurring (that is to say, isolated from a natural source) or synthetic (for example, by performing site-directed mutagenesis on the nucleic acid).
- a polynucleotide variant of the invention which encodes a polypeptide with enzyme activity is greater than 400, more preferably greater than 500, more - preferably greater than 600, more preferably greater than 700, more preferably greater than 800, more preferably greater than 900. and even more preferably greater than 1 ,000 nucleotides in length, up to the full length of the gene.
- a variant of an oligonucleotide of the invention includes molecules of varying sizes which are capable of hybridising, for example, to the wheat genome at a position close to that of the specific oligonucleotide molecules defined herein.
- variants may comprise additional nucleotides (such as 1 , 2. 3, 4, or more), or less nucleotides as long as they still hybridise to the target region.
- additional nucleotides such as 1 , 2. 3, 4, or more
- a few nucleotides may be substituted without influencing the ability of the oligonucleotide to hybridise to the target region.
- variants may readily be designed which hybridise close (for example, but not limited to, within 50 nucleotides) to the region of the plant genome where the specific oligonucleotides defined herein hybridise.
- polynucleotide corresponds to or “corresponding to” in the context of polynucleotides or polypeptides is meant a polynucleotide (a) having a nucleotide sequence that is substantially identical or complementary to all or a portion of a reference polynucleotide sequence or (b) encoding an amino acid sequence identical to an amino acid sequence in a peptide or protein.
- This phrase also includes within its scope a peptide or polypeptide having an amino acid sequence that is substantially identical to a sequence of amino acids in a reference peptide or protein.
- sequence relationships between two or more polynucleotides or polypeptides include “reference sequence”, “comparison , window”, “sequence identity”, “percentage of sequence identity”, “substantial identity” and “identical”, and are defined with respect to a defined minimum number of nucleotides or amino acid residues or preferably over the full length.
- sequence identity and “identity” are used interchangeably herein to refer to the extent that sequences are identical on a nucleotide-by-nucleotide basis or an amino acid-by-amino acid basis over a window of comparison.
- a "percentage of sequence identity” is calculated by comparing two optimally aligned sequences over the window of comparison, determining the number of positions at which the identical nucleic acid base (e.g., A, T, C, G, U) or the identical amino acid residue (e.g., Ala, Pro, Ser, Thr, Gly, Val, Leu, He, Phe. Tyr, Trp, Lys, Arg. His, Asp, GIu, Asn, Gin, Cys and Met) occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison (i.e.. the window size), and multiplying the result by 100 to yield the percentage of sequence identity.
- the identical nucleic acid base e.g., A, T, C, G, U
- the identical amino acid residue e.g., Ala, Pro, Ser, Thr, Gly, Val, Leu, He, Phe. Tyr, Trp, Lys, Arg
- the query sequence is at least 45 nucleotides in length, and the GAP analysis aligns the two sequences over a region of at least 45 nucleotides.
- the query sequence is at least 1 50 nucleotides in length, and the GAP analysis aligns the two sequences over a region of at least 150 nucleotides.
- the query sequence is at least 300 nucleotides in length and the GAP analysis aligns the two sequences over a region of at least 300 nucleotides, or at least 400, 500 or 600 nucleotides in each case.
- the GAP analysis aligns the two sequences over a region of at least 300 nucleotides, or at least 400, 500 or 600 nucleotides in each case.
- Nucleotide or amino acid sequences are indicated as "essentially simi lar" when such sequences have a sequence identity of at least about 95%, particularly at least about 98%, more particularly at least about 98.5%, quite particularly about 99%, especially about 99.5%, more especially about 100%, quite especially are identical. It is clear that when RNA sequences are described as essentially similar to, or have a certain degree of sequence identity with, DNA sequences, thymine (T) in the DNA sequence is considered equal to uracil (U) in the RNA sequence.
- the polynucleotide comprises a polynucleotide sequence which is at least 75%. More preferably at least 80%, more preferably at least 85%>, more preferably at least 90%. more preferably at least 91%, more preferably at least 92%, more preferably at least 93%, more preferably at least 94%, more preferably at least 95%. more preferably at least 96%.
- the present invention refers to the stringency of hybridization conditions to define the extent of complementarity of two polynucleotides.
- “Stringency” as used herein, refers to the temperature and ionic strength conditions, and presence or absence of certain organic solvents, during hybridization. The higher the stringency, the higher will be the degree of complementarity between a target nucleotide sequence and the labelled polynucleotide sequence.
- “Stringent conditions” refers to temperature and ionic conditions under which only nucleotide sequences having a high frequency of complementary bases will hybridize.
- hybridizes under low stringency, medium stringency, high stringency, or very high stringency conditions describes conditions for hybridization and washing.
- Guidance for performing hybridization reactions can be found in Current Protocols in Molecular Biology. John Wiley & Sons, N .Y. ( 1989), 6.3.1 -6.3.6, herein incorporated by reference.
- Speci fic hybridization conditions referred to herein are as follows: 1 ) low stringency hybridization conditions in 6 X sodium chloride/sodium citrate (SSC) at about 45°C, followed by two washes in 0.2 X SSC, 0.1 % SDS at 50-55°C; 2) medium stringency hybridization conditions in 6 X SSC at about 45°C, followed by one or more washes in 0.2 X SSC, 0. 1 % SDS at 60°C; 3) high stringency hybridization conditions in 6 X SSC at about 45°C, followed by one or more washes in 0.2 X SSC, 0.1 % SDS at 65°C; and 4) very high stringency hybridization conditions are 0.5 M sodium phosphate. 7% SDS at 65°C. followed by one or more washes at 0.2 X SSC, 1 % SDS at 65°C.
- a "chimeric gene” or “genetic construct” refers to any gene that is not a native gene in its native location i.e. it has been artificially manipulated, including a chimeric gene or genetic construct which is integrated into the wheat genome.
- a chimeric gene or genetic construct comprises regulatory and transcribed or protein coding sequences that are not found together in nature.
- a chimeric gene or genetic construct may comprise regulatory sequences and coding sequences that are derived from different sources, or regulatory sequences and coding sequences derived from the same source, but arranged in a manner different than that found in nature.
- endogenous is " used herein to refer to a substance that is normally produced in an unmodified plant at the same developmental stage as the plant under investigation, preferably a wheat plant, such as starch or a SBEIIa or SBEIlb.
- An "endogenous gene” refers to a native gene in its natural location in the genome of an organism, preferably a SBEIIa or SB EI lb gene in a wheat plant.
- recombinant nucleic acid molecule refers to a nucleic acid molecule which has been constructed or modified by recombinant DNA technology.
- flanking polynucleotide or “exogenous polynucleotide” or “heterologous polynucleotide” and the like refer to any nucleic acid which is introduced into the genome of a cell by experimental manipulations, preferably the wheat genome, but which does not naturally occur in the cell. These include modified forms of gene sequences found in that cell so long as the introduced gene contains some modification, e.g. an introduced mutation or the presence of a selectable marker gene, relative to the naturally-occurring gene.
- Foreign or exogenous genes may be genes found in nature that are inserted into a non-native organism, native genes introduced into a new location within the native host, or chimeric genes or genetic constructs.
- a “transgene” is a gene that has been introduced into the genome by a transformation procedure.
- the term “genetically modified” includes introducing genes into cells, mutating genes in cells and altering or modulating the regulation of a gene in a cell or organisms to which these acts have been done or their progeny.
- the present invention refers to elements which are operably connected or linked.
- "Operably connected” or “operably linked” and the like refer to a linkage of polynucleotide elements in a functional relationship.
- operably connected nucleic acid sequences are contiguously linked and, where necessary to join two protein coding regions, contiguous and in reading frame.
- a coding sequence is "operably connected to" another coding sequence when RNA polymerase will transcribe the two coding sequences into a single RNA. which if translated is then translated into a single polypeptide having amino acids derived from both coding sequences.
- the coding sequences need not be contiguous to one another so long as the expressed sequences are ultimately processed to produce the desired protein.
- m-acting sequence As used herein, the term "m-acting sequence”, “m-acting element” or “cix- regulatory region” or “regulatory region” or simi lar term shall be taken to mean any sequence of nucleotides which regulates the expression of the genetic sequence. This may be a naturally occurring cis-acting sequence in its native context, for example regulating a wheat SBEJIa or SBEIIb gene, or a sequence in a genetic construct which when positioned appropriately relative to an expressible genetic sequence, regulates its expression.
- Such a cis-regulatory region may be capable of activating, silencing, enhancing, repressing or otherwise altering the level of expression and/or cell-type-specificity and/or developmental specificity of a gene sequence at the transcriptional or post-transcriptional level.
- the cis-acting sequence is an activator sequence that enhances or stimulates the expression of an expressible genetic sequence, such as a promoter.
- an intron in the 5'-leader (UTR) of genes has been shown to enhance expression of genes in monocotyledonous plants such as wheat (Tanaka et al, 1990).
- Another type of cis-acting sequence is a matrix attachment region (MAR) which may influence gene expression by anchoring active chromatin domains to the nuclear matrix.
- MAR matrix attachment region
- vector is meant a nucleic acid molecule, preferably a DNA molecule derived, lor example, from a plasmid, bacteriophage or plant virus, into which a nucleic acid sequence may be inserted.
- the vector may also include a selection marker such as an antibiotic resistance gene that can be used for selection of suitable transformants, or sequences that enhance transformation of prokaryotic or eukaryotic (especially wheat) cells such as T-DNA or P-DNA sequences. Examples of such resistance genes and sequences are well known to those of skill in the art.
- marker gene is meant a gene that imparts a distinct phenotype to cells expressing the marker gene and thus allows such transformed cells to be distinguished from cells that do not have the marker, and are well known in the art.
- a “selectable marker gene” confers a trait for which one can ' select " based on resistance to a selective agent (e.g., a herbicide, antibiotic, radiation, heat, or other treatment damaging to untransfbrmed cells) or based on a growth advantage in the presence of a metabolizable substrate.
- Exemplary selectable markers for selection of plant transformants include, but are not limited to, a hyg gene which confers hygromycin B resistance; a neomycin phosphotransferase (npt) gene conferring resistance to kanamycin, paromomycin. G41 8 and the like as. for example, described by Potrykus et al .
- sulfonylurea or other ALS- inhibiting chemicals EP-A- 154204
- a mutated anthranilate synthase gene that confers resistance to 5-methyl tryptophan
- a dalapon dehalogenase gene that confers resistance to the herbicide.
- Preferred screenable markers include, but are not limited to, a uidA gene encoding a ⁇ -glucuronidase (GUS) enzyme for which various chromogenic substrates are known, a ⁇ - galactosidase gene encoding an enzyme for which chromogenic substrates are known, an aequorin gene (Prasher et al., 1985), which may be employed in calcium-sensitive bioluminescence detection; a green fluorescent protein gene (GFP, Niedz et al, 1 95) or one of its variants; a luciferase (luc) gene (Ow et al., 1 986). which allows for bioluminescence detection, and others known in the art.
- GUS ⁇ -glucuronidase
- luc luciferase
- the level of endogenous starch branching activity or other enzyme activity is modulated by decreasing the level of expression of genes encoding proteins involved in these activities in the wheat plant, or increasing the level of expression of a nucleotide sequence that codes for the enzyme in a wheat plant.
- Increasing expression can be achieved at the level of transcription by using promoters of different strengths or inducible promoters, which are capable of controlling the level of transcript expressed from the coding sequence.
- Heterologous sequences may be introduced which encode transcription factors that modulate or enhance expression of genes whose products down regulate starch branching.
- the level of expression of the gene may be modulated by altering the copy number per cell of a construct comprising the coding sequence and a transcriptional control element that is operably connected thereto and that is functional in the cell.
- a plurality of transformants may be selected, and screene.d for those with a favourable level and/or specificity of transgene expression arising from influences of endogenous sequences in the vicinity of the transgene integration site.
- a favourable level and pattern of transgene expression is one which results in a substantial increase in starch synthesis or amy lose content in the wheat plant. This may be detected by simple testing of transformants.
- Reducing gene expression may be achieved through introduction and transcription of a "gene-silencing chimeric gene" introduced into the wheat plant.
- the gene-silencing chimeric gene is preferably introduced stably into the wheat genome, preferably the wheat nuclear genome.
- gene-silencing effect refers to the reduction of expression of a target nucleic acid in a wheat cell, preferably an endosperm cell, which can be achieved by introduction of a silencing RNA.
- a gene- silencing chimeric gene is introduced which encodes an RNA molecule which reduces expression of one or more endogenous genes, preferably the SBEIIa and/or SBEJJb genes.
- Target genes in wheat also include the genes listed in Table 1. Such reduction may be the result of reduction of transcription, including via methylation of chromatin remodeling, or post-transcriptional modification of the RNA molecules, including via RNA degradation, or both. Gene-silencing should not necessarily be interpreted as an abolishing of the expression of the target nucleic acid or gene. It is su fficient that the level expression of the target nucleic acid in the presence of the silencing RNA is lower that in the absence thereof.
- the level of expression of the targeted gene may be reduced by at least about 40% or at least about 45% or at least about 50% or at least about 55% or at least about 60% or at least about 65% or at least about 70% or at least about 75% or at least about 80% or at least about 85% or at least about 90% or at least about 95% or effectively abolished to an undetectable level.
- Antisense techniques may be used to reduce gene expression in wheal cells.
- the term "antisense RNA” shall be taken to mean an RNA molecule that is complementary to at least a portion of a specific mRNA molecule and capable of reducing expression of the gene encoding the mRNA, preferably a SBEIIa and/or SBEIlb gene. Such reduction typically occurs in a sequence-dependent manner and is thought to occur by interfering with a post-transcriptional event such as mRNA transport from nucleus to cytoplasm. mRNA stability or inhibition of translation.
- the use of antisense methods is well known in the art (see for example. Hartmann and Endres. 1 999). Antisense methods are no a well established technique for manipulating gene expression in plants.
- dsRNA double-stranded RNA
- RNA interference is particularly useful for specifically reducing the expression of a gene or inhibiting the production of a particular protein, also in wheat (Regina et ciL. 2006). This technology relies on the presence of dsR A molecules that contain a sequence that is essentially identical to the mRNA of the gene of interest or part thereof, and its complement, thereby forming a dsRNA.
- the dsRNA can be produced from a single promoter in the host cell, where the sense and anti-sense sequences are transcribed to produce a hairpin RNA in which the sense and anti-sense sequences hybridize to form the dsRNA region with a related (to a SBEII gene) or unrelated sequence forming a loop structure, so the hairpin RNA comprises a stem-loop structure.
- the design and production of suitable dsRNA molecules for the present invention is wel l within the capacity of a person skilled in the art, particularly considering Waterhouse et al., 1998; Smith et al , 2000; WO 99/32619; WO 99/53050; WO 99/49029; and WO 01 /34815.
- the DNA encoding the dsRNA typically comprises both sense and antisense sequences arranged as an inverted repeat.
- the sense and antisense sequences are separated by a spacer region which may comprise an intron which, when transcribed into RNA, is spliced out. This arrangement has been shown to result in a higher efficiency of gene silencing (Smith et al., 2000).
- the double-stranded region may comprise one or two RNA molecules, transcribed from either one DNA region or two.
- the dsRNA may be classified as long hpRNA, having long, sense and antisense regions which can be largely complementary, but need not be entirely complementary (typically larger than about 200 bp, ranging between 200- 1000 bp).
- hpRNA can also be rather small with the double-stranded portion ranging in size from about 30 to about 42 bp, but not much longer than 94 bp (see WO04/073390).
- the presence of the double stranded RNA region is thought to trigger a response from an endogenous plant system that destroys both the double stranded RNA and also the homologous RNA transcript from the target plant gene, efficiently reducing or eliminating the activity of the target gene.
