WO2012102584A2 - 표적 바이러스 검출용 센서 및 이를 이용한 표적 바이러스 스크리닝 및 돌연변이 위치 분석 방법 - Google Patents

표적 바이러스 검출용 센서 및 이를 이용한 표적 바이러스 스크리닝 및 돌연변이 위치 분석 방법 Download PDF

Info

Publication number
WO2012102584A2
WO2012102584A2 PCT/KR2012/000655 KR2012000655W WO2012102584A2 WO 2012102584 A2 WO2012102584 A2 WO 2012102584A2 KR 2012000655 W KR2012000655 W KR 2012000655W WO 2012102584 A2 WO2012102584 A2 WO 2012102584A2
Authority
WO
WIPO (PCT)
Prior art keywords
target gene
sensor
region
target
detecting
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/KR2012/000655
Other languages
English (en)
French (fr)
Other versions
WO2012102584A9 (ko
WO2012102584A3 (ko
Inventor
이정훈
차미선
오흥범
박주성
최준규
박진혁
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
SNU R&DB Foundation
Original Assignee
SNU R&DB Foundation
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by SNU R&DB Foundation filed Critical SNU R&DB Foundation
Publication of WO2012102584A2 publication Critical patent/WO2012102584A2/ko
Publication of WO2012102584A9 publication Critical patent/WO2012102584A9/ko
Publication of WO2012102584A3 publication Critical patent/WO2012102584A3/ko
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/70Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
    • C12Q1/701Specific hybridization probes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/156Polymorphic or mutational markers

