WO2012020897A1 - 주의력 결핍 과잉 행동 모델 마우스，상기 모델 마우스를 이용한 집중력 장애 질병 예방 및 완화 효과 검증 방법，및 ｔ-타입 칼슘채널을 억제하여 집중력 장애를 치료하는 방법 - Google Patents

주의력 결핍 과잉 행동 모델 마우스，상기 모델 마우스를 이용한 집중력 장애 질병 예방 및 완화 효과 검증 방법，및 ｔ-타입 칼슘채널을 억제하여 집중력 장애를 치료하는 방법 Download PDF

Info

Publication number
WO2012020897A1
WO2012020897A1 PCT/KR2011/000433 KR2011000433W WO2012020897A1 WO 2012020897 A1 WO2012020897 A1 WO 2012020897A1 KR 2011000433 W KR2011000433 W KR 2011000433W WO 2012020897 A1 WO2012020897 A1 WO 2012020897A1
Authority
WO
WIPO (PCT)
Prior art keywords
disorder
calcium channel
type calcium
attention deficit
mouse
Prior art date
Application number
PCT/KR2011/000433
Other languages
English (en)
French (fr)
Inventor
김대수
김정진
Original Assignee
한국과학기술원
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 한국과학기술원 filed Critical 한국과학기술원
Priority to JP2013516490A priority Critical patent/JP5816686B2/ja
Priority to EP11816513.3A priority patent/EP2604109A4/en
Priority to US13/805,717 priority patent/US20130184321A1/en
Publication of WO2012020897A1 publication Critical patent/WO2012020897A1/ko

Links

Images

Classifications

    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/5082—Supracellular entities, e.g. tissue, organisms
    • G01N33/5088—Supracellular entities, e.g. tissue, organisms of vertebrates
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K67/00—Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
    • A01K67/027—New or modified breeds of vertebrates
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61B—DIAGNOSIS; SURGERY; IDENTIFICATION
    • A61B5/00—Measuring for diagnostic purposes; Identification of persons
    • A61B5/16—Devices for psychotechnics; Testing reaction times ; Devices for evaluating the psychological state
    • A61B5/168—Evaluating attention deficit, hyperactivity
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61B—DIAGNOSIS; SURGERY; IDENTIFICATION
    • A61B5/00—Measuring for diagnostic purposes; Identification of persons
    • A61B5/24—Detecting, measuring or recording bioelectric or biomagnetic signals of the body or parts thereof
    • A61B5/316—Modalities, i.e. specific diagnostic methods
    • A61B5/369—Electroencephalography [EEG]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61B—DIAGNOSIS; SURGERY; IDENTIFICATION
    • A61B5/00—Measuring for diagnostic purposes; Identification of persons
    • A61B5/68—Arrangements of detecting, measuring or recording means, e.g. sensors, in relation to patient
    • A61B5/6887—Arrangements of detecting, measuring or recording means, e.g. sensors, in relation to patient mounted on external non-worn devices, e.g. non-medical devices
    • A61B5/6897—Computer input devices, e.g. mice or keyboards
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/08—Antiepileptics; Anticonvulsants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/18—Antipsychotics, i.e. neuroleptics; Drugs for mania or schizophrenia
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/28—Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/15—Medicinal preparations ; Physical properties thereof, e.g. dissolubility
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2207/00—Modified animals
    • A01K2207/30—Animals modified by surgical methods
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2227/00—Animals characterised by species
    • A01K2227/10—Mammal
    • A01K2227/105—Murine
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2267/00—Animals characterised by purpose
    • A01K2267/03—Animal model, e.g. for test or diseases
    • A01K2267/035—Animal model for multifactorial diseases
    • A01K2267/0356—Animal model for processes and diseases of the central nervous system, e.g. stress, learning, schizophrenia, pain, epilepsy