- the length of the sense and antisense sequences that hybridise should each be at least 19 or at least 21 contiguous nucleotides, preferably at least 30 or 50 nucleotides, and more preferably at least 100, 200, 500 or 1000 nucleotides.
- the full-length sequence corresponding to the entire gene transcript may be used. The lengths are most preferably 100-2000 nucleotides.
- the degree of identity of the sense and antisense sequences to the targeted transcript should be at least 85%, preferably at least 90% and more preferably 95- 100%. The longer the sequence, the less stringent the requirement for the overall sequence identity.
- the RNA molecule may of course comprise unrelated sequences which may function to stabilize the molecule.
- the promoter used to express the dsRNA-forming construct may be any type of promoter that is expressed in the cells which express the target gene.
- the target gene is SBEIIa or SBEIlb or other gene expressed selectively in the endosperm
- an endosperm promoter is preferred, so as to not affect expression of the target gene(s) in other tissues.
- Example 4 Examples of dsRNA molecules that may be used to down-regulate SBEI1 gene(s) are provided in Example 4.
- RNA molecules that have 21 to 24 contiguous nucleotides that are complementary to a region of the mRNA transcribed from the target gene, preferably SBEIIa or SBEIlb.
- the sequence of the 21 to 24 nucleotides is preferably fully complementary to a sequence of 21 to 24 contiguous nucleotides of the mRNA i.e. identical to the complement of the 21 to 24 nucleotides of the region of the mRNA.
- miRNA sequences which have up to five mismatches in region of the mRNA may also be used (Palatnik et ah .
- bascpairing may involve one or two G-U basepairs.
- the 21 to 24 nucleotides of the silencing RNA are able to basepair with the mRN A, it is preferred that there are only one or two mismatches between the 21 to 24 nucleotides of the silencing RNA and the region of the mRNA.
- the miRNAs it is preferred that any mismatches, up to the maximum of li ve, are found towards the 3' end of the miRNA.
- Silencing RNAs derive from longer RNA molecules that are encoded by the chimeric DN As of the invention.
- the longer RNA molecules also referred to herein as “precursor RNAs” are the initial products produced by transcription from the chimeric DNAs in the wheat cells and have partially double-stranded character formed by intramolecular basepairing between complementary regions.
- the precursor RNAs are processed by a specialized class of RNAses. commonly called “Dicer(s)". into the silencing RNAs. typically of 21 to 24 nucleotides long.
- Silencing RNAs as used herein include short interfering RNAs (siRNAs) and microRNAs (miRNAs), which differ in their biosynthesis.
- SiRNAs derive from fully or partially double-stranded RNAs having at least 21 contiguous basepairs, including possible G-U basepairs, without mismatches or non-basepaired nucleotides bulging out from the double-stranded region.
- These double-stranded RNAs are formed from either a single, self-complementary transcript which forms by folding back on itself and forming a stem-loop structure, referred to herein as a "hairpin RNA", or from two separate RNAs which are at least partly complementary and that hybridize to form a double-stranded RNA region.
- MiRNAs are produced by processing of longer, single- stranded transcripts that include complementary regions that are not fully complementary and so form an imperfectly basepaired structure, so having mismatched or non-basepaired nucleotides within the partly double-stranded structure.
- the basepaired structure may also include G-U basepairs.
- Processing of the precursor RNAs to form miRNAs leads to the preferential accumulation of one distinct, small RNA having a specific sequence, the miRNA. It is derived from one strand of the precursor RNA, typically the "antisense" strand of the precursor RNA, whereas processing of the long complementary precursor RNA to form siRNAs produces a population of siRNAs which are not uniform in sequence but correspond to many portions and from both strands of the precursor.
- MiRNA precursor RNAs of the invention are typically derived from naturally occurring miRNA precursors by altering the nucleotide sequence of the miRNA portion of the naturally-occurring precursor so that it is complementary, preferably fully complementary, to the 21 to 24 nucleotide region of the target mRNA, and altering the nucleotide sequence of the complementary region of the miRNA precursor that basepairs to the miRNA sequence to maintain basepairing.
- the remainder of the miRNA precursor RNA may be unaltered and so have the same sequence as the naturally occurring miRNA precursor, or it may also be altered in sequence by nucleotide substitutions, nucleotide insertions, or preferably nucleotide deletions, or any combination thereof.
- the remainder of the miRNA precursor RNA is thought to be involved in recognition of the structure by the Dicer enzyme called Dicer-like 1 (DCL l ), and therefore it is preferred that few if any changes are made to the remainder of the structure.
- DCL l Dicer-like 1
- basepaired nucleotides may be substituted for other basepaired nucleotides without major change to the overall structure.
- the naturally occurring miRNA precursor from which the artificial miRNA precursor of the invention is derived may be from wheat, another plant such as another cereal plant, or from non-plant sources.
- Examples of such precursor RNAs are the rice mi395 precursor, the Arabidopsis mi 159b precursor, or the mi l 72 precursor.
- co-suppression Another molecular biological approach that may be used is co-suppression.
- the mechanism of co-suppression is not well understood but is thought to involve post- transcriptional gene silencing (PTGS) and in that regard may be very similar to many examples of antisense suppression. It involves introducing an extra copy of a gene or a fragment thereof into a plant in the "sense orientation" with respect to a promoter for its expression, which as used herein refers to the same orientation as transcription and translation (if it occurs) of the sequence relative to the sequence in the target gene.
- the size of the sense fragment, its correspondence to target gene regions, and its degree of homology to the target gene are as for the antisense sequences described above.
- the antisense, co-suppression or double stranded RNA molecules may also comprise a largely double-stranded RNA region, preferably comprising a nuclear localization signal, as described in WO 03/076619.
- RNA molecules can be targeted against a family of related genes by targeting a region of the genes which is in common.
- unrelated genes may be targeted by including multiple regions in one RNA molecule, each region targeting a different gene. This can readily be done by fusing the multiple regions under the control of a single promoter.
- transformation means alteration of the genotype of a cell, for example a bacterium or a plant, particularly a wheat plant, by the introduction of a foreign or exogenous nucleic acid.
- transformant is meant an organism so altered, introduction of DNA into a wheat plant by crossing parental plants or by mutagenesis per se is not included in transformation.
- transgene is meant a foreign or exogenous gene or sequence thai is introduced into a plant.
- the nucleic acid molecule may be replicated as an extrachromosomal element or is preferably stably integrated into the genome of the plant.
- genome is meant the total inherited genetic complement of the cell, plant or plant part, and includes chromosomal DNA, plastid DNA, mitochondrial DNA and extrachromosomal DNA molecules.
- a transgene is integrated in the wheat nuclear genome which in hexaploid wheat includes the A, B and D subgenomes, herein referred to as the A, B and D "genomes”.
- Transformed wheat plants can be produced by introducing a nucleic acid construct according to the invention into a recipient cell and growing a new plant that comprises and expresses .a polynucleotide according to the invention.
- the process of growing a new plant from a transformed cell which is in cell culture is referred to herein as "regeneration" .
- Regenerable wheat cells include cells of mature embryos, meristematic tissue such as the mesophyll cells of the leaf base, or preferably from the scutella of immature embryos, obtained 12-20 days post-anthesis, or callus derived from any of these.
- the most commonly used route to recover regenerated wheat plants is somatic embryogenesis using media such as MS-agar supplemented with an auxin such as 2,4-D and a low level of cytokinin, see Sparks and Jones , 2004).
- Agrobacterium-mQd ' vdiQd transformation of wheat may be performed by the methods of Cheng et ai , 1997; Weir et al,, 2001 ; Kanna and Daggard, 2003 or Wu et ai, 2003.
- Any Agrohacterium strain with sufficient virulence may be used, preferably strains having additional virulence gene functions such as LBA4404, AGL0 or AGL 1 (Lazo et ai , 1991 ) or versions of C58.
- Bacteria related to Agrohacterium may also be used.
- the DNA that is transferred (T-DNA) from the Agrobacterium to the recipient wheat cells is comprised in a genetic construct (chimeric plasmid) that contains one or two border regions of a T-DNA region of a wild-type Ti plasmid Hanking the nucleic acid to be transferred.
- the genetic construct may contain two or more T-DNAs, for example where one T-DNA contains the gene of interest and a second T-DNA contains a selectable marker gene, providing for independent insertion of the two T-DNAs and possible segregation of the selectable marker gene away from the transgene of interest.
- Any wheat type that is regenerablc may be used; varieties Bob White. Fielder, Veery-5, Cadenza and Florida have been reported with success. Transformation events in one of these more readily regenerable varieties may be transferred to any other wheat cultivars including elite varieties by standard backcrossing.
- An alternative method using Agrobacterium makes use of an in vivo inoculation method followed by regeneration and selection of transformed plants using tissue culture and has proven to be efficient, see WO00/63398.
- Agrobacterium Other methods involving the use of Agrobacterium include: co-cultivation of Agrobacierium with cultured isolated protoplasts; transformation of seeds, apices or meristems with Agrobacterium, or inoculation in planta such as the floral-dip method for Arabidopsis as described by Bechtold et ⁇ r//., 1993. This latter approach is based on the vacuum infiltration of a suspension of Agrobacterium cells.
- the chimeric construct may be introduced using root-inducing ( i) plasm ids of Agrobacierium as vectors.
- nucleic acid construct Another method commonly used for introducing the nucleic acid construct into a plant cell is high velocity ballistic penetration by small particles (also known as particle bombardment or microprojeclile bombardment) with the nucleic acid to be introduced contained either within the matrix of small beads or particles, or on the surface thereof as. for example described by Klein et ai, 1987.
- small particles also known as particle bombardment or microprojeclile bombardment
- Preferred selectable marker genes for use in the transformation of wheat include the Streptomyces hygroscopicus bar gene or pat gene in conjunction with selection using the herbicide glufosinate ammonium, the hpt gene in conjunction with the antibiotic hygromycin, or the nptll gene with kanamycin or G41 8.
- positively selectable markers such as the manA gene encoding phosphomannose isomerase ( ⁇ ) with the sugar mannose-6-phosphate as sole C source may be used.
- the synthesis of starch in tlie endosperm of higher plants including wheat is carried out by a suite of enzymes that catalyse four key steps.
- ADP-glucose pyrophosphorylase (EC 2.7.7.27) activates the monomer precursor of starch through the synthesis of ADP-glucose from G- l -P and ATP. Secondly, the activated glucosyl donor. ADP-glucose, is transferred to the non-reducing end of a pre-existing . 1 -4) linkage by starch synthases (EC 2.4.1 .24). Thirdly, starch branching enzymes introduce branch points through the cleavage of a region of D( l -4) linked glucan followed by transfer of the cleaved chain to an acceptor chain, forming a new DQ -6) linkage.
- Starch branching enzymes are the only enzymes that can introduce the a( l -6) linkages into a-polyglucans and therefore play an essential role in the formation of amylopectin. Fourthly, starch debranching enzymes (EC 2.4.4. 18) remove some of the branch linkages.
- Starch is the major storage carbohydrate in plants such as cereals, including wheat. Starch is synthesized in the amyloplasts and formed and stored in granules in the developing storage organ such as grain; it is referred to herein as “storage starch” or “grain starch” . In cereal grains, the vast majority of the storage starch is deposited in the endosperm. "Starch” is defined herein as polysaccharide composed of glucopvranose units polymerized through a combination of both a( l -4) and o.( l -6) linkages.
- the polydispcrse molecules of starch are classified as belonging to two component fractions, known as amylose and amylopectin, on the basis of their degree of polymerization (DP) and the ratio of ot( l -6) to a(l -4) linkages.
- Grain starch from wild-type cereal plants, including from wheat, comprises about 20%-30% of amylose and about 70%-80% of amylopectin.
- Amylose is defined herein as including essentially linear molecules of a( l ,4) linked glucosidic (glucopyranose) units, sometimes referred to as “true amylose”. and amylose-likc long-chain starch which is sometimes referred to as “intermediate material” or "amylose-like amylopectin” which appears as iodine-binding material in an iodometric assay along with true amylose (Takeda et a ⁇ ., 1993b; Fergason. 1994).
- the linear molecules in true amylose have a DP of between 500 and 5000 and contain less than 1 % a( l -6) linkages.
- amylopectin is a much larger molecule with a DP ranging from 5000 to 50,000 and contains 4-5% oc( l -6) linkages. Amylopectin molecules are therefore more highly branched. Amylose has a helical conformation with a molecular weight of about 1 () 4 to about 10 6 Daltons while amylopectin has a molecular weight of about 10 7 to about 1 () Daltons.
- the proportion of amylose in the starch as defined herein is on a weight/weight (w/w) basis, i.e. the weight of amylose as a percentage of the weight of total starch extractable from the grain, with respect to the starch prior to any fractionation into amylose and amylopectin fractions.
- the terms "proportion of amylose in the starch” and "amylose content" when used herein in the context of the grain, flour or other product of the invention are essentially interchangeable terms.
- Amylose content may be determined by any of the methods known in the art including size exclusion high-performance liquid chromatography (HPLC), for example in 90% (w/v) DMSO.
- HPLC method may involve debranching of the starch (Batey and Curtin, 1996) or not involve debranching. It will be appreciated that methods such as the HPLC method of Batey and Curtin, 1996 which assay only the "true amylose” may underestimate the amylose content as defined herein. Methods such as HPLC or gel permeation chromatography depend on fractionation of the starch into the amylose and amylopectin fractions, while iodometric methods depend on differential iodine binding and therefore do not require fractionation.
- the amount of amylose deposited per grain can be calculated and compared for test and control lines.
- starch branching enzyme means an enzyme that introduces a- 1 ,6 glycosidic bonds between chains of glucose residues (EC 2.4. 1.18).
- starch branching enzyme 1 SBEI
- starch branching enzyme Ha SBEIIa
- starch branching enzyme lib SBElIb
- Genomic and cDNA sequences for genes encoding these enzymes have been characterized for rice, barley and wheat (Table 1 ). Sequence alignment reveals a high degree of sequence similarity at both the nucleotide and amino acid levels, but also the sequence differences and allows the grouping into the SBEI, SBElla and SBFlIb classes. SBElla and SBEIlb from any one species generally exhibit around 80% amino acid sequence identity to each other, particularly in the central regions of the genes. SBEIIa and SBEIlb may also be distinguished by their expression patterns, but this di ffers in different species. In maize, SBEIIb is most highly expressed in endosperm while SBEIIa is present in every tissue of the plant.
- both SBEIIa and SBEIIb are present in about equal amounts in the endosperm, while in wheat endoperm, SBEI Ia is expressed about 3-4-fold more highly than SBEIIb. Therefore, the cereal species show significant differences in SBEIIa and SBEIIb expression, and conclusions drawn in one species cannot readily be applied to another species.
- SBEIIa and SBEIIb proteins are different in size (see below) and this is a convenient way to distinguish them. Specific antibodies may also be used to distinguish them.
- Starch branching enzyme (SBE) activity may be measured by enzyme assay, for example by the phosphorylase stimulation assay (Boyer and Preiss. 1978). This assay measures the stimulation by SBE of the incorporation of glucose 1 -phosphate into methanol-insoluble polymer (ot-D-glucan) by phosphorylase A. SBE activity can be measured by the iodine stain assay, which measures the decrease in the absorbency of a glucan-polyiodine complex resulting from branching of ' glucan polymers. SBE activity can also be assayed by the branch linkage assay which measures the generation of reducing ends from reduced amylose as substrate, following isoamylose digestion (Takeda et al.