Definitions

  • the present invention relates to a sensor capable of detecting a target virus and analyzing a mutation position, and a method for detecting and detecting a virus using the same.
  • biosensors which are life devices capable of sensing physical and chemical stimuli from the outside by applying electronic engineering by simulating biological functions
  • biosensors differ from chemical sensors such as gas sensors and ion sensors in that they use biomaterials in the sensor.
  • Biosensors have been in the spotlight in terms of selectivity for the measurement object and sensitivity in terms of sensitivity.
  • biosensors use biomaterials such as enzymes, fungi, and tissues of animals and plants, which can be divided into two parts. It can be divided into sites that recognize specific molecules and cause physical and chemical changes in proportion to their concentrations, and sites that electrically signal these materials and chemical changes.
  • biosensor can selectively recognize a specific molecule in a sample, and does not need to be separated and purified separately, resulting in a short detection time and high accuracy.
  • biosensors are known as enzyme sensors using enzyme membranes, organella sensors using mitochondrial electron transfer particle membranes as receptors, microbial sensors using microbial membranes as receptors, and immune sensors using antigen or antibody membranes as receptors.
  • Such biosensors can be used to detect uric acid, gluconic acid, amino acids, NADH, glucose and certain antibodies.
  • Biochip In addition to biosensors, biochips are also being studied. Biochip refers to a chip in which DNA, protein or other ligands derived from living organisms are integrated at high density on a solid surface, combined, and microarrayed. In addition, the presence, function, and roles of biomolecules, which specifically interact with substances attached to these surfaces, can be rapidly analyzed in large quantities using various analytical methods. In addition, a biochip system is called a biochip system that combines biochemical processes such as gene expression and binding, protein distribution, or a biochemical process, reaction rate, or information processing device.
  • Biochips are largely classified into microarray chips, lab-on-a-chips (LOCs), and microfluidics chips, depending on the purpose of the biomaterial used and the degree of systemization.
  • LOCs lab-on-a-chips
  • microfluidics chips depending on the purpose of the biomaterial used and the degree of systemization.
  • Microarray chips are made by arranging and attaching biomolecules such as DNA or proteins called frubra to the chip in order to detect target genes or proteins, and representative DNA chips and proteins according to the attached biomolecules. Chips, other cell chips, glycochips and the like. Lab-on-a-Chip uses Micro Electro Mechaninal Systems (MEMS) technology to create microfluidic channels on a chip, which can perform a variety of tasks such as separation and purification, mixing, reaction, washing, and detection of biological and chemical samples. Much research is underway to make this possible.
  • MEMS Micro Electro Mechaninal Systems
  • the present invention has been studied to solve the above problems and to develop an analytical apparatus and method having the advantage of identifying the mutation and the position of the mutation in one screening as well as an efficient diagnosis method and cost reduction.
  • a biosensor capable of detecting a target gene and mutating position in a single experiment was developed.
  • the object of the present invention was achieved by developing a target virus detection and mutation site analysis method.
  • the present invention provides a sensor for detecting a target gene, including a nano interphase transducer attached with a polynucleotide complementary to the target gene, capable of detecting one or more target genes.
  • the present invention also provides a method for detecting the presence or absence of a target gene and a target gene mutation genotype analysis using a target gene detection sensor.
  • the present invention also provides a method for detecting the presence of a target virus and a target virus mutant genotyping method using a sensor for detecting a target virus.
  • a detection system comprising a sensor for detecting the target gene including the nano-interface transducer.
  • the present invention includes a nucleotide sequence complementary to the target gene and includes a nucleotide at the final end of 5 'that does not complementarily bind to the nucleotide at the expected position of the SNP of the target gene.
  • a nano-interface transducer thin membrane transducer
  • a target gene detection sensor comprising a nanointerface transducer to which the polynucleotide for target gene detection is attached
  • the capacitance of the sensor for detecting the target gene with the third polynucleotide is increased, the target gene is present in the sample, and the mutation region is located at the 5 'end and 3' end of the third polynucleotide.
  • the present invention provides a detection system including a target gene detection sensor including the nano-interface transducer, in order to more efficiently measure the target gene detection sensor and detection method.
  • the target gene detection sensor including the nano-interface transducer attached to the target gene detection polynucleotide of the present invention, it is possible to detect the presence or absence of the target gene in real time, and the presence or absence of the gene, Since location can be identified in real time, mutations can be useful for detecting many genotypes, particularly virus genotypes such as HPV and HCV and for detecting mutant genotypes.
  • the present invention can be very useful for early diagnosis and therapeutic development.
  • FIG. 1 is a conceptual diagram of a transducer using a conventional nano-interface.
  • Figure 2 is a block diagram of a structure for filling the second liquid in the transducer according to the present invention.
  • FIG 3 is a cross-sectional view of the deformation generating unit including a hole when the transducer according to the present invention is filled with the first liquid and the second liquid.
  • FIG. 4 is a cross-sectional view of one embodiment of a transducer according to the present invention.
  • FIG 5 is a cross-sectional view of the deformation generating unit near the hole of the transducer according to the present invention.
  • FIG. 6 is a view showing a method of manufacturing a transducer of an embodiment of the present invention.
  • FIG. 7 is a view showing a method of manufacturing the transducer of an embodiment of the present invention.
  • FIG. 8 is a diagram showing the state of the interface according to the binding state of the target material.
  • FIG. 9 is a diagram showing a change in capacitance when a target material is completely complementary to a polynucleotide of a nanointerface transducer.
  • FIG. 10 is a diagram illustrating a change in capacitance when a target material is completely non-complementarily bound to a polynucleotide of a nanointerface tube transducer.
  • FIG. 11 is a diagram illustrating the state of the nano-interface according to the binding state of the target material.
  • FIG. 12 is a diagram illustrating a change value of capacitance according to various binding states of a polynucleotide of a nanointerface tube transducer.
  • FIG. 13 is a diagram illustrating an example of a system including a detection sensor of the present invention and analyzing a signal obtained therefrom.
  • FIG. 14 is a diagram illustrating an example of a system including a conventional sensor array and analyzing a signal obtained therefrom.
  • 15 is a schematic diagram illustrating a process of processing a signal of the present system.
  • 16 is a diagram illustrating a signal before passing through a low pass filter.
  • 17 is a diagram illustrating a signal after passing through a low pass filter.
  • FIG. 18 is a diagram illustrating a change in a signal according to a concentration of a sample and a reactant of a sensor.
  • 19 is a diagram schematically illustrating a method of extracting accurate data using analyzed signals.
  • Figure 20 shows the changes in the shape of the ruins when the DPhPs and DNA sequence on the surface of the remains bound using a linker (N- (4-aminophenyl) maleimde). It was confirmed that the surface tension was reduced by the DNA attached to the surface of the remains, so that the remains were slightly floated.
  • Figure 21 shows the change in the shape of the remains when only the DPhPs on the surface of the remains. It was confirmed that the shape of the site remains unchanged if only geology exists in the site.
  • Figure 22 shows the presence of DPhPs-linker (N- (4-aminophenyl) maleimde) -DNA (SEQ ID NO: 7) on the surface, the DNA having a sequence complementary to the DNA (SEQ ID NO: 8), It was confirmed that the relics appeared when complementary binding between the DNA.
  • DPhPs-linker N- (4-aminophenyl) maleimde
  • Figure 23 shows the presence of DPhPs-linker (N- (4-aminophenyl) maleimde) -DNA (SEQ ID NO: 7) on the surface, the DNA (SEQ ID NO: 9) having a non-complementary sequence with the DNA In the absence of complementary binding between DNA, it was confirmed that the injury did not occur.
  • the present invention comprises a 14mer to 40mer comprising a nucleotide sequence complementary to a target gene, including the nucleotide at the last end of 5 'nucleotides that do not complementarily bind to the nucleotide at the expected position of the SNP of the target gene
  • Nanointerface with two or more polynucleotides selected from the group consisting of a third polynucleotide 'S transducer (thin membrane transducer) provides a detection target and the mutant, the target gene detecting sensor at the same time for analyzing the gene of the target gene containing the.
  • the target gene means a gene of interest among genes included in a specific sample.
  • the target gene may be DNA or RNA having artificially created artificial sequences, and means all genes obtained from cells of animals and plants including viruses and microorganisms obtained from nature.
  • the nucleotide of the position where the SNP (single nucleotide polymorphism) is expected may vary depending on the target gene and purpose, and means that the nucleotide having a different nucleotide than the kind of nucleotides possessed by most of the same group. . More preferably, the nucleotide at the position where the SNP is expected is preferably an SNP which may have a different phenotype depending on the genotype according to the SNP.
  • the first to third polynucleotides consist of nucleotides between 14 and 40 mer.
  • the first to third polynucleotides may consist of between 16 and 35 mer nucleotides, more preferably between 18 and 30 mer nucleotides.
  • the polynucleotides of the first to the third may be used in a range of 6 to 60 mer as long as it specifically binds to a target gene and does not hybridize with other genes.
  • the polynucleotide may be modified to bind to the nanointerface transducer, and such modification may be combined with a C 1 to C 20 alkyl group at the 5 'end of the polynucleotide, and binds to the nanointerface transducer.
  • a material such as thiol may be added.
  • these modifications can be appropriately changed depending on the purpose and the nanointerface transducer.
  • the nano-membrane transducer (thin membrane transducer) is possible if the target material can detect the target material by measuring the change in the fluid surface tension caused by the adsorption on the surface of the thin film of several tens to hundreds of nanometers in thickness.
  • the change in the fluid surface tension can be measured through the change in capacitance due to deformation of the thin film.
  • FIG. 1 What may be used here may be known as conventional nanointerface transducers (FIG. 1), but porous nanointerface transducers are preferred.
  • a chamber and the chamber are separated into a first region and a second region, and the first region for coupling with a target material on a surface in contact with the first region.
  • a binding layer to which the third polynucleotide may bind is provided, the deformation generating portion having a porous member shape including at least one hole penetrating the first region and the second region, and the deformation generating portion
  • a strain measuring member for measuring a strain amount, a first liquid provided in the first region and containing a target material, and a second liquid provided in the second region and forming an interface with the first liquid near the hole; It includes, the deformation generating unit is characterized in that the elastic deformation occurs as the target material is bonded to the bonding layer, characterized in that for measuring the force applied by the target material is bonded to the surface.
  • the first liquid 22 is hydrophilic
  • the second liquid 21 is hydrophobic
  • the second liquid 21 is silicone oil. It is preferable.
  • the deformation generating unit 13 may be any material that can be changed by the fluid surface tension, and is preferably a parylene material, which is a plastic obtained by paraxylene polymerization.
  • the deformation generating unit 13 is surface-treated to be hydrophilic on the surface in contact with the first region 19, and surface-treated to be hydrophobic on the surface in contact with the second region 17.
  • the bonding layer 32 may be replaced with a suitable material according to the purpose, but is preferably Au.
  • the deformation amount measuring member is fixed to the upper electrode 13 provided on a surface of the deformation generating unit 13 that is in contact with the second region 17, and is fixed to the inside of the second region 17.
  • a lower electrode 33 provided to form capacitance, and measuring capacitance between the upper electrode 31 and the lower electrode 32 according to the deformation of the deformation generator 13. It is characterized by.
  • the chamber (chamber), the substrate and the chamber is separated into a first region and a second region, and for coupling to the target material on the surface in contact with the first region
  • a binding layer capable of binding the first to third polynucleotides is provided, and includes a porous member shape provided on the substrate including one or more holes penetrating the first region and the second region.
  • a strain generating portion a strain measuring member for measuring a strain amount of the strain generating portion, a first liquid provided in the first region and containing a target material, and provided in the second region and near the hole; And a second liquid forming an interface with the liquid, wherein the deformation generating unit generates elastic deformation as the target material is bonded to the bonding layer, and is applied by binding the target material to the surface. It is characterized by measuring the force (see FIGS. 2 to 4).
  • the present invention comprises the steps of: 1) contacting the sample to the target gene detection sensor comprising a nano-interface transducer to which the target gene detection polynucleotide is attached; 2) measuring a signal of capacitance generated from the detection sensor; And 3) analyzing the signal of the capacitance to determine the presence or absence of the target gene and the location of the mutation of the target gene.
  • the present invention in the step of determining the presence or absence of the target gene and the mutation of the target gene,
  • the capacitance of the sensor for detecting the target gene with the first polynucleotide attached decreases, the target gene is present in the sample, and the mutant region of the target gene in the sample is present at the 5 'end of the first polynucleotide sequence. Judging,
  • the capacitance of the sensor for detecting the target gene with the second polynucleotide attached decreases, the target gene is present in the sample, and the mutant region of the target gene in the sample is present at the final end of 3 'of the second polynucleotide sequence. Judging, or
  • the capacitance of the sensor for detecting the target gene with the third polynucleotide is increased, the target gene is present in the sample, and the mutant region of the target gene in the sample has the final end of 5 'and 3' of the third polynucleotide.
  • the presence or absence of the target gene in the sample can be easily detected as a change in capacitance.
  • the difference in capacitance according to the position of the target gene can be sensitively detected even the difference of one nucleotide.
  • the location of the SNP may vary depending on the purpose performed, if the target gene is a known gene, there will also be information about the location of the relevant SNP, in which case the SNP may be placed between the 5 'end or 3' end of the probe. Fabricating the probe to be positioned is now known to those skilled in the art.
  • the location of such mutations can be very useful for the measurement of single nucleotide pholymorphism in which a variety of diseases can be caused by modification of one nucleotide sequence in genes. It is very diverse, and may be very useful for detecting a virus in which the degree and treatment of the disease may vary depending on the mutant genotype.
  • the virus that can be applied to the present invention may be applicable to various kinds such as influenza virus, coronavirus, HIV virus, human papilloma virus (HPV) and hepatitis C virus (HCV).
  • influenza virus coronavirus
  • HIV virus HIV virus
  • HPV human papilloma virus
  • HCV hepatitis C virus
  • HPV and HCV virus detection and mutant genotyping methods that have many mutations and may exhibit various symptoms depending on the mutation.
  • the target virus can also be used for hepatitis C virus detection and hepatitis C virus mutant genotyping, characterized in that hepatitis C virus (HCV).
  • HCV hepatitis C virus
  • the present invention provides a detection system comprising a target gene detection sensor including the nano-interface transducer.
  • the signal analysis step may be performed as follows.
  • the analog data sensed by the detection sensor device 101 including the nano-interface transducer is amplified by the amplification device 102.
  • the amplification apparatus attached to each column is selectively operated by a signal generated by a column decoder.
  • the amplified analog signal of the sensor array pointer to be measured is converted into digital data by the ADC 104.
  • the data converted to digital data is stored in the buff and then in the storage RAM 105 via an appropriate format converter.
  • the noise signal of the biosensor Since the analog signal of the biosensor is very weak, the noise is affected by the noise, so the data stored in the RAM is added to the original bio signal. Therefore, the noise signal should be removed in a proper way. The symptoms of the disease must be judged from the noise-free signal.
  • FlashROM nonvolatile memory
  • the system of the present invention is in the form of an array having many sensor pointers, it is possible not only to mount various reactants but also to mount the same reactants on multiple sensing pointers. By mounting the same reactant on multiple sensing pointers, differences in sensor sensitivity and arrays can be addressed.
  • the best measurement information for a specific reactant is stored in the flash ROM 106 of FIG. 13 and the data closest to the stored data are selected among the data measured at various pointers. In this process, the measured values are normalized to overcome the difference in sensitivity according to the sensors.
  • a saturation signal from the sensor is used as a basis for judgment after sufficient time has elapsed.
  • the bio signal varies in slope after a certain reaction time elapses as shown in FIG. 18 according to the concentration of the sample and the reactants of the array. Two kinds of information, slope and saturated according to concentration and substance, can be used to diagnose disease infection more accurately.
  • the amplification device 102 is connected to the sensor device 101 for detecting a target gene including a nano-interface transducer, and one of the input signals is selected for the amplification device 102.
  • the selection device 103 was connected.
  • the converter 104 was connected to the selection device 103, and the converter 104 and the temporary storage device 106 were connected to the processing device 107.
  • the storage device 105 and the display device 108 were connected to the processing device 107.
  • a system manufactured by being connected to the apparatus 109 for asynchronous transmission and reception of data to or from the processing unit 107 or the apparatus 110 for transmitting and receiving in a synchronous manner is possible.
  • This system has many advantages over the conventional system (FIG. 14). In particular, from the structural point of view, it is economical because it can be miniaturized than the conventional one, and has less impact on noise. In addition, accurate data measurements can be made.
  • CMOS Complementary Metal Oxide Semiconductor
  • ADC analog-to-digital converter
  • CMOS amplification apparatus capable of amplifying a sensor array and a weak signal of the sensor array can be simultaneously manufactured as shown in FIG.
  • system of the present invention can overcome the sensor's sensitivity difference and the sensor defect by mounting the same reactant on several sense pointers and measuring the data most similar to the best measured data. Similar data selection process is shown in FIG.
  • the system of the present invention can determine the presence or absence of a disease or virus and mutation through the following process.
  • the measurement signal of the array sensor (n) is amplified in step (102) of FIG. 13 and then selected by the selector 103, converted from the ADC 104 to digital, stored in the storage device 105, and processed.
  • a reference database previously stored in the temporary storage device 106 is compared with a measurement signal stored in the storage device 105.
  • the CPU removes noise through low-pass filtering (2) in FIG. 15 and compares the measured signal with a slope or a predetermined interval at the same point of the measured signal to be compared with the reference DB.
  • the result of the signal processing is compared (4 in FIG. 15), and the disease signal is determined by extracting the measurement signal closest to the reference DB (6 in FIG. 15).
  • the present invention can accurately determine the disease by using the slope and the final value of the measured data as a disease judgment criteria.
  • Probe and its complementary and non-complementary DNA, mismatched 5 'and 3' positions, and two internals to measure capacitance changes with binding states in nanointerface transducers DNA with mis-match was prepared (SEQ ID NOS: 1-6).
  • the probe was prepared by combining hexanethiol in the 5 'portion in order to facilitate the coupling with the nano-interface transducer.
  • Nano interface transducers were manufactured by the following process.
  • the lower electrode 33 was formed on the insulating layer 11. Thereafter, a sacrificial layer 12 covering a portion of the insulating layer and a portion of the lower electrode 33 was formed.
  • the upper electrode 31 extends to the upper portion of the sacrificial layer 12 and is spaced apart from the lower electrode 33, and the deformation generator 13 is formed to cover the sacrificial layer 12.
  • the bonding layer 32 is formed on the deformation generating unit 13.
  • a hole is formed through the bonding layer 32, the deformation generating unit 13, and the upper electrode 31 at the same time.
  • the sacrificial layer 12 is removed to remove the nanointerface transducer. Was prepared (see FIGS. 6 and 7).
  • the substrate 10 is made of a low resistivity silicon material, it may be a glass material.
  • the deposition process of the insulating layer 11 is performed by plasma enhanced chemical vapor deposition (PECVD), a low pressure chemical vapor deposition (LPCVD) method is also possible.
  • PECVD plasma enhanced chemical vapor deposition
  • LPCVD low pressure chemical vapor deposition
  • the lower electrode for flowing the current was installed in Cr / Au, the Cr layer was a layer for improving the adhesion, the Au layer was deposited thereon, the deposition was carried out by the e-gun evaporator method.
  • the sacrificial PR layer 12 was later used to form the internal space of the transducer, and was used using a photoresist of AZ5214.
  • the upper electrode 31 which performs the upper electrode function of the transducer was also manufactured using Cr / Au.
  • the deformation generating unit 13 is made of parylene, which is a polymer material, but may be made of other polymer materials.
  • the hole pattern is formed by a positive panning method, and the hole penetrates through the thin film, the upper electrode 31, and the bonding layer 32 of the deformation generating unit 13, and the inside and outside of the deformation generating unit 13. To be connected. In this case, if there is no bonding layer 32, it may be manufactured to penetrate the deformation generating unit 13 and the upper electrode 31.
  • the upper surface of the thin film was surface treated to have hydrophilic properties through a plasma process.
  • the sacrificial layer 12 was removed through a hole using critical point drying using acetone as the medium. At this time, a solvent such as methanol may be used in addition to acetone.
  • the second liquid silicon oil was filled in the space where the sacrificial layer 12 was removed.
  • the second liquid may be used in addition to the silicone oil hydrophobic liquid according to the purpose.
  • the detection sensor for detecting the target gene is as shown in FIG. 2. However, depending on the purpose, more nanointerface transducers may be included.
  • the probe prepared in ⁇ Production Example 1> was bonded to the bonding layer of the nano-interface transducer.
  • the amplifying device 102 is connected to the sensor device 101, and a selecting device 103 for selecting one of the input signals is connected to the amplifying device 102.
  • the converter 104 was connected to the selection device 103, and the converter 104 and the temporary storage device 106 were connected to the processing device 107.
  • the storage device 105 and the display device 108 were connected to the processing device 107.
  • the processing device 107 is connected to the device 109 for asynchronous transmission and reception of data or the device 110 for transmission and reception in a synchronous manner.
  • the sensor device 101 may be a device for detecting a biosignal using a capacitance difference, and in particular, a sensor including the nano-interface transducer manufactured above may be used.
  • the amplifying device 102 may be a device for amplifying an analog signal in the sensor device, and in particular, a CMOS amplifying device may be used.
  • the selection device 103 is a device for selecting one of several analog input signals, and may select a suitable portion of the signal from the sensor device.
  • the conversion device 104 is a device for converting analog data into digital data, wherein the data converted into digital data is stored in a buffer, and then stored in the storage device RAM 105 through an appropriate format converter.
  • the storage device 105 uses RMA as a device for storing the data necessary for signal processing or the processed final result using the digitally converted data and the CPU measured by the sensor.
  • the temporary storage device 106 uses a flash Rom as a device for storing a program to be executed in the CPU, and reference data necessary for signal processing and disease determination.
  • the processing device 107 is a device for removing noise from the noise-mixed data obtained by the sensor array, selecting the best data, and then determining the disease.
  • the display device 108 is a device for displaying measured data or determined results, and an appropriate display device may be used according to a display method.
  • the transmitting and receiving device may be selectively or simultaneously used by the asynchronous transmitting and receiving device 109 and the synchronous transmitting and receiving device 110, the asynchronous transmitting and receiving device 109 is asynchronous method to measure the data measured in the sense array
  • the asynchronous transmitting and receiving device 109 is asynchronous method to measure the data measured in the sense array
  • the synchronous transmission / reception apparatus 110 is a device for transferring data measured in a sense array to a personal computer or receiving a program or data from the personal computer in a synchronous manner. to be.
  • the detection sensor including the nanointerface transducer to which the probe of SEQ ID NO: 1 was bound was treated with the DNA of the probe of SEQ ID NO: 1 (SEQ ID NO: 2) and non-complementary DNA (SEQ ID NO: 3). Then, the difference in capacitance generated in the nanointerface transducer was measured (Keithly 2400 Sourcemeter, Keithly, USA).
  • the detection sensor including the nanointerface transducer coupled with the probe of SEQ ID NO: 1 was treated with the probe of SEQ ID NO: 1 and DNA having two mis-matches inside (SEQ ID NO: 6). Then, the difference in capacitance generated in the nanointerface transducer was measured (Keithly 2400 Sourcemeter, Keithly, USA).
  • the detection sensor including the nanointerface transducer coupled with the probe of SEQ ID NO: 1 was treated with DNA (SEQ ID NOs: 4 and 5) having mis-matches at the positions of the probe of SEQ ID NO: 1 and 3 'and 5'. Then, the difference in capacitance generated in the nanointerface transducer was measured (Keithly 2400 Sourcemeter, Keithly, USA).
  • the chloroform solution was evaporated through nitrogen injection into DPhPS (Diphytanoyl glycerol phospho serine) solution (please tell us where to buy) dissolved in chloroform at a concentration of 10 mg / ml.
  • DPhPS Diphytanoyl glycerol phospho serine
  • EDC Ethyl-3- [3-dimethylaminopropyl] carbodiimide hydrochloride
  • NHS N-hydroxysulfosuccinimide
  • N- (4-aminophyenyl) malemide molecules containing amine groups must be maintained at pH 7.2 to 7.4 to immobilize already activated molecules. Therefore, after buffer exchange using 1X PBS buffer (pH 7.2 ⁇ 7.4), N- (4-aminophyenyl) malemide was dissolved in 1X PBS buffer at a concentration of 500 ⁇ M and injected into 10 ⁇ l for 2 hours.
  • Reference Signs List 10 substrate, 11: insulating layer, 12: sacrificial layer, 13: strain generating portion, 17: second space, 19: first space, 21: second liquid, 22: first liquid, 31: upper electrode, 32 : Bonding layer, 33: lower electrode
  • 201 sensor device
  • 202 conversion device
  • 303 mixing device
  • 204 buffer device
  • 205 storage device
  • 206 temporary storage device
  • 207 processing device
  • 208 display device
  • 209 asynchronous transmission and reception Device
  • 220 synchronous transceiver
  • Sensors capable of detecting target genes and mutating sites of the present invention are devices capable of detecting target genes using minimal probes, and do not require PCR for amplification and labeling for target detection. Target genes can be detected quickly and electrically. Moreover, one screening can be used to check for mutations in real time. Therefore, the present invention may be very useful for detecting and genotyping viruses in which various mutations exist.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Analytical Chemistry (AREA)
  • Molecular Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Genetics & Genomics (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Virology (AREA)
  • Apparatus Associated With Microorganisms And Enzymes (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Investigating Or Analyzing Materials By The Use Of Electric Means (AREA)