Definitions

  • the present invention relates to a attention deficit hyperactivity model mouse prepared by inserting a cobalt line, a method for screening a composition for preventing and treating concentration disorder diseases using the same, and a method for treating concentration disorder diseases.
  • ADHD Attention Deficit and Hyperactivity Disorder
  • a psychiatric disorder common in children before and after school age, with inattention, hyperactivity, and impulsivity being the main symptoms.
  • This lack of attention and hyperactivity are accompanied by various psychosocial disorders, including children's learning disabilities, and have been reported to cause adolescent misconduct, deviant behavior, and drug abuse and crime in adulthood (YB Lee).
  • JS Shin Korean journal of family social work, 2000; GD Kewley, British Medical Journal, 1998; LB Silver, Attention-deficit hyperactivity disorder, Washington, DC .: American Psychiatry Press, Inc. 1992).
  • the causes of attention deficit hyperactivity disorder include genetic factors (RA Barkley.Attention deficit hyperactivity disorder: A handbook of diagnosis and treatment.New York: Guilford Press. 1990), biochemistry as a reaction to lead levels and fast food food additives.
  • Environmental factors G. David, J. Neal, Abnormal Psychology.John Wilry & Sons. 1976
  • the view that there are problems with the proper selection of stimuli to the brain Hyo-Shin Lee, Emotional Learning Disorder Research.16
  • neurobiological factors are considered to be more important than social psychological factors. Accordingly, studies on therapeutic agents and biological factors for treating attention deficit hyperactivity disorder have been actively conducted.
  • Neuroanatomical abnormalities of the frontal lobe and neurobiochemical abnormalities of the neurotransmitters of the central nervous system have been studied. Neurobiological aspects of the prefrontal cortex, thalamus, and dopaminergic mesocortical projection The abnormalities in the function of) were studied. In particular, it is suggested that the biological factors are a non-uniform disease group caused by the abnormalities of the various brain regions responsible for high cognitive function rather than the development of a single nervous system (Y. Frank, SG Pavlakis, Pediatric Neurology). , 2001; Bung-Yeon Kim, Dong-Soo Lee, Soo-Chul Cho. Neuropsychiatry, 2000).
  • Symptoms of attention deficit hyperactivity disorder in addition to dopaminergic nerves, are associated with the regulation of noradrenaline nerves that regulate the nerve circuits of the frontal lobe. Studies have also been reported that the action of ADHD results in an imbalance between the regulation of noradrenaline and dopaminergic neurons. It is estimated that catecholamines, which dominate Glutamatergic neurons and GABA (g-aminobutyric acid) neurons, have a decreased effect on posterior synapses (T. Sagvolden, T. Xu. Behav. Brain Funct. 4, 2008). EB Johansen, PR Killeen et al., Behav.Brain Funct. 3, 2007).
  • Drugs most commonly used to treat attention deficit hyperactivity disorder are central nervous stimulants.
  • Ritalin, methylphen, etc. which are methylphenidate-containing compounds, are used in Korea. These drugs are known to have short-term effects on relieving inattention, hyperactivity and impulse, but their long-term effects have not been validated (S. Kim, D. Ahn, Y. Lee, J. Korean Neuropsychiatr. Assoc. 4, pp683). -699, 1998).
  • Concentration disorders such as attention deficit hyperactivity disorder include schixophrenia, frontal lobe epilepsy, and autism. Their common features include hyperactivity and low frequency oscillation increased in the frontal lobe (Callicott et al., 2000; Manoach et al., 2000, Barry et al., 2003; Wienbruch et al., 2003; Verkhliutov et al., 2006; Yoon et al., 2008; Kumari et al., 2009).
  • Ethosuximide is a T-type calcium channel inhibitor and has been used as an epilepsy treatment.
  • a composition containing ethosuccimid is known to treat anxiety disorder. It is not known what is used as.
  • the anxiety disorder described in the present invention is a symptom that causes a problem in memory formation about fear formed around the frontal lobe and amygdala, and the abnormalities of these functions are phobic disorder and general anxiety disorder ( in generalized anxiety disorders, obsessive compulsive disorders, post-tra ⁇ matic stress disorders, somatoform disorders, dissociative disorders, and factitious disorders It is found a lot.
  • Anxiety disorders are caused by structural problems in the brain that are responsible for emotion and memory, which is different from attention deficit hyperactivity disorder.
  • the invention is an invention that helps to understand the mechanisms that produce emotions and memories and to develop new therapeutics.
  • the present invention is based on the understanding of attention deficit hyperactivity disorder.
  • the inventor's findings are based on understanding the process of generating attention, not the generation of memory and emotion.
  • Attention deficit disorder is a typical symptom observed not only in Attention deficit hyperactivity disorder (ADHD) but also in schizophrenia, frontal lobe epilepsy and autism.
  • this concentration disorder is acting as a big obstacle to human social adaptation.
  • attention deficit hyperactivity and stereotypic in hyperactivity disorder symptoms have also been reported in schizophrenia, and low-frequency EEG observed only in the frontal lobe has also been found in both diseases.
  • many cases of the above two diseases are reported together in patients in clinical case reports. Based on these results, it can be expected that concentration disorders in hyperactivity disorder and concentration disorders in schizophrenia may have a common mechanism.
  • the present inventors fabricated an animal model in which a cobalt line was inserted into the brain, and observed low frequency electrical excitability, behavioral disorder, and cognitive deterioration observed in attention deficit disorder in the frontal lobe of the animal model.
  • T-type calcium channels were subjected to hyperactivity and low frequency frequencies through T-type calcium channel knockout mice and thalamus locally depleted animal models of T-type calcium channels.
  • T-type calcium channel inhibitors ethosuximide, Zonisamide, and Peynytoin were administered to the attention deficit hyperactivity model mouse of the present invention.
  • the cobalt of the present invention through the result that the spike-like EEG generated in the frontal lobe is reduced
  • An animal model with a line inserted is useful as a attention deficit hyperactivity model mouse, and can be used to screen for treatment of concentration disorders, and a composition containing a T-type calcium channel inhibitor can be used as a composition for treating attention deficit disorders.
  • the present invention was completed.
  • compositions for preventing and treating concentration disorders comprising a T-type calcium channel inhibitor.
  • the present invention provides a attention deficit hyperactivity model in which a cobalt wire is implanted into the brain.
  • the present invention provides a method of manufacturing a attention deficit hyperactivity model mouse comprising the following steps.
  • a method of making a attention deficit hyperactivity model mouse prepared by selecting a mouse exhibiting concentration disorder disease.
  • the present invention provides a method for screening a therapeutic agent for concentration disorders comprising the steps of:
  • It is also an object of the present invention to provide a method for screening a therapeutic agent for concentration disorders comprising the steps of:
  • the present invention provides a composition for preventing and treating concentration disorder disease, which contains a T-type calcium channel inhibitor as an active ingredient.
  • the present invention provides a health food for preventing and improving concentration disorder diseases containing a T-type calcium channel inhibitor as an active ingredient.
  • the present invention also provides a feed additive for the prevention and improvement of concentration disorder disease containing a T-type calcium channel inhibitor as an active ingredient.
  • the present invention also provides the use of the attention deficit hyperactivity model mouse according to the invention for screening for treatment of concentration disorders.
  • the present invention also provides the use of a T-type calcium channel inhibitor in the manufacture of a therapeutic agent for concentration disorders.
  • the present invention provides a use of the T-type calcium channel inhibitor in the manufacture of health foods for improving concentration disorders diseases.
  • the present invention provides a use of the T-type calcium channel inhibitor for the production of feed additives for improving concentration disorders diseases.
  • the animal mice inserted with the cobalt line of the present invention are observed to have low frequency of increased electric excitement, hyperactivity, and cognitive decline, which are characteristic of concentration disorders, and thus can be usefully used as attention deficit hyperactivity model mice. It can be useful for screening drugs for concentration disorders that show symptoms in common.
  • ethosuccimid which is one of the T-type calcium channel inhibitors
  • the composition containing the T-type calcium channel inhibitors is concentrated. It can be usefully used for treating disorders.
  • Figure 1 is a drawing showing the duration of the experiment and the experimental animal model of attention deficit hyperactivity disorder:
  • FIG. 1A is a diagram showing a position where a cobalt line and an EEG electrode are inserted to measure the fabrication and behavior of an animal model of attention deficit hyperactivity disorder;
  • Cobalt-wire The cobalt line is 500 ⁇ m (diameter) (Alfa Aesar) in the radial direction (ie, perpendicular to the cerebral surface) in the 2.6 mm of the anteroposterior of the dorsolateral frontal lobe. Inserting at positions 1.8 mm lateral and 1.3 mm ventral;
  • T R right temporal lobe
  • T L left temporal lobe
  • FIG. 1B is a diagram illustrating a period during which EEG change and behavior analysis were performed after the cobalt wire was inserted.
  • control no insertion control
  • cobalt_theta EEG at a frequency of 4-7 Hz observed in rats with cobalt lines;
  • cobalt_spike spike-like brainwaves with a frequency of 1 to 4 Hz observed in rats with cobalt lines;
  • FIG. 3A is a graph showing the results of an openfield test for behavioral quantification in an attention deficit hyperactivity disorder animal model
  • Cobalt ⁇ 6d Attention deficit hyperactivity animal model of 6 days or less with cobalt line insertion
  • Cobalt ⁇ 14d Attention deficit hyperactivity animal model of 14 days or less with cobalt line insertion
  • Cobalt ⁇ 28d Attention deficit hyperactivity animal model with cobalt gland insertion more than 28 days;
  • 3B is a result of observing the behavior of the attention deficit hyperactivity animal model observed in the open field test through video;
  • Co cobalt line insertion 28 days or more attention deficit hyperactivity animal model
  • 3C is a graph showing the results of a conditioned fear learning test of an animal model with attention deficit hyperactivity disorder
  • Cobalt animal model with attention deficit hyperactivity disorder of at least 28 days;
  • Figure 4 is a spike form that occurs after the injection of T-type calcium channel inhibitors, ethosuximide, zonisamide, Pyenytoin, respectively, in attention deficit hyperactivity disorder animal model mice
  • EEG EEG
  • 4A is a diagram showing spiked EEG before and after administration of ethosuximide, zonisamide, and phenytoin;
  • Veh control group administered saline
  • ZNS group administered with zonamid
  • PHT group administered with peytoinin
  • FIG. 4B is a graph counting the number of spike-like EEG before and after administration of ethosuximide, zonisamide, and Pyenytoin;
  • Veh control group administered saline
  • ZNS group administered with zonamid
  • PHT group administered with peytoinin
  • 5 is a graph observing the spike shape of an animal model mouse inserted with copper, aluminum and cobalt wires:
  • 5A is a graph illustrating the spike shape of an animal model mouse inserted with a copper wire
  • MD mediodorsal thalamus
  • T left temporal lobe
  • 5B is a graph observing the spike shape of an animal model mouse inserted with an aluminum wire
  • MD mediodorsal thalamus
  • T left temporal lobe
  • 5C is a graph showing the number of spikes observed in the animal model with the copper wire, the aluminum wire, and the cobalt wire inserted and the non-inserted animal model;
  • Al group into which aluminum is inserted
  • FIG. 6 is a diagram measuring the EEG and behavioral changes of an ⁇ 1G T-type calcium channel ablation animal model:
  • FIG. 6A is a picture and graph showing EEG observed in the frontal lobe and thalamus nucleus of ⁇ 1G T-type calcium channel-removed animal model
  • MD mediodorsal thalamus
  • FIG. 6B is the result of observing the behavior of the ⁇ 1G T-type calcium channel removing animal model observed in the open field test through video;
  • 60 minutes The time from the start of the open field test to 55 to 60 minutes.
  • FIG. 7 shows the electroencephalography in an animal model in which a lentiviral vector containing a shRNA targeting an ⁇ 1G T type calcium channel is locally injected into the thalamus nucleus (MD), whereby the ⁇ 1G T type calcium channel is locally inhibited.
  • MD thalamus nucleus
  • FIG. 7A is a picture and graph showing EEG observed in the frontal lobe and thalamus nucleus of a thalamic nucleus focal ⁇ 1G T-type calcium channel ablation animal model;
  • MD mediodorsal thalamus
  • sh3.1 Animal model of thalamic sagittal local removal of ⁇ 1G T-type calcium channel using shRNA virus
  • FIG. 7B is a power spectrum analysis showing that the low frequency EEG was significantly reduced in the animal model in which the sagittal nucleus local ⁇ 1G T type calcium channel was suppressed.
  • Figure 8 is a local injection of a lentiviral vector containing a shRNA targeting the ⁇ 1G T type calcium channel into the thalamus nucleus (MD) to measure behavioral changes in animal models in which the ⁇ 1G T type calcium channel is inhibited only in the thalamus nucleus. Picture is:
  • FIG. 8A is the result of video observation of the behavior of the sagittal nucleus local ⁇ 1G T-type calcium channel ablation animal model observed in the open field test;
  • sh3.1 Animal model of thalamic sagittal local removal of ⁇ 1G T-type calcium channel using shRNA virus;
  • 60 minutes The time from the start of the open field test to 55 to 60 minutes.
  • FIG. 8B is a graph showing the behavior of thalamic nucleus local ⁇ 1G T-type calcium channel ablation animal model observed in open field examination;
  • sh3.1 Animal model of thalamic sagittal local removal of ⁇ 1G T-type calcium channel using shRNA virus;
  • 60 minutes The time from the start of the open field test to 55 to 60 minutes.
  • the present invention provides attention deficit hyperactivity model mice produced by the following steps:
  • Attention deficit hyperactivity model mouse prepared by screening for mice exhibiting concentration disorder disease.
  • the attention deficit hyperactivity model mouse of the present invention is preferably produced by the above steps, but is not limited to the above steps.
  • the attention deficit hyperactivity model mouse is produced by fixing the head of the mouse (C57BL / 6J between 10 to 20 weeks) to stereotaxic, and then attaching the cobalt wire (Alfa Aesar) to a stereosteric holder (stereotaxic). It is preferable to insert using a holder, but is not limited thereto.
  • the cobalt line of step 1) has a diameter of 500 ⁇ m (diameter) (Alfa Aesar) in the radial direction (i.e., perpendicular to the cerebral surface).
  • Is preferably inserted at a position of 2.0 to 3.0 mm in the anteroposterior of the frontal lobe, 1.5 to 2.5 mm in the lateral direction, and 1.0 to 2.0 mm in the ventral direction, more preferably on the right dorsal side.
  • the insertion is preferably at a position of 2.6 mm in the anteroposterior of the dorsolateral frontal lobe, 1.8 mm in the lateral, and 1.3 mm in the ventral.
  • epidural anesthesia electrodes for EEG recording were inserted in the right frontal lobe where the cobalt line was inserted, while the other electrodes were inserted in the left frontal and temporal lobe frontal lobes.
  • the insertion position is 2.8 mm in the anteroposterior and 0.8 mm in the frontal lobe in the right frontal lobe, and 2.8 mm in the anteroposterior and 0.8 mm in the lateral in the left frontal lobe. Inserted in position respectively.
  • the grounding EEG is preferably inserted at the position of the occipital of the skull, but is not limited thereto.
  • an attention deficit hyperactivity animal model (see FIG. 1).
  • Epilepsy is known to occur in animal models made by inserting cobalt wire into the brain (Chang et al., Epilepsy Research, 2004), but it is not known to use it as an animal model for attention deficit hyperactivity disorder.
  • the present inventors observed the characteristic EEG, behavioral, and cognitive functions observed in attention disorders disorders to determine whether cobalt-inserted mice can be used as attention deficit hyperactivity disorder animals.
  • EEG electroencephalogram
  • mice inserted with cobalt lines were inserted with cobalt lines.
  • the behavior was monitored by an open-field test at 6, 14, and 28 days, and the activity of the cobalt line compared to the control group was increased. Significant increase was observed (see A of FIG. 3).
  • This tendency increased as the duration of the cobalt line insertion increased, and more specifically, the activity was analyzed by drawing a trace of the animal model of attention deficit hyperactivity disorder. It was confirmed that homotypy (stereotypy), which is a turning direction, was observed (see FIG. 3B).
  • T-type calcium channel inhibitors in addition to the above eto succinimide, Zonisamide, Peynytoin, SUN-N8075, eponidipine and Y 3+ , La 3+ , Ce 3+ , Trivalent metal ions selected from the group consisting of Nd 3+ , Gd 3+ , Ho 3+ , Er 3+ Yb 3+ , Ni 2+ , U-92032 (7-[[4- [bis (4-fluorophenyl ) methyl] -1-piperazinyl] methyl] -2-[(2-hydroxyethyl) amino] 4- (1-methylethyl) -2,4,6-cycloheptatrien-1-one), penfluridol, flu There are spirylene and valproate, and when these T-type calcium channel inhibitors are introduced into the attention deficit hyperactivity animal of the present invention, the symptoms of behavioral disorders may be alleviated.
  • the inventors inserted copper and aluminum wires other than cobalt wires into the right frontal lobe of the mouse instead of cobalt wires.
  • the spike-like EEG observed in the EEG of the cobalt line-inserted mouse was not observed, this result was similar to the insertion-free control group inserted nothing. That is, the non-insertion control group can be usefully used as a control group for the cobalt line-inserted mouse, and the spike-type EEG observed in the animal model according to the present invention was confirmed to be generated by the cobalt line inserted (FIG. 5).
  • a knockout model (Cav3.1 T-type calcium channel removal animal model) from which all ⁇ 1G T-type calcium channels have been removed and the ⁇ 1G T-type calcium channel according to the present invention are targeted.
  • Local injection of a lentiviral vector containing shRNA followed by electroencephalogram and behavioral changes confirmed that low EEG was observed in the frontal lobe when all ⁇ 1G T-type calcium channels were removed locally or all the thalamus. (See FIGS. 6-8).
  • the present invention provides a method of manufacturing a attention deficit hyperactivity model mouse comprising the following steps.
  • a method of making a attention deficit hyperactivity model mouse prepared by selecting a mouse exhibiting concentration disorder disease.
  • the attention deficit hyperactivity model mouse is produced by fixing the head of the mouse (C57BL / 6J between 10 to 20 weeks) to stereotaxic, and then attaching the cobalt wire (Alfa Aesar) to a stereosteric holder (stereotaxic). It is preferable to insert using a holder, but is not limited thereto.
  • the cobalt line of step 1) has a diameter of 500 ⁇ m (diameter) (Alfa Aesar) in the radial direction (i.e., perpendicular to the cerebral surface).
  • epidural anesthesia electrodes for EEG recording were inserted in the right frontal lobe where the cobalt line was inserted, while the other electrodes were inserted in the left frontal and temporal lobe frontal lobes.
  • the insertion position is 2.8 mm in the anteroposterior and 0.8 mm in the frontal lobe in the right frontal lobe, and 2.8 mm in the anteroposterior and 0.8 mm in the lateral in the left frontal lobe. Inserted in position respectively.
  • the grounding EEG is preferably inserted at the position of the occipital of the skull, but is not limited thereto.
  • the present invention provides a method for screening a therapeutic agent for concentration disorders comprising the following steps.
  • the concentration disorder disease therapeutic agent screening method preferably includes the above step, but is not limited thereto.
  • the disorder is selected from the group consisting of attention deficit hyperactivity disorder, schizophrenia, frontal lobe epilepsy, and autism. It is preferably one, but is not limited thereto.
  • the animal mouse inserted with the cobalt line of the present invention is observed as a low frequency EEG, behavioral disorder, and cognitive decline, which is characteristic of concentration disorders, and thus is useful as a attention deficit hyperactivity model mouse mouse, so that it can be screened for treatment of concentration disorders. It can be used for the method.
  • the present invention provides a method for screening a therapeutic agent for concentration disorders comprising the steps of:
  • the concentration disorder disease therapeutic agent screening method preferably includes the above step, but is not limited thereto.
  • the behavioral disorder is selected from the group consisting of open field test, water maze, new object test, and new recognition test. It is preferable to measure a behavioral disorder through, but is not limited thereto.
  • the cognitive function is a fear learning function memory test, a pre-pulse inhibition test, an increased pulse maze (elevated plus maze). It is preferable to measure the cognitive function through a method selected from the group consisting of, but is not limited thereto. Behavioral and cognitive impairments seen in attention deficit disorders include planning, impulse control, purpose management, self-correction of behavior, attention control, and working memory. It is the case that there is a problem in management function.
  • the present invention provides a composition for preventing and treating concentration disorder disease, which contains a T-type calcium channel inhibitor as an active ingredient.
  • the concentration disorder disease group is composed of attention deficit hyperactivity disorder, schizophrenia, frontal lobe epilepsy, and autism It is preferably selected from, but is not limited thereto.
  • the T-type calcium channel inhibitors are mibefradil, tetramethrin, ethosuximide, zonisamide, Peynytoin, SUN-N8075, Eponidipine and a trivalent metal ion selected from the group consisting of Y 3+ , La 3+ , Ce 3+ , Nd 3+ , Gd 3+ , Ho 3+ , Er 3+ Yb 3+ , Ni 2+ , U-92032 (7-[[4- [bis (4-fluorophenyl) methyl] -1-piperazinyl] methyl] -2-[(2-hydroxyethyl) amino] 4- (1-methylethyl) -2, 4,6-cycloheptatrien-1-one, penfluridol
  • an animal mouse inserted with cobalt can be usefully used as a model of attention deficit hyperactivity disorder, and by administering ethosuccimid, which is one of T-type calcium channel inhibitors, to the animal model Since the symptoms of concentration disorder disease are reduced, it can be seen that a composition containing a T-type calcium channel inhibitor can be usefully used as a composition for preventing and treating concentration disorder disease.
  • the therapeutically effective amount of a T-type calcium channel inhibitor may vary depending on several factors, such as the method of administration, the site of interest, the condition of the patient, and the like. Therefore, when used in humans, the dosage should be determined in an appropriate amount in consideration of both safety and efficiency. It is also possible to estimate the amount used in humans from an effective amount determined through animal testing. Such considerations when determining the effective amount include, for example, Hardman and Limbird, eds., Goodman and Gilman's The Pharmacological Basis of Therapeutics, 10th ed. (2001), Pergamon Press; And E.W. Martin ed., Remington's Pharmaceutical Sciences, 18th ed. (1990), Mack Publishing Co.
  • compositions of the present invention may also include carriers, diluents, excipients or combinations of two or more commonly used in biological agents.
  • Pharmaceutically acceptable carriers are not particularly limited so long as they are suitable for in vivo delivery of T-type calcium channel inhibitors, for example, Merck Index, 13th ed., Merck & Co. Inc.
  • Compounds, saline solution, sterile water, Ringer's solution, buffered saline solution, dextrose solution, maltodextrin solution, glycerol, ethanol and one or more of these components can be mixed and used as needed. Conventional additives can be added.
  • diluents, dispersants, surfactants, binders and lubricants may be additionally added to formulate into main dosage forms, pills, capsules, granules or tablets such as aqueous solutions, suspensions, emulsions and the like.
  • it may be preferably formulated according to each disease or component by a suitable method in the art or using a method disclosed in Remington's Pharmaceutical Science (Mack Publishing Company, Easton PA, 18th, 1990).
  • composition of the present invention may further contain one or more active ingredients exhibiting the same or similar functions.
  • the composition of the present invention comprises 0.0001 to 10% by weight of the protein, preferably 0.001 to 1% by weight, based on the total weight of the composition.
  • composition may be parenterally administered (eg, applied intravenously, subcutaneously, intraperitoneally, or topically) or orally, depending on the desired method, but is preferably parenterally administered, but is not limited thereto.
  • Formulations for parenteral administration include powders, granules, tablets, capsules, sterile aqueous solutions, solutions, non-aqueous solutions, suspensions, emulsions, syrups, suppositories, aerosols, etc. It may be used in the form of a formulation, and preferably, an external skin pharmaceutical composition of cream, gel, patch, spray, ointment, warning agent, lotion agent, linen agent, pasta agent or cataplasma agent may be prepared and used. It is not limited to this. Compositions of topical administration may be anhydrous or aqueous, depending on the clinical prescription.
  • non-aqueous solvent and suspending agent propylene glycol, polyethylene glycol, vegetable oil such as olive oil, injectable ester such as ethyl oleate and the like can be used.
  • base of the suppository witepsol, macrogol, tween 61, cacao butter, laurin butter, glycerogelatin and the like can be used.
  • Solid preparations for oral administration include powders, granules, tablets, capsules, soft capsules, pills and the like.
  • Oral liquid preparations include suspensions, solvents, emulsions, syrups, and aerosols.In addition to commonly used simple diluents such as water and liquid paraffin, various excipients such as wetting agents, sweeteners, fragrances, and preservatives may be included. Can be.
  • Dosage varies depending on the weight, age, sex, health condition, diet, time of administration, method of administration, rate of excretion and severity of the patient.
  • the daily dosage of the composition according to the present invention is 0.0001 mg to 300 mg, preferably 0.001 mg to 200 mg, and more preferably administered once to several times a day.
  • the present invention also provides the use of a concentration deficit hyperactivity disorder animal model mouse according to the invention for screening a therapeutic agent for concentration disorders.
  • the present invention also provides the use of a T-type calcium channel inhibitor in the manufacture of a therapeutic agent for concentration disorders.
  • T-type calcium channel inhibitors were administered to this attention deficit hyperactivity disorder animal model At the same time, it was confirmed that hyperactivity and abnormal electrical excitability of the frontal lobe were alleviated. Therefore, T-type calcium channel inhibitors screened using the attention deficit hyperactivity disorder animal model of the present invention can be usefully used for the preparation of therapeutic agents for concentration disorders.
  • the present invention provides a health food for preventing and improving concentration disorder diseases containing a T-type calcium channel inhibitor as an active ingredient.
  • the present invention provides a use of the T-type calcium channel inhibitor in the manufacture of health foods for improving concentration disorders diseases.
  • the attention disorder disorder consists of attention deficit hyperactivity disorder, schizophrenia, frontal lobe epilepsy, and autism It is preferably selected from the group, but is not limited thereto.
  • the T-type calcium channel inhibitors are mibefradil, tetramethrin, ethosuximide, zonisamide, Peynytoin, SUN-N8075, Eponidipine and a trivalent metal ion selected from the group consisting of Y 3+ , La 3+ , Ce 3+ , Nd 3+ , Gd 3+ , Ho 3+ , Er 3+ Yb 3+ , Ni 2+ , U-92032 (7-[[4- [bis (4-fluorophenyl) methyl] -1-piperazinyl] methyl] -2-[(2-hydroxyethyl) amino] 4- (1-methylethyl) -2, 4,6-cycloheptatrien-1-one, penflurid
  • an animal mouse inserted with cobalt wire can be usefully used as a model of attention deficit hyperactivity disorder, and administration of ethosuccimid, a type of T-type calcium channel inhibitor, to the animal model
  • a composition containing a T-type calcium channel inhibitor can be usefully used as a composition for preventing and treating concentration disorder disease.
  • the T-type calcium channel inhibitor of the present invention may be provided as a food composition by mixing with a food acceptable carrier.
  • the T-type calcium channel inhibitor of the present invention When used as a food or beverage additive, the T-type calcium channel inhibitor may be added as it is or used together with other food or food ingredients, and may be appropriately used according to a conventional method.
  • the mixed amount of the T-type calcium channel inhibitor may be appropriately determined depending on the purpose of use (prevention, health or therapeutic treatment).
  • the T-type calcium channel inhibitor In the case of long-term intake for health and hygiene or health control, the T-type calcium channel inhibitor has no problem in terms of safety, and thus can be taken for a long time.
  • Examples of the food to which the substance can be added include meat, sausage, bread, chocolate, candy, snacks, confectionery, pizza, ramen, dairy products including other noodles, gum, ice cream, various soups, drinks, tea, and drinks. Alcoholic beverages and vitamin complexes.
  • the liquid component added in addition to the T-type calcium channel inhibitor when formulated into a beverage is not limited to now, but may contain various flavors or natural carbohydrates, etc. as additional ingredients, as in conventional beverages.
  • natural carbohydrates include monosaccharides (e.g. glucose, fructose, etc.), disaccharides (e.g. maltose, sucrose, etc.) and polysaccharides (e.g. conventional sugars such as dextrins, cyclodextrins, etc.), and xylitol Sugar alcohols such as sorbitol and erythritol.
  • the proportion of said natural carbohydrates is generally about 1-20 g, preferably about 5-12 g per 100 ml of the composition of the present invention.
  • natural flavoring agents taumarin, stevia extract (e.g., Rebaudioside A, glycyrzin, etc.)
  • synthetic flavoring agents e.g., saccharin, aspartame, etc.
  • the food composition of the present invention is a nutrient, colorant and enhancer (cheese, chocolate, etc.), pectic acid and salts thereof, organic acids of various nutrients, vitamins, minerals (electrolytes), synthetic flavors and natural flavors, etc. , Protective colloid thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohols, carbonation agents used in carbonated drinks, and the like.
  • the food composition of the present invention may also contain pulp for the production of fruit and vegetable drinks. These components may be used alone or in combination, and the proportion of such additives is generally selected in the range of 0.001 to 50 parts by weight per total weight of the composition.
  • the present invention also provides a feed additive for the prevention and improvement of concentration disorder disease containing a T-type calcium channel inhibitor.
  • the present invention provides a use of the T-type calcium channel inhibitor in the manufacture of a feed additive for improving concentration disorders disease.
  • the concentration disorder disease is composed of attention deficit hyperactivity disorder, schizophrenia, frontal lobe epilepsy, and autism It is preferably selected from the group, but is not limited thereto.
  • the T-type calcium channel inhibitors are mibefradil, tetramethrin, ethosuximide, zonisamide, Peynytoin, SUN-N8075, Eponidipine and a trivalent metal ion selected from the group consisting of Y 3+ , La 3+ , Ce 3+ , Nd 3+ , Gd 3+ , Ho 3+ , Er 3+ Yb 3+ , Ni 2+ , U-92032 (7-[[4- [bis (4-fluorophenyl) methyl] -1-piperazinyl] methyl] -2-[(2-hydroxyethyl) amino] 4- (1-methylethyl) -2, 4,6-cycloheptatrien-1-one, penflurid
  • the composition comprising a -type calcium channel inhibitor can be usefully used as a feed additive for preventing and improving concentration disorder diseases.
  • Feed composition of the present invention can be prepared in the form of fermented feed, compound feed, pellets and silage, etc., can be prepared by conventional methods.
  • An effective amount of the T-type calcium channel inhibitor added to the feed of the present invention is preferably selected from the range of 0.001 to 50 parts by weight per weight of the total composition, but is not limited thereto.
  • mice C57BL / 6J mice (Bio Model System Park), 10 to 20 weeks old, were bred and handled according to the regulations of the Experimental Animal Steering Committee of the Korea Advanced Institute of Science and Technology (KAIST). Mice remained freely accessible to water and feed, with a light and dark cycle of 12 hours.
  • KAIST Experimental Animal Steering Committee of the Korea Advanced Institute of Science and Technology
  • a cobalt line reported to cause hypoxia was inserted into the right frontal lobe to create an animal model of Attention Deficit Hyperactivity Disorder.
  • attention deficit hyperactivity model mice were fabricated after 0.2% avertin anesthesia (Tribromoethanol, injected at 20 mg / ml via intraperitoneal injection), and the inventors followed the stereotaxic After fixing the head of the mouse (B6 mouse between 10 and 20 weeks), the cobalt wire (Alfa Aesar) is inserted using a holder which is a part of stereotaxic (David Kopf Instr ⁇ ments, Germany). do.
  • the cobalt line is 500 ⁇ m (diameter) (Alfa Aesar) in the radial direction (ie, perpendicular to the cerebral surface) 2.6 mm, anteroposterior of the right dorsal lateral frontal lobe, lateral ) 1.8 mm, and 1.3 mm in the ventral direction.
  • epidural anesthesia electrodes for EEG recording were inserted in the right frontal lobe where the cobalt line was inserted, while the other electrodes were inserted in the left frontal and temporal lobe frontal lobes.
  • the insertion position is 2.8 mm in the anteroposterior and 0.8 mm in the frontal lobe in the right frontal lobe, and 2.8 mm in the anteroposterior and 0.8 mm in the lateral in the left frontal lobe. Inserted in position respectively.
  • Grounding EEG was inserted at the occipital position of the skull.
  • the EEG electrode When the EEG electrode was put together with the cobalt wire, it was closed using dental cement. In the case of surgery for behavioral experiments without inserting the EEG electrode, the suture was closed using a surgical thread.
  • the EEG signal and video images were taken for 30 days.
  • the EEG signal was amplified (Grass model 7H polygraph, Grass Technologies, USA) and digitized at a sampling rate of 500 Hz (DIGIDATA 1320A, Molecular Devices, USA).
  • pClamp9.2 software (Molecular Devices, USA) was used to obtain the data.
  • Lenti virus vectors expressing shRNAs targeting Ca v 3.1 T-type calcium channels were constructed.
  • the synthesized double oligonucleotides (SEQ ID NO: 1: 5′-CGGAATTCCGG GAAGATCGTAGATA GCAAA ttcaagaga TTTGCTATCTACGATCTTC TTTTTGATATCTAGACA-3 ′) were inserted into the sh Lentisyn3.4G lentiviral vector (Macrogen, KOREA.).
  • the sh Lentisyn3.4G lentiviral vector was designed to express sh RNA from the U6 promoter and to express the enhanced green fluorescent protein (EGFP) from the synapsin promoter.
  • EGFP enhanced green fluorescent protein
  • the target sequence was inconsistent with any mRNA except Ca v 3.1 from the National Center for Biotechnology Information database.
  • the scrambled version of the Ca v 3.1 sh RNA oligonucleotide has the sequence of SEQ ID NO: 2 (5'-C GGAATTCCGG GTAAGTGAA CTGACAAGAA ttcaagaga TTCTTGTCAGTTCACTTAC T TTTTGATATCTAGACA -3 '), and the sh Lentisyn3.4G lentiviral vector (Macrogen, KOREA.) And used as a control.
  • This sequence did not show homology with any known mammalian genes.
  • the recombinant lentivirus vector can be produced commercially and concentrated (Macrogen LentiVector Institute, Korea).
  • lentiviral at a concentration of about 2 ⁇ 10 6 transduction units / ml.
  • Ca v 3.1 The solution having a virus containing sh RNA or scrambled control micro syringe pumps (micro syringe p ⁇ mp) using (Eicom, UK), ipsi- MD ( on the right side of the ipsilateral thalamus MD, MD sisanghaek Virus was inserted) using a Nanofil 33G blunt needle and a Nanofil syringe (World Precision Instruments, USA).
  • the present inventors observed the brain waves characteristic of the hyperactivity disorder disease in order to check whether the animal model prepared by inserting the cobalt line of Example 1 into the right frontal lobe can be used as an attention deficit hyperactivity disorder animal model.
  • EEG electrodes were inserted into the left, right frontal lobe, and the left and right temporal lobes for electroencephalogram (EEG) measurement of the animal model, and then the brain waves were observed for 30 days.
  • the EEG electrode was inserted simultaneously with the cobalt wire.
  • the coordinates were calculated and positioned using a stereotaxic machine, such as a cobalt line, and the EEG electrode was inserted.
  • the cobalt line is 500 ⁇ m (diameter) (Alfa Aesar) in the radial direction (ie, perpendicular to the cerebral surface) of 2.6 mm of the anteroposterior of the right dorsal lateral frontal lobe, Insertions were made at positions 1.8 mm lateral and 1.3 mm ventral.
  • epidural anesthesia electrodes for EEG recording were inserted in the right frontal lobe where the cobalt line was inserted, while the other electrodes were inserted in the left frontal and temporal lobe frontal lobes.
  • the insertion position is 2.8 mm in the anteroposterior and 0.8 mm in the frontal lobe in the right frontal lobe, and 2.8 mm in the anteroposterior and 0.8 mm in the lateral in the left frontal lobe. Inserted in position respectively. Grounding EEG was inserted at the occipital position of the skull.
  • EEG recording was performed simultaneously with video recording after a recovery period of 3-4 days.
  • the present inventors intended to identify the characteristic behavior of the hyperactivity disorder disease in order to check whether the animal model prepared by inserting the cobalt line of Example 1 into the right frontal lobe can be used as an animal model of attention deficit hyperactivity disorder. .
  • the mouse is carefully placed in an open field test kit (a square bottom box made of acrylic, 40 ⁇ 40 ⁇ 50 cm), and the distance traveled within the kit for 1 hour and 1/2 cycle is determined by digital video recording. Monitoring at minute intervals The open field test was performed between 18 and 22 hours and EthoVision (Noduls, USA) was used to analyze the video images.
  • the attention deficit hyperactivity disorder animal model has a long time to insert a cobalt line. Increasingly, the distance moved was increased, and this tendency was observed to be significantly increased as compared to the control group without the cobalt line inserted (A of FIG. 3).
  • EthoVision (Noduls, USA) analyzed traces of animal models with attention deficit hyperactivity disorder 28 days after cobalt line insertion, and found that repetitive unilateral homology in the movement of mice inserted with cobalt line. (stereotype) was observed (FIG. 3B).
  • the mouse In order to perform a fear conditioning test, the mouse repeatedly gave an electrical stimulus with a specific sound on the first day, causing the mouse to remember fear. On the second day, two tests were carried out, the first of which confirmed the context of the space where the electrical stimulation was received on the first day, and the second of which remembered the sound that was produced when receiving the electrical stimulation ( cue) was tested.
  • the freezing time of the mouse was measured to confirm memory. Since the mouse does not show movement when it is afraid, the freezing time will be long if the mouse is remembering, otherwise the freezing time will be reduced. This time was measured to examine the cognitive function of the cobalt wired mouse.
  • the attention deficit hyperactivity disorder animal model of the present invention increased the electrical signal of low frequency characteristically in the frontal lobe.
  • etosuccimid Huguenard, 2002
  • Huguenard, 2002 known as an inhibitor of T-type calcium channel (Huguenard, 2002)
  • the attention deficit hyperactivity disorder animal model of the present invention increased the electrical signal of low frequency characteristically in the frontal lobe, and etosuccimid (inhibitor of T-type calcium channel) Huguenard, 2002), Zonisamide (ZNS) (Kito et al., 1996) and Peynytoin (PHT) (Lacinova et al., 2000) were treated in hyperactivity disorder mouse models.
  • Etosuccimid (Sigma-aldrich, USA) was administered to the abdominal cavity of the attention deficit hyperactivity disorder animal model 7 to 9 days after the cobalt gland was inserted at a concentration of 150 mg / kg, followed by changes in the EEG for 1 hour. Observed. EEG records were recorded 30 minutes before drug treatment in a free-moving cube brain room. As a result of comparing the number of spikes observed in the EEG before and after the administration of etosukimide, when treated with ethosuccimid, the number of spikes observed in the frontal lobe was significantly reduced compared to before treatment. This means that etosuccimid can alleviate the symptoms of hyperactivity by mitigating excess electrical signals of the frontal lobe.
  • the present inventors used a method in which the cobalt wire was inserted into the copper wire and the aluminum wire.
  • the cobalt wire (Alfa Aesar), the copper wire, and the aluminum wire are each a stereotaxic holder. Insert using.
  • the cobalt line is 500 ⁇ m (diameter) (Alfa Aesar) in the radial direction (ie, perpendicular to the cerebral surface) 2.6 mm, anteroposterior of the right dorsal lateral frontal lobe, lateral ) 1.8 mm, and 1.3 mm in the ventral direction.
  • epidural anesthesia electrodes for EEG recording were inserted in the right frontal lobe where the cobalt line was inserted, while the other electrodes were inserted in the left frontal and temporal lobe frontal lobes.
  • the insertion position is 2.8 mm in the anteroposterior and 0.8 mm in the frontal lobe in the right frontal lobe, and 2.8 mm in the anteroposterior and 0.8 mm in the lateral in the left frontal lobe. Inserted in position respectively. Grounding EEG was inserted at the occipital position of the skull.
  • the spike-like EEG observed in the cobalt line was not observed in the copper and aluminum wire insert groups as shown in FIG. 5, and this tendency was similar to the non-insertion control group in which nothing was inserted into the mouse frontal lobe ( 5). Therefore, it was confirmed that the non-inserted animal model mouse of the present invention can be used as a control.
  • the present inventors studied the mechanism of frontal lobe spike generation using the animal model in which all Ca v 3.1 T-type calcium channels of ⁇ Example 2-1> were removed.
  • EGE Electroencephalogram
  • the low frequency spike generated in the frontal lobe 6-7 days after cobalt line insertion was significantly reduced in an animal model in which ⁇ 1G T-type calcium channel, which is known to be important for producing brain waves in the thalamus nucleus, was significantly reduced. I did it.
  • the frequency of low frequency EEG observed in the frontal lobe of the ⁇ 1G T-type calcium channel-removed animal model was significantly reduced compared to the control (T test, p ⁇ 0.05).
  • the present inventors studied the mechanism of frontal lobe spike generation using the animal model in which all Ca v 3.1 T-type calcium channels of ⁇ Example 2-1> were removed.
  • EGE Electroencephalogram
  • the mouse is carefully placed in an open field test kit (a square bottom box made of acrylic, 40 ⁇ 40 ⁇ 50 cm), and the distance traveled within the kit for 1 hour and 1/2 cycle is determined by digital video recording. Monitoring at minute intervals The open field test was performed between 18 and 22 hours and EthoVision (Noduls, USA) was used to analyze the video images.
  • an open field test kit a square bottom box made of acrylic, 40 ⁇ 40 ⁇ 50 cm
  • the ⁇ 1G T-type calcium channel removing animal model was cobalt-line inserted 6 to 7 After one day, the distance to travel was increased compared to the control animals, and this tendency was observed to be markedly increased as compared to the control group without enhancement of ⁇ 1G T-type calcium channel removal (FIG. 6B).
  • the present inventors localized a lentiviral vector expressing shRNA targeting the Ca v 3.1 T-type calcium channel of ⁇ Example 2-2 only to the thalamus nucleus.
  • the mechanism of sagittal nucleus spike production was studied using a thalamus local ⁇ 1G T-type calcium channel ablation animal model prepared by transfection.
  • the present inventors localized a lentiviral vector expressing shRNA targeting the Ca v 3.1 T-type calcium channel of ⁇ Example 2-2 only to the thalamus nucleus.
  • the mechanism of sagittal nucleus spike production was studied using a thalamus local ⁇ 1G T-type calcium channel ablation animal model prepared by transfection.
  • the mouse is carefully placed in an open field test kit (a square bottom box made of acrylic, 40 ⁇ 40 ⁇ 50 cm), and the distance traveled within the kit for 1 hour and 1/2 cycle is determined by digital video recording. Monitoring at minute intervals The open field test was performed between 18 and 22 hours and EthoVision (Noduls, USA) was used to analyze the video images.
  • an open field test kit a square bottom box made of acrylic, 40 ⁇ 40 ⁇ 50 cm
  • FIG. 8A As a result of quantifying behavioral symptoms using an open-field test (40 ⁇ 40 ⁇ 50 cm), as shown in FIG. 8A, the ⁇ 1G T-type calcium channel-removing animal model was moved compared to the control animal. The distance was increased, and this tendency was observed to be significantly increased as compared to the control group did not improve the ⁇ 1G T-type calcium channel removal (Fig. 8A). In addition, these results are shown graphically as shown in FIG. 8B (B in FIG. 8).
  • compositions of the present invention are given below.
  • tablets were prepared by tableting according to a conventional method for producing tablets.
  • the capsule was prepared by filling in gelatin capsules according to the conventional method for producing a capsule.
  • Example ⁇ 1-1> of the present invention 0.5 to 5.0 parts by weight of the extract was added to the flour, using the mixture to prepare bread, cakes, cookies, crackers and noodles to prepare a food for health promotion.
  • Example 1-1 of the present invention 5-10 parts by weight of extract was added to milk, and various dairy products such as butter and ice cream were prepared using the milk.
  • Brown rice, barley, glutinous rice, and yulmu were alphad by a known method, and then dried and roasted to prepare a powder having a particle size of 60 mesh.
  • Black beans, black sesame seeds, and perilla were also steamed and dried by a known method, and then ground to a powder having a particle size of 60 mesh.
  • Example 1-1 of the present invention The extract was concentrated under reduced pressure in a vacuum concentrator, and the dried product obtained by drying with a sprayer and a hot air dryer was pulverized with a particle size of 60 mesh to obtain a dry powder.
  • the dry powder of the grains, seeds and the extract of Example 1-1 of the present invention prepared in the above was prepared by blending in the following ratio.
  • Cereals (30 parts by weight brown rice, 15 parts by weight brittle, 20 parts by weight of barley),
  • Seeds (7 parts by weight perilla, 8 parts by weight black beans, 7 parts by weight black sesame seeds),
  • the resulting solution is filtered and obtained in a sterilized 2 L container, sealed sterilized and stored in the refrigerator after Used in the manufacture of the health food of the invention.
  • composition ratio is a composition suitable for a preferred beverage in a preferred embodiment
  • the composition ratio may be arbitrarily modified according to regional and ethnic preferences such as demand hierarchy, demand country, and intended use.
  • ADHD model animals produced using the cobalt line according to the present invention exhibit hyperactivity and prefrontal hyper-excitability of the frontal lobe, which are characteristic of concentration disorders. Since it is reduced by the administration of ethosuximide (ethosuximide), etosuccimid can be usefully used as a composition for the prevention and treatment of concentration disorder symptoms common to the symptoms of hyperactivity.
  • ethosuximide ethosuximide
  • etosuccimid can be usefully used as a composition for the prevention and treatment of concentration disorder symptoms common to the symptoms of hyperactivity.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Chemical & Material Sciences (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Biophysics (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Neurology (AREA)
  • Neurosurgery (AREA)
  • Psychiatry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Surgery (AREA)
  • Medical Informatics (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Immunology (AREA)
  • Environmental Sciences (AREA)
  • Psychology (AREA)
  • Developmental Disabilities (AREA)
  • Hospice & Palliative Care (AREA)
  • Hematology (AREA)
  • Urology & Nephrology (AREA)
  • Cell Biology (AREA)
  • Analytical Chemistry (AREA)
  • General Physics & Mathematics (AREA)
  • Food Science & Technology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Biodiversity & Conservation Biology (AREA)