- the activity is measured in the absence of SBEI activity, [so forms of SBE show different substrate specificities, for example SBEI exhibits higher activity in branching amylose, while SBEI la and S BEIIb show higher rates of branching with an amylopeetin substrate.
- the isoforms may also be distinguished on the basis of the length of the glucan chain that is transferred.
- SBE protein may also be measured by using specific antibodies such as those described herein.
- the SBE1I activity may be measured during grain development in the developing endosperm. Alternatively, SBEII levels are measured in the mature grain where the protein is still present and can be assayed by immunological methods.
- the level or activity of SBEII or SBEIIa may be assessed by assessing transcript levels such as by Northern or RT-PCR analysis.
- the amount of SBEIIa protein in grain or developing endosperm is measured by separating the proteins in extracts of the grain/endosperm on gels by electrophoresis, then transferring the proteins to a membrane by Western blotting, followed by quantitative detection o f the protein on the membrane using specific antibodies ('"Western blot analysis"). This is exemplified in Example 1 1 .
- Starch was isolated on small scale from both developing and mature wheat grain using the method of Regina et ciL . (2006). Earge scale starch extraction was carried out following the method of Regina et ai , (2004). Starch content was determined using the total starch analysis kit supplied by Megazyme (Bray, Co Wicklow, Republic of Ireland) and calculated on a weight basis as a percentage of the mature, unmilled grain weight. The starch content was then compared to control plants. Subtraction of the starch weight from the total grain weight to give a total non- starch content of the grain determined whether the reduction in total weight was due to a reduction in starch content.
- amylose content of starch samples was determined by the colorimetric (iodometric) method of Morrison and Laignelet ( 1983) with slight modifications as follows. Approximately 2 mg of starch was weighed accurately (accurate to 0. 1 mg) into a 2 ml screw-capped tube fitted with a rubber washer in the lid. To remove lipid, 1 ml of 85% (v/v) methanol was mixed with the starch and the tube heated in a 65°C water bath for 1 hour with occasional vortexing. After centrifugation at 13.000g for 5 min, the supernatant was carefully removed and the extraction steps repeated.
- the starch was then dried at 65°C for 1 hour and dissolved in urea-dimethyl sulphoxide solution (UDMSO; 9 volumes of dimethyl sulphoxide to 1 volume of 6 M urea), using 1 ml of IJDMSO per 2 mg of starch (weighed as above).
- UDMSO urea-dimethyl sulphoxide solution
- IJDMSO urea-dimethyl sulphoxide solution
- the absorbance of the mixture at 620 nm was measured by transferring 200 ⁇ to microplate and reading the absorbance using an Emax Precision Microplate Reader (Molecular Devices, USA). Standard samples containing from 0 to 100% amylose and 100% to 0% amylopectin were made from potato amylose and corn (or potato) amylopectin (Sigma) and treated as for the test samples. The amylose content (percentage amylose) was determined from the absorbance values using a regression equation derived from the absorbances for the standard samples. Analysis of the amylose/amylopectin ratio of non-debranched starches may also be carried out according to Case et al. , ( 1998) or by an HPLC method using 90% DMSO for separating debranched starches as described by Batey and Curtin, ( 1996).
- the parameters measured included peak viscosity (the maximum hot paste viscosity), holding strength, final viscosity and pasting temperature.
- the swelling volume of flour or starch was determined according to the method of Ko.nik-R.ose et al.. (2001 ).
- the uptake of water was measured by weighing the sample prior to and after mixing the flour or starch sample in water at defined temperatures and following collection of the gelatinized material.
- Starch granule morphology was analysed by microscopy. Puri fied starch granule suspensions in water were examined under both normal and polarized light using a Leica- DMR compound microscope to determine the starch granule morphology. Scanning electron microscopy was carried out using a Joel .ISM 35C instrument. Purified starches were sputter-coated with gold and scanned at 15kV al room temperature.
- ⁇ -Glucan levels were determined using the kit supplied by Megazyme (Bray. Co. Wicklow, Republic of Ireland).
- the ground samples were centrifuged for 10 min at 13,000g and the supernatant aliquoted and frozen at -80°C until use.
- a BSA standard curve was set up using 0, 20. 40, 60, 80 and 100 ⁇ aliquots of 0.25 mg/ml BSA standard.
- the samples (3 ⁇ 1) were made up to ⁇ ⁇ with distilled water and 1 ml of Coomassie Plus Protein reagent was added to each.
- the absorbance vvas read after 5 min at 595nm, using the zero BSA sample from the standard curve as the blank, and the protein levels in the samples determined.
- Antiserum against wheat SBElla protein was generated using a synthetic peptide having the amino acid sequence of the N-terminal sequence of mature wheat SBEIIa, AASPGKVLVPDGESDDL (SEQ ID NO: 16) (Rahman et al.., 2001 ).
- Antiserum against wheat SBEIIb was generated in an analogous manner using the N-terminal synthetic peptide, AGGPSGEVMI (SEQ ID NO: 17) (Regina el al:, (2005).
- This peptide was thought to represent the N-terminal sequence of the mature SBEIIb peptide and furthermore was identical to the N-terminus of the barley SBEIIb protein (Sun et al. , 1998).
- a polyclonal antibody against wheat SBEI was synthesised in an analogous manner using the N-terminal synthetic peptide VSAPRDYTMATAEDGV (SEQ I D NO: 18) (Morell et al., 1997).
- Such antisera were obtained from rabbits immunised with the synthetic peptides according to standard methods.
- Enzyme assay for SBE Enzyme activity assays of branching enzymes to delect the activity of all three isoforms, SBEI, SBEIIa and SBEIIb was based on the method of Nishi et al., 2001 with minor modification. After electrophoresis, the gel was washed twice in 50 mM HEPES, pH 7.0 containing 10% glycerol and incubated at room temperature in a reaction mixture consisting of 50mM HEPES, pi J 7.4, 50 mM glucose- 1 -phosphate. 2.5 mM AMP, 10% glycerol, 50 U phosphorylase a I mM DTT and 0.08% mallotriose for 1 6 h.
- the bands were visualised with a solution of 0.2% (VV/V) I : and 2% I.
- the SBEI. SBEIIa and SBEIIb isoform specific activities were separated under these conditions of > electrophoresis. This was confirmed by immunoblotting using anti-SBEI, anti-SBEl Ia and anti-SBEIlb antibodies. Densitometric analysis of immunoblots using TolalLab software package (Nonlinear Dynamics Ltd, Newcastle, UK) which measures the intensity of each band was conducted to determine the level of enzyme activity of each isoform.
- Starch branching enzyme (SBE) activity may be measured by enzyme assay, for example by the phosphorylase stimulation assay (Boyer and Preiss, 1978 ). This assay measures the stimulation by SBE of the incorporation of glucose 1 -phosphate into methanol-insoluble polymer (a-D-glucan) by phosphorylase A. Activity of specific isoforms of SBE can be measured by this assay following purification of individual isoforms as described in Regina et al., 2004. The total soluble protein extracts were applied to a 3ml ⁇ -cyclodextrin ( ⁇ -CD) affinity column pre-equilibrated with the extraction buffer described above.
- ⁇ -CD 3ml ⁇ -cyclodextrin
- the column was prepared by coupling ⁇ -CD to Epoxy-activated sepharose 6B (Amersham Biosciences. Uppsala, Sweden) following the manufacturer ' s instructions.
- the bound proteins (containing SBEs) were eluted using 1 % ⁇ -CD in Phosphate buffer and then dialysed against buffer A (20 mM phosphate buffer, pi I 8.0. 1 mM ED TA and 1 mM DTT).
- the dialysed samples were subjected to anion exchange chromatography using a 1 ml MonoQ column (Amersham Pharmacia), pre-equilibrated with buffer A.
- buffer B 500 mM Phosphate buffer, pH 8.0, 1 mM EDTA, 1 mM DTT
- SBE activity can also be measured by the iodine stain assay, which measures the decrease in the absorbency of a glucan-polyiodine complex resulting from branching of glucan polymers.
- SBE activity can also be assayed by the branch linkage assay which measures the generation of reducing ends from reduced amy lose as substrate, fol lowing isoamylase digestion (Takeda el al , 1993a).
- the activity is measured in the absence of SBE1 activity.
- Iso forms of SBE show different substrate specificities, for example SBEI exhibits higher activity in branching amylose, while SBEI la and SBEIIb show higher rates of branching with an amylopectin substrate.
- the isoforms may also be distinguished on the basis of the length of the glucan chain that is transferred.
- SBE protein may also be measured by using specific antibodies such as those described herein.
- the SBEII activity is measured during grain development in the developing endosperm.
- SBEII protein levels are preferably measured in the mature grain where the protein is still present by immunological methods such as Western blot analysis.
- PCR analysis of transformed wheat plants or of plants to be tested for the presence of transgencs was performed on genomic DNA extracted from 1 -2 cm 2 of fresh leaf material using the mini-prep method described by Stacey and Isaac, (1994).
- PCR assays to determine the presence of the hairpin RNA constructs used the primers SBEIla-l or: 5 -CCCGC TGCTTTCGC TCA TTTTG-3' (S Q ID NO: 19) and SBEIJa-Rev; 5*-GACTACCGGAGCTCCCACCTTC-3' (SEQ ID NO: 20) designed to amplify a fragment (462bp) from the SBEIla gene.
- Reaction conditions were as follows: "hot start” (94°C, 3 min) followed by 30 cycles of denaturation (95°C, 30 sec), annealing (55°C, 30 sec), extension (73°C, 2 min) followed by 1 cycle at 73°C (5 min).
- Reaction products were analysed by agarose or polyacrylamide gel electrophoresis. [0310J Southern blot hybridization analysis was performed on DNA from a larger scale (9 ml) extraction from lyophilized ground tissue (Stacey and Isaac, 1994). DNA samples were adjusted to 0.2 mg/ml and digested with restriction enzymes such as /7 wdIIl, EcoRl and Kpnl.
- TSIM 1 MS media with 100 mg/1 myo-inositol, 10 g/1 glucose, 50 mg/1 MES buffer pH5.5
- TSIM 1 MS media with 100 mg/1 myo-inositol, 10 g/1 glucose, 50 mg/1 MES buffer pH5.5
- 400 mM acetosyringone to an optical density of 2.4 at 650 nm for wheat inoculation.
- Wheat plants (variety NB 1 , a Spring wheat variety obtained from Nickerson Seeds Ltd, Rothwell, Lines.) were grown in a glasshouse at 22/ 15°C day/night temperature with supplemented light to give a 16 hour day. ' fillers were harvested approximately 14 days post-anthesis (embryos approximately 1 mm in length) to include 50 cm tiller stem. All leaves were then removed from the tillers except the flag leaf, which was cleaned to remove contaminating fungal spores. The glumes of each spikelet and the lemma from the first two florets were then carefully removed to expose the immature seed. Generally, only these two seed in each spikelet were uncovered. This procedure was carried out along the entire length of the inflorescence. The ears were then sprayed with 70% IMS as a brief surface sterilization.
- Agrobacterium suspensions ( ⁇ ⁇ ) were inoculated using a 10 ⁇ Hamilton syringe into the immature seed approximately at the position of the scutellunrendosperm interface so that all exposed seed were inoculated.
- the tillers were then placed in water, covered with a translucent plastic bag to prevent seed dehydration, and placed in a lit incubator for 3 days at 23°C, 16 hr day, 45 ⁇ Em ' V'PAR. .
- the inoculated immature seed were removed and surface sterilized with 70% ethanol (30 sec), then 20% bleach (Domestos, 20 min), followed by thorough washing in sterile distilled water.
- Immature embryos were aseptically isolated and placed on W3 media (MS supplemented with 20 g/1 sucrose and 2 mg/1 2.4-D and solidified with 6 g/1 Type 1 agarose, Sigma) with the addition of 150mg/ l Timentin (W3T medium) and with the scutellum uppermost (20 embryos per plate). Cultures were placed at 25°C in the light ( 16 hour day, 80 / ⁇ Em " V ' PAR). The development of the embryonic axis on the embryos was assessed about 5 days after isolation and the axis was removed where necessary to improve callus production. The embryos were maintained on W3T for 4 weeks, with a transfer to fresh media at 2 weeks post-isolation and assessed for embryogenic capacity.
- callus derived from the inoculated embryos was very similar to control callus obtained from uninoculated embryos plated on W3T medium. Presence of the bacteria did not appear to have substantially reduced the embryogenic capacity of the callus derived from the inoculated embryos.
- Embryogenic calli were transferred to W3 media with 2 mg/1 Asulam or geneticin at 25 mg/1 and 150mg/l Timentin (W32AT medium). Calli were maintained on this media for a further 2 weeks and then each callus was divided into 2 mm-sized pieces and re-plated onto W32AT. Control embryos derived from inoculations with the LBA4404 without binary vector constructs did not produce transformed callus on selection media.
- dsRNA constructs were made to reduce the expression of i) the SBElla, or ii) the SBElla.
- SBElIb and SBEI genes of wheat were linked to a high molecular weight glute in ( I IMWG) promoter sequence obtained from a wheat Dx5 gene to provide endosperm-specific expression of the hairpin RNA, and a transcription terminator sequence from the nopaline synthase gene from Agrohacterium (nos3'). This promoter provided for endosperm- specific expression of the synthetic genes encoding the hairpin -RNAs.
- hp5'-SBEIIa The construction and use of the first of the constructs, designated as hp5'-SBE[Ia, is described in Regina et ai, (2006).
- the hp5'-SBEHa construct contained 1536bp of nucleotide sequence amplified by PCR from the wheat SBElla gene (GenBank Accession number AF33843 1 ).
- Fragments 1 , 2 and 3 were then ligated so that the sequence of fragment 3 was ligated to fragment 2 in the antisense orientation relative to fragment 1 .
- the hairpin RNA constructs were initially generated in the vector pDVO3()()0 which contains the H WG promoter sequence and nos.3' terminator.
- the SBElla construct designated hpc-SBElla comprised a 293 base- pair DNA fragment corresponding to nucleotides 1255 to 1547 of the SBElla cDNA (GenBank Accession No. AF338432.1 ), which corresponds to part of exon 12, exons 13 and 14 and part of exon 15 of the SBElla gene.
- This region of SBElla was chosen because it had only about 81 % identity to the nucleotide sequence of the corresponding region of SBEIIb cDNA, thus increasing the chance of specificity of silencing of SBElla but not SBEIIb.
- hp3 '-SBElla The SBEIIa construct designated hp3'-SBEIIa comprised a 1 30 base- pair DNA fragment corresponding to nucleotides 2305 to 2434 of the SBEIIa cDNA, corresponding to part of exon 21 , exon 22 and part of the 3' untranslated region (3 * UTR) of the SBEIIa gene.
- hp-combo The hairpin RNA construct designated hp-combo comprised regions of the wheat SBEl gene in addition to parts of the SBEIIa gene, and contained i ) a 41 7 base- pair sequence corresponding to nucleotides 1 756 to 2172 from the SBEIIa cDNA. corresponding to part of exon 1 6, exons 17 to 19, and part of exon 20. and ii) a 357 base- pair sequence corresponding to nucleotides 267 to 623 of an SBEl cDNA (GenBank Accession No. AF076679), corresponding to part of exon 3, exon 4, and part of exon 5 of the SBEl gene.
- the SBEIIa gene fragment had about 86%) identity to the corresponding region of the SBEIIb gene, including several regions of 23 consecutive nucleotides with 100% identity to their corresponding regions of SBEIIb. and therefore the combination construct was designed with the expectation that it would reduce expression of the genes encoding SBEIIb as well as the genes encoding SBEIIa and SBEl in wheat.