Abstract

본원 발명은 표적 바이러스 검출 및 돌연변이 위치를 분석할 수 있는 센서 및 검출 방법에 대한 것이다. 보다 구체적으로 표적 바이러스의 돌연변이 예상 위치가 5'의 최종 말단, 내부 또는 3'의 최종 말단에 위치한 프루브를 포함한, 나노계면트랜스듀서로 구성된 표적 바이러스 검출용 센서 및 이를 이용하여, 정전 용량의 변화를 이용하여, 표적 바이러스의 유무를 스크리닝 하는 방법 및 돌연변이의 위치를 분석하는 방법에 대한 것이다. 본원 발명은 바이러스 검출 및 바이러스의 유전자형을 동시에 검출할 수 있다.

Description

표적 바이러스 검출용 센서 및 이를 이용한 표적 바이러스 스크리닝 및 돌연변이 위치 분석 방법
본 발명은 표적 바이러스 검출 및 돌연변이 위치를 분석할 수 있는 센서 및 이를 이용한 바이러스 검출 및 돌연변이 위치 분석 방법에 대한 것이다.
바이오 기술이 발전함에 따라, 보다 신속하고 보다 정확한 분석 기술에 대한 요구와 필요성이 점차 증가하고 있다. 이러한 분석 기술 중 최근 바이오센서 및 바이오칩에 대한 연구가 많이 진행되고 있다. 특히, 생물 기능을 모사 하여 전자 공학을 응용함으로써 외부로부터 받은 물리·화학적 자극을 감지할 수 있는 생명소자인 바이오센서에 대한 수요가 지속적으로 증가하고 있다. 이러한 바이오센서는 가스 센서나 이온 센서와 같이 화학물질을 검출하는 화학 센서에 비하여, 센서 내에 생체 물질을 이용한다는 점에서 차이가 있다. 바이오센서는 측정 대상에 대한 선택성 면이나, 감도가 매우 민감하다는 면에서 각광을 받고 있다.
현재까지 바이오센서에 대한 다양한 연구가 진행되고 있는데, 이런 바이오센서는 효소, 균류 및 동·식물의 조직 등 생체 물질을 이용하는 것으로, 크게 두 부분으로 나뉘어 질 수 있다. 특정 분자를 인식하고 그 농도에 비례하여 물리, 화학적 변화를 일으키게 하는 부위와, 이들 물질, 화학적 변화를 전기 신호화하는 부위로 나눌 수 있다. 이러한, 바이오센서는 특히, 시료 속의 특정 분자를 선택적으로 인식할 수 있으며, 별도로 분리 정제를 하지 않아도 되므로, 검출 시간이 짧으며, 정확도가 높다.
기존에 널리 알려진 바이오센서는 효소막를 이용하는 효소 센서, 미토콘드리아 전자전달 입자막을 리셉터로 이용하는 오르가넬라 센서, 미생물막을 리셉터로 이용하는 미생물 센서, 그리고 항원막 또는 항체막을 리셉터로 이용하는 면역 센서 등 여러가지가 알려져 있으며, 이러한 바이오센서를 이용하여, 요산, 글루코산, 아미노산, NADH, 글루코즈 및 특정 항체 등을 검출할 수 있다.
그러나, 효소센서의 경우 가격은 저렴한 반면 감응시간이 상대적으로 길며, 다음 분석을 위한 시간적 간격이 길고, 여러 가지 막이나 세포 소기관을 이용할 경우 안정성에 문제가 있으므로, 상용화시 여러가지면에서 문제점이 대두되고 있다.
바이오센서와 더불어 바이오칩 또한 많은 연구가 이루어지고 있다. 바이오칩이란 생물에서 유래된 DNA, 단백질 또는 그 외의 리간드를 고체표면에 고밀도로 집적화하고, 조합하여, 마이크로어레이화 시킨 칩을 말한다. 또한, 이들 표면에 부착된 물질들과의 특이적으로 상호작용하는, 생체분자들의 존재, 기능 및 역할들을 다양한 분석방법을 이용하여 대량으로 신속하게 분석할 수 있다. 또한, 이와 더불어, 유전자 발현 및 결합, 또는 단백질 분포 등의 생물학적 정보를 얻거나 생화학적 공정 및 반응 속도 또는 정보 처리 속도를 높일 수 있는 도구나 장치 등을 합하여 바이오칩 시스템이라고 불린다.
바이오칩은 사용되는 생체물질의 용도, 시스템화 정도 등에 따라 크게 마이크로어레이칩(Microarray chip), 랩온어칩(Lab-on-a-chip, LOC) 및 마이크로플루이딕스칩(Microfluidics chip)으로 구분된다.
마이크로어레이칩은 대상 유전자나 단백질을 감지하기 위하여 프루브라 불리는 수천 혹은 수 만개 이상의 DNA나 단백질과 같은 생물 분자를 어레이 형태로 칩에 배열, 부착시켜 만들며, 부착하는 생물분자에 따라 대표적인 DNA칩, 단백질칩, 그 밖에 세포칩, glycochip 등을 들 수 있다. 랩온어칩은 MEMS(Micro Electro Mechaninal Systems)기술을 이용하여 칩 위에 미세유체 채널(Microfluidic channels)을 만들어, 생물 및 화학시료의 분리 및 정제, 혼합, 반응, 세척, 검출 등 다양한 작업을 하나의 칩 위에서 할 수 있게 만든 것으로 현재 많은 연구가 진행 중에 있다.
바이러스 검출의 경우, 바이러스는 매우 다양한 변이를 갖는 유전자형이 존재하며, 그 종류에 따라 신속한 검출과 유전형 변이 판별이, 치료와 직결되는 경우가 많아 검출 방법 및 돌연변이 분석방법이 매우 중요 하다. 특히, HPV와 HCV와 같이 다양한 돌연변이를 갖는 바이러스의 검출은 그 중요성이 점차 증대되고 있는 실정이다.
현재의 진단 센서 및 바이오칩은, 방사선이나 형광 물질 등의 별도의 라벨링 처리 과정이 필요하며, PCR 과정이 수반되는 경우가 많아 시간 및 비용이 많이 소요되고, 돌연변이 유전자형을 스크리닝하기 위하여는 각각의 프루브 제작이 필요하므로 비용이 많이 소요된다.
따라서, 상기와 같은 문제점을 해소하고, 효율적 진단 방법 및 비용 경감 뿐 아니라, 한번의 스크리닝으로 돌연변이 여부 및 돌연변이 위치를 파악할 수 있는 장점을 갖는 분석기구 및 방법을 개발하기 위하여 연구하였다. 그 결과, 본원 발명과 같이 한번의 실험으로 표적 유전자 검출 및 돌연변이 위치를 분석할 수 있는 바이오센서를 개발하였다. 이것을 이용한 정전 용량의 변화 분석을 통하여, 표적 바이러스 검출 및 돌연변이 위치 분석 방법을 개발함으로서 본 발명의 목적을 달성하였다.
상기 목적을 해결하기 위하여,
본 발명은 하나 이상의 표적 유전자를 검출할 수 있는, 표적 유전자와 상보적인 폴리뉴클레오티드가 부착된 나노계면트랜스듀서(nano interphase transducer)를 포함하는, 표적 유전자 검출용 센서를 제공한다.
또한, 본 발명은 표적 유전자 검출용 센서를 이용하여 표적 유전자의 유무 검출 및 표적 유전자 돌연변이 유전자형 분석 방법을 제공한다.
또한, 본 발명은 표적 바이러스 검출용 센서를 이용하여 표적 바이러스의 유무 검출 및 표적 바이러스 돌연변이 유전자형 분석 방법을 제공한다.
아울러, 본 발명의 표적 유전자 검출 및 검출 방법을 보다 효율적으로 측정하기 위하여, 상기 나노계면트랜스듀서를 포함하는 표적 유전자 검출용 센서를 포함한 검출 시스템을 제공한다.
상기 목적을 달성하기 위하여, 본 발명은, 표적 유전자와 상보적인 염기 서열을 포함하며 상기 표적 유전자의 SNP가 예상되는 위치의 뉴클레오티드와 상보적으로 결합하지 않는 뉴클레오티드를 5'의 최종 말단에 포함하는 14머 내지 40머로 구성되는 제1 폴리뉴클레오티드, 표적 유전자와 상보적인 염기 서열을 포함하며 상기 표적 유전자의 SNP가 예상되는 위치의 뉴클레오티드와 상보적으로 결합하지 않는 뉴클레오티드를 3'의 최종 말단에 포함하는 14머 내지 40머로 구성되는 제2 폴리뉴클레오티드, 및 표적 유전자와 상보적인 염기 서열을 포함하며 상기 표적 유전자의 SNP가 예상되는 위치의 뉴클레오티드와 상보적으로 결합하지 않는 뉴클레오티드를 5'의 최종 말단과 3'의 최종 말단 사이에 포함하는 14머 내지 40머로 구성되는 제3 폴리뉴클레오티드로 구성된 군으로부터 선택된 2개 이상의 폴리뉴클레오티드가 부착된 나노계면트랜스듀서(thin membrane transducer)를 포함하는, 표적 유전자의 검출 및 표적 유전자의 돌연변이를 동시에 분석하는, 표적 유전자 검출용 센서를 제공한다.
또한, 본 발명은,
1) 표적 유전자 검출용 폴리뉴클레오티드가 부착된 나노계면트랜스듀서를 포함하는 표적 유전자 검출용 센서에 샘플을 접촉하는 단계;
2) 상기 검출용 센서로부터 발생한 정전 용량의 신호를 측정하는 단계; 및
3) 정전 용량의 신호를 분석하여, 표적 유전자의 유무 및 표적 유전자의 돌연변이의 위치를 결정하는 단계를 포함하는, 표적 유전자 검출 및 표적 유전자 돌연변이 유전자형 분석 방법을 제공한다.
또한, 본 발명은
표적 유전자의 유무 및 표적 유전자의 돌연변이의 위치를 결정하는 단계에 있어서,
샘플 접촉시, 제1 폴리뉴클레오티드가 부착된 표적 유전자 검출용 센서의 정전 용량이 감소하면, 샘플내에 표적 유전자가 존재하며, 돌연변이 지역이 제1 폴리뉴클레오티드 5'의 최종 말단에 존재하는 것으로 판단하는 단계,
샘플을 처리시, 제2 폴리뉴클레오티드가 부착된 표적 유전자 검출용 센서의 정전 용량이 감소하면, 샘플내에 표적 유전자가 존재하며, 돌연변이 지역이 제2 폴리뉴클레오티드 3'의 최종 말단에 존재하는 것으로 판단하는 단계, 또는
샘플을 처리시, 제3 폴리뉴클레오티드가 부착된 표적 유전자 검출용 센서의 정전 용량이 증가하면, 샘플내에 표적 유전자가 존재하며, 돌연변이 지역이 제3 폴리뉴클레오티드의 5'의 최종 말단과 3'의 최종 말단 사이에 존재하는 것으로 판단하는 단계를 추가적으로 포함하는, 표적 유전자 검출 및 돌연변이 유전자형 분석 방법을 제공한다.
아울러, 본 발명은 표적 유전자 검출용 센서 및 검출 방법을 보다 효율적으로 측정하기 위하여, 상기 나노계면트랜스듀서를 포함하는 표적 유전자 검출용 센서를 포함한 검출 시스템을 제공한다.
본 발명의 표적 유전자 검출용 폴리뉴클레오티드가 부착된 나노계면트랜스듀서를 포함하는 표적 유전자 검출용 센서를 이용하면, 표적 유전자 유무를 전기적으로 실시간 검출할 수 있으며, 유전자 유무뿐 아니라, 돌연변이 유무 및 돌연변이의 위치까지 실시간으로 확인할 수 있으므로, 돌연변이가 많은 유전자형, 특히 HPV 및 HCV와 같은 바이러스 검출 및 돌연변이 유전자형을 검출하는데 유용할 수 있다.
이러한, 신속한 유전자 검출로 인해, 조기 진단 및 치료제 개발에 본 발명은 매우 유용하게 활용될 수 있다.
도 1은 종래의 나노계면을 이용한 트랜스듀서의 개념도이다.
도 2는 본 발명에 의한 트랜스듀서에 제2 액체를 채우는 구조체의 구성도이다.
도 3은 본 발명에 의한 트랜스듀서에 제1 액체 및 제2 액체가 채워졌을 때, 홀을 포함한 변형 발생부의 단면도이다.
도 4는 본 발명에 의한 트랜스듀서의 일 실시예의 단면도이다.
도 5는 본 발명에 의한 트랜스듀서의 홀 근처의 변형 발생부의 단면도이다.
도 6은 본 발명의 일 실시예의 트랜스듀서의 제작방법을 나타낸 도면이다.
도 7은 본 발명의 일 실시예의 트랜스듀서의 제작방법을 나타낸 도면이다.
도 8은 표적물질의 결합 상태에 따른 계면의 상태를 도식화한 도면이다.
도 9은 표적물질이 나노계면튜랜스듀서의 폴리뉴클레오티드와 완전히 상보적 결합을 했을시의 정전 용량의 변화값을 도식화한 도면이다.
도 10은 표적물질이 나노계면튜랜스듀서의 폴리뉴클레오티드와 완전히 비상보적 결합을 했을시의 정전 용량의 변화값을 도식화한 도면이다.
도 11는 표적물질의 결합 상태에 따른 나노계면의 상태를 도식화한 도면이다.
도 12은 표적물질이 나노계면튜랜스듀서의 폴리뉴클레오티드와 다양한 결합 상태에 따른 정전 용량의 변화값을 도식화한 도면이다.
도 13은 본 발명의 검출 센서를 포함하고, 이로부터 얻은 신호를 분석하기 위한 시스템의 일례를 도식화한 도면이다.