Abstract

본 발명은 주의력 결핍 과잉 행동 모델 마우스 및 이를 이용한 집중력 장애 질병 예방 및 치료용 조성물의 스크리닝 방법에 관한 것으로서, 보다 구체적으로 코발트 선을 전두엽의 우측에 삽입한 동물 모델이 주의력 결핍 과잉 행동 모델 마우스로써 유용하며, 상기 동물 모델에 T-타입 칼슘채널 억제제의 하나인 에토숙시미드를 투여함으로써, 집중력 장애의 특징인 낮은 주파수의 뇌파, 과잉행동, 및 인지기능의 저하가 관찰되는 결과를 통하여 주의력 결핍 과잉 행동 모델 마우스를 이용하여 집중력 장애 치료제 스크리닝에 활용할 수 있으며, T-타입 칼슘채널 억제제를 함유하는 조성물을 집중력 장애 예방 및 치료에 유용하게 사용할 수 있음을 확인하였다.

Description

주의력 결핍 과잉 행동 모델 마우스，상기 모델 마우스를 이용한 집중력 장애 질병 예방 및 완화 효과 검증 방법，및 Ｔ-타입 칼슘채널을 억제하여 집중력 장애를 치료하는 방법
본 발명은 코발트 선을 삽입하여 제작된 주의력 결핍 과잉 행동 모델 마우스, 이를 이용한 집중력 장애 질병 예방 및 치료용 조성물의 스크리닝 방법, 및 집중력 장애 질병 치료방법에 관한 것이다.
주의력 결핍 과잉 행동장애(Attention Deficit and Hyperactivity Disorder, 이하 ADHD)는 학령기 전후의 아동에게서 흔히 나타나는 정신과적 질환으로, 부주의(Inattention), 과잉행동(Hyperactivity), 충동성(Impulsivity)이 주된 증상이다. 이와 같은 주의 집중 부족과 과잉활동은 아동의 학습장애를 비롯한 다양한 심리사회적 장애들을 동반하며, 청소년기의 비행이나 일탈행동, 성인기에는 약물 남용 및 범죄 등을 야기시키는 원인이 될 수 있다고 보고되었다(Y. B. Lee, J. S. Shin, Korean journal of family social work, 2000; G. D. Kewley, British Medical Journal, 1998; L. B. Silver, Attention-deficit hyperactivity disorder, Washington, DC.: American Psychiatry Press, Inc. 1992).
주의력 결핍 과잉 행동장애의 원인에는 유전적 요인(R. A. Barkley. Attention deficit hyperactivity disorder: A handbook of diagnosis and treatment. New York: Guilford Press. 1990), 납 수치와 인스턴트식품의 식품첨가물에 대한 반작용으로 보는 생화학적 요인(G. David, J. Neal, Abnormal Psychology. John Wilry & Sons. 1976), 뇌에 전달하는 자극을 적절히 선택하는데 문제가 있다고 보는 견해(이효신, 정서학습장애연구. 16), 환경적 요인 즉 부모와 자녀와의 관계나 부모의 사회적 지위, 임신 중 산모의 흡연과 알콜 남용 등이 있다. 그러나, 사회심리적인 요인보다 신경생물학적 요인이 중요하다고 여겨지고 있으며 이에 따라 주의력 결핍 과잉 행동장애 치료를 위한 치료제 및 생물학적 요인에 대한 연구가 활발히 진행되고 있다.
신경해부학적으로는 전두엽의 이상, 신경생화학적으로는 중추신경계의 신경전달물질의 이상이 연구되었으며, 신경생물학적으로는 전전두엽 피질(prefrontal cortex), 시상(thalamus), 도파민 중피질 돌기(dopaminergic mesocortical projection)의 기능에 이상에 관하여 연구되었다. 특히, 생물학적 요인으로 단일한 신경계의 발달 이상보다는, 고위 인지기능을 담당하는 여러 뇌 영역의 상호연관성의 이상으로 초래되는 비 균일한 질환군일 가능성이 제시되고 있다(Y. Frank, S. G. Pavlakis, Pediatric Neurology., 2001; 김붕년, 이동수, 조수철. 신경정신의학., 2000). 최근까지의 주의력 결핍 과잉 행동장애 환아를 대상으로 한 구조적, 기능적 뇌 영상연구에 따르면, 대체로 ADHD의 병태생리가 전두-선조회로(fronto-striatal tract)의 기능장애와 연관되어 있으며, 메틸페니데이트(Methylphenidate, MPH)에 의한 약물 효과는 이 영역에서의 도파민계의 기능변화와 연관되어 있다고 알려져 있다(M. H. Teicher, C. M. Anderson et al., Nat. Med., 2000; J. B. Schweitzer, D. O. Lee et al., Neuropsychopharmacology, 2003; E. Y. Oh, I. Hwang et al., J. Korean Soc. Biol. Ther. Psychiatri., 2003). 그러나, 주의력 결핍 과잉 행동장애가 발생되는 정확한 원인은 밝혀지지 않았으며, 상기의 원인들이 복합적으로 작용하여 발생한다고 추정한다(H. Mang, H. Chung, The Journal of Elementary Education., 2005).
주의력 결핍 과잉 행동장애의 증상은 도파민성 신경 외에도 전두엽의 신경회로를 조절하는 노르아드레날린성 신경의 조절과 연관이 있다. ADHD의 행동이 노르아드레날린성 신경과 도파민성 신경의 조절간에 불균형으로 초래된다는 연구도 보고된 바 있다. 포괄적으로는 Glutamatergic neurons와 GABA(g-aminobutyric acid)성 신경을 지배하는 카테콜라민류가 시냅스 후부에 미치는 영향력이 감소에 따른 것으로 추정된다(T. Sagvolden, T. Xu. Behav. Brain Funct. 4, 2008; E. B. Johansen, P. R. Killeen et al., Behav. Brain Funct. 3, 2007).
주의력 결핍 과잉 행동장애의 치료제로 가장 흔히 쓰이는 약물은 중추신경 흥분제로서, 국내에서는 메틸페니데이트(Methylphenidate)를 성분으로 하는 리탈린(Ritalin), 메틸펜(Methylphen) 등이 사용되고 있다. 이러한 약물은 부주의, 과잉행동 및 충동성 완화에 단기적인 효과를 나타내는 것으로 알려져 있으나, 장기적인 효과는 검증되지 못하였다(S. Kim, D. Ahn, Y. Lee, J. Korean Neuropsychiatr. Assoc. 4, pp683-699, 1998).
주의력 결핍 과잉 행동장애와 같은 집중력 장애 질병에는 정신분열증(schixophrenia), 전두엽 간질(Frontal lobe epilepsy), 및 자폐증(autism)이 있다. 이들의 공통적인 특징으로 행동 과잉 증상(hyperactivity)과 전두엽에서 증가된 낮은 진동수의 신경 진동(oscillation)이 있다(Callicott et al., 2000; Manoach et al., 2000, Barry et al., 2003; Wienbruch et al., 2003; Verkhliutov et al., 2006; Yoon et al., 2008; K㎛ari et al., 2009).
에토숙시미드(ethosuximide)는 T-타입 칼슘채널 억제제로써, 간질(epilepsy) 치료제로써 사용되었다. 그 외에도, "Ｔ―타입 칼슘채널을 억제하여 불안 장애를 치료하는 방법(한국 등록특허 10-09582910000)"에서 에토숙시미드가 포함되는 조성물을 불안장애 치료에 사용한 바가 알려져 있으나, 집중력 장애 질병의 치료제로써 사용된 바는 알려진 바 없다. 상기 발명에 기재된 불안장애는 전두엽(frontal lobe)과 편도체(amygdala)를 중심으로 형성되는 공포에 대한 기억형성에 문제가 생기는 증상으로, 이러한 기능의 이상은 공포장애(phobic disorder), 범불안장애(generalized anxiety disorder), 강박장애(obsessive compulsive disorder), 외상 후 스트레스 장애(post-tra㎛atic stress disorder), 신체형 장애(somatoform disorder), 해리성 장애(dissociative disorder) 및 인위성 장애(factitious disorder) 등에서 많이 발견된다. 불안장애는 감정(emotion)과 기억(memory)을 담당하는 뇌의 구조적인 문제점에 의하여 발생하므로, 주의력 결핍 과잉 행동 장애와 차이가 있다. 상기 발명은 감정과 기억을 생성하는 메커니즘을 이해하고 새로운 치료제를 개발하는데 도움이 되는 발명이다.
그러나, 본 발명은 주의력 결핍 과잉 행동 장애에 대한 이해에 바탕을 두고 있다. 본 발명자가 발견한 것은 기억과 감정의 생성이 아닌, 집중력(attention)의 생성과정을 이해하는데 바탕을 두고 있다. 집중력의 생성 과정은 많은 연구자들의 노력에도 불구하고, 아직 밝혀진 것이 거의 없는 실정이다. 집중력(attention deficit)장애는 주의력 결핍 과잉 행동 장애(Attention deficit hyperactivity disorder, ADHD)뿐 아니라, 정신분열증(schizophrenia), 전두엽 간질(Frontal lobe epilepsy), 자폐증(autism) 등에서도 대표적으로 관찰되는 증상이다. 그리고 이러한 집중력 장애는 사람이 사회적으로 적응하는데 큰 장애물로 작용하고 있는 실정이다. 또한, 과잉 행동 장애 증상에서 보이는 주의력 결핍 과잉 행동(hyperactivity)와 상동증(stereotypic)이 역시 정신분열증에서도 보고되고 있으며, 전두엽에서만 관찰되는 낮은 진동수의 뇌파 또한 두 질병에서 모두 발견되고 있다. 또한, 임상 사례 보고서에서 환자에서 상기 두 질병의 양상이 같이 보고되는 경우가 많이 있다. 이러한 결과들을 바탕으로 과잉행동장애에서 보이는 집중력장애와 정신분열증에서 보이는 집중력장애는 공통된 기작을 가지고 있을 수도 있다고 예상할 수 있다.
이에, 본 발명자들은 코발트 선을 뇌에 삽입한 동물 모델을 제작하여, 상기 동물 모델의 전두엽에서 주의력 결핍 장애에서 관찰되는 낮은 주파수의 전기적 흥분, 행동 장애, 및 인지기능의 저하를 관찰하였으며, 또한 이러한 주의력 결핍 장애의 구체적인 기작을 확인하기 위하여, T-타입 칼슘 채널 녹아웃(knockout) 마우스와 시상핵 국소적으로 T-타입 칼슘 채널 제거 동물 모델을 통해서 T-타입 칼슘 채널이 과잉행동과 낮은 진동수의 주파수를 조절하는데 관여하는 것을 확인하였으며, 아울러 본 발명의 주의력 결핍 과잉 행동 모델 마우스에 T-타입 칼슘채널 억제제인 에토숙시마이드(ethosuximide), 조니사미드(Zonisamide), 및 페이에니토인(Phyenytoin)을 투여함으로써, 전두엽에서 발생되는 스파이크(spike) 형태의 뇌파가 감소되는 결과를 통하여, 본 발명의 코발트 선이 삽입된 동물 모델은 주의력 결핍 과잉 행동 모델 마우스로서 유용하며, 이를 이용하여 집중력 장애 치료제를 스크리닝할 수 있으며, T-타입 칼슘채널 억제제를 포함하는 조성물을 주의력 결핍 장애 치료용 조성물로써 사용할 수 있음을 밝힘으로써, 본 발명을 완성하였다.
본 발명의 목적은 코발트 선(cobalt wire)을 뇌에 이식한 주의력 결핍 과잉 행동 모델 마우스를 제공하는 것이다.
또한, 본 발명의 목적은 주의력 결핍 과잉 행동 모델 마우스를 이용하여 집중력 장애 질병 치료제 스크리닝 방법을 제공하는 것이다.
아울러, 본 발명의 목적은 T-타입 칼슘채널 억제제를 포함하는 집중력 장애 예방 및 치료용 조성물을 제공하는 것이다.
본 발명은 코발트 선(cobalt wire)을 뇌에 이식한 주의력 결핍 과잉 행동 모델을 제공한다.
또한, 본 발명은 하기의 단계를 포함하는 주의력 결핍 과잉 행동 모델 마우스를 제조하는 방법을 제공한다.
1) 코발트 선(cobalt wire)을 마우스의 뇌의 오른쪽 전두엽 측면에 이식하는 단계;
2) 코발트 선을 이식한 후, 상기 마우스의 뇌를 봉합시키는 단계; 및
3) 집중력 장애 질병을 나타내는 마우스를 선별하는 단계로 제조되는 주의력 결핍 과잉 행동 모델 마우스를 제조하는 방법.
또한, 본 발명은 하기의 단계를 포함하는 집중력 장애 질병 치료제 스크리닝 방법을 제공한다:
1) 피검 화합물 또는 조성물을 본 발명에 따른 주의력 결핍 행동 모델 마우스에 투여하는 단계;
2) 단계 1)의 투여된 주의력 결핍 행동 모델 마우스의 뇌파를 측정하는 단계; 및
3) 단계 2)의 주의력 결핍 행동 모델 마우스의 뇌파를 피검 화합물 또는 조성물을 투여하지 않은 대조군과 비교하여, 뇌파의 스파이크(spike) 수가 감소된 피검 화합물 또는 조성물을 선별하는 단계.
또한, 본 발명의 목적은 하기의 단계를 포함하는 집중력 장애 질병 치료제 스크리닝 방법을 제공한다:
1) 피검 화합물 또는 조성물을 본 발명에 따른 주의력 결핍 행동 모델 마우스에 투여하는 단계;
2) 단계 1)의 투여된 주의력 결핍 행동 모델 마우스의 행동장애 또는 인지기능을 측정하는 단계; 및
3) 단계 2)의 주의력 결핍 행동 모델 마우스의 뇌파를 피검 화합물 또는 조성물을 투여하지 않은 대조군과 비교하여, 행동장애 또는 인지기능이 감소된 피검 화합물 또는 조성물을 선별하는 단계.
또한, 본 발명은 T-타입 칼슘채널 억제제를 유효성분으로 함유하는 집중력 장애 질병 예방 및 치료용 조성물을 제공한다.
또한, 본 발명은 T-타입 칼슘채널 억제제를 유효성분으로 함유하는 집중력 장애 질병 예방 및 개선용 건강식품을 제공한다.
또한, 본 발명은 T-타입 칼슘채널 억제제를 유효성분으로 함유하는 집중력 장애 질병 예방 및 개선용 사료 첨가제를 제공한다.
또한, 본 발명은 본 발명에 따른 주의력 결핍 과잉 행동 모델 마우스를 집중력 장애 치료제 스크리닝에 이용하는 용도를 제공한다.
또한, 본 발명은 T-타입 칼슘채널 억제제를 집중력 장애 질병 치료제의 제조에 이용하는 용도를 제공한다.
또한, 본 발명은 T-타입 칼슘채널 억제제를 집중력 장애 질병 개선용 건강식품의 제조에 이용하는 용도를 제공한다.
아울러, 본 발명은 T-타입 칼슘채널 억제제를 집중력 장애 질병 개선용 사료 첨가제의 제조에 이용하는 용도를 제공한다.
본 발명의 코발트 선을 삽입한 동물 마우스은 집중력 장애의 특징인 낮은 주파수의 증가된 전기 흥분, 과잉행동, 및 인지기능의 저하가 관찰되므로, 이를 주의력 결핍 과잉 행동 모델 마우스로써 유용하게 사용할 수 있으며, 상기 증상을 공통적으로 보이는 집중력 장애 질병 치료제 스크리닝에 유용하게 사용할 수 있다. 또한, 상기 주의력 과잉 행동 모델 마우스 모델에 T-타입 칼슘채널 억제제의 하나인 에토숙시미드를 투여함으로써, 뇌파에서 관찰되는 스파이크(spike) 수가 감소하므로, T-타입 칼슘채널 억제제를 포함하는 조성물을 집중력 장애 질병 치료용으로 유용하게 사용할 수 있다.
도 1은 주의력 결핍 과잉 행동장애 동물 모델을 제작 및 실험 수행기간을 나타낸 그림이다:
도 1의 A는 주의력 결핍 과잉 행동장애 동물 모델의 제작 및 행동을 측정하기 위하여 코발트 선과 EEG 전극봉을 삽입한 위치를 나타낸 그림이다;
Cobalt-wire: 코발트 선은 500 ㎛(직경)(Alfa Aesar)를 방사상(radial) 방향(즉, 대뇌 표면에 대하여 수직인 방향)으로 오른쪽 배측외측(dorsolateral) 전두엽의 전후 방향(anteroposterior)의 2.6 mm, 측면(lateral)의 1.8 mm, 및 복부 방향(ventral)의 1.3 mm인 위치에 삽입함;
FR:오른쪽 전두엽;
FL:왼쪽 전두엽;
TR:오른쪽 측두엽;
TL:왼쪽 측두엽;
도 1의 B는 코발트 선(Cobalt wire)을 삽입한 이후, EEG 변화 및 행동 분석을 수행한 기간을 나타낸 그림이다
도 2는 주의력 결핍 과잉 행동장애 동물 모델에서 EEG 기록을 나타낸 그림이다:
control: 무삽입 대조군;
cobalt_theta: 코발트 선을 삽입한 쥐에서 관찰되는 4 ~ 7 Hz의 진동수의 뇌파;
cobalt_spike: 코발트 선을 삽입한 쥐에서 관찰되는 1~ 4 Hz의 진동수의 스파이크 형태의 뇌파;
FR:오른쪽 전두엽; 및
FL:왼쪽 전두엽.
도 3은 주의력 결핍 과잉 행동장애 동물 모델의 행동 변화 및 인지기능 변화를 측정한 결과이다:
도 3의 A는 주의력 결핍 과잉 행동장애 동물 모델의 행동성 정량을 위한 개방장(openfield) 검사 결과를 나타낸 그래프이다;
○ cotrol: 무삽입 대조군;
■ cobalt≤6d: 코발트 선 삽입 6일 이하의 주의력 결핍 과잉 행동장애 동물 모델;
◆ cobalt≤14d: 코발트 선 삽입 14일 이하의 주의력 결핍 과잉 행동장애 동물 모델;
▲ cobalt≥28d: 코발트 선 삽입 28일 이상의 주의력 결핍 과잉 행동장애 동물 모델;
도 3의 B는 개방장 검사에서 관찰되는 주의력 결핍 과잉 행동장애 동물 모델의 행동성을 비디오를 통하여 관찰한 결과이다;
Con: 무삽입 대조군
Co: 코발트 선을 삽입 28일 이상의 주의력 결핍 과잉 행동장애 동물 모델;
도 3의 C는 주의력 결핍 과잉 행동장애 동물 모델의 공포 학습 기억 검사(conditioned fear learning test) 결과를 나타낸 그래프이다;
□ cotrol: 무삽입 대조군;
■ cobalt: 코발트 선을 삽입 28일 이상의 주의력 결핍 과잉 행동장애 동물 모델;
context: 공포가 생성된 장소를 기억하고 있는지를 테스트한 군; 및
cue: 공포와 연결된 소리를 기억하고 있는지를 테스트한 군.
도 4는 주의력 결핍 과잉 행동장애 동물 모델 마우스에 T-타입 칼슘채널 억제제인, 에토숙시미드(ethosuximide), 조니사미드(zonisamide), 페이에니토인(Phyenytoin)을 각각 주입한 후 발생되는 스파이크 형태의 뇌파를 관찰한 그래프이다:
도 4의 A는 에토숙시미드(ethosuximide), 조니사미드(zonisamide), 페이에니토인(Phyenytoin) 투여 전, 후의 스파이크 형태의 뇌파를 기록한 그림이다;
Veh: 식염수를 투여한 대조군;
ZNS: 조니사미드를 투여한 군;
PHT: 페이에니토인을 투여한 군;
Etho: 에토숙시미드를 투여한 군;
Before: 투여 전;
After: 투여 후;
도 4의 B는 에토숙시미드(ethosuximide), 조니사미드(zonisamide), 페이에니토인(Phyenytoin) 투여 전, 후의 스파이크 형태의 뇌파 수를 계수한 그래프이다;
Veh: 식염수를 투여한 대조군;
ZNS: 조니사미드를 투여한 군;
PHT: 페이에니토인을 투여한 군;
Etho: 에토숙시미드를 투여한 군;
Before: 투여 전; 및
After: 투여 후.
도 5는 구리선, 알루미늄선, 및 코발트 선을 삽입한 동물 모델 마우스의 스파이크 형태를 관찰한 그래프이다:
도 5의 A는 구리선을 삽입한 동물 모델 마우스의 스파이크 형태를 관찰한 그래프이다;
F: 오른쪽 전두엽;
MD: 시상핵(mediodorsal thalamus, MD);
T: 왼쪽 측두엽;
도 5의 B는 알루미늄 선을 삽입한 동물 모델 마우스의 스파이크 형태를 관찰한 그래프이다;
F: 오른쪽 전두엽;
MD: 시상핵(mediodorsal thalamus, MD);
T: 왼쪽 측두엽;
도 5의 C는 구리선, 알루미늄 선, 및 코발트 선을 삽입한 동물 모델과 무삽입 동물 모델에서 관찰되는 스파이크 수를 나타낸 그래프이다;
Cu: 구리를 삽입한 군;
Al: 알루미늄을 삽입한 군; 및
Co: 코발트 선을 삽입한 군.
도 6은 α1G T-타입 칼슘채널 제거 동물 모델의 뇌파 및 행동 변화를 측정한 그림이다:
도 6의 A는 α1G T-타입 칼슘채널 제거 동물 모델의 전두엽 및 시상핵에서 관찰되는 뇌파를 나타낸 그림 및 그래프이다;
F: 오른쪽 전두엽;
MD: 시상핵(mediodorsal thalamus, MD);
**: p<0.05;
도 6의 B는 개방장 검사에서 관찰되는 α1G T-타입 칼슘채널 제거 동물 모델의 행동성을 비디오를 통하여 관찰한 결과이다;
Cav3.1 +/+: α1G T-타입 칼슘채널이 제거되지 않은 대조군 동물 모델;