- PGR reactions were designed to amplify a fragment of about 462bp from the SBElIa gene. Reaction conditions were as follows: "hot start” (94°C, 3 min) followed by 30 cycles of denaturation (95°C. 30 sec), annealing (55°C, 30 sec) and extension (73°C, 2 min), followed by 1 cycle at 73°C (5 min).
- Starch granule morphology The morphology of starch granules from mature T l seed obtained from the TO transformed wheat plants was observed by light microscopy, fen individual grains from each of 25 TO hp5'-SBEHa plants were analysed. Each endosperm was gently crushed to release the starch granules which were dispersed in water and visualized under a light microscope. Of the 25 lines analysed, 12 had grains with distorted granules although the visual observation revealed varying levels of distortion in different seeds.
- [0326J Protein expression by Western blotting in developing endosperm Four to seven T2 developing endosperms from T l transgenic lines were analysed for the level of SBEIIa and SBEIIb proteins by Western blotting using anti-SBEIIa and anti-SBEIlb antibodies, respectively. In the case of hp-combo lines, SBEI expression was also analysed using anti- SBE1 antibody. Total SBEII protein levels (SBEIIa and SBEIIb) from selected transgenic lines were calculated as a percentage of the level in the wild-type (variety NB 1 ) and is shown in Table 1 1 .
- Amylose levels in mature grain from the transgenic lines was also determined (Table 1 1 ) using an iodometric method as described in Example 1 . This is represented graphically in Figure 5.
- a range of expression levels of SBEIIa and SBEJIb were obtained in the grain of the transgenic plants of independent lines. Such a range is normally expected in transgenic lines obtained with any one construct, due to the variation in integration sites of the transgene in different transgenic events, commonly referred to as "position effect". The range of expression levels seen in these experiments was extended because it was observed that the four constructs were not equally eflicient in reducing the expression of the SBEIIa and SBEIIb genes.
- the exons 12 to 14 region oi SBEIla was amplified from the hexaploid wheat variety Chara using the primers AR2aE12F()7 (5'-CATTCGTCAAATAATACCCTTGACGG-3' (SEQ ID NO: 21 )) and AR2aE 14R07 (5'-CTTCACCAATGGATACAGCATCAG-3' (SEQ ID NO: 22)).
- AR2aE 12F()7 5'-CATTCGTCAAATAATACCCTTGACGG-3' (SEQ ID NO: 21 )
- AR2aE 14R07 5'-CTTCACCAATGGATACAGCATCAG-3' (SEQ ID NO: 22)
- This yielded a PGR product of about 656bp which was presumed to be a mixture of the ampli fied fragments from each of the three homoeologous genes.
- This product was sequenced following cloning in a ⁇ vector. Three polymorphic sequences were obtained that covered the region between exon
- the intron 3 region of SBEIla was amplified from two hexaploid wheat varieties, Sunco and Tasman, using the primer pair AR2akpnlF ( 5'- GGTACCGGCAAATATACGAG ATTGACCCG-3' (SEQ ID NO: 23)) and AR2aSacIR (S'-GAGCTCCCACCTTCATGTT GGTCAATAGC-3' (SEQ ID NO: 24)).
- Three polymorphic sequences were obtained from each of Sunco and Tasman ( Figure 8).
- the sequences Tasman 0257 and Sunco 0242 were assigned to the D genome.
- Tasman 0272 and Sunco 0241 sequences were assigned to the B genome based on mapping a polymorphic marker based on a single nucleotide polymorphism in a segregating population.
- the sequences Tasman 0264 and Sunco 0243 appeared to be different from the B and D genome sequences and it was concluded they must be from the A genome. Genotype specific polymorphisms were also observed for this region of SBElla between Sunco and Tasman in each of the three genomes.
- the exon 1 region of SBElla from CS was amplified using the primers AR2aexonl F (5'-CACACGTTGCTCCCCCTTCTC-3' (SEQ ID NO: 29)) and AR2aexonl R (5'-GAGAGGAGTCCTTCTTCCTGAGG r 3' (S Q ID NO: 28)).
- the sequences were obtained ( Figure 10). Alignment with SBEII GenBank accessions led to assigning the sequence CS exon l to the B genome (100% homology to FM865435).
- CS exon 1 b to the A genome (99% homology to Y l 1282.1 ) and CS exon l c to the D genome (100% homology to AF338431 .1 ).
- SBElla gene sequences were also obtained from the diploid progenitors or relatives of breadwheat, Triticum urartu which is thought to be the A genome progenitor of breadwheat, Aegilops speltoides (also known as Triticum speltoides) which is thought to be the B genome progenitor, and Aegilops Wilmingtonii which is thought to be related closely to the D genome progenitor.
- Gene fragments were obtained from these species as follows: Ten primers were designed based on the nucleotide sequence of the SBElla gene of the D genome (Accession No. AF338432) or its complement and covering the whole of that sequence.
- primer sets were used to amplify fragments of the SBEl la genes of diploid species by PCR.
- 16 combinations were used in PC lis with DNA from the diploid species T. urarlu (AA genome).
- 35 fragments were selected from these amplifications which were of sufficient quality for sequencing, to determine their nucleotide sequences.
- the sequences will be compared and edited using Contig Express and combined sequences determined for the progenitor SBEIIa genes from the diploids. Polymorphisms such as SNPs or insertions/deletions will be identified which can be used to distinguish the genes on the A, B and D genomes, and specific primers designed using Amplifier for identification of mutants.
- nucleotide sequence of the exon 1 1 -22 region of the SBEIIa gene from T. warm is shown in SEQ ID NO: 1 3, of the exons 3-8 as SEQ ID NO: 1 5 and of exons 1 -3 as SEQ ID NO: 14.
- the nucleotide sequence of the entire SBEIIa gene of A. tauschii is provided in WO2005001098 (incorporated herein by reference).
- SBEIIa and SBEIIb- genetic linkage of SBEIIa and SBEIIb in wheat were both located on the long arm of wheat chromosome 2 (Regina et al., 2005; Rahman et al.. 2001 ) and based on these reports were thought to be linked, although it was not known exactly how close the linkage was.
- Genetic mapping of the SBEIIa and SBEIIb genes was carried out using a segregating population obtained from a 4-way cross involving the parental cultivars Baxter. Yitpi. Chara and Westonia.
- BACl was shown to contain a SBElIa gene by partial direct sequencing and BAC3 appeared to contain portions of both of the SBEIIa and SBEIIb genes as shown by PCR. This indicated how closely the two genes are physically linked. BAC l and BAC3 will be fully sequenced. This physical data confirmed the close genetic linkage.
- deletion mutants created by agents such as radiation which affected one of the genes were likely to extend into or across both genes i.e. be null for both genes: Furthermore, this suggested to us the possibility that such deletion mutants might be viable and have wild-type fitness. At least, the observed tight linkage raised the possibility of obtaining mutants with relatively small deletions which did not extend to other linked genes needed for viability or fitness. Such mutants were therefore sought as described below in Examples .5-7.
- PCR assays were designed and prepared to distinguish the homoeologous SBEIIa genes in breadwheat.
- DNA samples isolated from each of approximately 1 5,000 M2 plants were individually screened for mutations in each of the SBElIa and SBEIIb genes using the genome specific PCR primers for SBEIla (ARIIaF2/ARIlaR2) and SBEIIb (ARA 19F/ARA23R) (diagnostic PCR).
- SBEIla ARIIaF2/ARIlaR2
- SBEIIb ARA 19F/ARA23R
- Each of the PCR reactions on wild-type DNA samples yielded 3 distinct amplification products which corresponded to the amplified regions of SBElIa or SBEIIb genes on the A. B and D genomes, whereas the absence of one of the fragments in the PCRs from mutagenised V12 samples indicated the absence of the corresponding region in one of the genomes, i.e. the presence of a mutant allele in which at least part of the gene was deleted. Such mutant alleles would almost certainly be null alleles.
- the mutant alleles could be assigned to one of the genomes according to which amplification product was absent.
- a l refers to the genotype where both the SBEIIa and SBEIlb genes on the A genome were mutant
- A2 refers to the genotype where the SBEIIa gene was mutant and the SBEIlb gene on the A genome was wild-type
- A3 refers to the genotype where the SBEIIa gene was wild-type and the SBEIlb gene on the A genome was mutant.
- the designations "B l “, “B2”, “B3”, “D P, "D2” and “D3” have the analogous meanings for the B and D genomes. Mutants of each of these nine possible types were identified among the collection of 34 mutants.
- the extent of the chromosome deletion in each of the 34 mutants was determined by microsatellite mapping. Microsatellite markers previously mapped to the long arm of chromosomes 2A, 2B and 2D (Table 12) were tested on these mutants to determine the presence or absence of each marker in each mutant. Mutant plants in which cither, al! or most of the specific chromosome microsatellite markers were retained, based on the production of the appropriate amplification product in the reactions, were inferred to be relatively small deletion mutants. Such mutants were preferred, considering that it was less likely that other, important genes were affected by the mutations. The identified mutants and the results from the microsatellite mapping are summarized in Table 1 3.
- Starch granule morphology was analysed by microscopy of selected normal looking and shriveled/shrunken F2 seeds from these crosses.
- Six shrivelled/shrunken seeds were selected, 5 from the 08/dd cross and 1 from the 08/bb cross, each of which were obtained from crosses between a D2 single null parent plant and an A 1 B2 double null parent plant.
- Each of the six seeds showed severe distortion of starch granules, showing abnormal, distorted shapes for most granules in the seeds which was similar to granules observed in transgenic seeds with elevated amylose levels (Example 2).
- DNA from these plants were further tested using quantitative PCR (Real-time PCR, Rotorgene 6000) using genome specific individual primer pairs to assay the presence or absence and the homozygosity or heterozygosity of the 3 SBEIIa genes in the plants.
- the primer pairs used for SBEIIa were Snp6for/Arev5 (SEQ ID NO: 51 /SEQ ID NO: 61 ) (A genome, 205bp amplification product), BSnp4/Arev5 (SEQ ID NO: 55/SEQ ID NO: 61 ) (B genome, 494bp amplification product) and DSnp7for/Drev l (SEQ ID NO: 58/SEQ ID NO: 62) (D genome, 278bp amplification product).
- a primer pair (SJ 156/SJ242) which amplified a 190bp product from the slF6 gene, which is a cell-wall biosynthesis gene expected to be equally expressed in all of the plants and located on wheat Chromosome 7, was used in control ampli fications.
- the relative concentration values generated in the reactions with the SBEIIa primers were normalised with the value for Cslf6 primers for each template DNA preparation.
- the values for the potential triple null plants and CS were calculated relative to line 2B2.
- the D genome primers produced a clear single band for one plant designated as S 14 which enabled quantitation.
- S 14 had approximately 30-50% of the D allele complement compared to 2B2 whereas CS gave a value of approximately 95% of 2B2 for the D genome SBEIIa gene. This showed that S 14 which gave seed with amylose levels of about 67% was homozygous for SBEIIa null mutations for two of the genomes (A and B) and heterozygous for the third genome (D).
- S 14 had an Al (homozygous), B2 (homozygous), D2/+ (heterozygous) genotype.
- the quantitative PCR showed that plant designated as S24 had a B2 (homozygous). D2 (homozygous) and A l (heterozygous) genotype.
- the PCR analysis showed that the remaining 5 plants had the following genotypes: 08dd9-B4 was homozygous for an A l B2 genotype i.e.
- Starch granule morphology was determined by light microscopy on 100-200 seeds from each of the lines S28, S 14 and S22. From the line S22, 102 F3 seeds were identified with distorted starch granules from among 200 seeds tested. The data revealed a distortion of the segregation ratios away from the expected 1 :2: 1 (homozygous mutant: heterozygote: wild-type) with a higher number of normal phenotypes than expected. In order to see whether a homozygous plant with a high amylose phenotype could be identified, 102 seeds with distorted granules were placed in conditions suitable for germination. Sixty one out of the 102 seeds germinated.
- SBEIIa protein expression in developing endosperms obtained from one whole spike from an S28 plant was analysed by Western blotting using a SBEIIa specific antibody. All 1 5 endosperms in the spike showed a pattern lacking both A and D genome isoforms of SBEIIa (AD double null) with only one S BEI Ia band present, expressed from the B genome. Out of the 1 endosperms, 7 had a B genome SBEIIa expression level considerably lower than the others and that of the control line. NB 1 . Based on the band intensity, the SBEIIa expression in each endosperm was quantitated.
- S22, S24 and S28 seeds demonstrated that the addition of the fifth SBEIla mutant (deletion) allele elevated the amylose level to about 67%. Accordingly, the increase in number from four SBEIla null alleles to a minimum of five mutant SBEIla alleles was critical to increasing the amylose level to greater than 50% (w/w), indeed greater than 60% (w/w). This conclusion fitted with the predictions made from the data in Example 2. The observed relationship of the allelic composition to the amylose content indicated that the total number of SBEIla mutant alleles in the plant was important in determining the amylose content (Table 18). It was also concluded that the number of SBElIb mutant alleles also played a role, although less important than the number of SBEIla mutant alleles.
- EXAMPLE 8 FURTHER ATTEMPTS TO PRODUCE TRI LE-NULL DELETION
- F2 seeds from six of the A 1 B2D2 crosses were also screened microscopically to identify seeds having a high amylose phenotype. Such seeds were identi fied at a moderate frequency.
- F2 seeds of the 08/mm- l cross were screened by microscopy to identify any seeds with a high amylose/distorted starch granule (HA) phenotype. Of 576 F2 seeds that were screened, no seeds were identified with the HA phenotype. This population of seeds should have included a low frequency of seeds having 5 mutant SBEIia alleles, being homozygous mutant in two genomes and heterozygous mutant/wild-type in the third genome for SBEIia.
- HA amylose/distorted starch granule
- Crosses involving Type 3 mutations were carried out with the aim of finding homozygous mutants having two, four or six mutant SBEIIb alleles combined with four mutant SBEIla alleles, and determining the phenotype of the resultant plants and its grain.
- Triple nulls for SBEIIb were identified from A3 B3 D3 and A3 B2D2 crosses, having 6 null alleles of SBEIIb with either zero or four null alleles of SBEIla. all of which showed wild type starch granule morphology.
- DNA was loaded on 384- well plates and duplex Q-PCR reactions were performed in duplicate for each plate.
- the PCR reactions were designed to amplify a 65bp fragment from exon 21 of the SBEIIa genes using the primers SBE2a QPCRABDF4 (forward primer); 5'-ACGATGCA CTCTTTGGTGGAT-3' (SEQ ID NO: 3 1 ) and SBE2a QPCRABDR4 (reverse primer): 5'- ACTTACGGTTGTGAAGTAGTCGACAT (SEQ I D NO: 32).
- the probe used to deliver the fluorescent signal during Q-PCR reactions was SBE2a QPCRABDS4 ( TaqMan* probe MGB, FAM) 5'-CAGCAGGC t ' TGATCAT-3' (SEQ ID NO: 33).
- a sequence from an endogenous gene, GamyB was used as an internal control to normalize the signal value of each sample, using the primers GamyB I F (primer forward): 5'- GATCCGAATAGCTGGCTCAAGTAT-3' (SEQ ID NO: 34) and GamyB2R (primer reverse): 5 -GGAGACTGCAGGTAGGGATCAAC-3' (SEQ ID NO: 35). Reaction conditions were as follows: .
- NIRS Near Infrared Red Spectroscopy
- this method was modified, simplified and scaled down to allow measurement of apparent amylose content in single seeds, thereby to allow for variation in amylose content between seeds.
- apparent amylose content is used in this context because the modified method did not purify the starch from the ground grain, the lipids interacting with the amylose in the starch were not removed, and the results were expressed as percentage of fresh seed weight rather than as a percentage of the isolated starch from the seed. For these reasons, the values obtained for "apparent amylose content" were much lower than the values obtained using the standard method as described in Example 1.