도 14는 종래의 센서어레이를 포함하고, 이로부터 얻은 신호를 분석하기 위한 시스템의 일례를 도식화한 도면이다.
도 15는 본 시스템의 신호를 처리하는 과정을 개략적으로 도식화한 도면이다.
도 16은 Low Pass Filter를 거치기 전의 신호를 도식화한 도면이다.
도 17은 Low Pass Filter를 거친 후의 신호를 도식화한 도면이다.
도 18은 시료의 농도 및 센서의 반응 물질에 따른 신호의 변화를 도식화한 도면이다.
도 19는 분석된 신호를 이용하여, 정확한 데이터를 추출하는 방법의 개요를 도식화한 도면이다.
도 20은 유적 표면에 있는 DPhPs와 DNA 서열을 링커(N-(4-aminophenyl)maleimde)를 사용하여 결합하였을 경우 유적 형태 변화를 나타내는 것이다. 유적 표면에 부착된 DNA에 의해 표면 장력이 감소하여 유적이 약간 부상(flotation)하였음을 확인하였다.
도 21은 유적 표면에 DPhPs만이 존재 할 경우의 유적 형태의 변화를 나타내는 것이다. 유적 내에 지질만이 존재할 경우 유적의 형태는 변하지 않음을 확인하였다.
도 22는 표면에 DPhPs-링커(N-(4-aminophenyl)maleimde)-DNA(서열번호 7)가 존재하는 유적에, 상기 DNA와 상보적인 서열을 갖는 DNA(서열번호 8)을 처리시에, DNA간의 상보적인 결합시에 유적이 부상하였음을 확인하였다.
도 23은 표면에 DPhPs-링커(N-(4-aminophenyl)maleimde)-DNA(서열번호 7)가 존재하는 유적에, 상기 DNA와 비-상보적인 서열을 갖는 DNA(서열번호 9)를 처리시에, DNA간의 상보적인 결합이 없을 경우 유적에 부상이 일어나지 않음을 확인하였다.
이하, 본 발명을 상세히 설명한다.
본 발명은, 표적 유전자와 상보적인 염기 서열을 포함하며, 상기 표적 유전자의 SNP가 예상되는 위치의 뉴클레오티드와 상보적으로 결합하지 않는 뉴클레오티드를 5'의 최종 말단에 포함하는 14머 내지 40머로 구성되는 제1 폴리뉴클레오티드, 표적 유전자와 상보적인 염기 서열을 포함하며, 상기 표적 유전자의 SNP가 예상되는 위치의 뉴클레오티드와 상보적으로 결합하지 않는 뉴클레오티드를 3'의 최종 말단에 포함하는 14머 내지 40머로 구성되는 제2 폴리뉴클레오티드, 및 표적 유전자와 상보적인 염기 서열을 포함하며, 표적 유전자의 SNP가 예상되는 위치의 뉴클레오티드를 5'의 최종 말단과 3'의 최종 말단 사이에 포함하는 14머 내지 40머로 구성되는 제3 폴리뉴클레오티드로 구성된 군으로부터 선택된 2개 이상의 폴리뉴클레오티드가 부착된 나노계면트랜스듀서(thin membrane transducer)를 포함하는, 표적 유전자의 검출 및 표적 유전자의 돌연변이를 동시에 분석하는, 표적 유전자 검출용 센서를 제공한다.
상기에서, 표적 유전자라고 함은 특정 샘플에 포함된 유전자 중 관심있는 유전자를 의미한다. 표적 유전자는 인위적으로 만들어진 인공 서열을 갖는 DNA나 RNA등이 될 수 있으며, 자연으로부터 얻은 바이러스, 미생물을 비롯한 동식물의 세포에서 얻어지는 모든 유전자를 의미한다.
상기에서, SNP(단일염기다형성, single nucleotide polymorphism)가 예상되는 위치의 뉴클레오티드란, 표적 유전자 및 목적에 따라 달라질 수 있으며, 동일한 그룹의 대부분이 가지고 있는 뉴클레오티드의 종류가 아닌 다른 뉴클레오티드를 가지는 것을 의미한다. 보다 바람직하게, 상기 SNP가 예상되는 위치의 뉴클레오티드는, 상기 SNP에 따른 유전형에 따라서, 다른 표현형을 가질 수 있는 SNP인 것이 바람직하다.
상기에서, 제1 내지 3의 폴리뉴클레오티드는 14머 에서 40머 사이의 뉴클레오티드로 구성된다. 그러나, 바람직하게 제1 내지 3의 폴리뉴클레오티드는 16머 에서 35머 사이의 뉴클레오티드로 구성될 수 있으며, 보다 바람직하게 18머 에서 30머 사이의 뉴클레오티드로 구성될 수 있다. 그러나, 상기 제1 내지 3의 폴리뉴클레오티드는, 표적 유전자에 특이적으로 결합하고, 다른 유전자와 혼성화가 일어나지 않는 범위에서는 6머 내지 60머의 폴리뉴클레오티드도 이용될 수 있다.
상기의 폴리뉴클레오티드는 나노계면트랜스듀서에 결합이 가능하도록 변형될 수 있으며, 이러한 변형은 폴리뉴클레오티드의 5'의 최종 말단에 C1~C20 알킬기가 결합될 수 있으며, 나노계면트랜스듀서와의 결합을 용이하게 하기 위하여, 티올과 같은 물질이 부가될 수 있다. 그러나, 이러한 변형은 목적 및 나노계면트랜스듀서에 따라 적절히 변화가 가능하다.
상기에서, 나노계면트랜스듀서(thin membrane transducer)는 목표 물질이 두께가 수십~수백 나노인 박막 표면에 흡착되면서 발생하는 유체 표면 장력의 변화를 측정하여 목표 물질을 감지할 수 있는 것이면 모두 가능하다. 특히, 상기 유체 표면 장력의 변화는 박막의 변형으로 인한 정전용량(Capacitance) 변화를 통해 측정될 수 있다.
여기서 이용할 수 있는 것은 종래의 나노계면트랜스듀서로 알려진 것일 수도 있으나(도 1), 다공성 나노계면트랜스듀서가 바람직하다.
상기 다공성 나노계면트랜스듀서의 일실시예로서, 챔버(chamber)와, 상기 챔버를 제1 영역과 제2 영역으로 분리하고, 상기 제1 영역에 접하는 면에 표적물질과의 결합을 위한 상기 제1 내지 제3 폴리뉴클레오티드가 결합할 수 있는 결합층이 제공되고, 상기 제1 영역과 상기 제2 영역을 관통시키는 한 개 이상의 홀(hole)을 포함한 다공성 부재 형상의 변형 발생부와, 상기 변형 발생부의 변형량을 측정하는 변형량 측정 부재와, 상기 제1영역에 제공되고 표적물질을 포함하는 제1 액체와, 상기 제2 영역에 제공되고 상기 홀 근처에서 상기 제1 액체와 계면을 형성하는 제2 액체를 포함하고, 상기 변형 발생부는 상기 결합층에 상기 표적물질이 결합함에 따라 탄성변형이 발생하고, 표적물질이 표면에 결합함으로써 인가되는 힘을 측정하는 것을 특징으로 한다.
상기 제1 액체(22)는 친수성(hydrophilic)의 특성을 갖고, 상기 제2 액체(21)는 소수성(hydrophobic)의 특징을 갖으며, 상기 제2 액체(21)는 실리콘 오일(silicone oil)인 것이 바람직하다.
상기 변형 발생부(13)는, 유체 표면 장력에 의해 변화될 수 있는 재질이면 모두 가능하며, 파라크실렌 중합으로 얻어지는 플라스틱인 파릴렌(Parylene) 재질인 것이 바람직하다.
상기 변형 발생부(13)는 상기 제1 영역(19)과 접하는 면은 친수성이 되도록 표면처리되어 있고, 상기 제2 영역(17)과 접하는 면은 소수성이 되도록 표면처리 되어 있는 것을 특징으로 한다.
상기 결합층(32)은, 목적에 따라 적절한 물질로 대체가능하나, Au인 것이 바람직하다.
상기 변형량 측정 부재는 상기 변형 발생부(13)의 상기 제2 영역(17)과 접하는 면에 제공되는 상부 전극(13)과, 상기 제2 영역 내(17)에 고정되어 상기 상부 전극(31)과 정전 용량(capacitance)를 형성하도록 제공되는 하부전극(33)을 포함하고, 상기 변형 발생부(13)의 변형에 따라 상기 상부 전극(31)과 상기 하부 전극(32) 간의 정전 용량을 측정하는 것을 특징으로 한다.
상기 다공성 나노계면트랜스듀서의 다른 일실시예로서, 챔버(chamber)와, 기판과 상기 챔버를 제1 영역과 제2 영역으로 분리하고, 상기 제1 영역에 접하는 면에 표적물질과의 결합을 위한 상기 제1 내지 제3 폴리뉴클레오티드가 결합할 수 있는 결합층이 제공되고, 상기 제1 영역과 상기 제2 영역을 관통시키는 한 개 이상의 홀(hole)을 포함하여 상기 기판 상에 제공되는 다공성 부재 형상의 변형 발생부와, 상기 변형 발생부의 변형량을 측정하는 변형량 측정 부재와, 상기 제1 영역에 제공되고 표적물질을 포함하는 제1액체와, 상기 제2 영역에 제공되고 상기 홀 근처에서 상기 제1 액체와 계면을 형성하는 제2 액체를 포함하고, 상기 변형 발생부는 상기 결합층에 상기 표적물질이 결합함에 따라 탄성변형이 발생하고, 표적물질이 표면에 결합함으로써 인가되는 힘을 측정하는 것을 특징으로 한다(도 2 내지 도 4 참조).
또한, 본 발명은, 1) 표적 유전자 검출용 폴리뉴클레오티드가 부착된 나노계면트랜스듀서를 포함하는 표적 유전자 검출용 센서에 샘플을 접촉시키는 단계; 2) 상기 검출용 센서로부터 발생한 정전 용량의 신호를 측정하는 단계; 및 3) 정전 용량의 신호를 분석하여 표적 유전자의 유무 및 표적 유전자의 돌연변이의 위치를 결정하는 단계를 포함하는 표적 유전자 검출 및 표적 유전자 돌연변이 유전자형 분석 방법을 제공한다.
아울러, 본 발명은, 표적 유전자의 유무 및 표적 유전자의 돌연변이의 위치를 결정하는 단계에 있어서,
제1 폴리뉴클레오티드가 부착된 표적 유전자 검출용 센서의 정전 용량이 감소하면, 샘플내에 표적 유전자가 존재하며, 샘플내 표적 유전자의 돌연변이 지역이 제1 폴리뉴클레오티드 서열의 5'의 최종 말단에 존재하는 것으로 판단하는 단계,
제2 폴리뉴클레오티드가 부착된 표적 유전자 검출용 센서의 정전 용량이 감소하면, 샘플내에 표적 유전자가 존재하며, 샘플내 표적 유전자의 돌연변이 지역이 제2 폴리뉴클레오티드 서열의 3'의 최종 말단에 존재하는 것으로 판단하는 단계, 또는
제3 폴리뉴클레오티드가 부착된 표적 유전자 검출용 센서의 정전 용량이 증가하면, 샘플내에 표적 유전자가 존재하며, 샘플내 표적 유전자의 돌연변이 지역이 제3 폴리뉴클레오티드의 5'의 최종 말단과 3'의 최종 말단 사이에 존재하는 것으로 판단하는 단계를 추가적으로 포함하는, 표적 유전자 검출 및 돌연변이 유전자형 분석 방법을 제공한다.
나노계면트랜스듀서를 포함한 표적 유전자 검출용 센서에 부착된 프루브와 mis-match되는 뉴클레오티드의 위치에 따른 변화는, 나노계면에서 상보적 또는 비상보적 결합의 경우 나노계면트랜스듀서의 막 및 정전 용량의 변화를 주며(도 8 및 도 9 참조), mis-match의 위치에 따라서도 정전 용량의 변화가 있음을 확인하였다(도 11 및 12 참조). mis-match의 위치가 상보 결합의 내부에 위치한 경우 정전 용량의 값이 크게 증가함을 알 수 있었다. 그러나, mis-match가 내부에 있을 때와는 다르게, mis-match의 위치가 나노계면으로부터 가까운 곳인 프루브의 5'의 최종 말단에 위치시 정전 용량의 값이 약간 감소함에 비하여, mis-match의 위치가 나노계면으로부터 먼 곳인 프루브의 3'의 최종 말단에 위치시 정전 용량의 값이 크게 감소함을 알 수 있었다.
따라서, 이러한 결과로부터 프루브 폴리뉴클레오티드 제작시, 표적 유전자에 상보적이며, 나노계면에 결합하는 프루브의 5' 부분이 나노계면에 결합하므로, 돌연변이가 있을 것으로 예상되는 뉴클레오티드의 위치를 나노계면으로부터 가장 먼 3'의 최종 말단 위치에 있도록 한다면, 정전 용량이 크게 감소한다는 것은 본 분야의 당업자에게는 자명하다고 할 수 있다.
또한, 프루브 뉴클레오티드 제작시, 표적 유전자에 상보적이며, 돌연변이가 있을 것으로 예상되는 뉴클레오티드의 위치를 나노계면으로부터 가장 가까운 프루브의 5'의 최종 말단 위치에 있도록 한다면, 정전 용량이 작게 감소한다는 것은 본 분야의 당업자에게는 자명하다고 할 수 있다.