Cav3.1 -/-: α1G T-타입 칼슘채널 제거 동물 모델;
5분: 개방장 검사 시작부터 5분까지의 시간; 및
60분: 개방장 검사 시작부터 55분에서 60분까지의 시간.
도 7은 α1G T타입 칼슘채널을 표적으로 하는 shRNA를 포함하는 렌티바이러스 벡터를 시상핵(MD)에 국소적으로 주입하여, 시상핵 국소적으로 α1G T타입 칼슘채널을 억제한 동물 모델에서의 뇌파를 측정한 그림이다:
도 7의 A는 시상핵 국소적 α1G T-타입 칼슘채널 제거 동물 모델의 전두엽 및 시상핵에서 관찰되는 뇌파를 나타낸 그림 및 그래프이다;
F: 오른쪽 전두엽;
MD: 시상핵(mediodorsal thalamus, MD);
shC: α1G T-타입 칼슘채널을 억제하지 않는 대조군 shRNA 바이러스를 시상핵에 넣은 대조군 동물 모델;
sh3.1: shRNA 바이러스를 이용해 α1G T-타입 칼슘채널을 시상핵 국소적으로 제거한 동물 모델; 및
도 7의 B는 시상핵 국소적 α1G T 타입 칼슘채널을 억제한 동물모델에서는 낮은 진동수의 뇌파가 크게 감소하였음을 파워스펙트럼(power spectr㎛)분석으로 보여주는 그림이다.
도 8은 α1G T타입 칼슘채널을 표적으로 하는 shRNA를 포함하는 렌티바이러스 벡터를 시상핵(MD)에 국소적으로 주입하여, 시상핵에서만 α1G T타입 칼슘채널을 억제한 동물 모델에서의 행동 변화를 측정한 그림이다:
도 8의 A는 개방장 검사에서 관찰되는 시상핵 국소적 α1G T-타입 칼슘채널 제거 동물 모델의 행동성을 비디오를 통하여 관찰한 결과이다;
shC: α1G T-타입 칼슘채널을 억제하지 않는 대조군 shRNA 바이러스를 시상핵에 넣은 대조군 동물 모델;
sh3.1: shRNA 바이러스를 이용해 α1G T-타입 칼슘채널을 시상핵 국소적으로 제거한 동물 모델;
5분: 개방장 검사 시작부터 5분까지의 시간; 및
60분: 개방장 검사 시작부터 55분에서 60분까지의 시간.
도 8의 B는 개방장 검사에서 관찰되는 시상핵 국소적 α1G T-타입 칼슘채널 제거 동물 모델의 행동성 나타낸 그래프이다;
shC: α1G T-타입 칼슘채널을 억제하지 않는 대조군 shRNA 바이러스를 시상핵에 넣은 대조군 동물 모델;
sh3.1: shRNA 바이러스를 이용해 α1G T-타입 칼슘채널을 시상핵 국소적으로 제거한 동물 모델;
5분: 개방장 검사 시작부터 5분까지의 시간; 및
60분: 개방장 검사 시작부터 55분에서 60분까지의 시간.
이하, 본 발명을 상세히 설명한다.
본 발명은 하기의 단계에 의해서 제작된 주의력 결핍 과잉 행동 모델 마우스를 제공한다:
1) 코발트 선(cobalt wire)을 마우스의 뇌의 오른쪽 전두엽 측면에 이식하는 단계;
2) 코발트 선을 이식한 후, 상기 마우스의 뇌를 봉합시키는 단계; 및
3) 집중력 장애 질병을 나타내는 마우스를 선별하는 단계로 제조되는 주의력 결핍 과잉 행동 모델 마우스.
본 발명의 주의력 결핍 과잉 행동 모델 마우스는 상기의 단계에 의해서 제작되는 것이 바람직하나, 상기의 단계에 한정되지 않는다.
상기 주의력 결핍 과잉 행동 모델 마우스 제작은 스테레오텍식(stereotaxic) 에 마우스(10 ~ 20주 사이의 C57BL/6J)의 머리를 고정한 후, 코발트 선(Alfa Aesar)을 스테레오텍식(stereotaxic)의 부품인 홀더(holder)를 이용하여 삽입하는 것이 바람직하나, 이에 한정되지 않는다. 상기 주의력 결핍 과잉 행동 모델 마우스 제작에 있어서, 단계 1)의 코발트 선은 500 ㎛(직경)(Alfa Aesar)를 방사상(radial) 방향(즉, 대뇌 표면에 대하여 수직인 방향)으로 오른쪽 배측외측(dorsolateral) 전두엽의 전후 방향(anteroposterior)의 2.0 ~ 3.0 mm, 측면(lateral)의 1.5 ~ 2.5 mm, 및 복부 방향(ventral)의 1.0 ~ 2.0 mm인 위치에 삽입하는 것이 바람직하나, 보다 바람직하게는 오른쪽 배측외측(dorsolateral) 전두엽의 전후 방향(anteroposterior)의 2.6 mm, 측면(lateral)의 1.8 mm, 및 복부 방향(ventral)의 1.3 mm인 위치에 삽입하는 것이 바람직하나, 이에 한정되지 않는다. 또한, EEG 기록을 위한 경막외 마취제(epidural) 전극봉(electrode)은 상기 코발트 선이 삽입된 오른쪽 전두엽에 삽입하였으며, 다른 전극봉은 왼쪽 전두엽 및 측두엽 전두엽에 삽입하였다. 구체적으로 삽입 위치는 오른쪽 전두엽에 있어서는 전후 방향(anteroposterior)의 2.8 mm, 측면(lateral)의 0.8 mm의 위치이며, 왼쪽 전두엽에 있어서는 전후 방향(anteroposterior)의 2.8 mm, 측면(lateral)의 0.8 mm의 위치에 각각 삽입하였다. 접지(grounding) EEG는 두개골의 후두(occipital)의 위치에 삽입하는 것이 바람직하나, 이에 한정되지 않는다.
본 발명의 구체적인 실시예에서, 본 발명자들은 주의력 결핍 과잉 행동장애 동물 모델을 제작하였다(도 1 참조). 코발트 선(cobalt wire)을 뇌에 삽입하여 제작된 동물 모델에서 간질이 유발된다 것이 알려져 있으나(Chang et al., Epilepsy Research, 2004), 이를 주의력 결핍 과잉 행동 장애 동물 모델로써 이용한 바는 알려지지 않았다. 이에, 본 발명자들은 코발트 선을 삽입한 마우스를 주의력 결핍 과잉 행동장애 동물로써 사용할 수 있는지를 확인하기 위하여, 집중력 장애 질병에서 관찰되는 특징적인 뇌파, 행동, 및 인지 기능을 관찰하였다.
본 발명의 구체적인 실시예에서, 코발트 선을 우측 전두엽에 삽입한 마우스의 뇌전도(EEG)를 분석하였다. 상기 동물 모델 마우스의 좌, 우측 전두엽 및 측두엽에 삽입한 EEG 전극봉을 통하여 뇌파를 관찰한 결과, 코발트 선이 삽입된 우측 전두엽에서만 낮은 진동수의 뇌파가 증가하였으며, 보다 구체적으로 4 ~ 7 Hz의 세타(theta oscillation)파가 먼저 시작된 후, 1 ~ 4 Hz의 스파이크 형태가 관찰되었다. 이러한 뇌파는 코발트 선이 삽입되지 않은 좌측 전두엽에서는 관찰되지 않았다(도 2 참조).
또한, 본 발명의 구체적인 실시예에서, 코발트 선을 삽입한 마우스에 행동, 및 인지기능 변화를 관찰하였다. 코발트 선을 삽입한 후, 6일, 14일, 및 28일이 경과한 시점에서 개방장 검사(open-field test)를 통해서 행동을 모니터링한 결과, 대조군에 비하여 코발트 선을 삽입한 마우스에서 활동성이 현저하게 증가한 것을 관찰할 수 있었다(도 3의 A 참조). 이러한 경향성은 코발트 선을 삽입한 기간이 길어질수록 증가하였으며, 보다 구체적으로 상기 활동성을 주의력 결핍 과잉 장애 동물 모델의 자취를 그리는 실험을 통해 분석한 결과, 코발트 선을 삽입한 마우스의 움직임에서 반복적으로 한쪽 방향으로 도는 행동인 상동증(stereotypy)이 관찰되는 것을 확인할 수 있었다(도 3의 B 참조). 상기 상동증은 주의력 결핍 과잉 행동 장애나 정신분열증에서 대표적으로 관찰된다고 보고되고 있다(Jones, Comprehensive Psychiatry, 1965; Davids et al., Brain Research Reviews, 2003). 또한, 주의력 결핍 과잉 행동장애 질병에서 많이 관찰되는 기억력 감퇴가 코발트 선을 삽입한 마우스에서도 나타나는지 확인하기 위하여, 공포 학습 기억 검사(conditioned fear learning test)를 수행한 결과, 대조군에 비하여 코발트 선이 삽입된 주의력 결핍 과잉 행동장애 동물 모델은 현저히 기억력이 감소되는 것을 관찰할 수 있었다(도 3의 C 참조). 따라서, 본 발명의 코발트 선을 삽입한 마우스에서 집중력 장애 질병의 특징인 낮은 진동수의 뇌파, 상동증, 및 인지기능의 저하가 관찰되므로, 코발트 선을 삽입한 마우스를 주의력 결핍 과잉 행동장애 모델 마우스로써 유용하게 사용될 수 있음을 알 수 있다.
또한, 본 발명의 구체적인 실시예에서, 주의력 결핍 과잉 행동장애 동물에서 관찰되는 행동장애의 증상을 완화시키기 위하여, T-타입 칼슘채널의 억제제로 사용되는 에토숙시미드(ethosuximide), 조니사미드(zonisamid), 및 페이에니토인(phyenytoin)을 각각 처리한 결과, 이러한 약물을 처리하기 전에 비하여, 전두엽에서 관찰되는 스파이크(spike) 수가 현저히 감소함을 알 수 있었다(도 4 참조). T-타입 칼슘채널 억제제에는 상기 에토숙시마이드 이외에도 조니사미드(Zonisamide), 페이에니토인(Phyenytoin), SUN-N8075, 에포니디핀(efonidipine)과 Y3+, La3+, Ce3+, Nd3+,Gd3+,Ho3+,Er3+Yb3+ 로 구성되는 군으로부터 선택되는 3가 금속 이온, Ni2+, U-92032(7-[[4-[bis(4-fluorophenyl)methyl]-1-piperazinyl]methyl]-2-[(2-hydroxyethyl)amino]4-(1-methylethyl)-2,4,6-cycloheptatrien-1-one), 펜플루리돌(penfluridol), 플루스피릴렌(fluspirilene) 및 발프로에이트(valproate)가 있으며, 이러한 T-타입 칼슘채널 억제제를 본 발명의 주의력 결핍 과잉 행동장애 동물에 투입하였을 때, 행동장애 증상을 완화시킬수 있을 것이다.
또한, 본 발명의 구체적인 실시예에 사용된 대조군 무삽입 마우스를, 대조군으로써 유용한지를 확인하기 위하여, 본 발명자들은 코발트 선 이외의 구리 선 및 알루미늄 선을 코발트 선 대신 마우스의 오른쪽 전두엽에 삽입하였다. 그 결과, 도 5에 나타난 바와 같이, 코발트 선을 삽입한 마우스의 EEG에서 관찰되는 스파이크 형태의 뇌파가 관찰되지 않았으며, 이러한 결과는 아무것도 삽입하지 않은 무삽입 대조군과 유사한 결과를 보였다. 즉, 무삽입 대조군을 코발트 선을 삽입한 마우스에 대한 대조군으로 유용하게 사용할 수 있으며, 본 발명에 따른 동물 모델에서 관찰되는 스파이크 형태의 뇌파는 삽입되는 코발트 선에 의해서 발생하는 것임을 확인할 수 있었다(도 5 참조).
또한, 본 발명의 구체적인 실시예에서, α1G T-타입 칼슘채널을 전부 제거한 녹아웃 모델(Cav3.1 T-타입 칼슘채널 제거 동물모델)과, 본 발명에 따른 α1G T-타입 칼슘채널을 표적으로 하는 shRNA를 포함하는 렌티바이러스 벡터를 시상핵 국소적으로 주입한 후, 뇌파 및 행동변화를 관찰한 결과, α1G T-타입 칼슘채널이 전부 또는 시상핵 국소적으로 제거되었을 때, 전두엽에서 낮은 뇌파가 관찰되었음을 확인할 수 있었다(도 6 내지 8 참조). 이러한 결과를 통해서 α1G T-타입 칼슘채널이 전두엽 관련 질병 생성에 중요하다는 것을 확인할 수 있었다.
따라서, 코발트 선을 삽입한 동물 마우스에서, 집중력 장애 질병의 특징인 낮은 주파수의 뇌파, 행동장애, 및 인지 기능의 저하가 관찰되므로, 이를 주의력 결핍 과잉 행동장애 모델 마우스로써 유용하게 사용할 수 있다.
또한, 본 발명은 하기의 단계를 포함하는 주의력 결핍 과잉 행동 모델 마우스를 제조하는 방법을 제공한다.
1) 코발트 선(cobalt wire)을 마우스의 뇌의 오른쪽 전두엽 측면에 이식하는 단계;
2) 코발트 선을 이식한 후, 상기 마우스의 뇌를 봉합시키는 단계; 및
3) 집중력 장애 질병을 나타내는 마우스를 선별하는 단계로 제조되는 주의력 결핍 과잉 행동 모델 마우스를 제조하는 방법.
상기 주의력 결핍 과잉 행동 모델 마우스 제작은 스테레오텍식(stereotaxic) 에 마우스(10 ~ 20주 사이의 C57BL/6J)의 머리를 고정한 후, 코발트 선(Alfa Aesar)을 스테레오텍식(stereotaxic)의 부품인 홀더(holder)를 이용하여 삽입하는 것이 바람직하나, 이에 한정되지 않는다. 상기 주의력 결핍 과잉 행동 모델 마우스 제작에 있어서, 단계 1)의 코발트 선은 500 ㎛(직경)(Alfa Aesar)를 방사상(radial) 방향(즉, 대뇌 표면에 대하여 수직인 방향)으로 오른쪽 배측외측(dorsolateral) 전두엽의 전후 방향(anteroposterior)의 2.6 mm, 측면(lateral)의 1.8 mm, 및 복부 방향(ventral)의 1.3 mm인 위치에 삽입하는 것이 바람직하나, 이에 한정되지 않는다. 또한, EEG 기록을 위한 경막외 마취제(epidural) 전극봉(electrode)은 상기 코발트 선이 삽입된 오른쪽 전두엽에 삽입하였으며, 다른 전극봉은 왼쪽 전두엽 및 측두엽 전두엽에 삽입하였다. 구체적으로 삽입 위치는 오른쪽 전두엽에 있어서는 전후 방향(anteroposterior)의 2.8 mm, 측면(lateral)의 0.8 mm의 위치이며, 왼쪽 전두엽에 있어서는 전후 방향(anteroposterior)의 2.8 mm, 측면(lateral)의 0.8 mm의 위치에 각각 삽입하였다. 접지(grounding) EEG는 두개골의 후두(occipital)의 위치에 삽입하는 것이 바람직하나, 이에 한정되지 않는다.
또한, 본 발명은 하기의 단계를 포함하는 집중력 장애 질병 치료제 스크리닝 방법을 제공한다.
1) 피검 화합물 또는 조성물을 본 발명에 따른 주의력 결핍 행동 모델 마우스에 투여하는 단계;
2) 단계 1)의 투여된 주의력 결핍 행동 모델 마우스의 뇌파를 측정하는 단계; 및
3) 단계 2)의 주의력 결핍 행동 모델 마우스의 뇌파를 피검 화합물 또는 조성물을 투여하지 않은 대조군과 비교하여, 뇌파의 스파이크(spike) 수가 감소된 피검 화합물 또는 조성물을 선별하는 단계.
상기 집중력 장애 질병 치료제 스크리닝 방법은 상기의 단계를 포함하는 것이 바람직하나, 이에 한정되지 않는다. 상기 집중력 장애 질병 치료제 스크리닝 방법에 있어서, 집중력 장애 질병은 주의력 결핍 과잉 행동장애(attention deficit hyperactivity disorder), 정신 분열증(schizophrenia), 전두엽 간질(Forntal lobe epilepsy), 및 자폐증(autism)으로 구성된 군으로부터 선택된 어느 하나인 것이 바람직하나, 이에 한정되지 않는다.
본 발명의 코발트 선을 삽입한 동물 마우스는 집중력 장애의 특징인 낮은 주파수의 뇌파, 행동장애, 및 인지기능의 저하가 관찰되므로, 주의력 결핍 과잉 행동 모델 마우스 마우스로써 유용하므로, 이를 집중력 장애 질병 치료제 스크리닝 방법에 활용할 수 있다.
또한, 본 발명은 하기의 단계를 포함하는 집중력 장애 질병 치료제 스크리닝 방법을 제공한다:
1) 피검 화합물 또는 조성물을 본 발명에 따른 주의력 결핍 행동 모델 마우스에 투여하는 단계;
2) 단계 1)의 투여된 주의력 결핍 행동 모델 마우스의 행동장애 또는 인지기능을 측정하는 단계; 및
3) 단계 2)의 주의력 결핍 행동 모델 마우스의 뇌파를 피검 화합물 또는 조성물을 투여하지 않은 대조군과 비교하여, 행동장애 또는 인지기능이 감소된 피검 화합물 또는 조성물을 선별하는 단계.
상기 집중력 장애 질병 치료제 스크리닝 방법은 상기의 단계를 포함하는 것이 바람직하나, 이에 한정되지 않는다. 또한, 집중력 장애 질병 치료제 스크리닝 방법에 있어서, 행동장애는 개방장 검사, 수중 미로 실험(Water maze), 새로운 물건 검사(Noble object test), 새로운 인식 검사(Noble recognition test)로 구성된 군으로부터 선택되는 방법을 통해서 행동장애를 측정하는 것이 바람직하나, 이에 한정하지 않는다. 또한, 집중력 장애 질병 치료제 스크리닝 방법에 있어서, 인지기능은 공포 학습 기능 기억 검사, 전-펄스 억제 검사(pre-pulse inhibition test), 증가된 펄스 메이즈(고가식 십자미로실험)(elevated plus maze)로 구성된 군으로부터 선택되는 방법을 통해서 인지기능을 측정하는 것이 바람직하나, 이에 한정되지 않는다. 주의력 결핍 장애에서 보이는 행동 및 인지 장애는 계획, 임펄스 조절(impulse control), 목적 관리, 행동의 자율 조정(self-correction of behavior), 집중력 조절(attention control), 및 워킹 메모리(working memory)과 같은 관리 기능에 문제가 있는 경우를 일컫는다.
또한, 본 발명은 T-타입 칼슘채널 억제제를 유효성분으로 함유하는 집중력 장애 질병 예방 및 치료용 조성물을 제공한다.
상기 집중력 장애 질병 예방 및 치료용 조성물에 있어서, 집중력 장애 질병은 주의력 결핍 과잉 행동장애(attention deficit hyperactivity disorder), 정신 분열증(schizophrenia), 전두엽 간질(Forntal lobe epilepsy), 및 자폐증(autism)으로 구성된 군으로부터 선택되는 것이 바람직하나, 이에 한정되지 않는다. 또한, 상기 T-타입 칼슘채널 억제제는 미베프라딜(mibefradil), 테트라메쓰린(tetramethrin), 에토숙시마이드(ethosuximide), 조니사미드(Zonisamide), 페이에니토인(Phyenytoin), SUN-N8075, 에포니디핀(efonidipine)과 Y3+, La3+, Ce3+, Nd3+,Gd3+,Ho3+,Er3+Yb3+ 로 구성되는 군으로부터 선택되는 3가 금속 이온, Ni2+, U-92032(7-[[4-[bis(4-fluorophenyl)methyl]-1-piperazinyl]methyl]-2-[(2-hydroxyethyl)amino]4-(1-methylethyl)-2,4,6-cycloheptatrien-1-one), 펜플루리돌(penfluridol), 플루스피릴렌(fluspirilene) 및 발프로에이트(valproate)로 이루어진 군으로부터 선택되는 것이 바람직하며, 에토숙시마이드(ethosuximide)인 것이 가장 바람직하나, 이에 한정되지 않는다.
본 발명의 구체적인 실시예를 통하여, 코발트 선을 삽입한 동물 마우스를 주의력 결핍 과잉 행동장애 모델 마우스로써 유용하게 사용할 수 있으며, 상기 동물 모델에 T-타입 칼슘채널 억제제의 하나인 에토숙시미드를 투여함으로써 집중력 장애 질병의 증상이 감소하므로, T-타입 칼슘채널 억제제를 포함하는 조성물을 집중력 장애 질병 예방 및 치료용 조성물로서 유용하게 사용할 수 있음을 알 수 있다.
T-타입 칼슘채널 억제제의 치료학적으로 유효한 양은 여러 요소, 예를 들면 투여방법, 목적부위, 환자의 상태 등에 따라 달라질 수 있다. 따라서, 인체에 사용 시 투여량은 안전성 및 효율성을 함께 고려하여 적정량으로 결정되어야 한다. 동물실험을 통해 결정한 유효량으로부터 인간에 사용되는 양을 추정하는 것도 가능하다. 유효한 양의 결정시 고려할 이러한 사항은, 예를 들면 Hardman and Limbird, eds., Goodman and Gilman's The Pharmacological Basis of Therapeutics, 10th ed.(2001), Pergamon Press; 및 E.W. Martin ed., Remington's Pharmaceutical Sciences, 18th ed.(1990), Mack Publishing Co.에 기술되어있다.
본 발명의 조성물은 또한 생물학적 제제에 통상적으로 사용되는 담체, 희석제, 부형제 또는 둘 이상의 이들의 조합을 포함할 수 있다. 약제학적으로 허용 가능한 담체는 T-타입 칼슘채널 억제제를 생체내 전달에 적합한 것이면 특별히 제한되지 않으며, 예를 들면, Merck Index, 13th ed., Merck & Co. Inc. 에 기재된 화합물, 식염수, 멸균수, 링거액, 완충 식염수, 덱스트로스 용액, 말토 덱스트린 용액, 글리세롤, 에탄올 및 이들 성분 중 1 성분 이상을 혼합하여 이용할 수 있으며, 필요에 따라 항산화제, 완충액, 정균제 등 다른 통상의 첨가제를 첨가할 수 있다. 또한, 희석제, 분산제, 계면활성제, 결합제 및 윤활제를 부가적으로 첨가하여 수용액, 현탁액, 유탁액 등과 같은 주이용 제형, 환약, 캡슐, 과립 또는 정제로 제제화할 수 있다. 더 나아가 당 분야의 적정한 방법으로 또는 Remington's Pharmaceutical Science(Mack Publishing Company, Easton PA, 18th, 1990)에 개시되어 있는 방법을 이용하여 각 질환에 따라 또는 성분에 따라 바람직하게 제제화할 수 있다.