- this method was developed by assessing the linearity between the colorimetric response and amylose content using ground wheat grain without starch purification.
- the high amylose material used for this was wheat grain transformed with the hp5'-SBEIIa construct and having reduced SBEIIa (WM, Line 85.2c, see Example 2) and wheat with the normal amylose level which was a wild-type wheat (WMC) grown at the same time and under the same conditions.
- Ground WM grain contained about 80% amylose as determined by the standard method of Example 1 , while ground WMC grain had an amylose content of about 25%. Samples with different ratios of WM to WMC were prepared from ground seed material but not further purified.
- Apparent amylose was measured by taking 10 ⁇ aliquots of each mixture and treating them with 10 ⁇ 0.3% I 2 + 3% I in 0.0 I N NaOH solution and diluted to 2 ml with 11 2 0, as before. Absorbance of each sample was measured at 605nm and absorbance values were converted to percent "apparent amylose" using a standard curve as described above.
- NIRS calibration Single seed NIRS scans on WM and WMC seeds were obtained using a Multi Purpose Analyser (MPA) NIRS spectrometer (Bruker Optics, F-77420 Champs Sur Marnes, France). Each seed was placed at the bottom of a glass tube wrapped with aluminium foil and scanned twice. Spectra were recorded using a Bruker MPA Multi- Purpose-Analyser spectrometer (Bruker Optics) fitted with a fiber probe. Spectra were recorded using 32 scans reference and 16 sample scans over the range 4000 - 12,500 cm " 1 at a resolution of 16 cm '1 resulting in 1 100 data points. The liber optic probe used was the IN 261 probe for solids.
- MPA Multi Purpose Analyser
- the number of PLS factors used to develop the calibration was 14.
- the accuracy of the calibration model was expressed by the standard error of cross validation (SECV) and the coefficient of determination (R 2 ).
- SECV standard error of cross validation
- R 2 coefficient of determination
- the efficiency of a calibration was shown by the RPD which is the ration of the standard error of prediction (RMSECV) to the standard deviation of the reference data of the set.
- MRS screening of F2 seeds from wheal crosses was carried out to detect mutant seeds having high amylose content.
- the screening used 2.700 F2 seeds from two different crosses: M80 and M85 which were, respectively: 21 . 142(B2)/Type I- 20257(A 1 ) [08/h- l l l ]//Type 1- 19.832 (D 1 )/CHARA and 5.706 (D2)/21 .668 (B2)//20.257 (A i yCHARA.
- the screening was therefore aimed at identifying seeds with an A 1 B2D 1 or A l B2D2 genotype, respectively.
- Two NIRS spectra were recorded per seed as described above
- Soluble proteins were extracted by homogenising the isolated endosperms from developing seeds (about 15 days post-anthesis) in 50 m phosphate buffer, pH 7.5 containing 5 mM EDTA, 5 mM DTT, 0.4% protease inhibitor cocktail and 20% glycerol. After centrifugation at 14,000 g for 10 min the supernatant was used for the gel electrophoresis. Protein concentration in the extracts was estimated using a Coomassie Plus Protein Assay Reagent.
- Affinity Electrophoresis In a two-dimensional (2D) affinity electrophoresis technique for separating SBEIIa protein isoforms, aliquots (40 or 100 ⁇ i ) of the protein extracts were loaded onto the first dimension gel, a non-denaturing polyacrylamide gel cast in a Hoefer SE600 vertical 16 cm slab gel unit. The resolving component of the second dimension gel was a 6 % non-denaturing gel ( 14 ⁇ 16 cm or 16 ⁇ 16 cm, 1 .5 mm thickness) containing 10% glycerol with an appropriate amount of polysaccharide target (amylopectin, ⁇ -limit dextrin or glycogen) immobilised within the gel structure.
- 2D affinity electrophoresis technique for separating SBEIIa protein isoforms aliquots (40 or 100 ⁇ i ) of the protein extracts were loaded onto the first dimension gel, a non-denaturing polyacrylamide gel cast in a Hoefer SE600 vertical 16
- a stacking gel (polysaccharide-free) was poured to 1 cm from the top of glass plates forming using a comb to form wells. Gels were run overnight at 4°C at constant voltage ( 100V for glycogen and ⁇ -limit dextrin and 1.35V for amylopectin containing gels). - I l l -
- a one dimensional system was used to separate SBEIIa proteins in which protein extracts (20 ⁇ ig) were loaded onto a non-denaturing polyacry amide gel.
- the resolving component of the gel was a 6% non-denaturing gel containing 10% glycerol with 0. 1 5% of ⁇ -limit dextrin immobilised within the gel structure, while the stacking gel was polysaccharide-free. Gels were run at 4°C at constant current of 20mA per gel and maximum voltage of 200V.
- SBEIIb proteins are separated on a Bis-Tris 4- 12% gradient gel (Invitrogen). The gel is run at 4 °C at constant current of 20mA per gel and maximum voltage of 200V.
- the migration patterns of the SBEII isoforms encoded by the homeoalleles from the wheat A. B and D genomes showed differences between different wheat varieties when analysed by the one-dimensional affinity gel electrophoresis method. In some varieties, a clear separation of the A, B and D homeoforms was possible, allowing the simple scoring of polymorphisms in mutagenised populations from those varieties. For example, affinity gel electrophoresis of protein extracts from endosperms of the wild-type wheat varieties Sunstate and NB 1 showed a clear separation of the SBEUa-A, -B and -D isoforms.
- Branching enzyme polypeptides with a reduced affinity for starch migrated a greater distance through the polysaccharide-containing polyacryiamide gel than the respective native polypeptides encoded by the homeoalleles.
- Lines containing alleles with reduced expression or an absence of expression of a particular homeoallele were identified by presence/absence of a band in homozygous state and through densitometry to measure band intensity in heterozygous lines.
- SBEIIa-and SBElib- uVdnt plants which were identified by genotypic analysis (Example 6) were confirmed to be lacking specific SBEIIa or SBEIIb proteins by affinity gel electrophoresis, consistent with ⁇ their genotypes.
- the dissociation constant ( d) of starch-enzyme interactions for each of the SBEIIa iso orms in some of the affinity mutants was calculated by measuring the change in enzyme mobility as a function of the ⁇ - limit dextrin concentration in a l -D affinity gel as described in osar-Hashcmi et al.. 2006.
- the affinity mutant designated 7-25 had SBEIIa proteins with the following Kd values: 0.53g/L, 0.52g/L and 1.69g/L for the SBEIIa-A, SBElIa-B and SBEI Ia-D isoforms respectively ( Figure 13).
- the D- genome isoform (SBEIIa-D) of this line is expected to have a lower enzyme activity, but not total loss of" activity, compared to the other two isoforms. This expectation is confirmed by SBEII activity assays in the presence of null alleles of SB Ella- A and SBEIIa-B.
- the mutant plants were further confirmed by analysing several endosperms from developing seeds of the plants. These M3 endosperms were isolated from the M2 plants and examined for SBEIIa proteins by gel electrophoresis and Western blotting ( Figure 19).
- the nucleotide sequence of the mutant SBEIIa genes in the plants, and the deduced amino acid sequences, were determined by amplifying cDNA sequences using genome specific primers followed by sequencing of the coding regions. So far, the specific point mutations in 9 of the 18 mutants have been identified, out of which 2 were A genome mutants, 3 were B genome mutants and 4 were D genome mutants, as summarised in Table 1 9.
- the mutated gene in each of the remaining plants was deduced from the absence of a particular polypeptide band in the immunoblots.
- the assignment of the polypeptides was further confirmed in some of the lines by running a 2-dimensional gel with a non-denaturing affinity gel as the second dimension gel.
- the mutants were thereby classified into two groups (Table 19), namely a) null mutants, in which the endosperms exhibited only two SBEIIa bands in the immunoblots with the missing band representing the mutated genome A, B or D (designated 'n' for null in Table 19) and b) affinity mutants which exhibited three bands in the immunoblots. where one of the polypeptides migrating differently to the wild-type due to an altered affinity to starch (designated ' ⁇ ' for partial).
- CAPs co-dominant cleavable amplified polymorphic sequence
- PCR amplification of the exon 1 22 region was carried out using the primers AR2aDex21 _22F (S'-CTGTTGTAGCCATAGGAAGG ': SEQ ID NO: 154) and AR2aex21_22R (5 '-GAGCGCTCACCAACAAGCTACC-3 ! ; SEQ ID NO: 1 55).
- PCR amplification of the exon 15 region was carried out using the primers AR2aE15F07 (5'- GTC AGTGGAATGCCTACATTTTGC-3 ' : SEQ ID NO: 156) and AR2aE l-5R07 (5'- GTC AGTGGA ⁇ GCCTACA ⁇ GC-3 ' ; SEQ ID " NO: 157).
- the digestion of the PC R products with the restriction enzyme HpylSSlll resulted in a fragment of approximately 105bp from the mutant line 15-3 D and a 63bp fragment from the wild-type.
- the digestion of the PCR products with the restriction enzyme BseR l resulted in a fragment of approximately 1529bp from the mutant line 16-9C and two bands of sizes about 1 159bp and 370bp from the wild-type.
- SBEIIa single mutants identified from the sodium azide mutagenised Sun tate population were then crossed with the previously identified HIB double null mutants (deletion mutants) in order to isolate triple mutants that lacked SBEIIa activity from two genomes with total or partial loss of activity from the third genome.
- Three groups of crosses were carried out. In a first group, four crosses to isolate mutants of the A 1B2D2 genotype, two crosses each to isolate the A2B2D2 and A2B2D 1 genotypes, and one cross to isolate the A 1 B2D 1 genotype were performed.
- the second group included .2 crosses aimed at generating triple null mutants of the A2B2D2 genotype, and one cross each aimed at generating the A 1 B2D2, A 1 B 1 D2 and A2B 1 D2 genotypes.
- the third group included four crosses each aimed at producing the A2B 1 D2, A2B2D 1 and A 1 B 1 D2 genotypes. 10 crosses aimed at the A2B2D2 genotype, 6 crosses aimed at the A 1 B2D2 genotype and 2 crosses aimed at the A1 B2D1 genotype.
- the resultant F l plants were set fed to produce F2 endosperms.
- Cross 7-25 (D2) X 08/H-92 (A1B2), designated CS3.
- Nineteen seeds with varying degrees of altered starch granule morphology were identified from a screening of 1 92 F2 seeds. These seeds were germinated and DNA extracted from leaf samples from the resultant plants.
- PCR was conducted on DNA from the 19 selected plants to detect 1 ) the CAPS codominant marker AR2aDex21_22F and AR2aex21 _22R with digestion by Mlyl to detect the point mutation in the D genome coming from the parent 7-25 (above), and 2) AR2aI13genome F2 and AR2aI 13genome R2 primers to detect SBEIIa deletions in the A and B genomes coming from 08/-H-92 parent line.
- Cross 6-60 (B2) X 08/i-G3 (A JD2), designated CS2.
- Four triple null seeds, designated F l l , D8, E6 and E l l were identified from this cross from a total of 288 F2 seeds that were screened.
- the triple null genotype of F l 1 and D8 was confirmed in plants produced from these seeds.
- the plants produced from the F l l and E6 seeds showed normal growth and development, plant El 1 died at the seedling stage, and plant D8 had a late flowering phenotype.
- the lack of SBEIIa expression in each of 4 endosperms for plants Fl l and E6 confirmed them to be homozygous triple null mutants of SBEIIa.
- Analysis of 10 F3 seeds from a heterozygous line from this cross, CS2-C6, also identified one triple null seed, CS2-C6.4, which was confirmed to be homozygous for lack of SBEIIa expression.
- Cross ()8/b-I8 (A lDl) X 6-60 (B2) designated CSI Screening of 1 92 F2 seeds by- microscopy and 288 seeds by PGR did not identify any homozygous triple nulls. However one confirmed heterozygous line, A l B2hetD l -G 1 2 which was a homozygous double null for the SBEIIa-A and -B genes and heterozygous for the SBEIIa-D mutant allele was grown. Embryos were isolated from the F3 developing seeds and cultured to produce plants and the corresponding endosperms typed for SBEIIa polypeptides.
- amylose level for the wild type grains was about 32.9% and that for the RNAi SBEIIa line 85.2c ranged from 72.2% to 75. 1 %.
- the amylose content was further analysed by iodometry to compare the performance of CS 1.
- CS2 and CS3 and the data are given in Table 21 . While both CS 1 and CS2 lines showed an amylose content of >80%, in the range 80-86%, CS3 lines showed an amylose content ranged from about 67% to 70%.
- a third round of amylose analysis was carried out including the A2B2D2 triple null line CS 10-C 12 and the results are shown in Table 22.
- CS 10-C 12 showed an amylose content of 67.4%, falling within the range observed for the CS3 lines, while CS 1 and CS2 triple null lines ranged from 74% to 84%. While the A l single null line gave a value of 39.5%, A 1 B2 double lines ranged from 50.4% to 53.6% in this assay.
- the growth and development of the plants produced from these seeds was observed.
- the preliminary agronomic characteristics of the triple null SBEIIa plants are summarised in Table 23.
- the average weight of individual seeds obtained from the triple null lines ranged from 34.2 to 46.5 mg.
- the total number of seeds per plant ranged from 1 5 to 254.
- the triple null lines of CS2 and C3 did not exhibit any significant loss of fertility compared to the control plants.
- Considerable sterility was observed in three out of four of CS 1 triple null lines. Examination of the seed morphology from these plants revealed no obvious shrinking of seed.
- the seeds of the triple null plants from the CS3-A2 line had a ⁇ chalky appearance compared to seeds from other triple null lines from CS3, CS2 and CS 1 lines.
- both A and B ( ⁇ 1 0 ⁇ diameter) starch granules from endosperms having reduced SBEIIb expression and unaltered SBElla expression were smooth surfaced, spherical or ellipsoid in shape and indistinguishable from wild-type wheat starch granules.
- Amylose content of transgenic wheal grain was assayed by two independent methods, namely an iodometric method and a size exclusion chromatography (SEC) method.
- the iodometric determination of amy lose content was based on measuring the colour change induced when iodine bound to l inear regions of ⁇ - 1 ,4 glucan, with reference to a standard curve generated using known concentrations of purified potato amylose and amylopcctin, as described in Example 1 .
- the size exclusion chromatography method was based on the separation, by column chromatography, of amylose and amylopectin which had not been debranched, followed by measurement of the starch concentration in the fractions eluted from the column.
- Three genotypes of grain were analysed. Firstly, plants transformed with the hp-SB EIIa construct and having very low levels of SBEIla expression; secondly, plants containing the hp- SBEIIb construct and having no detectable expression of SBElIb but wild-type for SB El la: and thirdly, the non-transformed wild-type control (NB 1 ).
- Grain from the plants lacking SBEIJb expression had an amylose content of 27.3% determined by the iodometric method and 32% by the SEC method. This was not significantly di fferent to the amylose content of grain from non-transformed control line NB 1 (3 1 .8% iodometric, 25.5% SEC). However, in grain having the reduced SBEIla expression (line 087) the amylose content was significantly elevated (88.5% iodometric, 74.4% SEC).
- Chain length distribution of starch by FA CE Chain length distribution of isoamylase de-branched starch was determined by . fluorophore assisted carbohydrate electrophoresis (FACE). This technique provides a high resolution analysis of the distribution of chain lengths in the range from DP 1 to 50. From the molar difference plot in which the normalized chain length distribution of the non-transformed control was subtracted from the normalized distribution of the transgenic lines, it was observed that there was a marked decrease in the proportion of chain lengths of DP 6- 12 and a corresponding increase in the chain lengths greater than DP 12 in starch from grain having reduced SBEIla expression. No statistically significant alteration in the chain length distribution of starch from hp-SBEIIb lines was observed when compared to wild-type.