아울러, 프루브 뉴클레오티드 제작시, 표적 유전자에 상보적이며, 돌연변이가 있을 것으로 예상되는 뉴클레오티드의 위치를 프루브의 5'의 최종 말단과 3'의 최종 말단 사이에 있도록 한다면, 정전 용량이 크게 감소한다는 것은 본 분야의 당업자에게는 자명하다고 할 수 있다.
그러므로, 이러한 3가지 경우 중 2가지 이상의 프루브의 조합으로, 샘플내에 표적 유전자의 존재 유무를 정전 용량의 변화로 손쉽게 검출할 수 있다. 그뿐 아니라, 표적 유전자의 위치에 따른 정전 용량의 차이로 하나의 뉴클레오티드의 차이까지도 민감하게 검출할 수 있다.
SNP의 위치는 수행하는 목적에 따라, 달라질 수 있으므로, 표적 유전자가 알려진 유전자라면 관련 SNP의 위치에 대한 정보 또한 있을 것이며, 이러한 경우 SNP를 프루브의 5'의 최종 말단 또는 3'의 최종 말단 사이에 위치하도록 프루브를 제작하는 것은 현재 기술상 당업자에게 자명한 사항이다.
이와 같은 돌연변이의 위치 확인은 최근 각종 질병이 유전자중에서 하나의 염기서열의 변형으로 생길 수 있다는 단일염기다형성(single nucleotide pholymorphism)의 측정에 매우 유용할 수 있으며, 그뿐 아니라, 이와 같은 측정방법은 돌연변이가 매우 다양하며, 그 돌연변이 유전자형에 따라 질병의 정도 및 치료방법이 달라질 수 있는 바이러스 검출 등에 매우 유용할 수 있다.
본 발명에 적용될 수 있는 바이러스는, 인플루엔자바이러스, 코로나바이러스, HIV 바이러스, 인간유두종 바이러스(HPV) 및 C형 간염바이러스(HCV)와 같이 다양한 종류에 적용가능할 수 있다.
특히, 돌연변이가 많고, 돌연변이에 따라 다양한 증상을 보일 수 있는 HPV 및 HCV 바이러스 검출 및 돌연변이 유전자형 분석 방법으로 유용하게 이용될 수 있다.
또한, 표적 바이러스는 C형 간염바이러스(HCV)인 것을 특징으로 하는, C형 간염바이러스 검출 및 C형 간염바이러스 돌연변이 유전자형 분석 방법으로도 이용될 수 있다.
아울러, 본 발명의 표적 유전자 검출용 센서 및 검출 방법을 보다 효율적으로 측정하기 위하여, 상기 나노계면트랜스듀서를 포함하는 표적 유전자 검출용 센서를 포함한, 검출 시스템을 제공한다.
나노계면트랜스듀서에서 신호를 분석하고, 이러한 정보에서 질환이나 바이러스의 유무 또는 돌연변이 여부를 확인하기 위하여는 다음과 같은 신호 분석단계를 거칠 수 있다.
나노계면트랜스듀서를 포함한 검출용 센서장치(101)로부터 감지된 아날로그 데이터는 증폭장치(102)를 통하여 증폭된다. 각 열에 부착된 증폭장치는 컬럼디코더(column decoder)에 의하여 만들어진 신호에 의하여 선택적으로 동작한다. 측정하고 싶은 센서 어레이 포인터의 증폭된 아날로그 신호가 ADC(104)에서 디지털 데이터로 변환된다. 디지털 데이터로 변환된 데이터는 버프에 저장된 후 적절한 포맷 변환기를 거쳐 저장 장치 RAM(105)에 저장된다.
바이오센서의 아날로그 신호는 아주 미약하기 때문에 잡음의 영향을 많이 받게 되므로 RAM에 저장된 데이터는 원래의 바이오신호에 잡음신호가 첨가되어 있다. 따라서 잡음신호를 적절한 방법으로 제거해야한다. 그리고 잡음이 제거된 신호로부터 질병의 증상을 판단해야한다.
잡음제거와 질병판단에 필요한 프로그램과 기준 데이터는 비휘발성 메모리(FlashROM)에 저장되어 있다. 저장된 프로그램은 도 15와 같은 순서로 진행된다. RAM에 저장된 데이터는 도 15의 신호 ①은 도 16의 파형 같이 저주파 바이오신호에 고주파 잡음이 섞여있다. 따라서 low pass filter를 통하여 잡음을 제거하여 도 17의 파형과 같이 만든다.
본 발명의 시스템은 많은 센서 포인터를 가진 어레이 형태이므로 다양한 반응물질을 탑재시킬 수 있을 뿐만 아니라 동일한 반응물질을 여러 센싱 포인터에 탑재시킬 수 있다. 여러 센싱 포인터에 동일한 반응물질을 탑재함으로써 센서의 감도의 차이점과 어레이(array)의 단점을 해결할 수 있다. 많은 실험을 통하여 특정 반응물질에 대한 최상의 측정정보를 도 13의 임시저장장치(FlashROM)(106)에 저장해두고 여러 포인터에서 측정된 데이터 중에서 저장된 데이터와 가장 근접한 데이터를 선택한다. 이 과정에서 센서에 따른 감도의 차이를 극복하기 위하여 측정된 값을 표준화(normalization) 한다.
일반적으로 바이오 센서를 이용하여 질병진단 하는 경우 충분한 시간이 경과된 후 센서로부터 나오는 포화된(saturation)신호를 이용하여 판단의 근거로 삼는다. 바이오 신호는 시료의 농도와 어레이의 반응 물질에 따라 도 18과 같이 일정 반응시간이 경과한 후 기울기를 달리한다. 농도와 물질에 따른 기울기와 포화된 2가지 정보를 이용하면 보다 정확하게 질병 감염을 진단 할 수 있다.
본 발명의 시스템의 구체적인 일제조예로서, 나노계면트랜스듀서를 포함하는 표적 유전자 검출용 센서 장치(101)에, 증폭 장치(102)를 연결하고, 증폭장치(102)에 입력신호 중에 하나를 선택하는 선택 장치(103)를 연결하였다. 선택 장치(103)에 변환 장치(104)를 연결시키고, 변환장치(104)와 임시저장 장치(106)를, 처리 장치(107)에 연결하였다. 또한, 처리 장치(107)에, 저장하는 장치(105), 표시 장치(108)를 연결하였다. 또한, 처리 장치(107)에 비동기 방식의 데이터 송수신하는 장치(109) 또는 동기 방식의 송수신하는 장치(110)에 연결하여 제작된 시스템이 가능하다.
이러한 시스템은 종래의 시스템(도 14)에 비하여 많은 장점을 가지고 있다. 특히, 구조적인 측면에서, 기존 것보다 소형화가 가능하므로 경제적이며, 노이즈에 대한 영향이 적다. 또한, 정확하게 데이터 측정을 할 수 있다.
보다 구체적으로 살펴보면, 센서어레이와 센서어레이에서 측정된 미약한 신호를 증폭할 수 있는 CMOS(Complementary Metal Oxide Semiconductor) 증폭 장치를 동시에 제작할 수 있어 하나의 ADC(Analog-to-Digital Converter)를 이용하여 전체 어레이의 디지털 데이터를 변환할 수 있다. 만약 센서 어레이와 CMOS를 하나의 칩에 제작할 수 없으면 도 14와 같이 어레이의 매 열(Column)마다 ADC(212)를 장착해야 한다. 일반적으로 증폭장치를 구현하는데 필요한 트랜지스터는 ADC를 구현하는데 소요되는 트랜지스터보다 작기 때문에 경제적이다.
그 뿐 아니라, 센서로부터 측정된 미약한 신호를 증폭하지 않고 ADC(212)로 전달하는 경우 주변과 PCB(Printed Circuit Board)로부터 많은 잡음을 받게 되어 측정오차가 크다. 본 발명은 도 13과 같이 센서어레이와 센서어레이의 미약한 신호를 증폭할 수 있는 CMOS 증폭 장치를 동시에 제작할 수 있어 노이즈에 영향을 많이 받지 않는다.
그뿐 아니라, 본 발명의 시스템은 여러 센스 포인터에 동일한 반응물질을 탑재해두고 미리 측정된 최상의 데이터와 가장 유사한 데이터를 측정함으로써 센서의 감도 차이와 센서의 결함을 극복할 수 있다. 유사 데이터 선별과정은 도 19와 같다.
본 발명의 시스템은 다음과 같은 과정을 거쳐 질병, 또는 바이러스 유무 및 돌연변이 여부를 판단할 수 있다.
보다 구체적으로 살펴보면, Array sensor(n개)의 측정신호가 도 13의 (102)단에서 증폭 후 선택장치(103) 되어 ADC(104)에서 디지털로 변환되어 저장장치(105)에 저장되고, 처리장치(107)에서 임시저장장치(106)에 미리 저장되어있는 참조 데이터 베이스(reference DB)와 저장장치(105)에 저장된 측정 신호를 비교하게 된다. 도 15와 같이 CPU는 비교하기 전, 측정 신호를 Low-pass filtering(도 15의 ②)을 거쳐서 노이즈를 제거하고, reference DB와 비교할 측정 신호의 동일 지점에서 기울기(slope)나, 일정 간격에서의 신호처리에 의한 결과를 비교(도 15의 ④)해서, reference DB에 가장 근접한 측정 신호를 추출하여 질병을 판단한다(도 15의 ⑥).
아울러, 본 발명은 측정된 데이터의 기울기와 최종 값을 질병 판단 기준으로 사용함으로써 정확하게 질병 판단을 할 수 있다.
이하, 본 발명을 실시예에 의해 상세히 설명한다.
하기 실시예는 본 발명을 구체적으로 예시하는 것이며, 본 발명의 내용이 실시예에 의해 한정되는 것은 아니다.
<제조예 1> DNA 프루브 제작
나노계면트랜스듀서에서 결합 상태에 따른 정전 용량의 변화를 측정하기 위하여 프루브 및 그 프루브와 상보적, 비상보적인 DNA와, 5' 및 3' 위치에 mis-match가 있는 DNA, 및 내부에 두개의 mis-match가 있는 DNA를 제작하였다(서열번호 1 내지 6). 또한, 프루브의 경우 나노계면트랜스듀서와의 결합을 용이하게 하기 위하여 5' 부분에 헥산티올을 결합하여 제작하였다.
표 1
명칭(서열변호) 서열
티올레이트 프루브 DNA (서열번호 1) 5'-(CH2)6- T AGCCGA TA TGCGCA T -3'
상보적 DNA (서열번호 2) 5'-ATGCGCATATCGGCTA-3'
비상보적 DNA (서열번호 3) 5'-GCATATGCCGATTAGC-3'
distal-single SNP (서열번호 4) 5'- C TGCGCATATCGGCTA-3'
Proximal-single SNP (서열번호 5) 5'-ATGCGCATATCGGCT G -3'
Internal two SNP (서열번호 6) 5'-ATGCGCA GC TCGGCTA-3'
<제조예 2> 검출용 센서 제작
<제조예 2-1> 나노계면트랜스듀서의 제작
나노계면트랜스듀서는 다음과 같은 과정을 거쳐 제조되었다.
기판(substrate)(10)에 절연층(11)을 증착(nitride deposition)시킨 후, 상기 절연층(11)의 상부에 하부 전극(33)을 형성하였다. 그 후 상기 절연층의 일부 및 상기 하부 전극(33)의 일부를 덮는 희생층(12)을 형성하였다. 또한, 상기 희생층(12)의 상부까지 연장되고, 상기 하부 전극(33)과 이격되도록 상부 전극(31)을 형성하였으며, 상기 희생층(12)을 덮도록 변형 발생부(13)를 형성하였다. 또한, 상기 변형 발생부(13)의 상부에 결합층(32)을 형성하였다. 또한, 상기 결합층(32), 상기 변형 발생부(13) 및 상기 상부 전극(31)을 동시에 관통하는 홀(hole)을 형성하였고, 마직막으로 상기 희생층(12)을 제거하여 나노계면트랜스듀서를 제작하였다(도 6 및 도 7 참조).
특히, 기판(substrate)(10)은 낮은 저항성의 실리콘 재질을 사용하되었으나, 글라스 재질인 것도 가능하다.
절연층(11) 증착(nitride deposition) 공정은 PECVD(plasma enhanced chemical vapor deposition)으로 진행하였으나, LPCVD(low pressure chemical vapor deposition)방식도 가능하다.
전류를 흐르게 하기 위한 하부 전극은 Cr/Au로 설치하였고, Cr 층은 점착력을 향상시키기 위한 층으로서, 그 위에 Au 층을 증착하였고, 증착은 e-gun evaporator 방식으로 진행하였다.
희생층(Sacrificial PR layer)(12)은 후에 트랜스듀서의 내부 공간을 형성하기 위한 것으로, AZ5214의 포토레지스트를 이용하여 사용하였다.
트랜스듀서의 상부 전극 기능을 수행하는 상부 전극(31) 역시 Cr/Au를 이용하여 제작하였다.