본 발명의 조성물에 추가로 동일 또는 유사한 기능을 나타내는 유효성분을 1종 이상 함유할 수 있다. 본 발명의 조성물은, 조성물 총 중량에 대하여 상기 단백질을 0.0001 내지 10 중량%로, 바람직하게는 0.001 내지 1 중량%를 포함한다.
조성물은 목적하는 방법에 따라 비경구 투여(예를 들어 정맥 내, 피하, 복강 내 또는 국소에 적용)하거나 경구 투여할 수 있으나, 비경구 투여하는 것이 바람직하나, 이에 한정되지 않는다.
비경구 투여를 위한 제제로는 각각 통상의 방법에 따라 산제, 과립제, 정제, 캡슐제, 멸균된 수용액, 액제, 비수성용제, 현탁제, 에멀젼, 시럽, 좌제, 에어로졸 등의 외용제 및 멸균 주사제제의 형태로 제형화하여 사용될 수 있으며, 바람직하게는 크림, 젤, 패취, 분무제, 연고제, 경고제, 로션제, 리니멘트제, 파스타제 또는 카타플라스마제의 피부 외용 약학적 조성물을 제조하여 사용할 수 있으나, 이에 한정하는 것은 아니다. 국소 투여의 조성물은 임상적 처방에 따라 무수형 또는 수성형일 수 있다. 비수성용제, 현탁제로는 프로필렌글리콜(propylene glycol), 폴리에틸렌 글리콜, 올리브 오일과 같은 식물성 기름, 에틸올레이트와 같은 주사 가능한 에스테르 등이 사용될 수 있다. 좌제의 기제로는 위텝솔(witepsol), 마크로골, 트윈(tween) 61, 카카오지, 라우린지, 글리세로제라틴 등이 사용될 수 있다.
경구투여를 위한 고형제제에는 산제, 과립제, 정제, 캡슐제, 연질캅셀제, 환 등이 포함된다. 경구를 위한 액상 제제로는 현탁제, 내용액제, 유제, 시럽제, 에어로졸 등이 해당되는데 흔히 사용되는 단순희석제인 물, 리퀴드 파라핀 이외에 여러 가지 부형제, 예를 들면 습윤제, 감미제, 방향제, 보존제 등이 포함될 수 있다.
투여량은 환자의 체중, 연령, 성별, 건강상태, 식이, 투여시간, 투여방법, 배설율 및 질환의 중증도 등에 따라 그 범위가 다양하다. 본 발명에 따른 조성물의 일일 투여량은 0.0001 ㎎ ~ 300 ㎎이며, 바람직하게는 0.001 ㎎ ~ 200 ㎎이며, 하루 일 회 내지 수회에 나누어 투여하는 것이 더욱 바람직하다.
또한, 본 발명은 본 발명에 따른 집중력 결핍 과잉 행동장애 동물 모델 마우스를 집중력 장애 치료제 스크리닝에 이용하는 용도를 제공한다.
본 발명의 구체적인 실시예에서, 코발트 선을 마우스의 뇌의 오른쪽 전두엽 측면에 이식한 후, 뇌의 절개면을 봉합시킨 마우스에서 집중력 장애의 특징인 인지기능 저하, 과잉행동 및 전두엽의 전기적 흥분이 관찰되었으며, 이러한 특징은 코발트 선에 대한 대조군으로써 구리, 알루미늄 선, 및 무삽입 동물군에서 관찰되지 않았다. 즉, 본 발명에 의해서 제조된 코발트 선이 삽입된 주의력 결핍 과잉 행동 모델로써 유용하며, 상기 동물 모델에 T-타입 칼슘채널 억제제를 투여하였을 때, 집중력 장애의 증상이 완화되는 것을 이용하여, 집중력 장애 치료제 스크리닝에 이용하는 용도를 제공할 수 있다.
또한, 본 발명은 T-타입 칼슘채널 억제제를 집중력 장애 질병 치료제의 제조에 이용하는 용도를 제공한다.
본 발명의 구체적인 실시예를 통하여, 코발트 선이 마우스 모델에서 집중력 장애의 특징적인 뇌파와 행동 및 인지기능의 저하가 관찰되었으며, 이러한 주의력 결핍 과잉 행동장애 동물 모델에 T-타입 칼슘채널 억제제를 투여하였을 때, 행동과잉증상 및 전두엽의 비정상적인 전기적 흥분이 완화되는 것을 확인하였다. 따라서, 본 발명의 주의력 결핍 과잉 행동장애 동물 모델을 이용하여 스크리닝 된 T-타입 칼슘채널 억제제를 집중력 장애 질병 치료제 제조에 유용하게 사용할 수 있다.
또한, 본 발명은 T-타입 칼슘채널 억제제를 유효성분으로 함유하는 집중력 장애 질병 예방 및 개선용 건강식품을 제공한다.
또한, 본 발명은 T-타입 칼슘채널 억제제를 집중력 장애 질병 개선용 건강식품의 제조에 이용하는 용도를 제공한다.
상기 집중력 장애 질병 예방 및 개선용 건강식품에 있어서, 집중력 장애 질병은 주의력 결핍 과잉 행동장애(attention deficit hyperactivity disorder), 정신 분열증(schizophrenia), 전두엽 간질(Forntal lobe epilepsy), 및 자폐증(autism)으로 구성된 군으로부터 선택되는 것이 바람직하나, 이에 한정되지 않는다. 또한, 상기 T-타입 칼슘채널 억제제는 미베프라딜(mibefradil), 테트라메쓰린(tetramethrin), 에토숙시마이드(ethosuximide), 조니사미드(Zonisamide), 페이에니토인(Phyenytoin), SUN-N8075, 에포니디핀(efonidipine)과 Y3+, La3+, Ce3+, Nd3+,Gd3+,Ho3+,Er3+Yb3+ 로 구성되는 군으로부터 선택되는 3가 금속 이온, Ni2+, U-92032(7-[[4-[bis(4-fluorophenyl)methyl]-1-piperazinyl]methyl]-2-[(2-hydroxyethyl)amino]4-(1-methylethyl)-2,4,6-cycloheptatrien-1-one), 펜플루리돌(penfluridol), 플루스피릴렌(fluspirilene) 및 발프로에이트(valproate)로 이루어진 군으로부터 선택되는 것이 바람직하며, 에토숙시마이드(ethosuximide)인 것이 가장 바람직하나, 이에 한정되지 않는다.
본 발명의 구체적인 실시예를 통하여, 코발트 선을 삽입한 동물 마우스를 주의력 결핍 과잉 행동장애 모델 마우스로써 유용하게 사용할 수 있으며, 상기 동물 모델에 T-타입 칼슘채널 억제제의 한 종류인 에토숙시미드를 투여함으로써 집중력 장애 질병의 증상이 감소하므로,T-타입 칼슘채널 억제제를 포함하는 조성물을 집중력 장애 질병 예방 및 치료용 조성물로서 유용하게 사용할 수 있음을 알 수 있다.
본 발명의 T-타입 칼슘채널 억제제는 식품학적으로 허용된 담체와 혼합하여 식품 조성물로서 제공될 수 있다.
본 발명의 T-타입 칼슘채널 억제제를 식품 또는 음료 첨가물로 사용할 경우, 상기 T-타입 칼슘채널 억제제를 그대로 첨가하거나 다른 식품 또는 식품 성분과 함께 사용되고, 통상적인 방법에 따라 적절하게 사용될 수 있다. 상기 T-타입 칼슘채널 억제제의 혼합양은 그의 사용목적(예방, 건강 또는 치료적 처치)에 따라 적합하게 결정될 수 있다.
건강 및 위생을 목적으로 하거나 또는 건강조절을 목적으로 하는 장기간의 섭취의 경우, 상기 T-타입 칼슘채널 억제제는 안전성 면에서 아무런 문제가 없기 때문에, 장기간 복용이 가능하다.
상기 식품의 종류에는 특별한 제한은 없다. 상기 물질을 첨가할 수 있는 식품의 예로는 육류, 소세지, 빵, 초콜릿류, 캔디류, 스넥류, 과자류, 피자, 라면, 기타 면류, 껌류, 아이스크림류를 포함한 낙농제품, 각종 스프, 음료수, 차, 드링크제, 알코올 음료 및 비타민 복합제 등이 있다.
음료수로 제형화할 경우에 T-타입 칼슘채널 억제제 이외에 첨가되는 액체 성분으로는 이제 한정되지는 않으나, 통상의 음료와 같이 여러 가지 향미제 또는 천연 탄수화물 등을 추가 성분으로서 함유할 수 있다. 상술한 천연 탄수화물의 예는 모노사카라이드(예, 포도당, 과당 등), 디사카라이드(예, 말토오스, 수크로오스 등) 및 폴리사카라이드(예, 덱스트린, 시클로덱스트린 등과 같은 통상적인 당), 및 자일리톨, 소르비톨, 에리스리톨 등의 당 알코올이다. 상기 천연 탄수화물의 비율은 본 발명의 조성물 100 ㎖ 당 일반적으로 약 1 내지 20 g, 바람직하게는 약 5 내지 12 g이다. 상술한 것 이외의 향미제로서 천연 향미제[타우마린, 스테비아 추출물(예, 레바우디오시드 A, 글리시르히진 등)] 및 합성 향미제(예, 사카린, 아스파르탐 등)를 사용할 수 있다.
다른 양태로서, 본 발명의 식품 조성물은 여러 가지 영양제, 비타민, 광물(전해질), 합성 풍미제 및 천연 풍미제 등의 풍미제, 착색제 및 증진제(치즈, 초콜릿 등), 펙트산 및 그의 염, 유기산, 보호성 콜로이드 증점제, pH 조절제, 안정화제, 방부제, 글리세린, 알코올, 탄산음료에 사용되는 탄산화제 등을 함유할 수 있다. 또한 본 발명의 식품 조성물은 과일 및 야채 음료의 제조를 위한 과육을 함유할 수 있다. 이러한 성분은 단독으로 또는 조합으로 사용될 수 있으며, 이러한 첨가제의 비율은 조성물 전체 중량당 0.001 내지 50 중량부의 범위에서 선택되는 것이 일반적이다.
또한, 본 발명은 T-타입 칼슘채널 억제제를 함유하는 집중력 장애 질병 예방 및 개선용 사료 첨가제를 제공한다.
아울러, 본 발명은 T-타입 칼슘채널 억제제를 집중력 장애 질병 개선용 사료첨가제의 제조에 이용하는 용도를 제공한다.
상기 집중력 장애 질병 예방 및 개선용 사료 첨가제에 있어서, 집중력 장애 질병은 주의력 결핍 과잉 행동장애(attention deficit hyperactivity disorder), 정신 분열증(schizophrenia), 전두엽 간질(Forntal lobe epilepsy), 및 자폐증(autism)으로 구성된 군으로부터 선택되는 것이 바람직하나, 이에 한정되지 않는다. 또한, 상기 T-타입 칼슘채널 억제제는 미베프라딜(mibefradil), 테트라메쓰린(tetramethrin), 에토숙시마이드(ethosuximide), 조니사미드(Zonisamide), 페이에니토인(Phyenytoin), SUN-N8075, 에포니디핀(efonidipine)과 Y3+, La3+, Ce3+, Nd3+,Gd3+,Ho3+,Er3+Yb3+ 로 구성되는 군으로부터 선택되는 3가 금속 이온, Ni2+, U-92032(7-[[4-[bis(4-fluorophenyl)methyl]-1-piperazinyl]methyl]-2-[(2-hydroxyethyl)amino]4-(1-methylethyl)-2,4,6-cycloheptatrien-1-one), 펜플루리돌(penfluridol), 플루스피릴렌(fluspirilene) 및 발프로에이트(valproate)로 이루어진 군으로부터 선택되는 것이 바람직하며, 에토숙시마이드(ethosuximide)인 것이 가장 바람직하나, 이에 한정되지 않는다.
본 발명의 구체적인 실시예를 통하여, 코발트 선을 삽입한 동물 마우스를 주의력 결핍 과잉 행동장애 모델 마우스에 T-타입 칼슘채널 억제제의 하나인 에토숙시미드를 투여함으로써 집중력 장애 질병의 증상이 감소하므로, T-타입 칼슘채널 억제제를 포함하는 조성물을 집중력 장애 질병 예방 및 개선용 사료 첨가제로서 유용하게 사용할 수 있음을 알 수 있다.
본 발명의 사료 조성물은 발효사료, 배합사료, 펠렛형태 및 사일레지 등의 형태로 제조될 수 있으며, 통상적인 방법에 의해 제조될 수 있다. 본 발명의 사료에 첨가되는 T-타입 칼슘채널 억제제의 유효량은 성물 전체 중량당 0.001 내지 50 중량부의 범위에서 선택되는 것이 바람직하나, 이에 한정되지 않는다.
이하, 본 발명을 실시예, 실험예 및 제조예에 의해 상세히 설명한다.
단, 하기 실시예, 실험예 및 제조예는 본 발명을 예시하는 것일 뿐, 본 발명의 내용이 하기 실시예, 실험예 및 제조예에 한정되는 것은 아니다.
<실시예 1> 주의력 결핍 과잉 행동장애 동물 모델의 제작
10 ~ 20 주령되는 C57BL/6J 마우스(바이오모델시스템파크)를 한국과학기술연구원(Korea Advanced Institute of Science and Technology, KAIST)의 실험동물운영위원회 규정에 따라 마우스를 사육 및 취급하였다. 마우스는 물과 사료에 자유롭게 접근할 수 있는 상태로 유지되었으며, 명암 주기는 12시간이었다.
저산소증을 일으킨다고 보고된 코발트 선을 오른쪽 전두엽에 삽입하여, 주의력 결핍 과잉 행동장애 동물 모델을 제작하였다.
구체적으로, 주의력 결핍 과잉 행동 모델 마우스 제작은 0.2 % 아베르틴(avertin) 마취(Tribromoethanol, 20 ㎎/㎖로 복강내(i.p.) 주사를 통해서 주입함)를 한 후, 발명자들은 스테레오텍식(stereotaxic) 에 마우스(10 ~ 20주 사이의 B6 마우스)의 머리를 고정한 후, 코발트 선(Alfa Aesar)을 스테레오텍식(stereotaxic)(David Kopf Instr㎛ents, Germany)의 부품인 홀더(holder)를 이용하여 삽입한다. 코발트 선은 500 ㎛(직경)(Alfa Aesar)를 방사상(radial) 방향(즉, 대뇌 표면에 대하여 수직인 방향)으로 오른쪽 배측외측(dorsolateral) 전두엽의 전후 방향(anteroposterior)의 2.6 mm, 측면(lateral)의 1.8 mm, 및 복부 방향(ventral)의 1.3 mm인 위치에 삽입하였다.
또한, EEG 기록을 위한 경막외 마취제(epidural) 전극봉(electrode)은 상기 코발트 선이 삽입된 오른쪽 전두엽에 삽입하였으며, 다른 전극봉은 왼쪽 전두엽 및 측두엽 전두엽에 삽입하였다. 구체적으로 삽입 위치는 오른쪽 전두엽에 있어서는 전후 방향(anteroposterior)의 2.8 mm, 측면(lateral)의 0.8 mm의 위치이며, 왼쪽 전두엽에 있어서는 전후 방향(anteroposterior)의 2.8 mm, 측면(lateral)의 0.8 mm의 위치에 각각 삽입하였다. 접지(grounding) EEG는 두개골의 후두(occipital)의 위치에 삽입하였다.
EEG 전극봉을 코발트 선과 같이 넣어 수술할 경우 덴탈 시멘트(dental sement)를 이용하여 봉합하였다. EEG 전극봉을 넣지 않고 행동실험을 위한 수술일 경우, 수술용 실을 이용하여 봉합하였다.
3일의 회복 기간이 지난 후, 상기 EEG 신호 및 비디오 영상을 30일 동안 촬영하였다. EEG신호는 증폭되었으며((Grass model 7H polygraph, Grass Technologies, USA)), 500 Hz의 샘플링 비율에서 디지털화되었다(DIGIDATA 1320A, Molecular Devices, USA). pClamp9.2 소프트웨어(Molecular Devices, USA)는 데이타를 얻기 위하여 이용되었다.
<실시예 2> T-타입 칼슘채널 제거 동물 모델의 제작
<2-1> Cav3.1 T-타입 칼슘채널 제거 동물 모델의 제작
Cav3.1 T-타입 칼슘채널 제거 동물 모델은 α1G T타입 칼슘채널이 한쪽의 크로모좀(chromosome)에만 있는 헤테로(hetero) 생쥐를 교배시켜서 녹아웃(Knockout, KO, -/-) 마우스를 제조하였다(Neuron,2001,Lack of the Burst Firing of Thalamocortical Relay Neurons and Resistance to Absence Seizures in Mice Lacking [alpha] 1G T-Type Ca2+ Channels). 이렇게 교배하여 제조된 녹아웃 마우스는 몸 전체에서 α1G T 타입 칼슘채널이 제거되었다.
<2-2> 시상핵 국소적 α1G T-타입 칼슘채널 제거 동물 모델의 제작
Cav3.1 T-타입 칼슘채널을 표적으로 하는 shRNA를 발현하는 렌티 바이러스 벡터를 제작하였다. 합성된 이중 올리고뉴클레오티드(서열번호 1: 5'- CGGAATTCCGGGAAGATCGTAGATA GCAAAttcaagagaTTTGCTATCTACGATCTTCTTTTTGATATCTAGACA -3')을 shLentisyn3.4G 렌티 바이러스 벡터(Macrogen, KOREA.)에 삽입하였다. 상기 shLentisyn3.4G 렌티 바이러스 벡터는 U6 프로모터로부터 shRNA가 발현되고, 녹색형광단백질(enhanced green fluorescent protein, EGFP)을 시냅신(synapsin) 프로모터로부터 발현하도록 제작되었다.
상기 표적 서열은 생물정보센터(National Center for Biotechnology Information)의 데이타베이스의 Cav3.1을 제외한 다른 어떠한 mRNA와도 일치하지 않았다.
Cav3.1 shRNA 올리고뉴클레오티드의 스트램블 버전(scrambled version)은 서열번호 2의 서열(5'- C GGAATTCCGGGTAAGTGAA CTGACAAGAA ttcaagaga TTCTTGTCAGTTCACTTACT TTTTGATATCTAGACA -3')을 가지며, shLentisyn3.4G 렌티 바이러스 벡터(Macrogen, KOREA.)에 삽입되어 대조군으로서 사용되었다. 이러한 서열은 알려진 어떠한 포유류 유전자와도 상동성을 보이지 않았다. 상기 재조합 렌티 바이러스 벡터는 상업적으로 생산되고 농축될 수 있다(Macrogen LentiVector Institute, Korea).
본 발명자들은 약 2×106 형질도입 단위/㎖의 농도로 렌티바이러스를 사용하였다. 상기 Cav3.1 shRNA 또는 스크램블 대조군을 포함하는 바이러스를 갖고 있는 용액은 마이크로 주사기 펌프(micro syringe p㎛p)(Eicom, UK)를 이용하여, ipsi-MD(ipsilateral MD thalamus, MD 시상핵의 오른쪽에 바이러스를 삽입한 것을 의미함)로 Nanofil 33G 블런트 니들(blunt needle) 및 나노필(Nanofil) 주사기(World Precision Instr㎛ents, USA)를 이용하여 주입하였다.
바이러스 형질전환 수행 7일 이후, 코발트 선 및 경막외 마취제(epidural) 전극봉(electrode)을 상기 기재한 바와 같이 삽입되었다. EEG 신호는 비디오 모티터와 함께 30일 동안 획득하였다.
<실험예 1> 주의력 결핍 과잉 행동장애 동물 모델의 뇌파 관찰
본 발명자들은 상기 <실시예 1>의 코발트 선을 오른쪽 전두엽에 삽입하여 제작한 동물 모델이 주의력 결핍 과잉 행동장애 동물 모델로써 이용할 수 있는지 확인하기 위하여, 과잉 행동장애 질병의 특징적인 뇌파를 관찰하였다.
상기 동물 모델의 뇌파(electroencephalogram, EEG) 측정을 위해 좌, 우측 전두엽과 좌, 우측 측두엽에 EEG 전극을 삽입한 후, 30일 동안 뇌파를 관찰하였다. 코발트 선을 삽입함과 동시에 EEG 전극을 삽입하였다. 코발트 선과 같이 스테레오텍식(stereotaxic) 기계를 이용하여 좌표를 계산하여 위치를 잡고 EEG 전극을 삽입하였다.
구체적으로, 코발트 선은 500 ㎛(직경)(Alfa Aesar)를 방사상(radial) 방향(즉, 대뇌 표면에 대하여 수직인 방향)으로 오른쪽 배측외측(dorsolateral) 전두엽의 전후 방향(anteroposterior)의 2.6 mm, 측면(lateral)의 1.8 mm, 및 복부 방향(ventral)의 1.3 mm인 위치에 삽입하였다. 또한, EEG 기록을 위한 경막외 마취제(epidural) 전극봉(electrode)은 상기 코발트 선이 삽입된 오른쪽 전두엽에 삽입하였으며, 다른 전극봉은 왼쪽 전두엽 및 측두엽 전두엽에 삽입하였다. 구체적으로 삽입 위치는 오른쪽 전두엽에 있어서는 전후 방향(anteroposterior)의 2.8 mm, 측면(lateral)의 0.8 mm의 위치이며, 왼쪽 전두엽에 있어서는 전후 방향(anteroposterior)의 2.8 mm, 측면(lateral)의 0.8 mm의 위치에 각각 삽입하였다. 접지(grounding) EEG는 두개골의 후두(occipital)의 위치에 삽입하였다.
코발튼 선 및 EEG 전극을 삽입한 후, 3 ~ 4일의 회복기를 보낸 후 비디오레코딩과 동시에 EEG 레코딩을 수행 하였다.