- FACE fluorophore assisted carbohydrate electrophoresis
- Molecular weight, of amylopectin and amylose was determined by size exclusion-FIPLC (SE-HPLC).
- the H PLC system comprised of a GBC pump (LC 1 150. GBC Instruments. Vic, Australia) equipped with Auto Sampler (GBC, LC 1610) and Evaporative Light Scattering Detector (ELSD) (ALLTech. Deerfield. USA).
- Ammonium acetate buffer (0.05 M; pH 5.2) was used as the mobi le phase at a flow rate of 0.8 m L m in " 1 .
- Starch Swelling Power (SSP). Starch swelling power of gelatinized starch was determined following the small scale test of onik-Rose el al.. (2001 ) which measured the uptake of water during gelatinization of starch. The estimated value of SSP was significantly lower for starch from the reduced SBEIla line with a figure of 3.5 1 compared to starch from the control (9.31) and reduced SBEIIb grain ( 10.74) (Table 24).
- Dough extensibility parameters were measured as follows: Doughs were mixed to peak dough development in a 10 g prototype Mixograph. Extension tests at lcm/s were carried out on a TA.XT2i texture analyser with a modi fied geometry Kieffer dough and gluten extensibility rig (Mann el al, 2003). Dough samples for extension testing (-1 .0 g / test) were moulded with a Kieffer moulder and rested at 3()°C and 90% Rll for 45 min. before extension testing. The R_Max and Ext Rmax were determined from the data with the help of Exceed Expert software (Sinewing. The measurement of dough and gluten extensibility using the SMS/Kieffer rig and the TA.TX2 texture analyzer handbook, SMS Ltd: Surrey, UK, 1995; Mann, ( 2002).
- An illustrative recipe based on the 14 g flour as 100% was as follows: flour 100%, salt 2%, dry yeast 1.5%, vegetable oil 2%, and improver (ascorbic acid l OOppm. fungal amylose 15ppm, xylanase 40ppm, soy flour 0.3%, obtained from Goodman Fielder Pty Ltd, Australia) 1 .5%.
- the water addition level was based on .the micro Z-arm water absorption values that were adjusted for the full formula.
- Flour ( 14 g) and the other ingredients were mixed to peak dough development time in a 35g Mixograph. The moulding and panning was carried out in a two staged proofing steps at 40C at 85% Rl I.
- Baking was carried out in a Rotel oven for 15 min at 190°C. Loaf volume (determined by the canola seed displacement method) and weight measurements were taken after cooling on a rack for 2 hours. Net water loss was measured by weighing the loaves over time.
- the flour or wholemeal may be blended with flour or wholemeal from non- modified wheats or other cereals such as barley to provide desired dough and bread- making or nutritional qualities.
- flour from cvs Chara or Glenlea has a high dough strength while that from cv Janz has a medium dough strength.
- the levels of high and low molecular weight glutenin subunits in the flour is positively correlated with dough strength, and further influenced by the miture of the alleles present.
- Flour from transgenic wheat lines having reduced SBElla were used at 1 00%, 60% and 30% addition levels, e.g. either all the flour came from the various wheat lines or 60% or 30% were added to the Baking Control (B. extra) flour. Percentages are of total flour in the bread formulation.
- Four transgenic wheat lines were used as follows: 072 (reduced SBElla), 212 (a wheat line derived from the cross, reduced SBElla x SBEI triple null wheat), 117 (a wheat line derived from the cross, reduced SBE Ila x SSlIa triple null wheat) and 008 (reduced SBEIlb) were tested along with a non transformed control wheat (N B 1 ).
- high amylose wheats are used in combination with preferred genetic background characteristics (e.g. preferred high and low- molecular weight glutenins), the addition of improvers such as gluten, ascorbate or emulsifiers, or the use of differing bread-making styles (e.g. sponge and dough bread- making, sour dough, mixed grain, or wholemeal) to provide a range of products with particular utility and nutritional efficacy for improved bowel and metabolic health.
- preferred genetic background characteristics e.g. preferred high and low- molecular weight glutenins
- improvers such as gluten, ascorbate or emulsifiers
- differing bread-making styles e.g. sponge and dough bread- making, sour dough, mixed grain, or wholemeal
- the BRI Research sponge and dough baking involved a two-step process.
- the sponge was made by mixing part of the total flour with water, yeast and yeast food.
- the sponge was allowed to ferment for 4 h.
- the sponge was incorporated with the rest of the flour, water and other ingredients to make dough.
- the sponge stage of the process was made with 200 g of flour and was given 4 h fermentation.
- the dough was prepared by mixing the remaining 100 g of flour and other ingredients with the fermented sponge. '
- Pasta- Spaghetti The method used for pasta production was as described in Sissons et ⁇ , (2007). Test sample flours from high amylose wheat (reduced SBEIIa) and control wheat (NB 1 ) were mixed with Manildra semolina at various percentages (test sample: 0, 20, 40, 60, 80, 100%) to obtain flour mixes for small scale pasta preparation. The samples were corrected to 30% moisture. The desired amount of water was added to the samples and mixed briefly before being transferred into a 50 g farinograph bowl for a further 2 min mix. The resulting dough, which resembled coffee-bean-size crumbs, was transferred into a stainless steel chamber and rested under a pressure of 7000 kPa for °min at 50 C.
- the pasta was then extruded at a constant rate and cut into lengths of approximately 48 cm. Two batches of pasta were made for each sample.
- the pasta was dried using a fhermoline Temperature and Humidity Cabinet (TEC 2604) (Thermolme Scientific Equipment. Smithfield, Australia). The drying cycle consisted of a holding temperature of 25 C followed by an increase to 65 C for 45 min then a period of about 13 h at 50 C followed by cooling to 25 C. Humidity was controlled during the cycle. Dried pasta was cut into 7 cm strands for subsequent tests.
- TEC 2604 fhermoline Temperature and Humidity Cabinet
- GI Glycemic Index
- Food samples were homogenised with a domestic food processor. An amount- of sample representing approximately 50mg of carbohydrate was weighed into a 120ml plastic sample container and ⁇ of carbonate buffer added without (x-amylase. Approximately 15-20 seconds after the addition of carbonate buffer, 5ml of Pepsin solution (65mg of pepsin (Sigma) dissolved in 65ml of HO 0.02M, pH 2.0, made up on the day of use) was added, and the mixture incubated at 37°C for 30 minutes in a reciprocating water bath at 70 rpm.
- Pepsin solution 65mg of pepsin (Sigma) dissolved in 65ml of HO 0.02M, pH 2.0, made up on the day of use
- the sample was neutralised with 5ml of NaOFl (0.02M) and 25ml of acetate buffer 0.2M pH 6 added.
- Na acetate buffer sodium acetate buffer, 0.2 M, pH 6.0, containing 0.20 M calcium chloride and 0.49 mM magnesium chloride
- Samples were diluted as necessary ( 1 in 10 dilution usually sufficient), ⁇ ⁇ of supernatant transferred from each sample to 96-well microtitre plates in duplicate or triplicate.
- a standard curve for each microtitre plate was prepared using glucose (Omg, 0.0625mg, 0. 125mg, 0.25mg, 0.5mg and l.Omg). 200ul of Glucose Trinder reagent (Microgenetics Diagnostics Pty Ltd, Lidcombe, NSW) was added to each well and the plates incubated at room temperature for approximately 20 minutes. The absorbance of each sample was measured at 505nm using a plate reader and the amount of glucose calculated with reference to the standard curve.
- RS Resistant Starch
- the food samples were processed in a manner simulating consumption, for example by homogenising with a domestic food processor to a consistency as would be achieved by chewing.
- an amount of food representing up to 500 mg of carbohydrate was weighed into a 125 mL Erlenmcyer flask.
- a carbonate buffer was prepared by dissolving 1 2 1 mg of NaHCO ? and 157 mg of C1 in approximately 90 mL purified water, adding 159 ⁇ of 1 M CaCl 2 .6H 2 0 solution and 41 ⁇ of 0.49 M MgCl2.6H 2 0, adjusting the pH to 7 to 7. 1 with 0.32 M HC1, and adjusting the volume to 100 mL.
- This buffer was stored at 4°C for up to five days.
- An artificial saliva solution containing 250 units of a-amylase (Sigma A-31 76 Type VI-B from porcine pancreas) per mL of the carbonate buffer was prepared.
- An amount of the artificial saliva solution, approximately equal to the weight of food, was added to the Hask.
- 5 mL of pepsin solution in HC1 ( 1 mg/ml , pepsin (Sigma) in 0.02 HC1. pH 2.0, made up on day of use) was added to each flask. The mixing of the amylase and then pepsin mimicked a human chewing the food before swallowing it.
- the mixture was incubated at 37°C for 30 min with shaking at 85 rpm.
- the mixture was then neutralised with 5 mL of 0.02M NaOH.
- 25 mL of acetate buffer (0.2 M, pH 6) and 5 m L of pancreatin enzyme mixture containing 2 mg/mL pancreatin (Sigma, porcine pancreas at 4 x USP activity) and 28 U of amyloglucosidase (AMG, Sigma) from Aspergillus in acetate buffer, pH6. were added per flask.
- Each llask was capped with aluminium foil and incubated at 37°C for 1 6 hours in a reciprocating water bath set to 85 rpm.
- each flask was transferred quantitatively to a 50 m L polypropylene tube and centrifuged at 2000 x g for 1 0 min at room temperature. The supernatants were discarded and each pellet washed three times with 20 mL of water, gently vortexing the tube with each wash to break up the pellet, followed by centrifugation. 50 ⁇ , of the last water wash was tested with Glucose Trinder reagent for the absence of free glucose. Hach pellet was then resuspended in approximately 6 mL of puri fied water and homogenised three times for 10 seconds using an Ultra Turrax TP 1 8/10 with an S25N- 8G dispersing tool.
- the contents are quantitatively transferred to a 25 mL volumetric flask and made to volume.
- the contents were mixed thoroughly and returned to the polypropylene tube.
- a 5 ml. sample of each suspension was transferred to a 25 mL culture tube and immediately shell frozen in liquid nitrogen and freeze dried.
- Solutions were incubated in the boiling water bath for a further 12 min, with vortex mixing at 3 min intervals. Tubes were then placed in a 50°C water bath and 4 mL of sodium acetate buffer (200 raM, pH 4.5, containing 0.02% sodium azide) and 0. 1 mL of amyloglucosidase at 300 U/ml added. The mixtures were incubated at 50°C for 30 min with gentle mixing at 10 min intervals. The volumes were made up to 25 mL in a volumetric flask and mixed well. Aliquots were centrifuged at 2000 x g for 1 0 min.
- the amount of glucose in 50 xL of supernatant was determined with 1 .0 mL of Glucose Trinder reagent and measuring the absorbance at 505 mn after incubation of the tubes at room temperature in the dark for a minimum of 18 min and a maximum of 45 min.
- Flour produced from grain of lines F9 and F 1 1 were tested for resistant starch content by the in vitro method.
- F9 flour showed an RS content of about 3g/100g flour (range 2.3-3.4 g/l OOg flour), while F l 1 flour showed an RS content of about 6.5 g/l OOg flour, compared to 0.2-0.4 g/l OOg flour for control flour from thw wild-type varieties Sunstate and NB 1 . This represents an increase of about 8-fold or at least 1 0-fold relative to the RS level in wild-type flour.
- EXAMPLE 16 PROCESSING OF HIGH AMYLOSE WHEA AND RESULTANT
- Narrower roller gaps also led to higher RS levels in the Hartog control, albeit at much lower overall RS levels; In contrast to the high amylose results, increased steaming times led to higher RS levels, possibly due to increased starch gelatinization at longer steaming times contributing to more starch retrogradation during subsequent processing and cooling.
- a population of mutated plant lines was developed after EMS mutagenesis of seeds of the wheat cultivars Arche or Apache, using standard EMS treatment conditions. About 5000 Apache and 900 Arche individual M l plants were grown from the mutagenised seed, self-fertilised, and seeds from each plant and subsequent progeny generations maintained as potentially mutant lines, each derived from an individual M l plant. The lines were screened for mutations in the three homoeologous SBE/la genes by next-generation Solexa sequencing (Illumina). To do this, 7 DNA pools were prepared, each by pooling D A from about 130 M l families from the Arche population and 96 from the Apache population. PCR was carried out on the pooled DNAs for 3 or 4 regions per homoeologous gene, targeting the exonic regions including splice sites of the genes. Genome-specific primers are set out in Table 30.
- the obtained mutants were categorised into three groups.
- the first group consisted of mutants which had mutated SBEIIa genes with stop codons in the protein coding regions of the SBEIIa genes on the B or D genomes, causing premature termination of translation of the SBEIIa proteins.
- the second group consisted of lines which comprised splice site mutations in the SBEIla-B or -D genes. Such mutations were expected to be null mutations.
- the third group consisted of mutants which comprised point mutations in the SBEIIa-A, SBEIla-B and SBElla-D genes which resulted in amino acid substitutions in the encoded polypeptides.
- EXAMPLE 18 PRODUCTION AND IDENTIFICATION OF SBEIIA TRIPLE NULL WHEAT COMBINING DOUBLE NULL DELETION M UTATIONS AND SINGLE POINT MUTATIONS TO PRODUCE HIG H AM YLOSE WHEAT
- HAW seeds A total of 2,300 HAW seeds were identified. All of the crosses but one produced HAW seeds. Selected seeds were sown in a greenhouse and out of 415 F3 plants obtained, 91 were identified as triple nulls for the SBEIla gene by molecular markers. Seeds were obtained from 85 plants among which 67 triple nulls plants were confirmed as high amylose wheat plants by NI RS measurement. Twenty-four plants produced seeds with amylose levels greater than for the GM 85,2c reference grain. Amylose content was measured by iodometry and showed that some of the SBEIla triple null grain had amylose levels up to 158% higher than the control grain. In this same experiment, the HAW GM reference grain exhibited an amylose level 58% higher than the control line (Table 35). Measurement Of the thousand kernel weight showed that the high amylose wheat grain were not significantly reduced in grain weight. [0456] Seeds were sown for multiplication to allow further tests of the starch characteristics in the grain.