변형 발생부(13)는 고분자 재질인 팔릴렌으로 제작되었으나, 다른 고분자 재질로도 제작할 수 있다.
홀(hole) 패턴은 Positive 패너닝 방식으로 형성하였으며, 홀은 변형 발생부(13)의 박막, 상부 전극(31) 및 결합층(32)을 관통하여, 변형 발생부(13)의 내부와 외부를 연결시키도록 하였다. 이 경우, 결합층(32)이 없다면 변형 발생부(13) 및 상부 전극(31)을 관통하도록 제작할 수 있다.
이후 플라즈마 공정을 통하여 박막의 상면은 친수성(hydrophilic)의 성질을 띄도록 표면처리하였다.
희생층(12)은 매질로서 아세톤을 사용하여 임계점 건조법(critical point drying)을 이용하여 홀(hole)을 통하여 제거하였다. 이때 아세톤 외에 메탄올과 같은 용매를 이용할 수 있다.
마지막으로, 희생층(12)이 제거된 공간에 제2 액체인 실리콘 오일을 채워넣었다. 이때 제2 액체는 실리콘 오일외에 소수성 액체가 목적에 맞게 이용될 수 있다.
<제조예 2-2> 검출용 센서 제작
표적 유전자를 검출하기 위한 검출용 센서는 도 2에서 보는 바와 같다. 그러나, 목적에 따라서, 더 많은 나노계면트랜스듀서를 포함할 수 있다.
나노계면트랜스듀서의 결합층에 상기 <제조예 1>에서 제작한 프루브를 결합하였다.
<제조예 3> 검출용 시스템 제작
표적 유전자를 보다 잘 검출하기 위하여, 일 제조예로 다음과 같은 검출용 시스템을 제작하였다(도 13).
센서 장치(101)에, 증폭 장치(102)를 연결하고, 증폭장치(102)에 입력신호 중에 하나를 선택하는 선택 장치(103)를 연결하였다. 선택 장치(103)에 변환 장치(104)를 연결시키고, 변환장치(104)와 임시저장 장치(106)를, 처리 장치(107)에 연결하였다. 또한, 처리 장치(107)에, 저장하는 장치(105), 표시 장치(108)를 연결하였다. 또한, 처리 장치(107)에 비동기 방식의 데이터 송수신하는 장치(109) 또는 동기 방식의 송수신하는 장치(110)에 연결하였다.
센서 장치(101)는 정전용량 차이를 이용하여 생체 신호를 감지하는 장치가 적용될 수 있으며, 특히, 상기에서 제작된 나노계면트랜스듀서를 포함하는 센서가 이용될 수 있다.
증폭 장치(102)는 센서 장치에서 아날로그 신호를 증폭하는 장치가 이용될 수 있으며, 특히 CMOS 증폭 장치가 이용될 수 있다.
선택 장치(103)은 여러 아날로그 입력신호 중에 하나를 선택하는 장치로서, 센서 장치에서 나온 신호에서 적합한 부분을 선택할 수 있다.
변환 장치(104)는 아날로그 데이터를 디지털 데이터로 변환하는 장치이며, 여기에서 디지털 데이터로 변환된 데이터는 버퍼(buffer)에 저장된 후, 적절한 포맷 변환기를 거쳐 저장 장치 RAM(105)에 저장된다.
저장 장치(105)는 센서로부터 측정된 디지털로 변환된 데이터와 CPU를 이용하여 신호처리과정에 필요한 데이터를 저장하거나, 처리된 최종 결과를 저장하는 장치로서, RMA을 사용하였다.
임시 저장 장치(106)는 CPU에서 수행될 프로그램과 신호처리와 질환판단에 필요한 기준데이터(reference data)를 저장하는 장치로서, flash Rom을 사용하였다.
처리 장치(107)는 센서 배열로 얻어진 잡음 섞인 데이터로부터 잡음을 제거하고 최상의 데이터를 선택한 후 질환을 판단하는 장치이다.
표시 장치(108)는 측정된 데이터나 판단된 결과를 표시하는 장치로서, 표시 방법에 따라 적절한 표시 장치가 이용될 수 있다.
송수신 장치는 목적에 따라, 비동기방식 송수신 장치(109)와 동기방식 송수신 장치(110)이 선택적 혹은 동시에 이용될 수 있으며, 비동식방식 송수신 장치(109)는 비동기 방식으로 센스 어레이에서 측정된 데이터를 퍼스널 컴퓨터로 전송하거나 퍼스널 컴퓨터로부터 프로그램이나 데이터를 수신하는 장치이며, 동기방식 송수신 장치(110)는 동기 방식으로 센스 어레이에서 측정된 데이터를 퍼스널 컴퓨터로 전송하거나 퍼스널 컴퓨터로부터 프로그램이나 데이터를 수신하는 장치이다.
<실험예 1> 비상보적 결합 및 상보적 결합의 경우 정전 용량 변화 측정
서열변호 1의 프루브가 결합된 나노계면트랜스듀서를 포함한 검출용 센서에 서열번호 1의 프루브와 상보적인 DNA(서열번호 2) 및 비상보적인 DNA(서열번호 3)를 처리하였다. 그 후 나노계면트랜스듀서에서 발생하는 정전 용량의 차이를 측정하였다(Keithly 2400 Sourcemeter, Keithly, USA).
그 결과, 프루브와 상보적으로 결합하는 DNA의 정전 용량이 급격히 감소하여 약 0.007pF 정도가 감소되었음을 확인하였다. 또한, 프루브와 비상보적으로 결합하는 DNA의 정전 용량의 경우 변화가 없음을 확인하였다(도 9 참조).
<실험예 2> 프루브 내부에 비 상보적 결합이 있는 경우 정전 용량 변화 측정
서열변호 1의 프루브가 결합된 나노계면트랜스듀서를 포함한 검출용 센서에 서열번호 1의 프루브와 내부에 2개의 mis-match가 있는 DNA(서열번호 6)를 처리하였다. 그 후 나노계면트랜스듀서에서 발생하는 정전 용량의 차이를 측정하였다(Keithly 2400 Sourcemeter, Keithly, USA).
그 결과, 프루브와 상보적으로 결합하는 DNA의 정전 용량이 급격히 증가하여 약 0.015pF 정도가 증가되었음을 확인하였다(도 9 참조).
<실험예 3> 프루브의 5' 및 3' 부분에 비 상보적 결합이 있는 경우 정전 용량 변화 측정
서열변호 1의 프루브가 결합된 나노계면트랜스듀서를 포함한 검출용 센서에 서열번호 1의 프루브와 3' 및 5'의 위치에 mis-match가 있는 DNA(서열번호 4 및 5)를 처리하였다. 그 후 나노계면트랜스듀서에서 발생하는 정전 용량의 차이를 측정하였다(Keithly 2400 Sourcemeter, Keithly, USA).
그 결과, 프루브와 3'의 위치에 mis-match가 있는 DNA(Distal-single SNP)의 정전 용량이 상당히 감소하여 약 0.008pF 정도가 감소되었음을 확인하였다. 또한, 프루브와 비상보적으로 결합하는 DNA의 정전 용량의 경우 변화가 없음을 확인하였다(도 10 참조).
<실험예 4> 유적(droplet)을 이용한 DNA 혼성화에 따른 정전 용량 변화 측정
클로로포름에 10 mg/ml의 농도로 녹아 있는 DPhPS (Diphytanoyl glycerol phospho serine) 용액(구입처를 알려주시기 바랍니다.)에 질소 분출을 통하여 클로로포름 용액을 증발 시켰다. 여기에 n-데칸 용액(구입처를 알려주시기 바랍니다.)을 다시 섞어서 1 mg/ml의 농도를 가지는 DPhPS 용액을 만들었다.
폴리메틸 메타크릴레이트의 재질을 가지는 플라스틱 큐빗에 0.1 M MES 버퍼(구입처를 알려주시기 바랍니다.)로 2 ml를 채우고, 바닥에 이미 제작한 DPhPS 용액을 9 μl 떨어뜨렸다.
그후, DPhPS 고착 유적(sessile droplet) 이 더 이상 변하지 않고 포화를 이룰 때 까지 기다린 후에 DPhPS 분자가 가지고 있는 카르복실기를 활성화 시키기 위해서 EDC (1-Ethyl-3-[3-dimethylaminopropyl]carbodiimide hydrochloride) powder(시그마 알드리치)를 0.1 M MES 버퍼 (pH 6.1)에 8 mg/ml의 농도로 녹여서 유적 주위에 10 μl 주입하여 5분 동안 기다렸다.
EDC에 의해서 활성화된 중간체 분자는 안정하지 못하여 처음 상태로 돌아가기 때문에 활성화된 상태를 유지하기 위해서 마찬가지로 NHS(N-hydroxysulfosuccinimide) powder(구입처를 알려주시기 바랍니다.)를 0.1 M MES 버퍼에 12 mg/ml의 농도로 녹여서 유적 주위에 10 μl 주입한 후, 25분 동안 기다렸다.
아민 그룹을 포함하고 있는 N-(4-aminophyenyl)malemide 분자를 이미 활성화된 분자를 고정화시키기 위해서는 pH 7.2~7.4의 상태를 유지해야 한다. 따라서 1X PBS 버퍼(pH 7.2~7.4)를 사용하여 버퍼 교환을 한 후, 즉시 N-(4- aminophyenyl)malemide를 1X PBS 버퍼에 500 μM의 농도로 녹여서 10 μl 주입하여 2시간 동안 반응시켰다.
2시간 후에 반응하지 못한 과량의 분자를 제거하고 새로운 1X PBS 버퍼로 교환한 후에, Thiol-Maleimied 특이적 결합 유도하기 위하여, 100 μM의 3’ 에 티올이 부가된 18머 DNA(5’-aaccatccagaagagcag-3’(서열번호 7)) 50 μl를 주입하여 1시간 이상 반응시켰다.
포화상태를 확인한 후에 반응하지 못한 과량의 DNA를 제거하고 새로운 1X PBS 버퍼로 교환한 후에 100 μM 상보적인 18머 DNA(5’-ctgctcttctggatggtt-3’(서열번호 8)) 또는 비-상보적인 DNA(5’-tagtgaatggatcggacagc-3’(서열번호 9)) 50 μl를 주입하여 반응시켰다.
그 결과, 유적에 부착된 DNA(서열번호 7)와 상보적인 DNA(서열번호 8)를 포함하는 샘플을 처리한 결과, 샘플내의 DNA와 유적에 결합된 DNA의 결합에 의해, 유적의 표면장력이 감소하여 약간 부상(flotation)하였음을 확인하였다(도 22 참조). 반면, 유적에 부착된 DNA와 비-상보적인 DNA(서열번호 9)를 포함하는 샘플을 처리한 결과 유적의 형태는 거의 변하지 않음을 확인하였다(도 23 참조).
부호의 설명
10: 기판, 11: 절연층, 12: 희생층, 13: 변형 발생부, 17: 제2 공간, 19: 제1 공간, 21: 제2 액체, 22: 제1 액체, 31: 상부 전극, 32: 결합층, 33: 하부 전극
101 : 센서 장치, 102: 증폭 장치, 103: 선택 장치, 104: 변환 장치, 105: 저장 장치, 106: 임시 저장 장치, 107: 처리 장치, 108: 표시 장치, 109: 비동기 방식 송수신 장치, 110: 동기 방식 송수신 장치
201 : 센서 장치, 202: 변환 장치, 303: 혼합 장치(Muxing 장치), 204: 버퍼 장치, 205: 저장 장치, 206: 임시 저장 장치, 207: 처리 장치, 208: 표시 장치, 209: 비동기 방식 송수신 장치, 220: 동기 방식 송수신 장치
본 발명의 표적 유전자 검출 및 돌연변이 위치를 분석할 수 있는 센서는 최소한의 프루브를 이용하여, 표적 유전자를 검출할 수 있는 장치로서, 증폭을 위한 PCR 및 표적검출을 위한 라벨링과정 등이 필요하지 않아, 신속하게 표적 유전자를 검출할 수 있으며, 전기적으로 검출할 수 있다. 더욱이, 한번의 스크리닝으로 돌연변이 여부를 실시간으로 확인할 수 있다. 따라서, 본 발명은 다양한 돌연변이가 존재하는 바이러스의 검출 및 유전자형 분석에 매우 유용하게 이용될 수 있을 것이다.
서열번호 1: tagccgatat gcgcat
서열번호 2: atgcgcatat cggcta
서열번호 3: gcatatgccg attagc
서열번호 4: ctgcgcatat cggcta
서열번호 5: atgcgcatat cggctg
서열번호 6: atgcgcagct cggcta
서열번호 7: aaccatccagaagagcag
서열번호 8: ctgctcttctggatggtt
서열번호 9: tagtgaatggatcggacagc