코발트 선 및 EEG 전극봉을 삽입한 후, 4일의 회복기를 보낸 C57BL/6J 마우스 10 마리를 EEG 챔버(EEG chamber, 정사각형 바닥의 박스)에 자유롭게 돌아다닐 수 있도록 넣은 뒤, EEG 신호를 Grass model 7H polygraph(Grass Technologies, USA)을 이용하여 증폭한 뒤, DIGIDATA 1320A(Molecular Devices, USA)를 통하여 500 Hz의 샘플링 속도(sampling rate)에서 디지털화하였다. 그 뒤, pClamp9.2 software(Molecular Devices, USA)를 이용하여 데이터를 얻었다.
그 결과, 도 2에 나타난 바와 같이, 주의력 결핍 과잉 행동장애 동물 모델에서 코발트 선이 삽입된 우측 전두엽에서만 낮은 진동수의 뇌파가 증가하였으며, 1 ~ 7 Hz의 세타파(theta oscillation)가 시작된 후, 1 ~ 4 Hz의 스파이크(spike) 형태의 뇌파가 관찰되었다. 이러한 스파이크 형태의 뇌파는 코발트 선이 삽입되지 않은 좌측 전두엽에서는 관찰되지 않았다(도 2).
<실험예 2> 주의력 결핍 과잉 행동장애 동물 모델의 행동 변화, 및 인지기능 변화 측정
본 발명자들은 상기 <실시예 1>의 코발트 선을 오른쪽 전두엽에 삽입하여 제작한 동물 모델이 주의력 결핍 과잉 행동장애 동물 모델로써 이용할 수 있는지 확인하기 위하여, 과잉 행동장애 질병의 특징적인 행동을 확인하고자하였다.
코발트 선을 삽입한 시간에 따라서, 6일(n=5), 14일(n=5), 및 28일(n=9) 이하로 나누어, 코발트 선을 삽입하지 않은 대조군 마우스(n=9)와 행동을 비교하였다. 마우스는 개방장 검사 키트(아크릴로 만들어진 사각형 바닥의 상자, 40×40× 50 cm의 가운데에 조심스럽게 넣은 뒤, 상기 키트 안에서 1시간 및 1/2 주기 동안 이동한 거리를 디지털 비디오 기록에 의해서 5분 간격으로 모니터링하였다. 개방장 검사는 18시에서 22시 사이에 수행되었으며, 비디오 영상을 분석하기 위하여, EthoVision(Noduls, USA)을 이용하였다.
개방장 검사(open-field test,40×40× 50 cm)를 이용해 행동 증상을 정량한 결과, 도 3의 A에 나타난 바와 같이, 주의력 결핍 과잉 행동장애 동물 모델은 코발트 선을 삽입한 시간이 길어질수록, 이동하는 거리가 많아졌으며, 이러한 경향성은 코발트 선을 삽입하지 않은 대조군에 비하여, 현저하게 증가한 것을 관찰할 수 있었다(도 3의 A).
또한, 코발트 선 삽입 후 28일이 경과한 주의력 결핍 과잉 행동장애 동물 모델의 자취를 EthoVision(Noduls, USA)를 이용하여 분석한 결과, 코발트 선을 삽입한 마우스의 움직임에서 반복적으로 한쪽 방향으로 도는 상동증(stereotype)이 관찰되었다(도 3의 B).
<실험예 3> 주의력 결핍 과잉 행동장애 동물 모델의 인지기능 변화 측정
본 발명자들은 상기 <실시예 1>의 코발트 선을 오른쪽 전두엽에 삽입하여 제작한 동물 모델이 주의력 결핍 과잉 행동장애 동물 모델로써 이용할 수 있는지 확인하기 위하여, 과잉 행동장애 질병에서 관찰되는 인지기능의 저하가, 본 발명의 동물 모델에서 관찰되는지 확인하고자 공포 학습 기억 검사를 수행하였다.
공포 학습 기억 검사(fear conditioning test)를 수행하기 위하여, 첫째날 특정 소리를 주면서 전기자극을 반복적으로 줘서 마우스가 공포를 기억하게 만들었다. 그리고 둘째 날 두 가지의 테스트를 수행하였는데, 첫번째는 첫째날 전기자극을 받았던 그 공간에 대한 기억을 하고 있나(context)에 대한 것을 확인하였으며, 두 번째는 전기자극을 받을 때 나오던 소리를 기억하고 있나(cue)를 테스트하였다. 기억 여부를 확인하기 위하여 마우스의 움직이지 않는 시간(freezing time)을 측정하였다. 마우스는 공포를 느끼는 경우 움직임이 나타나지 않기 때문에, 만일 쥐가 만약 기억을 하고 있을 경우 움직이지 않는 시간(freezing time)이 길 것이고, 그렇지 않은 경우 움직이지 않는 시간(freezing time)이 줄어들게 된다. 이러한 시간을 측정하여 코발트 선을 넣은 마우스의 인지기능을 검사하고자 하였다.
그 결과, 도 3의 C에 나타난 바와 같이, 코발트 선이 삽입된 동물 모델에서 인지기능이 저하된 것을 관찰할 수 있었다. 즉, 코발트 선을 넣은 마우스의 경우, 공간(context)과 소리(cue) 검사 모두에서 움직이지 않는 시간(freezing time)이 현저히 낮아진 것을 볼 수 있는데, 이것은 코발트 선을 넣은 마우스는 전기자극의 아픔을 제대로 기억하지 못하고 있다는 것을 알려준다.
<실험예 4> T-타입 칼슘 억제제에 주입에 의한 주의력 결핍 과잉 행동장애 동물 모델의 뇌파 변화
<4-1> 에토숙시미드에 의한 주의력 결핍 과잉 행동장애 동물 모델의 뇌파 변화
상기 <실험예 1>에서 관찰된 바와 같이, 본 발명의 주의력 결핍 과잉 행동장애 동물 모델은 전두엽에서 특징적으로 낮은 진동수의 전기적 신호가 증가하였다. 이러한 전기적 흥분을 완화시키기 위하여, T-타입 칼슘채널의 억제제(Huguenard, 2002)로 알려진 에토숙시미드(Huguenard, 2002)를 과잉 행동장애 마우스 모델에 처리하였다.
<4-2> 에토숙시미드에 의한 주의력 결핍 과잉 행동장애 동물 모델의 뇌파 변화
상기 <실험예 1>에서 관찰된 바와 같이, 본 발명의 주의력 결핍 과잉 행동장애 동물 모델은 전두엽에서 특징적으로 낮은 진동수의 전기적 신호가 증가하였으며, T-타입 칼슘채널의 억제제 중 하나인 에토숙시미드(Huguenard, 2002), 조니사미드(Zonisamide, ZNS)(Kito et al., 1996)와 페이에니토인(Phyenytoin, PHT)(Lacinova et al., 2000)을 과잉 행동장애 마우스 모델에 처리하였다.
에토숙시미드(Sigma-aldrich, USA)를 150 ㎎/㎏의 농도로 코발트 선을 삽입한 7 ~ 9일 경과한 주의력 결핍 과잉 행동장애 동물 모델의 복강에 투여한 후, 1시간 동안 뇌파의 변화를 관찰했다. 자유롭게 움직일 수 있는 정육면체의 뇌파 검사실 안에서 약물 처리 전 30분부터 뇌파를 기록하기 시작했다. 에토숙시마이드투여 전후의 뇌파에서 관찰되는 스파이크(spike) 수를 비교한 결과, 에토숙시미드를 처리하였을 경우, 처리전에 비해 전두엽에서 관찰되는 스파이크(spike) 수가 현저히 감소하였다. 이로써, 에토숙시미드는 전두엽의 과잉된 전기적 신호를 완화함으로써 과잉 행동장애(hyperactivity)의 증상을 완화시킬 수 있음을 의미한다.
또한, 제니사미드(Sigma-aldrich, USA) 및 페이에니토인(Sigma-aldrich, USA)을 각각 60 mg/kg, 100 ㎎/㎏의 농도로 코발트 선을 삽입한 7 ~ 9일 경과한 주의력 결핍 과잉 행동장애 동물 모델의 복강에 투여한 후, 1시간 동안 뇌파의 변화를 관찰했다. 자유롭게 움직일 수 있는 정육면체의 뇌파 검사실 안에서 약물 처리 전 30분부터 뇌파를 기록하기 시작했다.
제니사미드 및 페이에니토인을 각각 투여 전후의 뇌파에서 관찰되는 스파이크(spike) 수를 비교한 결과, 도 4에 나타난 바와 같이, 비특이적 T 타입 칼슘채널 억제제 중의 하나인 제니사미드 및 페이에니토인을 각각 본 발명의 주의력 결핍 과잉 행동장애 동물 모델에 처리하였을 경우, 처리 전에 비해 전두엽에서 관찰되는 스파이크(spike)를 통계적으로 유의하게 억제한다는 것을 알 수 있었다(P<0.05)(도 4).
<실험예 5> 코발트 선 이외의 물질삽입에 의한 뇌파변화 관찰
코발트 선 이외의 다른 금속물질에 의한 뇌파변화를 확인하기 위하여, 본 발명자들은 구리선과 알루미늄 선을 상기 코발트 선을 삽입한 방식을 이용하였다.
스테레오텍식(stereotaxic)에 마우스(10 ~ 20주 사이의 B6 마우스)의 머리를 고정한 후, 코발트 선(Alfa Aesar), 구리선, 및 알루미늄 선을 각각을 스테레오텍식(stereotaxic)의 부품인 홀더(holder)를 이용하여 삽입한다.
코발트 선은 500 ㎛(직경)(Alfa Aesar)를 방사상(radial) 방향(즉, 대뇌 표면에 대하여 수직인 방향)으로 오른쪽 배측외측(dorsolateral) 전두엽의 전후 방향(anteroposterior)의 2.6 mm, 측면(lateral)의 1.8 mm, 및 복부 방향(ventral)의 1.3 mm인 위치에 삽입하였다. 또한, EEG 기록을 위한 경막외 마취제(epidural) 전극봉(electrode)은 상기 코발트 선이 삽입된 오른쪽 전두엽에 삽입하였으며, 다른 전극봉은 왼쪽 전두엽 및 측두엽 전두엽에 삽입하였다. 구체적으로 삽입 위치는 오른쪽 전두엽에 있어서는 전후 방향(anteroposterior)의 2.8 mm, 측면(lateral)의 0.8 mm의 위치이며, 왼쪽 전두엽에 있어서는 전후 방향(anteroposterior)의 2.8 mm, 측면(lateral)의 0.8 mm의 위치에 각각 삽입하였다. 접지(grounding) EEG는 두개골의 후두(occipital)의 위치에 삽입하였다.
또한, 구리선 및 알루미늄선을 코발트 선을 삽입한 위치와 동일한 위치인 방사상(radial) 방향(즉, 대뇌 표면에 대하여 수직인 방향)으로 오른쪽 배측외측(dorsolateral) 전두엽의 전후 방향(anteroposterior)의 2.6 mm, 측면(lateral)의 1.8 mm, 및 복부 방향(ventral)의 1.3 mm인 위치에 삽입하였다. EEG 전극봉을 같이 넣어 수술한 뒤, 덴탈 시멘트(dental sement)를 이용하여 봉합하였다.
그 결과, 도 5에 나타난 바와 같이 구리선 및 알루미늄 선을 삽입한 군에서는 코발트 선에서 관찰되는 스파이크 형태의 뇌파가 관찰되지 않았으며, 이러한 경향성은 마우스 전두엽에 아무것도 삽입하지 않은 무삽입 대조군과 유사하였다(도 5). 따라서, 본 발명의 무삽입 동물 모델 마우스를 대조군으로써 사용할 수 있음을 확인할 수 있었다.
<실험예 6> Cav3.1 T-타입 칼슘채널 제거 동물 모델의 뇌파 및 행동 변화 관찰
<6-1> Cav3.1 T-타입 칼슘채널 제거 동물 모델의 전두엽에서의 뇌파 관찰
본 발명자들은 상기 <실시예 2-1>의 Cav3.1 T-타입 칼슘채널이 전부 제거된 동물 모델을 이용하여, 전두엽 스파이크 생성의 기전을 연구하였다.
Cav3.1 T-타입 칼슘채널이 제거된 생쥐가 태어난 후, 15 내지 20주될 때에, 상기 <실시예 1>의 방법과 같이 코발트 선과 EEG 기록을 위한 경막외 마취제(epidural) 전극봉(electrode)을 삽입하고, 뇌파(electroencephalogram, EEG)를 30일 동안 관찰하였다
그 결과, 도 6의 A에 나타난 바와 같이, 시상핵에서 뇌파를 만들어 내는데 중요하다고 알려진 α1G T타입 칼슘채널이 제거된 동물 모델에서 코발트 선 삽입 6 ~ 7일후 전두엽에서 생성되는 낮은 진동수의 스파이크가 현저히 감소하였습니다. α1G T-타입 칼슘채널 제거 동물 모델의 전두엽에서 관찰되는 낮은 진동수의 뇌파의 빈도수가 대조군에 비해 현저히 감소되어 있었다(T검정, p<0.05). 이를 통해, α1G T타입 칼슘채널이 주의력 결핍 과잉 행동 장애(ADHD) 등의 전두엽 관련 질병 생성에 중요하다는 사실을 알 수 있었다(도 6의 A).
<6-2> Cav3.1 T-타입 칼슘채널 제거 동물 모델의 전두엽에서의 행동 변화 관찰
본 발명자들은 상기 <실시예 2-1>의 Cav3.1 T-타입 칼슘채널이 전부 제거된 동물 모델을 이용하여, 전두엽 스파이크 생성의 기전을 연구하였다.
Cav3.1 T-타입 칼슘채널이 제거된 생쥐가 태어난 후, 15 내지 20주될 때에, 상기 <실시예 1>의 방법과 같이 코발트 선과 EEG 기록을 위한 경막외 마취제(epidural) 전극봉(electrode)을 삽입하고, 뇌파(electroencephalogram, EEG)를 30일 동안 관찰하였다
마우스는 개방장 검사 키트(아크릴로 만들어진 사각형 바닥의 상자, 40×40× 50 cm의 가운데에 조심스럽게 넣은 뒤, 상기 키트 안에서 1시간 및 1/2 주기 동안 이동한 거리를 디지털 비디오 기록에 의해서 5분 간격으로 모니터링하였다. 개방장 검사는 18시에서 22시 사이에 수행되었으며, 비디오 영상을 분석하기 위하여, EthoVision(Noduls, USA)을 이용하였다.
개방장 검사(open-field test,40×40× 50 cm)를 이용해 행동 증상을 정량한 결과, 도 6의 B에 나타난 바와 같이, α1G T-타입 칼슘채널 제거 동물 모델은 코발트 선 삽입 6 ~ 7일후 대조군 동물에 비하여 이동하는 거리가 많아졌으며, 이러한 경향성은 α1G T-타입 칼슘채널 제거이 제고되지 않은 대조군에 비하여, 현저하게 증가한 것을 관찰할 수 있었다(도 6의 B).
<실험예 7> α1G T-타입 칼슘채널 제거 동물 모델의 뇌파 및 행동 변화 관찰
<7-1> α1G T-타입 칼슘채널 제거 동물 모델의 시상핵에서의 뇌파 관찰
본 발명자들은 시상핵에서 α1G T-타입 칼슘채널의 발현을 억제하기 위하여, 상기 <실시예 2-2>의 Cav3.1 T-타입 칼슘채널을 표적으로 하는 shRNA를 발현하는 렌티 바이러스 벡터를 시상핵에만 국소적으로 형질 감염시켜 제조한 시상핵 국소적 α1G T-타입 칼슘채널 제거 동물 모델을 이용하여, 시상핵 스파이크 생성의 기전을 연구하였다.
Cav3.1 T-타입 칼슘채널을 표적으로 하는 shRNA를 발현하는 렌티 바이러스 벡터를 시상핵에 형질감염시킨지 7일이 경과한 후, 상기 <실시예 1>의 방법과 같이 코발트 선과 EEG 기록을 위한 경막외 마취제(epidural) 전극봉(electrode)을 삽입하고, 과잉 행동장애 질병의 특징적인 행동을 확인하고자하였다.
그 결과, 도 7에 나타난 바와 같이, 시상핵에서 뇌파를 만들어 내는데 중요하다고 알려진 α1G T타입 칼슘채널이 제거된 동물 모델에서 전두엽에서 낮은 진동수의 스파이크가 관찰되었다. α1G T-타입 칼슘채널 제거 동물 모델의 전두엽에서 관찰되는 낮은 진동수의 뇌파의 빈도수가 대조군에 비해 현저히 감소되어 있었다(T검정, p<0.05). 이를 통해, α1G T타입 칼슘채널이 주의력 결핍 과잉 행동 장애(ADHD) 등의 전두엽 관련 질병 생성에 중요하다는 사실을 알 수 있었다(도 7).
<7-2> α1G T-타입 칼슘채널 제거 동물 모델의 행동 변화 측정
본 발명자들은 시상핵에서 α1G T-타입 칼슘채널의 발현을 억제하기 위하여, 상기 <실시예 2-2>의 Cav3.1 T-타입 칼슘채널을 표적으로 하는 shRNA를 발현하는 렌티 바이러스 벡터를 시상핵에만 국소적으로 형질 감염시켜 제조한 시상핵 국소적 α1G T-타입 칼슘채널 제거 동물 모델을 이용하여, 시상핵 스파이크 생성의 기전을 연구하였다.
Cav3.1 T-타입 칼슘채널을 표적으로 하는 shRNA를 발현하는 렌티 바이러스 벡터를 시상핵에 형질감염시킨지 7일이 경과한 후, 상기 <실시예 1>의 방법과 같이 코발트 선과 EEG 기록을 위한 경막외 마취제(epidural) 전극봉(electrode)을 삽입하고, 과잉 행동장애 질병의 특징적인 행동을 확인하고자하였다.
마우스는 개방장 검사 키트(아크릴로 만들어진 사각형 바닥의 상자, 40×40× 50 cm의 가운데에 조심스럽게 넣은 뒤, 상기 키트 안에서 1시간 및 1/2 주기 동안 이동한 거리를 디지털 비디오 기록에 의해서 5분 간격으로 모니터링하였다. 개방장 검사는 18시에서 22시 사이에 수행되었으며, 비디오 영상을 분석하기 위하여, EthoVision(Noduls, USA)을 이용하였다.
개방장 검사(open-field test,40×40× 50 cm)를 이용해 행동 증상을 정량한 결과, 도 8의 A에 나타난 바와 같이, α1G T-타입 칼슘채널 제거 동물 모델은 대조군 동물에 비하여 이동하는 거리가 많아졌으며, 이러한 경향성은 α1G T-타입 칼슘채널 제거이 제고되지 않은 대조군에 비하여, 현저하게 증가한 것을 관찰할 수 있었다(도 8의 A). 또한, 이러한 결과를 그래프로 나타내면 도 8의 B에 나타난 바와 같다(도 8의 B).
하기에 본 발명의 조성물을 위한 제조예를 제시한다.
<제조예 1> 약학적 제제의 제조
<1-1> 산제의 제조
에토숙시마이드 2 g
유당 1 g
상기의 성분을 혼합하고 기밀포에 충진하여 산제를 제조하였다.
<1-2> 정제의 제조
에토숙시마이드 100 ㎎
옥수수전분 100 ㎎
유 당 100 ㎎
스테아린산 마그네슘 2 ㎎
상기의 성분을 혼합한 후, 통상의 정제의 제조방법에 따라서 타정하여 정제를 제조하였다.
<1-3> 캡슐제의 제조
에토숙시마이드 100 ㎎
옥수수전분 100 ㎎
유 당 100 ㎎
스테아린산 마그네슘 2 ㎎
상기의 성분을 혼합한 후, 통상의 캡슐제의 제조방법에 따라서 젤라틴 캡슐에 충전하여 캡슐제를 제조하였다.
<1-4> 환의 제조
에토숙시마이드 1 g
유당 1.5 g
글리세린 1 g
자일리톨 0.5 g
상기의 성분을 혼합한 후, 통상의 방법에 따라 1 환 당 4 g이 되도록 제조하였다.
<1-5> 과립의 제조
에토숙시마이드 150 ㎎
대두 추출물 50 ㎎
포도당 200 ㎎
전분 600 ㎎
상기의 성분을 혼합한 후, 30% 에탄올 100 ㎎을 첨가하여 60℃에서 건조하여 과립을 형성한 후 포에 충진하였다.
<제조예 2> 식품의 제조
<2-1> 과자 및 분식의 제조
본 발명의 실시예<1-1> 추출물 0.5~5.0 중량부를 밀가루에 첨가하고, 이 혼합물을 이용하여 빵, 케이크, 쿠키, 크래커 및 면류를 제조하여 건강 증진용 식품을 제조하였다.
<2-2> 유제품의 제조
본 발명의 실시예<1-1> 추출물 5~10 중량부를 우유에 첨가하고, 상기 우유를 이용하여 버터 및 아이스크림과 같은 다양한 유제품을 제조하였다.
<2-3> 선식의 제조
현미, 보리, 찹쌀, 율무를 공지의 방법으로 알파화시켜 건조시킨 것을 배전한 후 분쇄기로 입도 60 메쉬의 분말로 제조하였다.
검정콩, 검정깨, 들깨도 공지의 방법으로 쪄서 건조시킨 것을 배전한 후 분쇄기로 입도 60 메쉬의 분말로 제조하였다.
본 발명의 본 발명의 실시예<1-1> 추출물을 진공 농축기에서 감압 농축하고, 분무, 열풍건조기로 건조하여 얻은 건조물을 분쇄기로 입도 60 메쉬로 분쇄하여 건조분말을 얻었다.
상기에서 제조한 곡물류, 종실류 및 본 발명의 실시예<1-1> 추출물의 건조분말을 다음의 비율로 배합하여 제조하였다.
곡물류(현미 30 중량부, 율무 15 중량부, 보리 20 중량부),
종실류(들깨 7 중량부, 검정콩 8 중량부, 검정깨 7 중량부),
본 발명의 실시예<1-1> 추출물의 건조분말(3 중량부),
영지(0.5 중량부), 및
지황(0.5 중량부)
<제조예 3> 음료의 제조
본 발명의 실시예<1-1> 추출물 1000 ㎎
구연산 1000 ㎎
올리고당 100 g
매실농축액 2 g
타우린 1 g
정제수를 가하여 전체 900 ㎖
통상의 건강음료 제조방법에 따라 상기의 성분을 혼합한 다음, 약 1시간 동안 85℃에서 교반 가열한 후, 만들어진 용액을 여과하여 멸균된 2 ℓ용기에 취득하여 밀봉 멸균한 뒤 냉장 보관한 다음 본 발명의 건강식품 제조에 사용한다.
상기 조성비는 비교적 기호 음료에 적합한 성분을 바람직한 실시예로 혼합 조성하였지만, 수요계층, 수요국가, 사용 용도 등 지역적, 민족적 기호도에 따라서 그 배합비를 임의로 변형 실시하여도 무방하다.
상기에서 살펴본 바와 같이, 본 발명에 따른 코발트 선을 이용하여 제작한 ADHD 모델 동물은 집중력 장애의 특징인 행동과잉증상(hyperactivity) 및 전두엽의 비정상적인 전기적 흥분(prefrontal hyper-excitability)을 보이며, 이러한 증상은 에토숙시미드(ethosuximide)의 투여에 의하여 감소되므로, 에토숙시미드를 과잉행동 증상을 공통적으로 보이는 집중력 장애 증상의 예방 및 치료용 조성물로서 유용하게 사용될 수 있다.