- Organism Triticum cteslivum. 695 amino acids- partial SBEllb sequence
- Triticum cteslivum 836 aas. This is SBEIIb-D, 832/836 identical to AAW80631
- protein coding region is from the ATG at 151 - 153 to TA A at 2620-2620
- Table 19 Summary of the SNP mutants identified from the azide-mutagenised population of wheat (cv. Sunstate)
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Medicinal Chemistry (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biochemistry (AREA)
- Nutrition Science (AREA)
- Developmental Biology & Embryology (AREA)
- Environmental Sciences (AREA)
- Botany (AREA)
- Physiology (AREA)
- Biomedical Technology (AREA)
- Pharmacology & Pharmacy (AREA)
- Diabetes (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Animal Behavior & Ethology (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Polymers & Plastics (AREA)
- Food Science & Technology (AREA)
- Biophysics (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Cell Biology (AREA)
- Physics & Mathematics (AREA)
- Natural Medicines & Medicinal Plants (AREA)
- Hematology (AREA)
- Obesity (AREA)
- Materials Engineering (AREA)
Priority Applications (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| ES12846192T ES3000665T3 (en) | 2011-11-04 | 2012-11-02 | High amylose wheat - ii |
| JP2014539188A JP6346093B2 (ja) | 2011-11-04 | 2012-11-02 | 高アミロースコムギ |
| AU2012327161A AU2012327161B8 (en) | 2011-11-04 | 2012-11-02 | High amylose wheat - II |
| EP12846192.8A EP2773183B1 (en) | 2011-11-04 | 2012-11-02 | High amylose wheat - ii |
Applications Claiming Priority (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201161556051P | 2011-11-04 | 2011-11-04 | |
| US61/556,051 | 2011-11-04 | ||
| US201261645530P | 2012-05-10 | 2012-05-10 | |
| US61/645,530 | 2012-05-10 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2013063653A1 true WO2013063653A1 (en) | 2013-05-10 |
Family
ID=48191117
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/AU2012/001349 Ceased WO2013063653A1 (en) | 2011-11-04 | 2012-11-02 | High amylose wheat - ii |
Country Status (6)
| Country | Link |
|---|---|
| US (4) | US9357722B2 (https=) |
| EP (1) | EP2773183B1 (https=) |
| JP (2) | JP6346093B2 (https=) |
| AU (1) | AU2012327161B8 (https=) |
| ES (1) | ES3000665T3 (https=) |
| WO (1) | WO2013063653A1 (https=) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2016526882A (ja) * | 2013-06-13 | 2016-09-08 | コモンウェルス サイエンティフィック アンド インダストリアル リサーチ オーガナイゼーション | 非常に低レベルのホルデインを有するオオムギ |
| WO2019211796A1 (en) * | 2018-05-02 | 2019-11-07 | Cellectis | Engineering wheat with increased dietary fiber |
| FR3120318A1 (fr) | 2021-03-02 | 2022-09-09 | Arista Cereal Technologies Pty Ltd | Procédé de meunerie industrielle à rendement augmenté, farines obtenues par ce procédé, produits notamment de panification fabriqués à partir de ces farines |
| WO2024246182A1 (en) * | 2023-06-02 | 2024-12-05 | Plantcarb Aps | Barley plant having increased amylose content |
Families Citing this family (27)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7812221B2 (en) | 2003-06-30 | 2010-10-12 | Commonwealth Scientific And Industrial Research Organization | Wheat with altered branching enzyme activity and starch and starch containing products derived therefrom |
| AU2004284112B2 (en) | 2003-10-27 | 2010-07-08 | Commonwealth Scientific And Industrial Research Organisation | Rice and products thereof having starch with an increased proportion of amylose |
| CN101516181B (zh) | 2006-07-14 | 2015-09-30 | 联邦科学技术研究组织 | 改变水稻的脂肪酸组成 |
| AU2008329557B2 (en) * | 2007-11-27 | 2014-08-14 | Commonwealth Scientific And Industrial Research Organisation | Plants with modified starch metabolism |
| CA2653883C (en) | 2008-07-17 | 2022-04-05 | Colin Leslie Dow Jenkins | High fructan cereal plants |
| EP2315519B1 (en) | 2008-07-21 | 2016-08-17 | Commonwealth Scientific and Industrial Research Organisation | Improved cottonseed oil and uses |
| BR112012002114A2 (pt) | 2009-07-30 | 2015-09-15 | Australian Capital Ventures Ltd | cevadas e seu usos. |
| AR083767A1 (es) | 2010-11-04 | 2013-03-20 | Arista Cereal Technologies Pty Ltd | Trigo con alto contenido de amilosa |
| AU2012212404B2 (en) | 2011-02-03 | 2016-05-12 | The Healthy Grain Pty Limited | Barley with modified SSIII |
| AR087159A1 (es) | 2011-06-20 | 2014-02-26 | Gen Biscuit | Galletita para desayuno con glucosa de lenta disponibilidad |
| CN104160029A (zh) | 2011-10-04 | 2014-11-19 | 阿凯笛亚生物科学公司 | 具有增加的抗性淀粉水平的小麦 |
| ES3000665T3 (en) * | 2011-11-04 | 2025-03-03 | Arista Cereal Tech Pty Ltd | High amylose wheat - ii |
| HK1207938A1 (en) | 2012-04-25 | 2016-02-19 | Commonwealth Scientific And Industrial Research Organisation | High oleic acid oils |
| MY178434A (en) | 2014-07-07 | 2020-10-13 | Commw Scient Ind Res Org | Processes for producing industrial products from plant lipids |
| US11136589B2 (en) * | 2016-01-26 | 2021-10-05 | Pioneer Hi-Bred International, Inc. | Waxy corn |
| AU2017292900C1 (en) * | 2016-07-05 | 2023-03-30 | Commonwealth Scientific And Industrial Research Organisation | High amylose wheat - III |
| EP3507370A4 (en) | 2016-09-02 | 2020-06-24 | Commonwealth Scientific and Industrial Research Organisation | PLANTS WITH CHANGED PROPERTIES |
| EP3518655A4 (en) * | 2016-09-30 | 2020-05-27 | J.R. Simplot Company | CULTIVATION OF STRAWBERRIES IN LOW ALTITUDE MOTTES WITHOUT REQUIRING PACKAGING |
| CA3172525A1 (en) | 2020-03-23 | 2021-09-30 | Tanya Jeradechachai | Rapid high amylose wheat seed purity test |
| CN114145197B (zh) * | 2021-09-26 | 2023-03-28 | 中国科学院合肥物质科学研究院 | 一种提高小麦对赤霉病抗性的方法 |
| CN113881648B (zh) * | 2021-10-20 | 2022-12-13 | 江南大学 | 一种提高淀粉分支酶催化活力的方法 |
| JP2023098082A (ja) * | 2021-12-28 | 2023-07-10 | 日清製粉株式会社 | 中華まん類用穀粉組成物、及びこれを用いた中華まん類の製造方法 |
| JP7847430B2 (ja) * | 2021-12-28 | 2026-04-17 | 日清製粉株式会社 | うどん用穀粉組成物、及びこれを用いたうどんの製造方法 |
| JP2023116159A (ja) * | 2022-02-09 | 2023-08-22 | 日清製粉株式会社 | 麺皮類用穀粉組成物、及びこれを用いた麺皮類の製造方法 |
| JP2023118310A (ja) * | 2022-02-15 | 2023-08-25 | 日清製粉株式会社 | ベーカリー用穀粉組成物、及びこれを用いたベーカリー食品の製造方法 |
| CN116064895B (zh) * | 2022-08-23 | 2025-08-12 | 河南省作物分子育种研究院 | 小麦籽粒抗性淀粉含量相关位点qRS.4DS的分子标记及其应用 |
| WO2025228942A1 (en) * | 2024-05-03 | 2025-11-06 | Société des Produits Nestlé S.A. | Edible chew having a high content of amylose for oral use by infants and young children |
Citations (11)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1999014314A1 (en) | 1997-09-12 | 1999-03-25 | Commonwealth Scientific And Industrial Research Organisation | Regulation of gene expression in plants |
| WO1999032619A1 (en) | 1997-12-23 | 1999-07-01 | The Carnegie Institution Of Washington | Genetic inhibition by double-stranded rna |
| WO1999049029A1 (en) | 1998-03-20 | 1999-09-30 | Benitec Australia Ltd | Control of gene expression |
| WO1999053050A1 (en) | 1998-04-08 | 1999-10-21 | Commonwealth Scientific And Industrial Research Organisation | Methods and means for obtaining modified phenotypes |
| WO2001034815A1 (en) | 1999-11-05 | 2001-05-17 | Cambria Biosciences, Llc | Dsrna as insect control agent |
| WO2001062934A1 (en) | 2000-02-21 | 2001-08-30 | Commonwealth Scientific And Industrial Research Organisation | Starch branching enzyme |
| WO2002037955A1 (en) | 2000-11-09 | 2002-05-16 | Commonwealth Scientific And Industrial Research Organisation | Barley with reduced ssii activity and starch containing products with a reduced amylopectin content |
| WO2004073390A1 (en) | 2003-02-19 | 2004-09-02 | Commonwealth Scientific And Industrial Research Organisation | Efficient gene silencing in plants using short dsrna sequences |
| WO2005001098A1 (en) | 2003-06-30 | 2005-01-06 | Commonwealth Scientific And Industrial Research Organisation | Wheat with altered branching enzyme activity and starch and starch containing products derived thereform |
| US20050074891A1 (en) | 2000-03-01 | 2005-04-07 | Allen Stephen M. | Starch branching enzyme IIb |
| WO2006069422A1 (en) | 2004-12-30 | 2006-07-06 | Commonwealth Scientific And Industrial Research Organisation | Method and means for improving bowel health |
Family Cites Families (27)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US3690896A (en) | 1970-05-15 | 1972-09-12 | Gen Mills Inc | Process for forming a multi-colored food product |
| US4770710A (en) | 1987-07-02 | 1988-09-13 | American Maize-Products Company | Novel starch and products produced therefrom |
| US6013861A (en) | 1989-05-26 | 2000-01-11 | Zeneca Limited | Plants and processes for obtaining them |
| US5051271A (en) | 1989-11-22 | 1991-09-24 | Opta Food Ingredients, Inc. | Starch-derived, food-grade, insoluble bulking agent |
| NZ259291A (en) | 1992-12-24 | 1996-01-26 | Goodman Fielder Ltd | Food composition with enhanced dietary fibre content derived from starch with a high amylose content |
| HUP9902112A3 (en) | 1995-12-20 | 2001-11-28 | Du Pont | Novel starches via modification of expression of starch biosynthetic enzyme genes |
| BR9709487A (pt) | 1996-05-29 | 1999-08-10 | Hoechst Schering Agrevo Gmbh | Moléculas de ácido nucléico que codificam enzimas de trigo que est o envolvidas nas síntese de amigo |
| US6483009B1 (en) | 1997-02-21 | 2002-11-19 | Danisco A/S | Antisense intron inhibition of starch branching enzyme expression |
| HUP0103618A3 (en) | 1998-09-10 | 2003-12-29 | Monsanto Uk Ltd Cambridge | Isoforms of starch branching enzyme ii (sbe-iia and sbe-iib) from wheat |
| AUPQ005299A0 (en) | 1999-04-29 | 1999-05-27 | Commonwealth Scientific And Industrial Research Organisation | Novel genes encoding wheat starch synthases and uses therefor |
| CA2273673A1 (en) | 1999-06-04 | 2000-12-04 | Makoto Yamamori | High amylose wheat starch and wheat containing the same |
| US6897354B1 (en) | 1999-06-04 | 2005-05-24 | National Institute Of Agrobiological Sciences | High amylose wheat starch and wheat containing the same |
| US7041484B1 (en) | 1999-10-29 | 2006-05-09 | National Research Council Of Canada | Starch branching enzymes |
| CA2389390A1 (en) | 1999-10-29 | 2001-05-10 | National Research Council Of Canada | Starch branching enzymes |
| GB2360521A (en) | 2000-03-20 | 2001-09-26 | Danisco | Genetic modification of starch in plants |
| US20030035857A1 (en) | 2001-03-22 | 2003-02-20 | Sroka Pongpun Elisa | Process for preparing wheat bread and dough mix for same |
| US7009092B1 (en) | 2001-06-04 | 2006-03-07 | Iowa State University Research Foundation | Transgenic corn plants having seeds with modified cornstarch characteristics and method of making the transgenic corn plants |
| JP4460282B2 (ja) | 2001-06-12 | 2010-05-12 | バイエル・クロップサイエンス・アーゲー | 高アミロースデンプンを合成するトランスジェニック植物 |
| WO2003023024A1 (en) | 2001-09-10 | 2003-03-20 | Japan Science And Technology Agency | Starch synthases |
| AUPS219802A0 (en) | 2002-05-09 | 2002-06-06 | Commonwealth Scientific And Industrial Research Organisation | Barley with altered branching enzyme activity and starch and starch containing products with a reduced amylopectin content |
| AU2004284112B2 (en) | 2003-10-27 | 2010-07-08 | Commonwealth Scientific And Industrial Research Organisation | Rice and products thereof having starch with an increased proportion of amylose |
| US7993686B2 (en) | 2004-12-30 | 2011-08-09 | Commonwealth Scientific And Industrial Organisation | Method and means for improving bowel health |
| US7700139B2 (en) | 2004-12-30 | 2010-04-20 | Commonwealth Scientific And Industrial Research Organization | Method and means for improving bowel health |
| AU2008329557B2 (en) | 2007-11-27 | 2014-08-14 | Commonwealth Scientific And Industrial Research Organisation | Plants with modified starch metabolism |
| AR083767A1 (es) | 2010-11-04 | 2013-03-20 | Arista Cereal Technologies Pty Ltd | Trigo con alto contenido de amilosa |
| CN104160029A (zh) | 2011-10-04 | 2014-11-19 | 阿凯笛亚生物科学公司 | 具有增加的抗性淀粉水平的小麦 |
| ES3000665T3 (en) * | 2011-11-04 | 2025-03-03 | Arista Cereal Tech Pty Ltd | High amylose wheat - ii |
-
2012
- 2012-11-02 ES ES12846192T patent/ES3000665T3/es active Active
- 2012-11-02 JP JP2014539188A patent/JP6346093B2/ja active Active
- 2012-11-02 US US13/668,177 patent/US9357722B2/en active Active
- 2012-11-02 AU AU2012327161A patent/AU2012327161B8/en active Active
- 2012-11-02 EP EP12846192.8A patent/EP2773183B1/en active Active
- 2012-11-02 WO PCT/AU2012/001349 patent/WO2013063653A1/en not_active Ceased
-
2016
- 2016-05-16 US US15/156,066 patent/US10798957B2/en active Active
-
2018
- 2018-01-05 JP JP2018000651A patent/JP7182878B2/ja active Active
-
2020
- 2020-09-14 US US17/019,960 patent/US11737482B2/en active Active
-
2023