Claims (14)

  1. 표적 유전자와 상보적인 염기 서열을 포함하며, 상기 표적 유전자의 SNP가 예상되는 위치의 뉴클레오티드와 상보적으로 결합하지 않는 뉴클레오티드를 5'의 최종 말단에 포함하는 14머 내지 40머로 구성되는 제1 폴리뉴클레오티드,
    표적 유전자와 상보적인 염기 서열을 포함하며, 상기 표적 유전자의 SNP가 예상되는 위치의 뉴클레오티드와 상보적으로 결합하지 않는 뉴클레오티드를 3'의 최종 말단에 포함하는 14머 내지 40머로 구성되는 제2 폴리뉴클레오티드, 및
    표적 유전자와 상보적인 염기 서열을 포함하며, 표적 유전자의 SNP가 예상되는 위치의 뉴클레오티드를 5'의 최종 말단과 3'의 최종 말단 사이에 포함하는 14머 내지 40머로 구성되는 제3 폴리뉴클레오티드,
    로 구성된 군으로부터 선택된 2개 이상의 폴리뉴클레오티드가 부착된 나노계면트랜스듀서(thin membrane transducer)를 포함하는, 표적 유전자의 검출 및 표적 유전자의 돌연변이를 동시에 분석하는, 표적 유전자 검출용 센서.
  2. 제1항에 있어서, 상기 나노계면트랜스듀서는,
    챔버(chamber)와,
    상기 챔버를 제1 영역과 제2 영역으로 분리하고, 상기 제1 영역에 접하는 면에 표적물질과의 결합을 위한 상기 1 내지 3 폴리뉴클레오티드가 결합할 수 있는 결합층이 제공되고, 상기 제1 영역과 상기 제2 영역을 관통시키는 한 개 이상의 홀(hole)을 포함한 다공성 부재 형상의 변형 발생부와,
    상기 변형 발생부의 변형량을 측정하는 변형량 측정 부재와,
    상기 제1 영역에 제공되고 표적물질을 포함하는 제1 액체와,
    상기 제2 영역에 제공되고 상기 홀 근처에서 상기 제1 액체와 계면을 형성하는 제2액체를 포함하고,
    상기 변형 발생부는 상기 결합층에 상기 표적물질이 결합함에 따라 탄성변형이 발생하고,
    표적물질이 표면에 결합함으로써 인가되는 힘을 측정하는 것을 특징으로 하는,
    표적 유전자 검출용 센서.
  3. 제1항에 있어서, 상기 나노계면트랜스듀서는,
    챔버(chamber)와,
    기판과
    상기 챔버를 제1 영역과 제2 영역으로 분리하고, 상기 제1 영역에 접하는 면에 표적물질과의 결합을 위한 상기 제1 내지 제3 폴리뉴클레오티드가 결합할 수 있는 결합층이 제공되고, 상기 제1 영역과 상기 제2 영역을 관통시키는 한 개 이상의 홀(hole)을 포함하여 상기 기판 상에 제공되는 다공성 부재 형상의 변형 발생부와,
    상기 변형 발생부의 변형량을 측정하는 변형량 측정 부재와,
    상기 제1 영역에 제공되고 표적물질을 포함하는 제1 액체와,
    상기 제2 영역에 제공되고 상기 홀 근처에서 상기 제1 액체와 계면을 형성하는 제2 액체를 포함하고,
    상기 변형 발생부는 상기 결합층에 상기 표적물질이 결합함에 따라 탄성변형이 발생하고,
    표적물질이 표면에 결합함으로써 인가되는 힘을 측정하는 것을 특징으로 하는,
    표적 유전자 검출용 센서.
  4. 제2항 또는 제3항에 있어서,
    상기 제1 액체는 친수성(hydrophilic)의 특징을 갖고,
    상기 제2 액체는 소수성(hydrophobic)의 특징을 갖는 것을 특징으로 하는,
    표적 유전자 검출용 센서.
  5. 제2항 또는 제3항에 있어서,
    상기 제2 액체는 실리콘 오일(silicone)인 것을 특징으로 하는,
    표적 유전자 검출용 센서.
  6. 제2항 또는 제3항에 있어서, 상기 나노계면트랜스듀서는,
    상기 변형 발생부는 상기 제1 영역과 접하는 면은 친수성이 되도록 표면처리되어 있고, 상기 제2 영역과 접하는 면은 소수성이 되도록 표면처리되어 있는 것을 특징으로 하는,
    표적 유전자 검출용 센서.
  7. 제1항에 있어서, 상기 제1 내지 제3 폴리뉴클레오티드는, 16머 내지 35머로 구성되는 것을 특징으로 하는, 표적 유전자의 검출 및 표적 유전자의 돌연변이를 동시에 분석하는, 표적 유전자 검출용 센서.
  8. 제7항에 있어서, 상기 제1 내지 3 폴리뉴클레오티드는, 18머 내지 30머로 구성되는 것을 특징으로 하는, 표적 유전자의 검출 및 표적 유전자의 돌연변이를 동시에 분석하는, 표적 유전자 검출용 센서.
  9. 1) 제1항의 표적 유전자 검출용 센서에 샘플을 접촉시키는 단계;
    2) 검출용 센서로부터 발생한 정전 용량의 신호를 측정하는 단계; 및
    3) 정전 용량의 신호를 분석하여, 표적 유전자의 유무 및 표적 유전자의 돌연변이의 위치를 결정하는 단계를 포함하는,
    표적 유전자 검출 및 표적 유전자 돌연변이 유전자형 분석 방법.
  10. 제 9항에 있어서, 상기 표적 유전자의 유무 및 표적 유전자의 돌연변이의 위치를 결정하는 단계에 있어서,
    제1 폴리뉴클레오티드가 부착된 표적 유전자 검출용 센서의 정전 용량이 작게 감소하면, 샘플내에 표적 유전자가 존재하며, 샘플내 표적 유전자의 돌연변이 지역이 제1 폴리뉴클레오티드 서열의 5'의 최종 말단에 존재하는 것으로 판단하는 단계,
    제2 폴리뉴클레오티드가 부착된 표적 유전자 검출용 센서의 정전 용량이 크게 감소하면, 샘플내에 표적 유전자가 존재하며, 샘플내 표적 유전자의 돌연변이 지역이 제2 폴리뉴클레오티드 서열의 3'의 최종 말단에 존재하는 것으로 판단하는 단계, 또는
    제3 폴리뉴클레오티드가 부착된 표적 유전자 검출용 센서의 정전 용량이 증가하면, 샘플내에 표적 유전자가 존재하며, 샘플내 표적 유전자의 돌연변이 지역이 제3 폴리뉴클레오티드의 5'의 최종 말단과 3'의 최종 말단 사이에 존재하는 것으로 판단하는 단계,
    에서 선택되는 어느 하나의 단계를 추가적으로 포함하는 것을 특징으로 하는, 표적 유전자 검출 및 표적 유전자 돌연변이 유전자형 분석 방법.
  11. 제9항에 있어서, 표적 유전자는 바이러스 유전자인 것을 특징으로 하는, 표적 유전자 검출 및 표적 유전자 돌연변이 유전자형 분석 방법.
  12. 제11항에 있어서, 상기 바이러스 유전자는, 인간유두종 바이러스(HPV) 또는 C형 간염바이러스(HCV)인 것을 특징으로 하는, 표적 유전자 검출 및 표적 유전자 돌연변이 유전자형 분석 방법.
  13. 센서 장치, 증폭 장치, 선택 장치, 변환 장치, 저장장치, 임시저장장치, 처리 장치, 및 송수신장치로 구성되는 시스템에 있어서,
    센서 장치는 정전용량 차이를 이용하여 생체 신호를 감지하는 장치로서, 센서 장치는 아날로그 신호를 증폭하는 장치인 증폭 장치에 연결하고,
    증폭장치에는, 여러 아날로그 입력신호 중에 하나를 선택하는 선택 장치가 연결되며,
    선택 장치는, 아날로그 데이터를 디지털 데이터로 변환하는 장치인 변환 장치에 연결되며,
    변환장치는, 센서 배열로 얻어진 잡음 섞인 데이터로부터 잡음을 제거하고 최상의 데이터를 선택한 후 질환을 판단하는 장치인 처리장치에 연결되며,
    처리장치는, CPU에서 수행될 프로그램과 신호처리와 질환판단에 필요한 기준데이터(reference data)를 저장하는 장치인 임시저장장치와, 센서로부터 측정된 디지털로 변환된 데이터와 CPU를 이용하여 신호처리과정에 필요한 데이터를 저장하거나, 처리된 최종 결과를 저장하는 장치인 저장장치에 연결되며,
    또한, 처리장치는, 측정된 데이터나 판단된 결과를 표시하는 표시장치 및 센스 어레이에서 측정된 데이터를 퍼스널 컴퓨터로 전송하거나 퍼스널 컴퓨터로부터 프로그램이나 데이터를 수신하는 장치 송수신장치에 연결되는 것을 특징으로 하는, 바이오 센서 신호 분석 시스템.
  14. 제13항에 있어서, 상기 센서 장치는 나노계면트랜스듀서를 포함하는 센서가 포함된 제1항의 표적 유전자 검출용 센서가 포함되는 것을 특징으로 하는, 바이오 센서 신호 분석 시스템.
PCT/KR2012/000655 2011-01-28 2012-01-30 표적 바이러스 검출용 센서 및 이를 이용한 표적 바이러스 스크리닝 및 돌연변이 위치 분석 방법 Ceased WO2012102584A2 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2011-0008965 2011-01-28
KR1020110008965A KR20120087637A (ko) 2011-01-28 2011-01-28 표적 바이러스 검출용 센서 및 이를 이용한 표적 바이러스 스크리닝 및 돌연변이 위치 분석 방법