Claims (27)

1) 코발트 선(cobalt wire)을 마우스의 뇌의 오른쪽 전두엽 측면에 이식하는 단계;
2) 코발트 선을 이식한 후, 상기 마우스의 뇌를 봉합시키는 단계; 및
3) 집중력 장애 질병을 나타내는 마우스를 선별하는 단계로 제조되는 주의력 결핍 과잉 행동 모델 마우스.
제 1항에 있어서, 코발트 선은 직경이 400 ~ 500 ㎛인 것을 특징으로 하는 주의력 결핍 과잉 행동 모델 마우스.
제 1항에 있어서, 코발트 선은 방사상(radial) 방향으로, 오른쪽 배측외측(dorsolateral) 전두엽의 전후 방향(anteroposterior)의 2.0 ~ 3.0 mm, 측면(lateral)의 1.5 ~ 2.5 mm, 및 복부 방향(ventral)의 1.0 ~ 2.0 mm인 위치에 삽입하는 것을 특징으로 하는 주의력 결핍 과잉 행동 모델 마우스.
1) 코발트 선(cobalt wire)을 마우스의 뇌의 오른쪽 전두엽 측면에 이식하는 단계;
2) 코발트 선을 이식한 후, 상기 마우스의 뇌를 봉합시키는 단계; 및
3) 집중력 장애 질병을 나타내는 마우스를 선별하는 단계로 제조되는 주의력 결핍 과잉 행동 모델 마우스를 제조하는 방법.
1) 피검 화합물 또는 조성물을 제 1항의 주의력 결핍 행동 모델 마우스에 투여하는 단계;
2) 단계 1)의 투여된 주의력 결핍 행동 모델 마우스의 뇌파를 측정하는 단계; 및
3) 단계 2)의 주의력 결핍 행동 모델 마우스의 뇌파를 피검 화합물 또는 조성물을 투여하지 않은 대조군과 비교하여, 뇌파의 스파이크(spike) 수가 감소된 피검 화합물 또는 조성물을 선별하는 단계를 포함하는, 집중력 장애 질병 치료제 스크리닝 방법.
제 5항에 있어서, 집중력 장애 질병은 주의력 결핍 과잉 행동장애(attention deficit hyperactivity disorder), 정신 분열증(schizophrenia), 전두엽 간질(Forntal lobe epilepsy), 및 자폐증(autism)으로 구성된 군으로부터 선택된 어느 하나인 것을 특징으로 하는 집중력 장애 질병 치료제 스크리닝 방법.
1) 피검 화합물 또는 조성물을 제 1항의 주의력 결핍 행동 모델 마우스에 투여하는 단계;
2) 단계 1)의 투여된 주의력 결핍 행동 모델 마우스의 행동장애 또는 인지기능을 측정하는 단계; 및
3) 단계 2)의 주의력 결핍 행동 모델 마우스의 뇌파를 피검 화합물 또는 조성물을 투여하지 않은 대조군과 비교하여, 행동장애 또는 인지기능이 감소된 피검 화합물 또는 조성물을 선별하는 단계를 포함하는, 집중력 장애 질병 치료제 스크리닝 방법.
제 7항에 있어서, 행동장애는 상동증인 것을 특징으로 하는 집중력 장애 질병 치료제 스크리닝 방법.
제 7항에 있어서, 인지기능은 공포 학습 기능 기억 검사를 통하여 측정되는 것을 특징으로 하는 집중력 장애 질병 치료제 스크리닝 방법.
T-타입 칼슘채널 억제제를 유효성분으로 함유하는 집중력 장애 질병 예방 및 치료용 조성물.
제 10항에 있어서, T-타입 칼슘채널은 α1G T 칼슘채널인 것을 특징으로 하는 집중력 장애 질병 예방 및 치료용 조성물.
제 10항에 있어서, 집중력 장애 질병은 주의력 결핍 과잉 행동장애(attention deficit hyperactivity disorder), 정신 분열증(schizophrenia), 전두엽 간질(Forntal lobe epilepsy), 및 자폐증(autism)으로 구성된 군으로부터 선택된 어느 하나인 것을 특징으로 하는 집중력 장애 질병 예방 및 치료용 조성물.
제 10항에 있어서, 상기 T-타입 칼슘채널 억제제는 미베프라딜(mibefradil), 테트라메쓰린(tetramethrin), 에토숙시마이드(ethosuximide), 조니사미드(Zonisamide), 페이에니토인(Phyenytoin), SUN-N8075, 에포니디핀(efonidipine)과, Y3+, La3+, Ce3+, Nd3+,Gd3+,Ho3+,Er3+ 및 Yb3+ 로 구성되는 군으로부터 선택되는 3가 금속 이온, Ni2+, U-92032(7-[[4-[bis(4-fluorophenyl)methyl]-1-piperazinyl]methyl]-2-[(2-hydroxyethyl)amino]4-(1-methylethyl)-2,4,6-cycloheptatrien-1-one), 펜플루리돌(penfluridol), 플루스피릴렌(fluspirilene) 및 발프로에이트(valproate)로 이루어진 군으로부터 선택되는 어느 하나인 것을 특징으로 하는 집중력 장애 질병 예방 및 치료용 조성물.
제 10항에 있어서, 상기 T-타입 칼슘채널 억제제는 에토숙시마이드(ethosuximide), 조니사미드(Zonisamide), 및 페이에니토인(Phyenytoin)으로 이루어진 군에서 선택되는 어느 하나인 것을 특징으로 하는 집중력 장애 질병 예방 및 치료용 조성물.
T-타입 칼슘채널 억제제를 유효성분으로 함유하는 집중력 장애 질병 예방 및 개선용 건강식품.
제 14항에 있어서, 집중력 장애 질병은 주의력 결핍 과잉 행동장애(attention deficit hyperactivity disorder), 정신 분열증(schizophrenia), 전두엽 간질(Forntal lobe epilepsy), 및 자폐증(autism)으로 구성된 군으로부터 선택된 어느 하나인 것을 특징으로 하는 집중력 장애 질병 예방 및 개선용 건강식품.
제 14항에 있어서, 상기 T-타입 칼슘채널 억제제는 미베프라딜(mibefradil), 테트라메쓰린(tetramethrin), 에토숙시마이드(ethosuximide), 조니사미드(Zonisamide), 페이에니토인(Phyenytoin), SUN-N8075, 에포니디핀(efonidipine)과 Y3+, La3+, Ce3+, Nd3+,Gd3+,Ho3+,Er3+Yb3+ 로 구성되는 군으로부터 선택되는 3가 금속 이온, Ni2+, U-92032(7-[[4-[bis(4-fluorophenyl)methyl]-1-piperazinyl]methyl]-2-[(2-hydroxyethyl)amino]4-(1-methylethyl)-2,4,6-cycloheptatrien-1-one), 펜플루리돌(penfluridol), 플루스피릴렌(fluspirilene) 및 발프로에이트(valproate)로 이루어진 군으로부터 선택되는 어느 하나인 것을 특징으로 하는 집중력 장애 질병 예방 및 개선용 건강식품.
제 14항에 있어서, 상기 T-타입 칼슘채널 억제제는 에토숙시마이드(ethosuximide), 조니사미드(Zonisamide), 및 페이에니토인(Phyenytoin)으로 이루어진 군에서 선택되는 어느 하나인 것을 특징으로 하는 집중력 장애 질병 예방 및 치료용 조성물.
T-타입 칼슘채널 억제제를 유효성분으로 함유하는 집중력 장애 질병 예방 및 개선용 사료 첨가제.
제 19항에 있어서, 집중력 장애 질병은 주의력 결핍 과잉 행동장애(attention deficit hyperactivity disorder), 정신 분열증(schizophrenia), 전두엽 간질(Forntal lobe epilepsy), 및 자폐증(autism)으로 구성된 군으로부터 선택된 어느 하나인 것을 특징으로 하는 집중력 장애 질병 예방 및 개선용 사료 첨가제.
제 19항에 있어서, 상기 T-타입 칼슘채널 억제제는 미베프라딜(mibefradil), 테트라메쓰린(tetramethrin), 에토숙시마이드(ethosuximide), 조니사미드(Zonisamide), 페이에니토인(Phyenytoin), SUN-N8075, 에포니디핀(efonidipine)과 Y3+, La3+, Ce3+, Nd3+,Gd3+,Ho3+,Er3+Yb3+ 로 구성되는 군으로부터 선택되는 3가 금속 이온, Ni2+, U-92032(7-[[4-[bis(4-fluorophenyl)methyl]-1-piperazinyl]methyl]-2-[(2-hydroxyethyl)amino]4-(1-methylethyl)-2,4,6-cycloheptatrien-1-one), 펜플루리돌(penfluridol), 플루스피릴렌(fluspirilene) 및 발프로에이트(valproate)로 이루어진 군으로부터 선택되는 어느 하나인 것을 특징으로 하는 집중력 장애 질병 예방 및 개선용 사료 첨가제.
제 19항에 있어서, 상기 T-타입 칼슘채널 억제제는 에토숙시마이드(ethosuximide)인 것을 특징으로 하는 집중력 장애 질병 예방 및 개선용 사료 첨가제.
제 1항의 마우스를 집중력 장애 치료제 스크리닝에 이용하는 용도.
T-타입 칼슘채널 억제제를 집중력 장애 질병 치료제의 제조에 이용하는 용도.
T-타입 칼슘채널 억제제를 집중력 장애 질병 개선용 건강식품의 제조에 이용하는 용도.
T-타입 칼슘채널 억제제를 집중력 장애 질병 개선용 사료 첨가제의 제조에 이용하는 용도.
제 23항 내지 제 25항 중 어느 한 항에 있어서, T-타입 칼슘채널 억제제는 미베프라딜(mibefradil), 테트라메쓰린(tetramethrin), 에토숙시마이드(ethosuximide), 조니사미드(Zonisamide), 페이에니토인(Phyenytoin), SUN-N8075, 에포니디핀(efonidipine)과 Y3+, La3+, Ce3+, Nd3+,Gd3+,Ho3+,Er3+Yb3+ 로 구성되는 군으로부터 선택되는 3가 금속 이온, Ni2+, U-92032(7-[[4-[bis(4-fluorophenyl)methyl]-1-piperazinyl]methyl]-2-[(2-hydroxyethyl)amino]4-(1-methylethyl)-2,4,6-cycloheptatrien-1-one), 펜플루리돌(penfluridol), 플루스피릴렌(fluspirilene) 및 발프로에이트(valproate)로 이루어진 군으로부터 선택되는 어느 하나인 것을 특징으로 하는 용도.
PCT/KR2011/000433 2010-08-13 2011-01-21 주의력 결핍 과잉 행동 모델 마우스，상기 모델 마우스를 이용한 집중력 장애 질병 예방 및 완화 효과 검증 방법，및 ｔ-타입 칼슘채널을 억제하여 집중력 장애를 치료하는 방법 WO2012020897A1 (ko)