- 2023-08-28 US US18/456,986 patent/US20240122218A1/en active Pending
Patent Citations (11)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1999014314A1 (en) | 1997-09-12 | 1999-03-25 | Commonwealth Scientific And Industrial Research Organisation | Regulation of gene expression in plants |
| WO1999032619A1 (en) | 1997-12-23 | 1999-07-01 | The Carnegie Institution Of Washington | Genetic inhibition by double-stranded rna |
| WO1999049029A1 (en) | 1998-03-20 | 1999-09-30 | Benitec Australia Ltd | Control of gene expression |
| WO1999053050A1 (en) | 1998-04-08 | 1999-10-21 | Commonwealth Scientific And Industrial Research Organisation | Methods and means for obtaining modified phenotypes |
| WO2001034815A1 (en) | 1999-11-05 | 2001-05-17 | Cambria Biosciences, Llc | Dsrna as insect control agent |
| WO2001062934A1 (en) | 2000-02-21 | 2001-08-30 | Commonwealth Scientific And Industrial Research Organisation | Starch branching enzyme |
| US20050074891A1 (en) | 2000-03-01 | 2005-04-07 | Allen Stephen M. | Starch branching enzyme IIb |
| WO2002037955A1 (en) | 2000-11-09 | 2002-05-16 | Commonwealth Scientific And Industrial Research Organisation | Barley with reduced ssii activity and starch containing products with a reduced amylopectin content |
| WO2004073390A1 (en) | 2003-02-19 | 2004-09-02 | Commonwealth Scientific And Industrial Research Organisation | Efficient gene silencing in plants using short dsrna sequences |
| WO2005001098A1 (en) | 2003-06-30 | 2005-01-06 | Commonwealth Scientific And Industrial Research Organisation | Wheat with altered branching enzyme activity and starch and starch containing products derived thereform |
| WO2006069422A1 (en) | 2004-12-30 | 2006-07-06 | Commonwealth Scientific And Industrial Research Organisation | Method and means for improving bowel health |
Non-Patent Citations (100)
| Title |
|---|
| "GenBank", Database accession no. AF338431.1 |
| "Genbank", Database accession no. Y11282 |
| ABEL ET AL., THE PLANT JOURNAL, vol. 10, 1996, pages 981 - 991 |
| ALTSCHUL ET AL., NUCL. ACIDS RES., vol. 25, 1997, pages 3389 |
| ALVAREZ ET AL., PLANT CELL, vol. 18, 2006, pages 1121 - 1133 |
| BAGA ET AL., PLANT MOL BIOL., vol. 40, no. 6, 1999, pages 1019 - 1030 |
| BATEY ET AL., CEREAL CHEMISTRY, vol. 74, 1997, pages 497 - 501 |
| BATEYCURTIN, STARCH, vol. 48, 1996, pages 338 - 344 |
| BECHTOLD ET AL., C.R. ACAD. SCI. PARIS, vol. 316, 1993, pages 1194 |
| BEKES ET AL., CRIT CARE MED, vol. 30, no. 8, 2002, pages 1906 - 1907 |
| BLAUTH ET AL., PLANT PHYSIOLOGY, vol. 127, 2001, pages 1396 - 1405 |
| BOTTICELLA E. ET AL.: "High resolution melting analysis for the detection of EMS induced mutations in wheat SBEIIa genes", BMC PLANT BIOLOGY, vol. 11, 10 November 2011 (2011-11-10), pages 156, XP021111690 * |
| BOTTICELLA ET AL., BMC PLANT BIOLOGY, vol. 11, 2011, pages 156 |
| BOYER ET AL., STARCH, vol. 32, 1980, pages 217 - 222 |
| BOYERPREISS, CARBOHYDRATE RESEARCH, vol. 61, 1978, pages 321 - 334 |
| BOYERPREISS, PLANT PHYSIOLOGY, vol. 67, 1981, pages 1141 - 1145 |
| COMAI ET AL., PLANT J., vol. 37, 2004, pages 778 - 786 |
| CRAIG ET AL., PLANT CELL, vol. 10, 1998, pages 399 - 412 |
| DELWICHE ET AL., CEREAL CHEM, vol. 83, no. 3, 2006, pages 287 - 292 |
| DOWELL ET AL., CEREAL CHEM, vol. 86, no. 3, 2009, pages 251 - 255 |
| DURAI ET AL., NUCLIEIC ACIDS RESEARCH, vol. 33, no. 18, 2005, pages 5978 - 5990 |
| ELLISON ET AL.: "Triticum aestivum spp. vulgare (bread wheat) cv. Sunstate", AUSTRALIAN JOURNAL OF EXPERIMENTAL AGRICULTURE, vol. 34, no. 6, 1994, pages 869 - 869 |
| FISHER ET AL., JOURNAL PLANT PHYSIOL., vol. 108, no. 3, 1995, pages 1313 - 1314 |
| FISHER ET AL., PLANT PHYSIOL, vol. 102, 1993, pages 1045 - 1046 |
| FUWA ET AL., STARCH-STARKE, vol. 51, 1999, pages 147 - 151 |
| GODDARD ET AL., AM J CLIN NUTR, vol. 39, 1984, pages 388 - 392 |
| GRAS ET AL., PROC. ICC 11TH INT. CEREAL AND BREAD CONGRESS, 2001 |
| HARAYAMA, TRENDS BIOTECHNOL, vol. 16, 1998, pages 76 - 82 |
| HARTMANNENDRES, MANUAL OF ANTISENSE METHODOLOGY, 1999 |
| HAYASHI ET AL.: "Effects of ion beam irradiation on mutation induction in rice. Cyclotrons and Their Applications 2007", EIGHTEENTH INTERNATIONAL CONFERENCE, 2007, pages 237 - 239 |
| HEDMANBOYER, BIOCHEMICAL GENETICS, vol. 20, 1982, pages 483 - 492 |
| HENIKOFF ET AL., PLANT PHYSIOL., vol. 135, 2004, pages 630 - 636 |
| HINCHEE ET AL., BIOTECH, vol. 6, 1988, pages 915 |
| JAMES ET AL., PLANT CELL, vol. 7, 1995, pages 417 - 429 |
| JOBLING ET AL., PLANT JOURNAL, vol. 18, 1999, pages 163 - 171 |
| KANNADAGGARD, PLANT CELL REP, vol. 21, 2003, pages 659 - 668 |
| KAWASAKI ET AL., MOL GEN GENET, vol. 237, no. 1-2, 1993, pages 10 - 6 |
| KAZAMA ET AL., PLANT BIOTECHNOLOGY, vol. 25, 2008, pages 113 - 117 |
| KIM ET AL., GENE, vol. 216, no. 2, 1998, pages 233 - 43 |
| KIM ET AL., PLANT PHYSIOL., vol. 121, no. 1, 1999, pages 225 - 236 |
| KLEIN ET AL., NATURE, vol. 327, 1987, pages 70 |
| KONIK-ROSE ET AL., STARCH-STARKE, vol. 53, 2001, pages 14 - 20 |
| KRUEGER ET AL., CEREAL CHEMISTRY, vol. 64, 1987, pages 187 - 190 |
| KUBO ET AL., PLANT PHYSIOLOGY, vol. 120, 1999, pages 1147 - 1155 |
| LANGRIDGE ET AL., AUST. J. AGRIC. RES., vol. 52, no. 1, 2001, pages 1043 - 1077 |
| LAZO ET AL., BIOTECHNOLOGY (N Y), vol. 9, no. 10, 1991, pages 963 - 967 |
| LE PROVOST ET AL., TRENDS IN BIOTECHNOLOGY, vol. 28, no. 3, 2009, pages 134 - 141 |
| LIU ET AL., BIOTECHNOLOGY AND BIOENGINEERING, vol. 106, 2010, pages 97 - 105 |
| MANN: "PhD thesis", 2002, UNIVERSITY OF READING, article "New crop phenomenon in wheat and the mechanisms involved" |
| MCCALLUM ET AL., NAT BIOTECHNOL, vol. 18, 2000, pages 455 - 457 |
| MCCLURE, J, NEAR INFRARED SPECTROSC, vol. 11, 2003, pages 487 - 518 |
| MCCREERYHELENTJARIS: "Methods in Molecular Biology", vol. 28, 1994, HUMANA PRESS INC., article "Protocols for nucleic acid analysis by non-radioactive probes", pages: 67 - 15 |
| MIZUNO ET AL., JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 268, 1993, pages 19084 - 19091 |
| MORELL ET AL., ELECTROPHORESIS, vol. 19, 1998, pages 2603 - 2611 |
| MORELL ET AL., PLANT J., vol. 34, 2003, pages 173 - 185 |
| MORELL ET AL., PLANT PHYSIOL, vol. 113, 1997, pages 201 - 208 |
| MORRISONLAIGNELET, J CEREAL SCI, vol. 1, 1983, pages 9 - 20 |
| MOULLET ET AL., THEOR APPL GENET, vol. 99, 1999, pages 305 - 313 |
| MYERS ET AL., PLANT PHYSIOLOGY, vol. 122, 2000, pages 989 - 997 |
| NAIR ET AL., PLANT SCI, vol. 122, 1997, pages 153 - 163 |
| NAKAMURA, PLANT CELL PHYSIOLOGY, vol. 43, 2002, pages 718 - 725 |
| NAKAMURAYAMANOUCHI, PLANT PHYSIOL., vol. 99, no. 3, 1992, pages 1265 - 1266 |
| NEEDLEMANWUNSCH, J. MOL. BIOL., vol. 48, 1970, pages 443 - 453 |
| PALATNIK ET AL., NATURE, vol. 425, 2003, pages 257 - 263 |
| PARIZOTTO ET AL., GENES DEV, vol. 18, 2004, pages 2237 - 2242 |
| POTRYKUS ET AL., MOL. GEN. GENET., vol. 199, 1985, pages 183 |
| PRASHER ET AL., BIOCHEM. BIOPHYS. RES. COMM., vol. 126, 1985, pages 1259 - 68 |
| RAHMAN ET AL., AUST. J. PLANT PHYSIOL., vol. 22, 1995, pages 793 - 803 |
| RAHMAN ET AL., GENOME, vol. 40, 1997, pages 465 - 474 |
| RAHMAN ET AL., PLANT PHYSIOL, vol. 125, 2001, pages 1314 - 1324 |
| RAHMAN ET AL., THEOR. APPL. GENET., vol. 98, 1999, pages 156 - 163 |
| REGINA ET AL., FUNCT PLANT BIOL, vol. 31, 2004, pages 591 - 601 |
| REGINA ET AL., JEXP BOT, vol. 61, no. 5, 2010, pages 1469 - 1482 |
| REGINA ET AL., PLANTA, vol. 222, 2005, pages 899 - 909 |
| REGINA ET AL., PROC NATL ACAD SCI USA, vol. 103, 2006, pages 3546 - 3551 |
| REPELLIN ET AL., PLANT GENE REG, 1997, pages 97 - 094 |
| SAFFORD ET AL., CARBOHYDRATE POLYMERS, vol. 35, 1998, pages 155 - 168 |
| SCHULMANKAMMIOVIRTA, STARCH, vol. 43, 1991, pages 387 - 389 |
| SCHWALL ET AL., NATURE BIOTACHNOLOGY, vol. 18, 2000, pages 551 - 554 |
| SESTILI ET AL., MOL BREEDING, vol. 25, 2010, pages 145 - 154 |
| SHARP ET AL., AUST J AGRIC RES, vol. 52, 2001, pages 1357 - 1366 |
| SHURE ET AL., CELL, vol. 35, 1983, pages 225 - 233 |
| SIDEBOTTOM ET AL., JOURNAL OF CEREAL SCIENCE, vol. 27, 1998, pages 279 - 287 |
| SISSONS ET AL., JOURNAL OF THE SCIENCE OF FOOD AND AGRICULTURE, vol. 87, 2007, pages 1874 - 1885 |
| SLADE A.J. ET AL.: "Development of high amylose wheat through TILLING", BMC PLANT BIOLOGY, vol. 12, 14 May 2012 (2012-05-14), pages 69, XP021132532 * |
| SLADEKNAUF, TRANSGENIC RES, vol. 14, 2005, pages 109 - 115 |
| SMEWING: "TX2 texture analyzer handbook", 1995, SMS LTD, article "The measurement of dough and gluten extensibility using the SMS/Kieffer rig and the TA" |
| SMITH ET AL., NATURE, vol. 407, 2000, pages 319 - 320 |
| STALKER ET AL., SCIENCE, vol. 242, 1988, pages 419 |
| SUN ET AL., PLANT PHYSIOL, vol. 118, 1998, pages 37 - 49 |
| TAKEDA ET AL., CARBOHYDRATE RESEARCH, vol. 246, 1993, pages 273 - 281 |
| TANAKA ET AL., NUCL. ACIDS RES., vol. 18, 1990, pages 6767 - 6770 |
| TETLOW ET AL., PLANT CELL, vol. 16, 2004, pages 694 - 708 |
| TETLOW ET AL., PLANT PHYSIOL, vol. 146, 2008, pages 1878 - 1891 |
| THILLET ET AL., J. BIOL CHEM., vol. 263, 1988, pages 12500 |
| VOGEL ET AL.: "Fermentation and Biochemical Engineering Handbook: Principles, Process Design, and Equipment", 1996, NOYES PUBLICATIONS |
| WATERHOUSE ET AL., PROC. NATL. ACAD. SCI. U.S.A., vol. 95, 1998, pages 13959 - 13964 |
| YAMAMORI ET AL., THEOR APPL GENET, vol. 101, 2000, pages 21 - 29 |
| YU ET AL., SCIENCE, vol. 307, 2005, pages 932 - 935 |
| ZWARCHANDLER, PLANTA, vol. 197, 1995, pages 39 - 48 |
Cited By (11)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2016526882A (ja) * | 2013-06-13 | 2016-09-08 | コモンウェルス サイエンティフィック アンド インダストリアル リサーチ オーガナイゼーション | 非常に低レベルのホルデインを有するオオムギ |
| JP2020110171A (ja) * | 2013-06-13 | 2020-07-27 | コモンウェルス サイエンティフィック アンド インダストリアル リサーチ オーガナイゼーション | 非常に低レベルのホルデインを有するオオムギ |
| US10849345B2 (en) | 2013-06-13 | 2020-12-01 | Commonwealth Scientific And Industrial Research Organisation | Barley with very low levels of hordeins |
| JP7102096B2 (ja) | 2013-06-13 | 2022-07-19 | コモンウェルス サイエンティフィック アンド インダストリアル リサーチ オーガナイゼーション | 非常に低レベルのホルデインを有するオオムギ |
| JP7290591B2 (ja) | 2013-06-13 | 2023-06-13 | コモンウェルス サイエンティフィック アンド インダストリアル リサーチ オーガナイゼーション | 非常に低レベルのホルデインを有するオオムギ |
| WO2019211796A1 (en) * | 2018-05-02 | 2019-11-07 | Cellectis | Engineering wheat with increased dietary fiber |
| CN112352053A (zh) * | 2018-05-02 | 2021-02-09 | 塞勒克提斯公司 | 增加膳食纤维的工程化小麦 |
| AU2019263104B2 (en) * | 2018-05-02 | 2022-11-10 | Cellectis | Engineering wheat with increased dietary fiber |
| US12012607B2 (en) | 2018-05-02 | 2024-06-18 | Cellectis | Engineering wheat with increased dietary fiber |
| FR3120318A1 (fr) | 2021-03-02 | 2022-09-09 | Arista Cereal Technologies Pty Ltd | Procédé de meunerie industrielle à rendement augmenté, farines obtenues par ce procédé, produits notamment de panification fabriqués à partir de ces farines |
| WO2024246182A1 (en) * | 2023-06-02 | 2024-12-05 | Plantcarb Aps | Barley plant having increased amylose content |
Also Published As
| Publication number | Publication date |
|---|---|
| EP2773183A4 (en) | 2015-04-15 |
| JP2018075031A (ja) | 2018-05-17 |
| EP2773183A1 (en) | 2014-09-10 |
| EP2773183B1 (en) | 2024-10-09 |
| US20130115362A1 (en) | 2013-05-09 |
| AU2012327161B8 (en) | 2016-12-08 |
| AU2012327161A1 (en) | 2013-06-20 |
| EP2773183C0 (en) | 2024-10-09 |
| US20210161185A1 (en) | 2021-06-03 |
| US20170064986A1 (en) | 2017-03-09 |
| US9357722B2 (en) | 2016-06-07 |
| US11737482B2 (en) | 2023-08-29 |
| JP7182878B2 (ja) | 2022-12-05 |
| AU2012327161A8 (en) | 2016-12-08 |
| JP6346093B2 (ja) | 2018-06-20 |
| JP2015504301A (ja) | 2015-02-12 |
| ES3000665T3 (en) | 2025-03-03 |
| US10798957B2 (en) | 2020-10-13 |
| US20240122218A1 (en) | 2024-04-18 |
| AU2012327161B2 (en) | 2016-11-03 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20240122218A1 (en) | High amylose wheat- ii | |
| US12075806B2 (en) | Food ingredients produced from high amylose wheat | |
| US20210289730A1 (en) | Barley and uses thereof | |
| US20190338299A1 (en) | High amylose wheat - iii | |
| US20210054394A1 (en) | High amylose wheat - iv |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| WWE | Wipo information: entry into national phase |
Ref document number: 2012327161 Country of ref document: AU |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 12846192 Country of ref document: EP Kind code of ref document: A1 |
|
| ENP | Entry into the national phase |
Ref document number: 2014539188 Country of ref document: JP Kind code of ref document: A |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2012846192 Country of ref document: EP |