Publications (3)

Publication Number Publication Date
WO2012102584A2 true WO2012102584A2 (ko) 2012-08-02
WO2012102584A9 WO2012102584A9 (ko) 2012-11-01
WO2012102584A3 WO2012102584A3 (ko) 2012-12-20

Family

ID=46581311

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2012/000655 Ceased WO2012102584A2 (ko) 2011-01-28 2012-01-30 표적 바이러스 검출용 센서 및 이를 이용한 표적 바이러스 스크리닝 및 돌연변이 위치 분석 방법

Country Status (2)

Country Link
KR (1) KR20120087637A (ko)
WO (1) WO2012102584A2 (ko)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10436772B2 (en) 2014-08-25 2019-10-08 United Arab Emirates University Method and system for counting white blood cells electrically
US10564123B2 (en) 2014-05-25 2020-02-18 United Arab Emirates University Bioreactor system and method of operating same for cellular composition identification and quantification

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR100438822B1 (ko) * 2001-05-29 2004-07-05 삼성전자주식회사 핵산 돌연변이 분석 장치 및 그를 이용한 핵산 분석 방법
KR20070122012A (ko) * 2006-06-23 2007-12-28 대전보건대학 산학협력단 생체 정보 인식 및 분석을 통한 진단시스템 및 그 방법

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10564123B2 (en) 2014-05-25 2020-02-18 United Arab Emirates University Bioreactor system and method of operating same for cellular composition identification and quantification
US10436772B2 (en) 2014-08-25 2019-10-08 United Arab Emirates University Method and system for counting white blood cells electrically

Also Published As

Publication number Publication date
WO2012102584A9 (ko) 2012-11-01
KR20120087637A (ko) 2012-08-07
WO2012102584A3 (ko) 2012-12-20

Similar Documents

Publication Publication Date Title
CN1846130B (zh) 用于检测靶物质的桥接元件
US6268141B1 (en) Immobilization of unmodified biopolymers to acyl fluoride activated substrates
KR100407822B1 (ko) 전기화학식 면역 센서와 이를 이용한 생화학 시료검출장치 및 방법
Ingebrandt et al. Label‐free detection of DNA using field‐effect transistors
US6682648B1 (en) Electrochemical reporter system for detecting analytical immunoassay and molecular biology procedures
JP2000033712A (ja) マイクロセンサーデバイス作成方法及びそれを用いた液体機能評価方法
WO2009119972A2 (ko) 고감도 바이오 센서 및 이를 포함하는 바이오 칩 그리고 이를 제조하는 방법
US20250383314A1 (en) Scalable back-gated functionalized graphene field effect transistors for detection of dna and other target molecules
WO2016036145A1 (ko) 노로바이러스 검출 센서, 및 이를 이용하는 전기화학적 센싱방법
WO1999007879A1 (en) Electrochemical reporter system for detecting analytical immunoassay and molecular biology procedures
US20090170209A1 (en) Hydrogel chemical sensor
KR100436554B1 (ko) 혼성화된 핵산의 검출감도를 증가시키는 방법
WO2011031025A2 (ko) 바이오칩을 이용한 표적 물질 검출 및 정량 방법
JP2003090815A (ja) 遺伝子の電気化学的検出方法と核酸チップ
WO2012102584A9 (ko) 표적 바이러스 검출용 센서 및 이를 이용한 표적 바이러스 스크리닝 및 돌연변이 위치 분석 방법
WO2018186683A1 (ko) 바이오 센서 기판, 이의 제조방법 및 이를 포함하는 바이오 센서
JP2002527747A (ja) プローブと基質との間のカップリングを行う化学的又は生物学分析のための多重点を備えたマイクロシステム
CN115135766A (zh) 用于适体筛选的装置、方法和组合物
Tsouti et al. Detection of DNA mutations using a capacitive micro-membrane array
González-López et al. Genosensor on gold films with enzymatic electrochemical detection of a SARS virus sequence
KR102522179B1 (ko) 박막트랜지스터 센서의 제조 방법
Tsouti et al. Detection of the biotin–streptavidin interaction by exploiting surface stress changes on ultrathin Si membranes
KR100530085B1 (ko) 미소전극어레이형 디엔에이 칩 제조방법
AU2021102162A4 (en) Renewable universal terahertz metamaterial sensor and method for quickly detecting pathogenic bacteria and drug resistance genes
KR102512759B1 (ko) 재사용 가능한 바이러스 신속 검출용 dna 바이오 센서

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 12739379

Country of ref document: EP

Kind code of ref document: A2

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 12739379

Country of ref document: EP

Kind code of ref document: A2