Priority Applications (3)

Application Number Priority Date Filing Date Title
JP2013516490A JP5816686B2 (ja) 2010-08-13 2011-01-21 注意力欠陥・多動性障害モデルマウス、前記モデルマウスを用いた集中力障害の予防及び緩和効果の検証方法、及びｔ−タイプカルシウムチャンネルを抑制して集中力障害を治療する方法
EP11816513.3A EP2604109A4 (en) 2010-08-13 2011-01-21 MOUSE MODEL OF ATTENTION DEFICIT DISORDER WITH HYPERACTIVITY, METHOD OF INVESTIGATING THE EFFECTS OF PREVENTING AND REDUCING ATTENTION DISORDERS USING THE MOUSE MODEL, AND METHOD OF PROCESSING ATTENTION DISORDERS BY CHANNEL REMOVAL TYPE CALCIQUES
US13/805,717 US20130184321A1 (en) 2010-08-13 2011-01-21 Model Mouse of Attention Deficit Hyperactivity Disorder, Method for Investigating Effects for Preventing and Alleviating Attention Disorder using the Model Mouse, and Method for Treating Attention Disorder by Suppressing T-Type Calcium Channel

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020100078159A KR20120021694A (ko) 2010-08-13 2010-08-13 주의력 결핍 과잉 행동 모델 마우스, 상기 모델 마우스를 이용한 집중력 장애 질병 예방 및 완화 효과 검증 방법, 및 비특이적 ｔ?타입 칼슘 억제제를 함유하는 집중력 장애 질병 예방 및 치료용 조성물
KR10-2010-0078159 2010-08-13

Publications (1)

Publication Number Publication Date
WO2012020897A1 true WO2012020897A1 (ko) 2012-02-16

Family

ID=45567833

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2011/000433 WO2012020897A1 (ko) 2010-08-13 2011-01-21 주의력 결핍 과잉 행동 모델 마우스，상기 모델 마우스를 이용한 집중력 장애 질병 예방 및 완화 효과 검증 방법，및 ｔ-타입 칼슘채널을 억제하여 집중력 장애를 치료하는 방법

Country Status (5)

Country Link
US (1) US20130184321A1 (ko)
EP (1) EP2604109A4 (ko)
JP (1) JP5816686B2 (ko)
KR (1) KR20120021694A (ko)
WO (1) WO2012020897A1 (ko)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP4389126A1 (en) * 2021-08-20 2024-06-26 Dankook University Cheonan Campus Industry Academic Cooperation Foundation Pharmaceutical composition for preventing or treating attention deficit/hyperactivity disorder

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20060052428A1 (en) * 2001-08-08 2006-03-09 Chez Michael G Neurological functions
US20100087422A1 (en) * 2007-02-07 2010-04-08 Gosforth Centre (Holdings) Pty Ltd Treatment of adhd
KR100958291B1 (ko) 2008-01-23 2010-05-19 한국과학기술연구원 Ｔ―타입 칼슘채널을 억제하여 불안 장애를 치료하는 방법

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP3007974B2 (ja) * 1990-03-01 2000-02-14 ポーラ化成工業株式会社 てんかん関連物質
US20050251874A1 (en) * 2004-05-04 2005-11-10 Korea Institute Of Science And Technology Mice lacking alpha 1G showing enhanced novelty-seeking and alcohol preference and therapeutic methods for mood disorders by modulating alpha 1G T-type calcium channels
US7723562B2 (en) * 2004-05-04 2010-05-25 Korea Institute Of Science And Technology Mice lacking alpha 1G showing enhanced novelty-seeking and alcohol preference and therapeutic methods for mood disorders by modulating alpha 1G T-type calcium channels
JP5414012B2 (ja) * 2006-01-05 2014-02-12 独立行政法人産業技術総合研究所 変異ｂｄｎｆ遺伝子導入ノックインマウス

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20060052428A1 (en) * 2001-08-08 2006-03-09 Chez Michael G Neurological functions
US20100087422A1 (en) * 2007-02-07 2010-04-08 Gosforth Centre (Holdings) Pty Ltd Treatment of adhd
KR100958291B1 (ko) 2008-01-23 2010-05-19 한국과학기술연구원 Ｔ―타입 칼슘채널을 억제하여 불안 장애를 치료하는 방법

Non-Patent Citations (21)

* Cited by examiner, † Cited by third party
Title
"Goodman and Gilman's The Pharmacological Basis of Therapeutics", 2001, PERGAMON PRESS
"Merck Index", MERCK & CO. INC.
"Remington's Pharmaceutical Science", 1990, MACK PUBLISHING COMPANY
"Remington's Pharmaceutical Sciences", 1990, MACK PUBLISHING CO.
B. N. KIM ET AL., THE KOREAN JOURNAL OF NEUROKIATRIC ASSOCIATION, 2000
CHANG ET AL., EPILEPSY RESEARCH, 2004
DAVIDS ET AL., BRAIN RESEARCH REVIEWS, 2003
E. B. JOHANSEN; P. R. KILLEEN ET AL., BEHAV. BRAIN FUNCT., 2007, pages 3
E. Y. OH; I. HWANG ET AL., J. KOREAN SOC. BIOL. THER. PSYCHIATRI., 2003
G. D. KEWLEY, BRITISH MEDICAL JOURNAL, 1998
H. MANG; H. CHUNG, THE JOURNAL OF ELEMENTARY EDUCATION., 2005
HALLADAY ALYCIA K. ET AL.: "Animal models of autism spectrum disorders: Information for neurotoxicologists.", NEUROTOXICOLOGY., vol. 30, 2009, pages 811 - 821, XP026682418 *
J. B. SCHWEITZER; D. O. LEE ET AL., NEUROPSYCHOPHARMACOLOGY, 2003
JONES, COMPREHENSIVE PSYCHIATRY, 1965
L. B. SILVER: "Attention-deficit hyperactivity disorder", 1992, WASHINGTON, DC.: AMERICAN PSYCHIATRY PRESS, INC.
M. H. TEICHER; C. M. ANDERSON ET AL., NAT. MED., 2000
S. KIM; D. AHN; Y. LEE, J. KOREAN NEUROPSYCHIATR. ASSOC., vol. 4, 1998, pages 683 - 699
See also references of EP2604109A4
T. SAGVOLDEN; T. XU., BEHAV. BRAIN FUNCT., vol. 4, 2008
Y. B. LEE; J. S. SHIN, KOREAN JOURNAL OF FAMILY SOCIAL WORK, 2000
Y. FRANK; S. G. PAVLAKIS, PEDIATRIC NEUROLOGY., 2001

Also Published As

Publication number Publication date
JP2013531994A (ja) 2013-08-15
JP5816686B2 (ja) 2015-11-18
US20130184321A1 (en) 2013-07-18
EP2604109A1 (en) 2013-06-19
KR20120021694A (ko) 2012-03-09
EP2604109A4 (en) 2014-02-26

Similar Documents

Publication Publication Date Title
WO2017095138A1 (en) Curcumin-containing lipid nanoparticle complex comprising ginsenosides
WO2015160219A1 (ko) 피스타시아 웨인마니폴리아 추출물, 이의 분획물 또는 이로부터 분리된 화합물을 포함하는 만성폐쇄성 폐질환(copd) 예방 또는 치료용 약학적 조성물
WO2017123066A1 (ko) Pgc-1알파의 발현을 증가시키는 조성물
WO2022035115A1 (ko) 오리나무 추출물 또는 이로부터 분리된 화합물을 함유하는 골격근 근육관련 질환의 예방 및 치료용 조성물 및 이의 용도
WO2016108446A1 (ko) 락테이트 금속염을 포함하는 암 치료용 약학 조성물
WO2020106119A1 (en) Pharmaceutical composition comprising histone deacetylase 6 inhibitors
WO2012020897A1 (ko) 주의력 결핍 과잉 행동 모델 마우스，상기 모델 마우스를 이용한 집중력 장애 질병 예방 및 완화 효과 검증 방법，및 ｔ-타입 칼슘채널을 억제하여 집중력 장애를 치료하는 방법
WO2021107547A1 (ko) 호흡기 질환의 예방, 개선 또는 치료용 조성물
WO2019017677A9 (ko) 시트랄을 유효성분으로 함유하는 근력강화, 근육증강, 근육분화, 근육재생 또는 근감소증 억제효과를 갖는 조성물
WO2015102390A1 (ko) 신규한 아미드 유도체 또는 이의 약학적으로 허용가능한 염, 이의 제조방법 및 이를 포함하는 통증의 예방 또는 치료용 약학적 조성물
WO2012093787A2 (ko) 플로로글루시놀, 플로로탄닌 또는 갈조류 추출물을 포함하는 가바 ａ형-벤조다이아제핀 수용체 활성용 조성물 및 불안 완화, 경련 개선, 진정 작용, 및 수면 유도 및 개선용 조성물
WO2018008803A1 (ko) 세스퀴테르펜 유도체의 신규한 용도
WO2021206455A1 (ko) 멜리사엽 분획 추출물 및 이를 포함하는 신규한 약학적 조성물
WO2019027239A2 (ko) 탈모 방지 또는 발모 촉진용 조성물
WO2020197332A1 (ko) 봉독 추출물을 유효성분으로 함유하는 신경염증 질환 예방 또는 치료용 조성물
WO2015046743A1 (ko) 댕댕이나무 열매 추출물을 유효성분으로 포함하는 갑상선 질환의 예방 또는 치료용 약학적 조성물
WO2021230710A1 (ko) 신규 ido/tdo 억제제, 그의 항암 용도, 그의 항암 병용 요법
WO2019172566A1 (ko) 이오논을 유효성분으로 함유하는 항스트레스제, 항우울제 또는 항불안제 조성물
WO2023244051A1 (ko) 넉줄고사리 추출물을 유효성분으로 포함하는 퇴행성 신경질환 예방 또는 치료용 조성물
WO2019245347A2 (ko) 신경퇴행성 질환 예방 또는 치료용 조성물
WO2018070819A1 (ko) 시클레소나이드를 포함하는, 암 줄기세포 성장 억제용 조성물
WO2022231257A1 (ko) 옥시라세탐을 포함하는 근육질환 예방 또는 치료용 조성물
WO2017200194A2 (ko) 디아세틸을 포함하는, 암 줄기세포 성장 억제용 조성물
WO2019017676A9 (ko) 에틸바닐린을 유효성분으로 함유하는 근력강화, 근육증강, 근육분화, 근육재생 또는 근감소증 억제효과를 갖는 조성물
WO2017192013A1 (ko) 팥을 포함하는 근 기능 개선 또는 운동수행능력 향상용 조성물

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 11816513

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 13805717

Country of ref document: US

WWE Wipo information: entry into national phase

Ref document number: 2011816513

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 2013516490

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE