WO2012008748A2 - 지오바실러스 써모디니트리피칸스 유래 만노스-6-인산 이성화효소의 변이체 및 이를 이용한 엘-리보스 생산방법 - Google Patents

지오바실러스 써모디니트리피칸스 유래 만노스-6-인산 이성화효소의 변이체 및 이를 이용한 엘-리보스 생산방법 Download PDF

Info

Publication number
WO2012008748A2
WO2012008748A2 PCT/KR2011/005149 KR2011005149W WO2012008748A2 WO 2012008748 A2 WO2012008748 A2 WO 2012008748A2 KR 2011005149 W KR2011005149 W KR 2011005149W WO 2012008748 A2 WO2012008748 A2 WO 2012008748A2
Authority
WO
WIPO (PCT)
Prior art keywords
mannose
phosphate isomerase
seq
ribose
mutant
Prior art date
Application number
PCT/KR2011/005149
Other languages
English (en)
French (fr)
Other versions
WO2012008748A9 (ko
WO2012008748A3 (ko
Inventor
오덕근
염수진
Original Assignee
건국대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from KR1020100067901A external-priority patent/KR101063961B1/ko
Priority claimed from KR1020100103592A external-priority patent/KR101155507B1/ko
Priority claimed from KR1020110049206A external-priority patent/KR101282998B1/ko
Application filed by 건국대학교 산학협력단 filed Critical 건국대학교 산학협력단
Publication of WO2012008748A2 publication Critical patent/WO2012008748A2/ko
Publication of WO2012008748A9 publication Critical patent/WO2012008748A9/ko
Publication of WO2012008748A3 publication Critical patent/WO2012008748A3/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/90—Isomerases (5.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P19/00—Preparation of compounds containing saccharide radicals
    • C12P19/02—Monosaccharides
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P19/00—Preparation of compounds containing saccharide radicals
    • C12P19/24—Preparation of compounds containing saccharide radicals produced by the action of an isomerase, e.g. fructose

Definitions

  • the present invention relates to a method for producing L-ribose by enzymatic reaction, more specifically, mannose-6-phosphate isomerase derived from Geobacillus thermodenitrificans (mannose-6-phosphate isomerase) 6-phosphate isomerase) and a recombinant expression vector comprising the corresponding gene, a microorganism transformed therewith and a method for producing the mutant in large quantities using them and a mutant of the mannose-6-phosphate isomerase. It relates to a production method to obtain a high yield of el-ribose using.
  • L-ribose is the starting material for the synthesis of sugars of many L-type nucleic acids, and is used for the synthesis of antiviral methyl-L-riboflanoside ("Bezimidavir" TM ).
  • BW1263W94 non-double oil 1263 double oil 94
  • Glaxo Wellcome non-hepatitis B drug
  • L-ribose has been produced by chemical synthesis mainly from L-arabinose, L-xylose, di-glucose, di-galactose, di-ribose or di-manno-1,4-lactone (Akagi, M., et. al., Chem. Pharm. Bull. (Tokyo) 50: 866, 2002; Takahashi, H., et al., Org. Lett. 4: 2401, 2002; Yun, M., et al., Tetrahedron Lett. 46 : 5903, 2005).
  • chemical synthesis methods have several serious problems in their production process. Indeed, there are risks in the working environment that require high temperatures and pressures, complex el-ribose separation and purification due to the formation of additional sugars after chemical reactions, and environmental pollution from the chemical waste produced in this process.
  • El-biological production research method is keulribiji Ella pneumoniae (Klebsiella pneumonia) derived arabinose isomerase, Pseudomonas shoe Cherry (Pseudomonas stutzeri) derived from rhamnose isomerase (L-rhamnose isomerase) of ribose, Streptomyces Ruby Geonosis (Streptomyces rubiginosus) derived from xylose isomerase (D-xylose isomease) and Lactococcus lactis Cocos (Lactococcus lactis) derived from galactose-6-phosphate isomerase, but using the enzyme (galactose-6-phosphate isomerase) , the enzyme They have a broad substrate specificity that can convert El-Riblos to El-Ribose, but their conversion is very slow.
  • mannose-6-phosphate isomerase derived from Bacillus subtilis Yeom SJ, et al. , Appl. Environ.Microbiol. 75: 4705, 2009.
  • mannose-6-phosphate isomerase derived from Bacillus subtilis is an enzyme derived from mesophilic bacteria and has a limitation in dissolving a large amount of substrate because of low thermal stability and low reaction temperature. Therefore, in order to overcome this, it is urgent to develop economical biological methods that have high L-ribose productivity, high thermal stability, and overcome the limitations of substrate solubility.
  • the present invention solves the above problems and the object of the present invention is to provide a mutant of the novel mannose-6-phosphate isomerase.
  • Still another object of the present invention is to provide a method of preparing a mutant of the mannose-6-phosphate isomerase.
  • Another object of the present invention is to provide a method for producing high yield of el-ribose.
  • the present invention provides a) amino acids of residues 21, 74 and 134 of mannose 6-phosphate isomerase as set forth in SEQ ID NO: 1, lysine (K) and aspa, respectively. Mutants which are converted to glutamic acid (E), threonine (T), and arginine (R) from razine (N) and methionine (M), respectively;
  • e a mutant obtained by converting the amino acid of residue 129 of mannose 6-phosphate isomerase described in SEQ ID NO: 1 from leucine (L) to phenylalanine (F) or tyrosine (Y);
  • the present invention also provides a gene encoding the mannose 6-phosphate isomerase mutant of the present invention.
  • the gene encoding the mutant mannose 6-phosphate isomerase of the present invention is preferably one of the genes having the nucleotide sequence set forth in SEQ ID NO: 2 to SEQ ID NO: 11, but is not limited thereto.
  • the present invention also provides a recombinant expression vector comprising the mannose 6-phosphate isomerase gene of the present invention.
  • the recombinant expression vector preferably has a cleavage map described in Figure 8 is not limited thereto.
  • the present invention a) preparing an expression vector comprising the gene of the present invention
  • the present invention also provides a method for producing ribose using the mannose 6-phosphate isomerase mutant of the present invention.
  • the ribose is L-ribose (L-ribose), preferably produced using L-ribulose (L-ribulose) as a substrate, but is not limited thereto.
  • the present invention also provides a composition for producing ribose comprising the mannose 6-phosphate isomerase mutant of the present invention.
  • the mannose-6-phosphate isomerase mutant of the present invention is characterized in that a specific residue of the amino acid sequence represented by SEQ ID NO: 1 has a modified amino acid sequence.
  • the present invention includes a mannose 6-phosphate isomerase gene encoding one of the mutants of the present invention, and examples thereof include those represented by one of SEQ ID NOs: 2 to 12.
  • the present invention also includes a recombinant vector containing the mannose-6-phosphate isomerase gene and a transformant transformed with the recombinant vector.
  • the present invention also includes a method for producing a mannose-6-phosphate isomerase mutant, wherein the transformant is cultured to separate mannose-6-phosphate isomerase from the culture obtained.
  • the mannose-6-phosphate isomerase gene of the present invention is isolated from the Geobacillus thermodinititripicans strain.
  • chromosomal DNA is obtained from a strain of Geobacillus thermodinitiripykans with mannose-6-phosphate isomerase gene.
  • PCR polymerase chain reaction
  • the PCR amplified fragment thus obtained was a fragment having a homology close to 100% to the mannose-6-phosphate isomerase gene of the Geobacillus thermodinititricans strain, and was highly probed as a probe for colony hybridization. While expecting a / N ratio, it also facilitates stringency control of hybridization.
  • the PCR amplification fragments are labeled with appropriate reagents, and colony hybridization is performed on the chromosomal DNA library to select mannose-6-phosphate isomerase genes (Current Protocols in Molecular Biology, Vol. 1, p. 603). , 1994).
  • the DNA fragment containing the mannose-6-phosphate isomerase gene was obtained by recovering the plasmid from the E. coli selected by the above method using alkaline method (Current Protocols in Molecular Biology, Vol. 1, p. 161, 1994). Can be. After determining the nucleotide sequence by the above method, it is possible to obtain the entire gene of the present invention by hybridizing the DNA fragment prepared by digestion by restriction enzymes of the DNA fragment having the nucleotide sequence as a probe.
  • the transformed microorganism of the present invention is obtained by introducing the recombinant vector of the present invention into a host suitable for the expression vector used when producing the recombinant vector.
  • a host suitable for the expression vector used when producing the recombinant vector for example, when a bacterium such as E. coli is used as a host, the recombinant vector according to the present invention is capable of autonomous replication in the host, and at the same time, a DNA containing a promoter, mannose-6-phosphate isomerase gene, and transcription. It is preferable to have a structure required for expression of the termination sequence.
  • pTRC 99a was used as an expression vector used in the present invention, any expression vector satisfying the above requirements can be used.
  • Production of the mannose-6-phosphate isomerase mutant comprises culturing a transformant obtained by transforming a host with a recombinant vector having a gene encoding the same, and culturing the transformant into a culture (cultured cell or culture supernatant). It is performed by generating and accumulating mannose-6-phosphate isomerase, which is a gene product, and acquiring the enzyme from the culture.
  • Acquisition and purification of the mannose-6-phosphate isomerase of the present invention is carried out by centrifuging the cells or supernatants from the cultures obtained, followed by cell disruption, affinity chromatography, cation or anion exchange chromatography, or the like. It can carry out by combining.
  • Gio Bacillus Thermo di NITRY pecan switch (Geobacillus thermodenitrificans) mannose-6-phosphate isomerase from the fungus mutant high yield of the EL-can produce the ribose, the EL-ribose is different El
  • Gio Bacillus Thermo di NITRY pecan switch Giobacillus thermodenitrificans mannose-6-phosphate isomerase from the fungus mutant high yield of the EL-can produce the ribose
  • the EL-ribose is different El
  • El As a synthetic starting material it can be usefully used in the manufacture of pharmaceuticals.
  • Figure 1 shows the comparison of the enzyme activity according to the inorganic salt type of mannose-6-phosphate isomerase of the present invention.
  • Figure 2 shows the comparison of the enzyme activity according to the concentration of the optimum inorganic salt of mannose-6-phosphate isomerase of the present invention.
  • Figure 3 shows the comparison of the enzyme activity according to the pH of the mannose-6-phosphate isomerase of the present invention.
  • Figure 4 compares the enzyme activity according to the temperature of the mannose-6-phosphate isomerase of the present invention.
  • Figure 5 shows the stability measurement results according to the temperature of the mannose-6-phosphate isomerase of the present invention.
  • Figure 6 shows the amount of ribose production by mannose-6-phosphate isomerase of the present invention at a substrate concentration of 300g / l.
  • Figure 7-11 shows mutant 1 (8), Mutant 2 (9), Mutant 3 (10), Mutant 4 (Table 1) of the mannose-6-phosphate isomerase of the present invention (Fig. 7) and the mutant enzymes of the enzyme 11 shows the gene sequence.
  • FIG. 13-14 show the relative activity of the point mutants compared to the wild type of amino acid residues 90 (FIG. 13) and 129 (FIG. 14) substitution point mutants.
  • Figure 15 shows the relative activity of amino acids residues 90 and 129 of the mannose-6-phosphate isomerase of the present invention compared to the wild type of single and double mutant enzymes.
  • Figure 16 shows the comparison of the enzyme activity obtained by screening for the preparation of the variant mannose-6-phosphate isomerase of the present invention.
  • 17-20 show the activity of residues obtained by performing point mutations for the preparation of the variant mannose-6-phosphate isomerase of the present invention.
  • Figure 21 shows the comparison of the enzyme activity according to the metal ions of the variant mannose-6-phosphate isomerase of the present invention.
  • FIG. 22-23 show the comparison of enzyme activity according to pH (FIG. 22) and temperature (FIG. 23) of the variant mannose-6-phosphate isomerase of the present invention.
  • Figure 24 shows the results of measuring the stability according to the temperature of the variant mannose-6-phosphate isomerase of the present invention.
  • Figure 25 shows the kinetics of the variant mannose-6-phosphate isomerase of the present invention.
  • Figure 26 shows the production of L-ribose according to the variant mannose-6-phosphate isomerase of the present invention.
  • Mannose-6-phosphate for the production of isomerase and separating the geo Bacillus Thermo di NITRY pecan's one mannose-6-phosphate isomerase derived from (Geobacillus thermodenitrificans) strains before.
  • SEQ ID NO: 12 (Forward primer): 5'-TTT GAATTC ATGCATCAAGAACCGATTTTTC-3 '
  • SEQ ID NO: 13 (Reverse primer): 5'-TTT AAGCTT TTATTTGCTTGTCCGTGG-3 '
  • the primers of the mannose-6-phosphate isomerase gene were designed with EcoR I and Hind III restriction enzyme cleavage portions. PCR was performed using the primers to amplify the nucleotide sequence of the gene. A large amount of mannose-6-phosphate isomerase gene was inserted into the plasmid vector pTRC 99a (Novagen) using each restriction enzyme to prepare pTRC 99a / mannose-6-phosphate isomerase.
  • the recombinant expression vector thus obtained was transformed into E. coli ER 2566 strain (NEB) by a conventional transformation method.
  • the transformed microorganism was stored frozen before the culture for the production of ribose by adding a 20% glycerin (glycerine) solution.
  • the recombinant E. coli ER 2566 strain prepared in Example 1 was inoculated into a test tube containing 3 ml of LB medium and absorbed at 600 nm.
  • the spawn culture was performed with a shake incubator at 37 ° C. until 2.0.
  • the seed cultured culture was then added to a 2,000 ml flask containing 500 ml of LB medium to carry out the main culture.
  • 0.1 mM IPTG was added to induce mass expression of mannose 6-phosphate isomerase.
  • the stirring speed during the process was adjusted to 200 rpm, the culture temperature was maintained at 37 °C, and after incubating for 5 hours under the same conditions after adding IPtage (IPTG).
  • IPTG IPtage
  • the mannose-6-phosphate isomerase produced as overexpressed as described above was centrifuged at 6,000 ⁇ g for 30 minutes at 6,000 ⁇ g, and washed twice with 0.85% sodium chloride (NaCl).
  • the cell solution was then disrupted with an ultrasonic sonicator by adding 50 mM Tris-hydrogen chloride buffer and 0.1 mM protease inhibitor (phenylmethylsulfonyl fluoride).
  • the cell lysate was heat-treated at 65 ° C. for 10 minutes, and then centrifuged at 13,000 ⁇ g for 20 minutes at 4 ° C., cell pellets were removed, and only cell supernatant was obtained to obtain a fast protein liquid chromatography system. Rad Laboratories, Hercules, Calif., USA) was equipped with an anion resin Hi Trap TM HP adsorption column and separated as an enzyme solution used for the production of L-ribose.
  • the enzyme activity was treated with 10 mM EDTA and the metal ions (Mn 2+ , Zn 2+ , Ba 2+ , Cu 2+). , Co 2+ , Ca 2+ , Mg 2+ , Ni 2+ , Fe 2+ ) were added to the reaction and the activity was measured as follows.
  • the enzyme reaction was 10 mM L-ribuloose, 50 mM PIPES (piperazine- N , N' -bis (2-ethane sulfonic acid) buffer containing pH 7.0), each metal ion and 2 unit / ml enzyme.
  • the reaction was carried out at 70 ° C. for 10 minutes, and the reaction was stopped again by adding a final concentration of 200 mM hydrogen chloride.
  • Enzyme activity was measured using L-ribulose as a substrate, and the enzyme activity of 1 unit of enzyme activity was defined as the amount of 1 nmole per minute to produce L-ribose per minute at pH 7.0 and 70 °C was compared.
  • the analysis of L-ribose and L-ribulose concentrations and other sugars in the measurement of enzyme activity was carried out using a bio liquid chromatography (Bio-) equipped with an electrochemical detector and a CarboPacPA column. LC) system (Dionex ICS-3000, Sunnylvale, CA). At this time, the CarboPacPA column was allowed to pass 200 mM sodium hydroxide at a rate of 1 ml / min at 30 °C.
  • mannose 6-phosphate isomerase The activity of mannose 6-phosphate isomerase on metal ions is shown in FIG. 1, respectively.
  • the optimal concentration of metal salts for mannose 6-phosphate isomerase is shown in FIG. 2.
  • Example 2 The activity of the mannose-6-phosphate isomerase isolated in Example 2 was changed according to pH and temperature. Enzymes and substrates were reacted under various pH and temperature conditions and enzyme activities were compared.
  • enzyme reaction was carried out in the range of pH 6.5 to 8.5 using 50 mM EPPS buffer containing 10 mM L-ribulose, 1 mM cobalt, 2 unit / ml enzyme as substrate.
  • the enzymatic reaction was performed at 70 ° C. for 10 minutes and the reaction was stopped again by adding a final concentration of 200 mM hydrogen chloride.
  • the optimum pH was found to be 7.0.
  • the enzymatic reaction was carried out in a 50 mM PIPES buffer at pH 7.0 containing 10 mM L-ribulose, 1 mM cobalt and 2 unit / ml enzyme, ranging from 55 ° C. to 80 ° C. The reaction was carried out for 10 minutes each. The reaction was then stopped by adding a final concentration of 200 mM hydrogen chloride.
  • Figure 5 shows the results of measuring the temperature stability of the mannose-6-phosphate isomerase of the present invention.
  • temperature notation is represented by 60 ° C ( ⁇ ), 65 ° C ( ⁇ ), 70 ° C ( ⁇ ), 75 ° C ( ⁇ ) and 80 ° C ( ⁇ ), respectively.
  • the enzyme activity is reduced by half at 338 hours at 65 °C, 73 hours at 65 °C, 27 hours at 70 °C, 17 hours at 75 °C, 6.2 hours at 80 °C I could confirm it.
  • Bacillus Thermo di to NITRY pecan switch (Geobacillus thermodenitrificans) used to develop a method for producing a mannose 6-phosphate isomerase ribose derived from the strain, the optimum pH 7.0 and the enzyme activity of the enzyme determined in said reduced by half The hourly yield of ribose was measured with 300 g / L ribulose at time-considered temperature (70 ° C.).
  • Bacillus subtilis and Geobacillus thermodinitripicans (Geobacillus-derived mannose-6-phosphate isomerase, respectively, showed 71 g / l and 85.2 g / l, respectively. (Yoem et al., Appl. Environ. Microbiol. 2009. 75: 4705-4710).
  • Bacillus Thermo di NITRY pecan switch (Geobacillus thermodenitrificans) PCR mutagenesis kit ( ClonTech Laboratories, Palo Alto. CA, USA) is random in a mannose-6-phosphate isomerase derived from a strain to mutagenic (Random mutagenesis) PTrc99a / mannose-6-phosphate isomerase mutant vector was prepared.
  • the recombinant expression vector thus obtained was transformed into E. coli ER 2566 strain by a conventional transformation method.
  • the transformed microorganism was stored frozen before the culture for the production of ribose by adding a 20% glycerin (glycerine) solution.
  • Bacillus Thermo di NITRY pecan switch (Geobacillus thermodenitrificans) In order to mass-produce a mannose-6-phosphate isomerase mutant derived from the strain, produced in Example 5, and stored frozen The recombinant E. coli strain ER 2566 to LB The seed was inoculated into a test tube containing 3 ml of medium, and the seed culture was performed with a shake incubator at 37 ° C. until absorbance was 2.0 at 600 nm. The seed cultured culture was then added to a 2,000 ml flask containing 500 ml of LB medium to carry out the main culture.
  • the mannose-6-phosphate isomerase mutant produced by overexpression as described above was centrifuged at 6,000 ⁇ g for 30 minutes at 6,000 ⁇ g, and twice with 0.85% sodium chloride (NaCl). After washing, the cell solution was crushed with a sonicator by adding 50 mM PIPES (pH 7.0) buffer solution and 0.1 mM protease inhibitor (phenylmethylsulfonyl fluoride). The cell lysate was heat-treated at 70 ° C. for 10 minutes and then again centrifuged at 13,000 ⁇ g at 4 ° C. for 20 minutes, cell pellets were removed, and only cell supernatant was obtained to obtain a fast protein liquid chromatography system. Rad Laboratories, Hercules, Calif., USA) was equipped with an anion resin Hi Trap TM HP adsorption column and separated as an enzyme solution used for the production of L-ribose.
  • PIPES pH 7.0
  • protease inhibitor phenylmethyl
  • Example 8 Determination of the activity of mannose-6-phosphate isomerase mutant against el-ribulose
  • Bacillus Thermo di NITRY pecan switch (Geobacillus thermodenitrificans) derived from a strain mannose-6-phosphate isomerase and El of the mutant-enzyme activity for the re-fire agarose was carried out the measurement and the comparison experiments.
  • the enzymatic reaction was performed for 5 minutes at 70 ° C. using 50 mM PIPES buffer solution (pH 7.0) containing 10 mM ribulose, 1 mM Co 2+ metal ions, followed by addition of 200 mM hydrogen chloride. The reaction was stopped.
  • the enzyme activity was measured using L-ribulose as a substrate, and the enzyme activity of 1 unit (unit) of the enzyme activity was defined as the amount to produce 1 nmole of ribose per minute at pH 7.0 and 70 °C, comparative analysis It was smooth.
  • Table 1 shows the enzymatic activity of mannose-6-phosphate isomerase and mutant enzymes against el-ribulose.
  • the two most active residues were screened by screening mannose 6-phosphate isomerase derived from the strain of Geobacillus thermodenitrificans. The residues with the highest activity were selected by substitution with different amino acids.
  • N90 residue and the L129 residue are converted into amino acids having different properties, and then point mutations are performed with the following N90A, N90D, N90E, N90H, N90K, N90L, N90Y, L129A, L129F, L129H, L129W, and L129Y.
  • the activity test was compared with mannose-6-phosphate isomerase derived from wild type Geobacillus thermodinitripicans strain.
  • the screening test of this experiment was performed by ketose assay using error prone PCR using Clontech Diversify PCR Random Mutagenesis Kit.
  • the resulting mutants were converted to one residue each using a QuikChange II Site-Directed Mutagenesis Kit from Stratagene, replaced with another amino acid, or subjected to two mutations.
  • the activity was compared to the reaction with the existing MPi.
  • the reaction was performed with 10 mmol / L L-ribulose with 0.5 mg / ml of enzyme containing co-factor 1 mM Co 2+ in 50 mmole / L PIPES buffer.
  • the reaction was carried out at 70 ° C. for 10 minutes, and specific activity was measured and compared (see FIGS. 13 and 14).
  • doble mutations of N90A and L129F together confirmed higher activity (see FIG. 15).
  • Mannose-6-phosphate for the production of isomerase and separating the geo Bacillus Thermo di NITRY pecan's one mannose-6-phosphate isomerase derived from (Geobacillus thermodenitrificans) strains before.
  • a strain of Geobacilli thermodinitripicans having a gene sequence and an amino acid sequence is already selected (Dae-Heoun Baek, Yujin Lee, Hong-Sig Sin, and Deok-Kun (2004) J Microbiol.Biotechnol . 14: 312-316), and as a mannose -6- DNA base sequence of the well-known phosphate isomerase (Genebank Accession Number CP000557) derived therefrom based on the following primers were designed (primer).
  • Mannose-6-phosphate isomerase SEQ ID NO: 14 forward primers:
  • Mannose-6-phosphate isomerase SEQ ID NO: 15 (reverse primer):
  • the primers of the mannose-6-phosphate isomerase gene were designed to cleave Nde I and EcoR I restriction enzymes. PCR was performed using the primers to amplify the nucleotide sequence of the gene. A large amount of mannose-6-phosphate isomerase gene was inserted into plasmid vector pET 28a (Novagen) using each restriction enzyme to prepare pET 28a / mannose-6-phosphate isomerase.
  • the recombinant expression vector thus obtained was transformed into E. coli ER 2566 strain by a conventional transformation method.
  • the transformed microorganism was stored frozen before the culture for the production of ribose by adding a 20% glycerin (glycerine) solution.
  • mannose-6-phosphate isomerase In order to make another variant of mannose-6-phosphate isomerase, the above-described pET 28a / mannose-6-phosphate isomerase was subjected to error prone using Clontech Diversify PCR random mutagenesis kit. PCR was used to give about 2-3 mutations. The mutated PCR product was transformed into E. coli ER 2566. Colonies mutated for the first screening were incubated in LB at 500 rpm for 12 hours at 37 ° C, then incubated with IPTG for 10 hours at 500 rpm at 37 ° C.
  • the cultured colony was reacted for 30 minutes at 70 ° C using 10mM L-ribulose, followed by Ketose assay using 70% sulfuric acid, L-cystein and carbazole. Screened. Second screening was performed to reselect the colonies of approximately 50 strains obtained through the primary screening.
  • Second screening was carried out to confirm the reaction of only 50 strains of enzyme. Incubate at 37 ° C in LB and induction at 37 ° C using 0.1mM IPTG when cell OD is 0.6. Then, crude enzyme was extracted under 50 mM pipese (piperazine-N, N′-bis (2-ethanesulfonic acid); PIPES) pH 7.0 buffer condition, and the enzyme was stabilized by randomly adding 1 mM Co 2+ to the enzyme. After partial heat treatment at 70 ° C. for 10 minutes to remove enzymes derived from E. coli .
  • pipese piperazine-N, N′-bis (2-ethanesulfonic acid); PIPES
  • the mutated residues were prepared by using QuickChange's site directed mutagenesis kit (Stratagene; SDM), and each one of the point mutations was made.
  • the residues with increased residue activity were selected by comparing the activity of the prepared point variants with wild. 16 shows the result of increasing activity in nine residues of W17R, K21E, E67G, N74T, N90D, K105R, K124R, L129F, R142C, and T238I and above, among which the titer is 1.5 times or more in W17R, N90D, and L129F. It confirmed that it increased.
  • the point mutations prepared by making point mutations were compared with wild to further select residues with increased residue activity.
  • the activity of the triple mutant induced a mutant to the residues of three previously selected variants, W17R, N90D, and L129F, and the quadruple mutant which additionally changed R193A to the triple mutant. It was confirmed that the highest increase.
  • the recombinant E. coli ER 2566 strain prepared in Example 10 or below was inoculated into a test tube containing 3 ml of LB medium and inoculated at 600 nm.
  • the spawn cultivation was performed by shaking incubator at 37 degreeC until absorbance became 2.0.
  • the seed cultured culture was then added to a 2,000 ml flask containing 500 ml of LB medium to carry out the main culture.
  • mannose-6-phosphate isomerase produced as overexpressed as described above was centrifuged at 6,000 ⁇ g for 30 minutes at 6,000 ⁇ g, and washed twice with 0.85% sodium chloride (NaCl).
  • 50 mM pipes buffer solution and 0.1 mM protease inhibitor phenylmethylsulfonyl fluoride
  • the cell lysate was heat-treated at 65 ° C. for 10 minutes, and then centrifuged at 13,000 ⁇ g for 20 minutes at 4 ° C., cell pellets were removed, and only cell supernatant was obtained to obtain a fast protein liquid chromatography system. Rad Laboratories, Hercules, Calif., USA) was equipped with an affinity resin, His Trap TM HP adsorption column, and separated as an enzyme solution used for the production of L-ribose.
  • the enzyme activity prepared in Example 11 was treated with 10 mM EDTA and reacted by adding metal ions (Mn 2+ , Co 2+ ) as follows. Was measured. The enzymatic reaction was performed at 70 ° C. for 10 minutes using 10 mM L-ribulose, 50 mM pipes buffer (pH 7.0) containing each metal ion and 2 unit / ml enzyme, followed by a final concentration of 200 The reaction was stopped by addition of mM hydrogen chloride.
  • metal ions Mn 2+ , Co 2+
  • Enzyme activity was measured using El-ribulose as a substrate, and the enzyme activity of 1 unit of the enzyme activity was defined as comparatively defined as the amount of producing 1 ⁇ ole of el-ribose per minute at pH 7.0 and 70 °C.
  • the analysis of El-ribose and El-ribulose concentrations in the measurement of enzyme activity was carried out using a bio-liquid chromatography (Bio-LC) system (Dionex) equipped with an electrochemical detector and a CarboPacPA column. ICS-3000, Sunnylvale, CA). At this time, the CarboPacPA column was allowed to pass 200 mM sodium hydroxide at a rate of 1 ml / min at 30 °C.
  • the cobalt (Co 2+ ) in the ribose isomerization by the variant mannose-6-phosphate isomerase derived from Geobacillus thermodenitrificans among the tested metal salts It was the most effective. According to the concentration tests, the optimal concentration of all metal salts was 1 mM.
  • the variant mannose-6-phosphate isomerase was shown to be affected by 1 mM cobalt metal ions, confirming that the mannose 6-phosphate isomerase of the present invention is an enzyme dependent on metal ions.
  • Example 10 The activity according to pH and temperature change of the mutant mannose-6-phosphate isomerase isolated from Example 10 or below was confirmed as follows. Enzymes and substrates were reacted under various pH and temperature conditions and enzyme activities were compared.
  • the variant mannose-6-phosphate isomerase was used as a substrate using 50 mM pipes buffer containing 10 mM L-ribulose, 1 mM cobalt, 2 unit / ml enzyme. Enzymatic reactions were carried out from pH 6.5 to 8.5. Specifically, the enzymatic reaction was performed at 70 ° C. for 10 minutes and the reaction was stopped again by adding a final concentration of 200 mM hydrogen chloride. As a result, as shown in Figure 22, the optimum pH was found that the variant mannose-6-phosphate isomerase is 7.0.
  • each enzyme reaction was carried out at a temperature ranging from 55 ° C. to 80 ° C. in which the mutant mannose-6-phosphate isomerase had a pH of 10 mM ribulose, 1 mM cobalt and 2 unit / ml enzyme.
  • the reaction was performed for 10 minutes using 50 mM PIPES buffer solution, 7.0.
  • the reaction was then stopped by adding a final concentration of 200 mM hydrogen chloride.
  • the optimum temperature was found to be 70 °C for both enzymes.
  • Figure 22 shows by examining the enzyme activity according to the pH of the variant mannose-6-phosphate isomerase of the present invention.
  • Figure 23 shows the enzyme activity according to the temperature of the variant mannose-6-phosphate isomerase of the present invention.
  • Figure 24 shows the results of measuring the temperature stability of the variant mannose-6-phosphate isomerase of the present invention.
  • temperature notation is represented as 60 ° C., 65 ° C., 70 ° C., 75 ° C., and 80 ° C., respectively.
  • FIG. 26 is a graph showing the production of el-ribose by the variant mannose-6-phosphate isomerase of the present invention at El-ribulose at a concentration of 1.8 g / L as substrate, reaction 2 from 1.8 g / L L-ribulose. After time, 1.26 g / L ribose was obtained, indicating about 70% conversion yield. Therefore, it was confirmed that the production of 1.26 g / L of L-ribose in 2 hours.
  • the el-ribose production method according to the present invention is much more than the conventional fermentation and chemical synthesis methods in terms of productivity, production concentration and ease of purification. This is a good result.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

본 발명은 신규한 만노스-6-인산 이성화효소(mannose 6-phosphate isomerase) 돌연변이체 효소 및 그 효소를 이용한 엘-리보스를 제조하는 방법에 관한 것으로, 더욱 상세하게는 만노스-6-인산 이성화효소 돌연변이체 효소 그리고 그 해당 유전자를 포함하는 재조합 발현 벡터, 이로 형질전환된 미생물 및 이들을 이용하여 만노스-6-인산 이성화효소 돌연변이체를 대량으로 얻는 제조방법과 상기 만노스-6-인산 이성화효소 돌연변이체를 이용하여 엘-리보스를 고수율로 얻는 생산방법에 관한 것이다.

Description

지오바실러스 써모디니트리피칸스 유래 만노스-6-인산 이성화효소의 변이체 및 이를 이용한 엘-리보스 생산방법
본 발명은 효소반응에 의한 엘-리보스(L-ribose)를 생산하는 방법에 관한 것으로, 더욱 상세하게는 지오바실러스 써모디니트리피칸스 (Geobacillus thermodenitrificans)유래의 만노스-6-인산 이성화효소(mannose 6-phosphate isomerase)의 변이 효소 그리고 그 해당 유전자를 포함하는 재조합 발현 벡터, 이로 형질전환된 미생물 및 이들을 이용하여 그 돌연변이체를 대량으로 얻는 제조방법과 상기 만노스-6-인산 이성화효소의 돌연변이체를 이용하여 엘-리보스를 고수율로 얻는 생산방법에 관한 것이다.
엘-리보스(L-ribose)는 많은 엘-형태의 핵산당 의약품들의 합성 시작물질로서 항바이러스제인 메틸-엘-리보플라노사이드(methyl-L-riboflanoside; "Bezimidavir"TM) 등의 합성에 사용되어 엘-리보스 및 그 유도체의 세계시장은 2001년 약 11억불이었고, 최근에는 새로운 항포진제(Antiherpes)로 개발되고 있는 비더블유1263더블유94 (BW1263W94, Glaxo Wellcome)와 비(B)형간염 치료제로 개발되고 있는 엘-에프엠에이유(L-FMAU, Bukwang & Triangle) 등의 핵심중간체로서 그 수요가 급증하고 있어, 산업적으로 이용 가능한 그의 제조방법을 개발하는 것은 동 분야 많은 연구진들의 관심의 대상이다.
엘-리보스는 주로 엘-아라비노스, 엘-자일로스, 디-글루코스, 디-갈락토스, 디-리보스 또는 디-만노-1,4-락톤으로부터 화학 합성법으로 생산되어 왔다(Akagi, M., et al., Chem. Pharm. Bull.(Tokyo) 50:866, 2002; Takahashi, H., et al., Org. Lett. 4:2401, 2002; Yun, M., et al., Tetrahedron Lett. 46:5903, 2005). 그러나 화학적 합성 방법은 그 생산 과정에 있어 여러 가지 심각한 문제점을 가진다. 실제로 고온 및 고압을 요구하는 작업 환경상의 위험성, 화학 반응 후 부가적인 당류의 생성으로 인한 복잡한 엘-리보스의 분리 및 정제 과정 그리고 이 과정에서 생성되는 화학적 폐기물로 인한 환경오염 문제 등이 유발되고 있다.
상기와 같은 단점을 극복하기 위하여, 최근에는 리비톨 또는 엘-리불로오스로부터 생물학적 엘-리보스를 제조하는 방법이 연구되고 있다.
또한, 엔에이디-의존적인 만니톨-1-탈수소효소(NAD-dependent mannitol-1-dehydrogenase)를 포함하는 재조합 대장균을 사용하여 100g/l 리비톨로부터 발효 72시간 만에 55% 전환 수율을 얻었지만 엘-리보스의 생산성은 엘-아라비노스로부터 만드는 화학 합성법보다 약 28배가 낮았다(Woodyer R. N., et al., Appl. Environ. Microbiol. 74:2967, 2008; Jumppanen, J., et al., U.S. patent 6,140,498).
한편, 엘-리보스의 생물학적인 생산 연구 방법으로는 클리비지엘라 뉴모니아(Klebsiella pneumonia) 유래 아라비노스 이성화효소, 슈도모나스 슈체리(Pseudomonas stutzeri) 유래 람노스 이성화효소(L-rhamnose isomerase), 스트렙토마이세스 루비지노시스(Streptomyces rubiginosus) 유래 자일로스 이성화효소(D-xylose isomease) 및 락토코코스 락티스(Lactococcus lactis) 유래 갈락토스-6-인산 이성화효소(galactose-6-phosphate isomerase)를 이용하고 있으나, 상기 효소들을 광범위한 기질 특이성을 지니고 있어서 엘-리블로스를 엘-리보스로 전환시킬 수는 있지만 그 전환속도는 매우 느리다.
최근 본 발명자들은 바실러스 서브틸리스(Bacillus subtilis) 유래의 만노스-6-인산 이성화효소를 이용하여 엘-리불로오스를 엘-리보스로 전환하여 생산성이 낮은 문제를 극복하였다(Yeom S. J., et al., Appl. Environ. Microbiol. 75:4705, 2009). 그러나, 바실러스 서브틸리스 유래의 만노스-6-인산 이성화효소는 중온균 유래의 효소로서 열 안정성의 문제와 반응 온도가 낮기 때문에 다량의 기질 용해에 한계가 있다. 따라서, 이를 극복하기 위해 엘-리보스 생산성이 높고, 열 안정성이 높으면서 기질 용해도의 한계를 극복한 경제적인 생물학적인 방법의 개발이 시급하다.
본 발명은 상기의 문제점을 해결하고 상기의 필요성에 의하여 안출된 것으로서 본 발명의 목적은 신규한 만노스-6-인산 이성화효소의 돌연변이체를 제공하는 것이다.
본 발명의 또 다른 목적은 상기 만노스-6-인산 이성화효소의 돌연변이체를 제조하는 방법을 제공하는 것이다.
본 발명의 또 다른 목적은 고수율의 엘-리보스의 제조방법을 제공하는 것이다.
상기 목적을 달성하기 위하여, 본 발명은 a) 서열번호 1에 기재된 만노스 6-인산 이성화효소 (mannose 6-phosphate isomerase)의 21번, 74번, 134번 잔기의 아미노산을 각각 라이신(K), 아스파라진(N), 메티오닌(M)에서 각각 글루탐산(E), 트레오닌(T), 아르지닌(R)으로 변환시킨 돌연변이체;
b) 서열번호 1에 기재된 만노스 6-인산 이성화효소 (mannose 6-phosphate isomerase)의 67번, 238번 잔기의 아미노산을 각각 글루탐산(E), 트레오닌(T)에서 각각 글라이신(G), 아이소루신(I)으로 변환시킨 돌연변이체;
c)서열번호 1에 기재된 만노스 6-인산 이성화효소 (mannose 6-phosphate isomerase)의 124번, 129번 잔기의 아미노산을 각각 라이신(K), 루신(L)에서 각각 아르지닌(R), 페닐알라닌(F)으로 변환시킨 돌연변이체;
d) 서열번호 1에 기재된 만노스 6-인산 이성화효소 (mannose 6-phosphate isomerase)의 90번 잔기의 아미노산을 아스파라진(N)에서 알라닌(A), 아스파트산(D), 히스티딘(H) 또는 류신(L)으로 변환시킨 돌연변이체;
e)서열번호 1에 기재된 만노스 6-인산 이성화효소 (mannose 6-phosphate isomerase)의 129번 잔기의 아미노산을 류신(L)에서 페닐알라닌(F), 또는 타이로신(Y)으로 변환시킨 돌연변이체;
f)서열번호 1에 기재된 만노스 6-인산 이성화효소 (mannose 6-phosphate isomerase)의 90번 잔기의 아미노산을 아스파라진(N)에서 알라닌(A), 아스파트산(D), 히스티딘(H) 또는 류신(L)으로 변환시키고, 서열번호 1에 기재된 만노스 6-인산 이성화효소 (mannose 6-phosphate isomerase)의 129번 잔기의 아미노산을 류신(L)에서 페닐알라닌(F), 또는 타이로신(Y)으로 변환시킨 돌연변이체;
g)서열번호 1에 기재된 만노스 6-인산 이성화효소 (mannose 6-phosphate isomerase)의 17번 잔기의 아미노산을 트립토판(W)에서 글루타민(Q)으로 변환시킨 돌연변이체;
h)서열번호 1에 기재된 만노스 6-인산 이성화효소 (mannose 6-phosphate isomerase)의 17번 잔기의 아미노산을 트립토판(W)에서 글루타민(Q)으로 변환시키고, 서열번호 1에 기재된 만노스 6-인산 이성화효소 (mannose 6-phosphate isomerase)의 90번 잔기의 아미노산을 아스파라진(N)에서 알라닌(A)으로 변환시키고, 서열번호 1에 기재된 만노스 6-인산 이성화효소 (mannose 6-phosphate isomerase)의 129번 잔기의 아미노산을 류신(L)에서 페닐알라닌(F)으로 변환시킨 돌연변이체;
i)서열번호 1에 기재된 만노스 6-인산 이성화효소 (mannose 6-phosphate isomerase)의 193 잔기의 아미노산을 알기닌(R)에서 알라닌(A)으로 변환시킨 돌연변이체; 및
j)서열번호 1에 기재된 만노스 6-인산 이성화효소 (mannose 6-phosphate isomerase)의 17번 잔기의 아미노산을 트립토판(W)에서 글루타민(Q)으로 변환시키고, 서열번호 1에 기재된 만노스 6-인산 이성화효소 (mannose 6-phosphate isomerase)의 90번 잔기의 아미노산을 아스파라진(N)에서 알라닌(A)으로 변환시키고, 서열번호 1에 기재된 만노스 6-인산 이성화효소 (mannose 6-phosphate isomerase)의 129번 잔기의 아미노산을 류신(L)에서 페닐알라닌(F)으로 변환시키고, 서열번호 1에 기재된 만노스 6-인산 이성화효소 (mannose 6-phosphate isomerase)의 193 잔기의 아미노산을 알기닌(R)에서 알라닌(A)으로 변환시킨 돌연변이체로 구성된 군으로부터 선택된 만노스 6-인산 이성화효소 돌연변이체를 제공한다.
또한 본 발명은 상기 본 발명의 만노스 6-인산 이성화효소 돌연변이체를 코딩하는 유전자를 제공한다.
본 발명의 일 구현예에 있어서, 상기 본 발명의 돌연변이 만노스 6-인산 이성화효소를 코딩하는 유전자는 서열번호 2 내지 서열번호 11에 기재된 염기서열을 가지는 유전자 중 하나인 것이 바람직하나 이에 한정되지 아니한다.
또한 본 발명은 상기 본 발명의 만노스 6-인산 이성화효소 유전자를 포함하는 재조합 발현 벡터를 제공한다.
본 발명의 일 구현예에 있어서, 상기 재조합 발현벡터는 도 8에 기재된 개열지도를 가지는 것이 바람직하나 이에 한정되지 아니한다.
또한 본 발명은 a) 상기 본 발명의 유전자를 포함하는 발현벡터를 제조하고;
b) 상기 발현벡터로 형질전환된 미생물을 배양하고;c) 상기 미생물로부터 만노스 6-인산 이성화효소를 분리하는 단계를 포함하는 본 발명의 만노스 6-인산 이성화효소 돌연변이체를 제조하는 방법을 제공한다.
또한 본 발명은 상기 본 발명의 만노스 6-인산 이성화효소 돌연변이체를 이용하여 리보스를 생산하는 방법을 제공한다.
본 발명의 일 구현예에 있어서, 상기 리보스는 L-리보스(L-ribose)이고, L-리불로오스(L-ribulose)를 기질로 사용하여 생산되는 것이 바람직하나 이에 한정되지 아니한다.
또한 본 발명은 상기 본 발명의 만노스 6-인산 이성화효소 돌연변이체를 포함하는 리보스 생산용 조성물을 제공한다.
이하 본 발명을 상세하게 설명한다.
본 발명의 만노스-6-인산 이성화효소 돌연변이체는 서열번호 1로 표시되는 아미노산서열의 특정 잔기가 변형된 아미노산 서열을 가진 것을 특징으로 한다.
본 발명에는 상기 본 발명의 돌연변이체 중 하나를 코딩하는 코딩하는 만노스 6-인산 이성화효소 유전자가 포함되고, 그 유전자서열로서는 서열번호 2 내지 12 중 하나로 표시되는 것을 들 수 있다.
또, 본 발명에는, 상기 만노스-6-인산 이성화효소 유전자를 함유하는 재조합벡터, 상기 재조합벡터에 의해서 형질전환된 형질전환체가 포함된다. 또한, 본 발명에는, 이 형질전환체를 배양하여, 얻게되는 배양물로부터 만노스-6-인산 이성화효소를 분리하는 것을 특징으로 하는 만노스-6-인산 이성화효소 돌연변이체의 제조방법이 포함된다.
본 발명의 만노스-6-인산 이성화효소 유전자는 지오바실러스 써모디니트리피칸스 균주로부터 분리된 것이다. 먼저, 만노스-6-인산 이성화효소 유전자를 가진 지오바실러스 써모디니트리피칸스 균주로부터 염색체 DNA를 취득한다. 다음에, 설계한 올리고뉴클레오타이드를 프라이머로 하고, 지오바실러스 써모디니트리피칸스 균주의 염색체 DNA를 주형으로 해서 폴리머라제 연쇄반응(PCR)을 행하여, 만노스-6-인산 이성화효소 유전자를 부분적으로 증폭한다. 이와 같이 해서 얻게 된 PCR 증폭 단편은 지오바실러스 써모디니트리피칸스 균주의 만노스-6-인산 이성화효소 유전자에 100% 가까운 상동성을 가진 단편으로서, 콜로니하이브리디제이션을 행할 때의 프로브로서 높은 S/N비를 기대할 수 있는 동시에, 하이브리디제이션의 스트린전시 (stringency)제어를 용이하게 한다. 상기의 PCR 증폭 단편을 적당한 시약을 사용해서 표지하고, 상기 염색체 DNA라이브러리에 대해서 콜로니 하이브리디제이션을 행하여, 만노스-6-인산 이성화효소 유전자를 선발한다 (Current Protocols in Molecular Biology, 1권, 603페이지, 1994년).
상기의 방법에 의해 선발된 대장균으로부터 알칼리법(Current Protocols in Molecular Biology, 1권, 161페이지, 1994년)을 사용해서 플라스미드를 회수함으로써, 만노스-6-인산 이성화효소 유전자를 함유하는 DNA단편을 얻을 수 있다. 또한, 상기 방법에 의해 염기서열을 결정한 후에는, 상기 염기서열을 가진 DNA단편의 제한효소에 의한 분해에 의해 조제한 DNA단편을 프로브로 해서 하이브리다이즈함으로써 본 발명의 전체 유전자를 얻는 것이 가능하다.
본 발명의 형질전환된 미생물은, 본 발명의 재조합벡터를, 상기 재조합벡터를 제작할 때에 사용한 발현벡터에 적합한 숙주 속에 도입함으로써 얻게 된다. 예를 들면 대장균 등의 세균을 숙주로서 사용하는 경우는, 본 발명에 관한 재조합벡터는, 그 자신이 숙주 속에서 자율복제 가능한 동시에, 프로모터, 만노스-6-인산 이성화효소 유전자를 함유하는 DNA 및 전사종결서열 등의 발현에 필요한 구성을 가진 것임이 바람직하다. 본 발명에 사용된 발현벡터로서는 pTRC 99a를 사용하였으나 상기의 요건을 만족하는 발현벡터이면 어느 것이나 사용가능하다.
본 발명에 관한 만노스-6-인산 이성화효소 돌연변이체의 제조는, 이것을 코딩하는 유전자를 가진 재조합벡터에 의해 숙주를 형질전환해서 얻은 형질전환체를 배양하고, 배양물(배양균체 또는 배양상청액)속에 유전자 산물인 만노스-6-인산 이성화효소를 생성 축적시켜, 배양물로부터 효소를 취득함으로써 행하여진다.
본 발명의 만노스-6-인산 이성화효소의 취득 및 정제는, 얻게 되는 배양물 중으로부터, 균체 또는 상청액을 원심 회수하여, 균체파쇄, 친화성크로마토그래피, 양이온 또는 음이온교환크로마토그래피 등을 단독으로 또는 조합함으로써 행할 수 있다.
본 발명은 지오바실러스 써모디니트리피칸스(Geobacillus thermodenitrificans)균으로부터 만노스-6-인산 이성화효소 돌연변이체 고수율의 엘-리보스를 생산할 수 있으며, 상기 엘-리보스는 다양한 엘-형태 핵산당 의약품들의 합성 시작물질로서 의약품 등의 제조 시 유용하게 사용될 수 있다.
도 1은 본 발명의 만노스-6-인산 이성화효소의 무기염 종류에 따른 효소 활성도를 비교하여 나타낸 것이다.
도 2는 본 발명의 만노스-6-인산 이성화효소의 최적 무기염의 농도에 따른 효소 활성도를 비교하여 나타낸 것이다.
도 3은 본 발명의 만노스-6-인산 이성화효소의 pH에 따른 효소 활성도를 비교하여 나타낸 것이다.
도 4는 본 발명의 만노스-6-인산 이성화효소의 온도에 따른 효소 활성도를 비교하여 나타낸 것이다.
도 5는 본 발명의 만노스-6-인산 이성화효소의 온도에 따른 안정성 측정 결과를 나타낸 것이다.
도 6은 기질 농도 300g/ℓ 에서 본 발명의 만노스-6-인산 이성화효소에 의한 리보스의 생산량을 나타낸 것이다.
도 7-11은 본 발명의 만노스-6-인산 이성화 효소(도 7) 및 그 효소의 돌연변이 효소들인 표 1의 Mutant 1(8),Mutant 2(9),Mutant 3(10), Mutant 4(11)의 유전자 서열을 나타낸 것이다.
도 12는 발현벡터의 개열지도를 나타낸 그림이다.
도 13-14는 점 돌연변이체에서 아미노산 잔기 90번(도 13)과 129번(도 14) 치환 점 돌연변이체의 야생형과 비교한 상대적 활성도를 나타낸 것이다.
도 15는 본 발명의 만노스-6-인산 이성화 효소의 아미노산 잔기 90번과 129번에서 단일 돌연변이 및 이중 돌연변이 효소들의 야생형과 비교한 상대적 활성도를 나타낸 것이다.
도 16 본 발명의 변이체 만노스-6-인산 이성화효소의 제조를 위해 스크리닝으로 얻은 효소 활성도를 비교하여 나타낸 것이다.
도 17-20은 본 발명의 변이체 만노스-6-인산 이성화효소의 제조를 위해 점돌연변이를 실행하여 얻은 잔기들의 활성도를 비교하여 나타낸 것이다.
도 21은 본 발명의 변이체 만노스-6-인산 이성화효소의 메탈 이온에 따른 효소 활성도를 비교하여 나타낸 것이다.
도 22-23은 본 발명의 변이체 만노스-6-인산 이성화효소의 pH (도 22)및 온도 (도 23)에 따른 효소 활성도를 비교하여 나타낸 것이다.
도 24는 본 발명의 변이체 만노스-6-인산 이성화효소의 온도에 따른 안정성 측정 결과를 나타낸 것이다.
도 25는 본 발명의 변이체 만노스-6-인산 이성화 효소의 속도론을 나타낸 것이다.
도 26은 본 발명의 변이체 만노스-6-인산 이성화효소에 따른 엘-리보스의 생산량을 나타낸 것이다.
이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 예시하기 위한 것으로서, 본 발명의 범위가 이들 실시예에 의해 제한되는 것으로 해석되지 않는 것은 당업계에서 통상의 지식을 가진 자에게 있어서 자명할 것이다.
실시예 1: 만노스-6-인산 이성화 효소 유전자를 포함하는 재조합 발현 벡터 및 형질전환 미생물의 제조
만노스-6-인산 이성화 효소를 제조하기 위하여, 지오바실러스 써모디니트리피칸스 (Geobacillus thermodenitrificans) 균주로부터 유래한 만노스-6-인산 이성화 효소를 먼저 분리하였다.
구체적으로 유전자 염기서열과 아미노산 서열이 이미 특정되어 있는 지오바실러스 써모디니트리피칸스 균주를 선별하고(Dae-Heoun Baek, Yujin Lee, Hong-Sig Sin, and Deok-Kun (2004) J Microbiol. Biotechnol. 14: 312-316), 이로부터 유래한 만노스-6-인산 이성화 효소의 공지의 DNA 염기서열(Genebank Accession Number CP000557)을 기초로 하여 다음의 프라이머(primer)를 고안하였다.
만노스-6-인산 이성화 효소
서열번호 12(정방향 프라이머): 5'-TTTGAATTCATGCATCAAGAACCGATTTTTC-3'
서열번호 13(역방향 프라이머): 5'-TTTAAGCTTTTATTTGCTTGTCCGTGG-3'
상기 만노스-6-인산 이성화 효소 유전자의 프라이머는 EcoR Ⅰ과 Hind Ⅲ 제한효소 절단부분으로 설계되었다. 상기 프라이머를 이용한 중합효소 연쇄반응(PCR)을 실시하여 해당 유전자의 염기서열을 증폭하였다. 대량으로 얻은 만노스-6-인산 이성화 효소 유전자는 각각의 제한효소를 사용하여 플라스미드 벡터 pTRC 99a(Novagen 사)에 삽입하여 pTRC 99a/만노스-6-인산 이성화 효소를 제작하였다.
상기와 같이 얻은 재조합 발현 벡터는 통상적인 형질전환 방법에 의하여 대장균 ER 2566 균주(NEB)에 형질 전환하였다. 또한, 상기 형질전환된 미생물은 20% 글리세린(glycerine) 용액을 첨가하여 리보스의 생산을 위한 배양을 실시하기 전에 냉동 보관하였다.
실시예 2: 만노스-6-인산 이성화효소의 제조
만노스-6-인산 이성화효소를 대량 생산하기 위하여, 상기 실시예 1에서 제작하고, 냉동 보관된 재조합 대장균 ER 2566 균주를 LB 배지 3 ㎖이 들어있는 시험관(test tube)에 접종하고 600 ㎚에서 흡광도가 2.0이 될 때까지 37℃의 진탕 배양기로 종균 배양을 실시하였다. 그 다음 상기 종균 배양된 배양액을 LB 배지 500 ㎖이 들어있는 2,000 ㎖ 플라스크에 첨가하여 본 배양을 실시하였다. 또한, 600 ㎚에서의 흡광도가 0.6이 될 때, 0.1 mM IPTG를 첨가하여 만노스 6-인산 이성화효소의 대량 발현을 유도하였다. 상기 과정 중의 교반 속도는 200 rpm, 배양 온도는 37℃가 유지하도록 조절하고, 아이피티지(IPTG)를 첨가한 후에 같은 조건으로 5시간동안 배양하였다.
또한, 상기와 같이 과발현되어 생산된 만노스-6-인산 이성화효소는, 상기 형질전환된 균주의 배양액을 6,000× g로 4℃에서 30분 동안 원심분리하고, 0.85% 염화나트륨(NaCl)으로 두번 세척한 다음 50 mM 트리스-염화수소 완충용액과 0.1 mM 단백분해 효소 저해제(phenylmethylsulfonyl fluoride)를 첨가하여 상기 세포 용액을 초음파 파쇄기(sonicator)로 파쇄하였다. 상기 세포 파쇄물은 65℃에서 10분간 열처리를 한 후 다시 13,000× g로 4℃에서 20분 동안 원심분리하고 세포 펠렛은 제거한 다음 세포 상등액만을 얻어 고속 단백질 액체 크로마토그래피(fast protein liquid chromatography system(Bio-Rad Laboratories, Hercules, CA, USA))에 음이온 수지인 하이트랩 에이치피(Hi TrapTM HP) 흡착 컬럼을 장착 하여 엘-리보스 생산에 사용되는 효소액으로서 분리하였다.
실시예 3: 만노스-6-인산 이성화효소의 금속 특이성 조사
본 발명의 만노스-6-인산 이성화효소의 금속 이온에 대한 특이성을 조사하기 위하여서는, 상기 효소 활성은 10 mM EDTA를 처리하고 금속 이온(Mn2+, Zn2+, Ba2+, Cu2+, Co2+, Ca2+, Mg2+, Ni2+, Fe2+)을 첨가하여 반응시킨 후 다음과 같이 활성을 측정하였다. 상기 효소 반응은 10 mM 엘-리불로오스, 각각의 금속 이온과 2 unit/㎖ 효소가 포함된 50 mM PIPES(piperazine-N,N’-bis(2-ethane sulfonic acid) 완충용액(pH 7.0)을 사용하여 70℃에서 10분 동안 수행하였고, 다시 최종 농도 200 mM 염화수소를 첨가하여 상기 반응을 정지시켰다.
효소 활성은 엘-리불로오스를 기질로 사용하여 측정되었고, 상기 효소 활성의 효소 1 unit은 pH 7.0와 70℃에서 분당 1 nmole의 엘-리보스를 생산하는 양으로 정의하여 비교분석을 하였다. 또한, 효소 활성의 측정 시 엘-리보스 농도 및 엘-리불로오스 농도 그리고 다른 당들의 분석은 전기화학적 검출기(electrochemical detector) 및 카보팩 피에이(CarboPacPA) 컬럼이 장착된 바이오 액체 크로마토그래피(Bio-LC) 시스템(Dionex ICS-3000, Sunnylvale, CA)을 이용하여 진행되었다. 이때, 상기 카보팩 피에이(CarboPacPA) 컬럼은 30℃에서 1 ㎖/분 속도로 200 mM 수산화나트륨을 통과시키도록 하였다.
그 결과, 실험한 금속염 중 지오바실러스 써모디니트리피칸스(Geobacillus thermodenitrificans) 유래의 만노스-6-인산 이성화 효소에 의한 리보스 이성화에 코발트(Co2+)가 가장 효과적이었다. 농도별 테스트 결과 효소에 대한 금속염 모두 최적농도는 1 mM이었다. 만노스-6-인산 이성화효소는 1 mM 망간 및 코발트 금속 이온의 영향을 받는 것으로 나타나, 본 발명의 만노스 6-인산 이성화효소는 금속 이온에 대해 의존성 효소인 것을 확인하였다.
금속 이온에 대한 만노스 6-인산 이성화효소에 대한 활성은 각각 도 1에 나타내었고, 만노스 6-인산 이성화효소에 대한 금속염 최적 농도는 각각 도 2에 나타내었다.
실시예 4: pH 및 온도가 만노스 6-인산 이성화효소 활성에 미치는 영향
상기 실시예 2에서 분리한 만노스-6-인산 이성화효소의 pH 및 온도 변화에 따른 활성도를 다음과 같이 확인하였다. 다양한 pH 및 온도 조건 하에서 효소와 기질을 반응시키고 효소 활성을 비교하였다.
pH가 만노스-6-인산 이성화효소에 미치는 영향
상기 효소에 대한 pH 효과를 조사하기 위하여, 기질로서 10 mM 엘-리불로오스, 1 mM 코발트, 2 unit/㎖ 효소가 포함된 50 mM EPPS 완충용액을 사용하여 pH 6.5에서부터 8.5 범위까지 효소 반응을 실시하였다. 구체적으로, 효소반응은 70℃에서 10분 동안 수행하고 다시 최종 농도 200 mM 염화수소를 첨가하여 상기 반응을 정지시켰다. 그 결과, 도 3에 나타난 바와 같이, 최적 pH는 7.0인 것을 알 수 있었다.
온도가 만노스-6-인산 이성화효소에 미치는 영향
상기 효소에 대한 온도 효과를 조사하기 위하여, 효소 반응은 온도 55℃에서 80℃ 범위까지 10 mM 엘-리불로오스, 1 mM 코발트와 2 unit/㎖ 효소가 포함된 pH 7.0인 50 mM PIPES 완충용액을 사용하여 각각 10분 동안 반응을 실시하였다. 그 다음 최종 농도 200 mM 염화수소를 첨가하여 상기 반응을 정지시켰다.
그 결과, 도 4에 나타난 바와 같이, 최적 온도는 70℃인 것을 알 수 있었다.
또한, 도 3의 pH에 따른 만노스-6-인산 이성화 효소의 활성도에서 ●는 PIPES 완충용액을 나타내고, ○는 EPPS 완충용액을 나타낸다.
만노스-6-인산 이성화효소의 온도 안정성 조사
만노스-6-인산 이성화효소의 온도 안정성을 조사하기 위하여, 온도 60℃에서 80℃까지의 범위에서 10 mM 엘-리불로오스, 1 mM 코발트, 2 unit/㎖ 효소가 포함된 pH 7.0인 50 mM PIPES 완충용액을 사용하여 각각 효소 활성이 절반으로 줄어드는 시간까지 반응을 진행시켰다. 반응이 끝난 다음, 최종 농도 200 mM 염화수소를 첨가하여 상기 반응을 정지시키고, 만노스-6-인산 이성화효소 효소의 활성을 측정하였다.
도 5는 본 발명의 만노스-6-인산 이성화효소의 온도 안정성 측정 결과를 나타낸 것이다. 상기의 그래프에서 온도 표기는 60℃(▲), 65℃(△), 70℃(▲), 75℃(□) 및 80℃(■)로 각각 나타내었다.
그 결과 도 5에 나타난 바와 같이, 온도 60℃에서는 338시간, 65℃는 73시간, 70℃는 27시간, 75℃는 17시간, 그리고 80℃에서는 6.2시간 경과 시 상기 효소 활성이 절반으로 줄어드는 것을 확인할 수 있었다.
실시예 5: 만노스-6-인산 이성화효소를 이용한 리보스의 생산
지오바실러스 써모디니트리피칸스(Geobacillus thermodenitrificans) 균주로부터 유래한 만노스-6-인산 이성화효소를 이용한 리보스의 생산 방법을 개발하기 위하여, 상기에서 확인한 효소의 최적 pH 7.0 및 효소활성이 절반으로 줄어든 시간을 고려한 온도(70 ℃)에서 300 g/ℓ 리불로오스를 가지고 리보스의 시간별 생산량을 측정하였다.
그 결과, 반응 2.2 시간 후에 300 g/ℓ의 리불로오스에서 210 g/ℓ의 리보스가 생산되어 시간당 87.5 g/ℓ의 생산성과 70% 전환수율을 나타내었다(도 6 참조).
현재까지 리보스의 생산 중 가장 높은 생산성을 나타낸 것은 Molybdic acid를 사용한 화학합성법은 엘-아라비노스 로부터 23% 전환수율과 시간당 20 g/ℓ 생산성을 나타내었다(Jumppanen, J., J. Nurmi, and O. Pastinen. October 2000. Process for the continuous production of high purity of L-ribose. U.S. patent 6,140,498.).
또 다른 비교로는 바실러스 서브틸리스（Bacillus subtilis) 와 지오바실러스 써모디니트리피칸스(Geobacillus 유래의 만노스-6-인산 이성화 효소를 사용하여 각각 시간당 71 g/ℓ, 85.2 g/ℓ를 보여 주었다 (Yoem et al., Appl. Environ. Microbiol. 2009. 75:4705-4710).
이것은 보고된 생물학적 엘-리보스 생산에서 가장 높은 생산성으로, 본 발명에서 얻은 엘-리보스 생산 효소법은 생산성, 생산농도 및 정제의 용이함 등에서 화학합성법과 기존 생물학적 방법보다 훨씬 우수하다는 것을 알려준 결과이다.
실시예 6: 만노스-6-인산 이성화 효소 돌연변이를 포함하는 재조합 발현 벡터 및 형질전환 미생물의 제조
지오바실러스 써모디니트리피칸스(Geobacillus thermodenitrificans) 균주로부터 유래한 만노스-6-인산 이성화 효소의 무작이 돌연변이 (Random mutagenesis)를 유발하기 위하여 PCR mutagenesis kit (ClonTech Laboratories, Palo Alto. CA, USA) 을 이용하여 pTrc99a/만노스-6-인산 이성화 효소 돌연변이벡터를 제작하였다.
상기와 같이 얻은 재조합 발현 벡터는 통상적인 형질전환 방법에 의하여 대장균 ER 2566 균주에 형질 전환하였다. 또한, 상기 형질전환된 미생물은 20% 글리세린(glycerine) 용액을 첨가하여 리보스의 생산을 위한 배양을 실시하기 전에 냉동 보관하였다.
실시예 7: 만노스-6-인산 이성화효소 돌연변이체 제조
지오바실러스 써모디니트리피칸스(Geobacillus thermodenitrificans) 균주로부터 유래한 만노스-6-인산 이성화효소 돌연변이체를 대량 생산하기 위하여, 상기 실시예 5에서 제작하고, 냉동 보관된 재조합 대장균 ER 2566 균주를 LB 배지 3㎖이 들어있는 시험관(test tube)에 접종하고 600㎚에서 흡광도가 2.0이 될 때까지 37℃의 진탕 배양기로 종균 배양을 실시하였다. 그 다음 상기 종균 배양된 배양액을 LB 배지 500㎖이 들어있는 2,000㎖ 플라스크에 첨가하여 본 배양을 실시하였다. 또한, 600㎚에서의 흡광도가 0.6 이 될 때, 0.1mM IPTG를 첨가하여 만노스-6-인산 이성화효소의 대량 발현을 유도하였다. 상기 과정 중의 교반 속도는 200rpm, 배양 온도는 37℃가 유지하도록 조절하고, 아이피티지를 첨가한 후에 같은 조건으로 5시간동안 배양하였다.
또한, 상기와 같이 과발현되어 생산된 만노스-6-인산 이성화효소 돌연변이체는, 상기 형질전환된 균주의 배양액을 6,000× g로 4℃에서 30분 동안 원심분리하고, 0.85% 염화나트륨(NaCl)으로 두번 세척한 다음 50 mM PIPES (pH 7.0)완충용액과 0.1 mM 단백분해 효소 저해제(phenylmethylsulfonyl fluoride)를 첨가하여 상기 세포 용액을 초음파파쇄기(sonicator)로 파쇄하였다. 상기 세포 파쇄물은 70℃에서 10분간 열처리를 한 후 다시 13,000× g로 4℃에서 20분 동안 원심분리하고 세포 펠렛은 제거한 다음 세포 상등액만을 얻어 고속 단백질 액체 크로마토그라피(fast protein liquid chromatography system(Bio-Rad Laboratories, Hercules, CA, USA))에 음이온 수지인 하이트랩 에이치피(Hi TrapTM HP) 흡착 컬럼을 장착 하여 엘-리보스 생산에 사용되는 효소액으로서 분리하였다.
실시예 8: 만노스-6-인산 이성화효소 돌연변이체의 엘-리불로오스에 대한 효소 활성 측정
지오바실러스 써모디니트리피칸스(Geobacillus thermodenitrificans) 균주로부터 유래한 만노스-6-인산 이성화효소와 그 돌연변이체의 엘-리불로오스에 대한 효소 활성을 측정 및 비교하는 실험을 수행하였다.
상기 효소 반응은 10 mM 리불로오스, 1 mM Co2+의 금속 이온이 포함된 50 mM PIPES 완충용액(pH 7.0)을 사용하여 70℃에서 5분 동안 수행하였고, 다시 최종 농도 200 mM 염화 수소을 첨가하여 상기 반응을 정지시켰다. 본 발명에서는 효소 활성은 엘-리불로오스를 기질로 사용하여 측정되었고, 상기 효소 활성의 효소 1 단위(unit)는 pH 7.0와 70℃에서 분당 1 nmole의 리보오스를 생산하는 양으로 정의하여 비교분석을 원활히 하였다. 또한, 효소 활성의 측정 시 리보오스 농도 및 리불로오스 농도 그리고 다른 당들의 분석은 전기화학적 검출기(electrochemical detector) 및 카보팩 피에이(CarboPacPA) 컬럼 이 장착된 바이오 액체 크로마토그래피(Bio-LC) 시스템 (Dionex ICS-3000, Sunnylvale, CA)을 이용하여 진행되었다. 이 때, 상기 카보팩 피에이(CarboPacPA) 컬럼은 30℃에서 1 ㎖/분 속도로 200 mM 수산화 나트륨을 통과시키도록 하였다.
그 결과, 4개의 돌연변이 효소에서 wild 효소에 비해 엘 리불로오스를 기질로 하였을 때 활성이 1.2~1.4배 증가하는 것을 확인할 수 있었다. 이때 엘 리불로스에 대한 wild 효소의 specific activity 는 504 U/mg 임을 확인하였다 (표 1 참조). 그에 따른 돌연변이 효소의 DNA 염기 서열및 아미노산 서열을 wild 효소와 비교해본결과, 1~3개의 포인트가 돌연변이가 유발된 것을 확인할 수 있었다. 이는 현재까지 리보스의 생산 중 가장 높은 생산성을 나타낸 것은 지오바실러스 써모디니트리피칸스(Geobacillus thermodenitrificans) 균주 유래의 만노스-6-인산 이성화 효소였지만, 그에 따른 돌연 변이 효소가 보다 높은 활성을 보임을 확인할 수 있었다. 이것은 돌연변이 효소가 보고된 생물학적 엘-리보스 생산에서 가장 높은 생산성을 가진 지오바실러스 써모디니트리피칸스(Geobacillus thermodenitrificans)로부터 유래한 만노스-6-인산 이성화 효소를 능가하는 엘-리보스 생산 효소임을 나타낸다.
표 1
Enzyme Mutation point Relative activity (%)
Wild None 100
Mutant 1 K21E, N74T, M134R 121
Mutant 2 E67G, T238I 132
Mutant 3 K124R, L129F 131
Mutant 4 N90D 125
표 1은 만노스-6-인산 이성화 효소와 돌연변이 효소들의 엘-리불로스에 대한 효소 활성을 나타낸 것이다.
실시예 9: 점돌연변이를 이용한 잔기 선별
지오바실러스 써모디니트리피칸스(Geobacillus thermodenitrificans) 균주로부터 유래한 만노스-6-인산 이성화효소(mannose 6-phosphate isomerase)를 선별검사(screening)하여 얻은 활성 높은 잔기중에 활성이 가장 높은 두 가지 잔기를 각기 다른 아미노산으로 치환하여 활성이 가장 높은 잔기를 선별하였다.
구체적으로 N90잔기와 L129잔기를 각각 다른 성질의 아미노산으로 전환하여 아래 N90A, N90D, N90E, N90H, N90K, N90L, N90Y, L129A, L129F, L129H, L129W, L129Y로 점돌연변이를 진행하여, 기존 야생형(wild type)의 지오바실러스 써모디니트리피칸스 균주로부터 유래한 만노스-6-인산 이성화효소와 활성 실험을 비교하였다.
본 실험의 선별검사는 Clontech Diversify PCR Random Mutagenesis Kit을 이용하여 실수유발 PCR (error prone PCR)진행하여 케토오스 정량법(ketose assay)를 통해 선별하였다. 그렇게 얻은 돌연변이체(mutant)를 Stratagene에서 나온 QuikChangeⅡ Site-Directed Mutagenesis Kit를 이용하여 각각 하나의 잔기로 변환, 다른 아미노산으로 치환 혹은 두 개의 돌연변이를 진행하였다. 또한 그 활성은 기존 MPi와 함께 반응을 비교 진행하였다. 반응은 50 mmole/L 피페스버퍼(PIPES buffer)에 보인자(co-factor) 1 mM Co2+를 포함한 0.5 mg/ml의 enzyme을 10 mmol/L 엘-리불로오스(L-ribulose)와 70 ℃에서 10분간 반응하여 고유 활성도(specific activity)를 측정하여 비교하였다(도 13 및 14 참조).
실시예 10: 두개의 돌연변이로 생산성 증가
지오바실러스 써모디니트리피칸스 균주로부터 유래한 만노스-6-인산 이성화효소를 선별 검사하여 얻은 활성 높은 잔기들중 활성이 가장 높은 두가지 잔기를 한번에 double mutation시켜 그 활성을 비교하였다.
구체적으로 N90A와 L129F를 함께 doble mutation시켜 더 높아지는 활성을 확인하였다(도 15 참조).
실시예 11: 만노스-6-인산 이성화효소의 또 다른 돌연변이체 제조를 위한 재조합 발현벡터 및 형질전환 미생물의 제조 및 1차 스크리닝
만노스-6-인산 이성화 효소를 제조하기 위하여, 지오바실러스 써모디니트리피칸스 (Geobacillus thermodenitrificans) 균주로부터 유래한 만노스-6-인산 이성화 효소를 먼저 분리하였다.
구체적으로 유전자 염기서열과 아미노산 서열이 이미 특정되어 있는 지오바실러스 써모디니트리피칸스 균주를 선별하고(Dae-Heoun Baek, Yujin Lee, Hong-Sig Sin, and Deok-Kun (2004) J Microbiol. Biotechnol. 14: 312-316), 이로부터 유래한 만노스-6-인산 이성화 효소의 공지의 DNA 염기서열(Genebank Accession Number CP000557)을 기초로 하여 다음의 프라이머(primer)를 고안하였다.
만노스-6-인산 이성화 효소 서열번호 14(정방향 프라이머):
5'- TTTCATATGGACCTTGAACCGATTTTTCTCA -3'
만노스-6-인산 이성화 효소 서열번호 15(역방향 프라이머):
5'- TTTGAAATTCTTATTTGCCTTTCCGTGGCCA -3'
상기 만노스-6-인산 이성화 효소 유전자의 프라이머는 NdeI 과 EcoRⅠ 제한효소 절단부분으로 설계되었다. 상기 프라이머를 이용한 중합효소 연쇄반응(PCR)을 실시하여 해당 유전자의 염기서열을 증폭하였다. 대량으로 얻은 만노스-6-인산 이성화 효소 유전자는 각각의 제한효소를 사용하여 플라스미드 벡터 pET 28a (Novagen 사)에 삽입하여 pET 28a/만노스-6-인산 이성화 효소를 제작하였다.
상기와 같이 얻은 재조합 발현 벡터는 통상적인 형질전환 방법에 의하여 대장균 ER 2566 균주에 형질 전환하였다. 또한, 상기 형질전환된 미생물은 20% 글리세린(glycerine) 용액을 첨가하여 리보스의 생산을 위한 배양을 실시하기 전에 냉동 보관하였다.
또 다른 만노스-6-인산 이성화효소의 변이체를 만들기 위하여, 상기에서 제작한 pET 28a/만노스-6-인산 이성화효소를 Clontech 사 Diversify PCR random mutagenesis kit을 이용하여 error prone을 진행하였다. PCR을 이용하여 약 2~3개의 변이를 주었고. 변이를 준 PCR product를 E.coli ER 2566에 transformation하였다. 1차 스크리닝을 위해 변이가 일어난 콜로니를 LB에 37℃에서 500rpm에서 12시간 배양하였고, 그후 계대배양하여 IPTG로 37℃에서 500rpm에서 10시간 induction하였다. 그렇게 배양된 colony를 10mM L-ribulose를 이용하여 70℃에서 30분 반응한 후 70％ 황산과 L-cystein 그리고 carbazole을 이용하여 Ketose assay를 진행하여 wild와 비교하여 그 활성이 1.5배 이상 높은 colony를 선별하였다. 이렇게 1차 스크리닝을 통하여 얻은 약 50주의 colony를 다시 선별하기 위해 2차 스크리닝을 진행하였다.
실시예 12: 만노스-6-인산 이성화효소의 또 다른 변이체 제조를 위한 2차 스크리닝
2차 스크리닝은 50주의 균주의 효소만의 반응을 확인하기 위해 진행하였다. LB에 37℃에서 배양하다가 cell OD가 0.6일 때 0.1mM IPTG를 이용하여 37℃에서 induction을 한다. 그 후 50mM 피페스 (piperazine-N,N′-bis(2-ethanesulfonic acid); PIPES) pH 7.0 완충액 조건에서 crude 효소를 추출하여 얻고, 이 효소에 1mM Co2+를 임의적으로 넣어서 효소를 안정화 시킨 후 E.coli 유래의 효소들을 제거하기 위해 70℃에서 10분 열처리를 하여 부분적인 정제를 진행한다. 그 후 부분적인 정제가 진행된 효소를 각 같은 양으로 맞춘 후 1mM Co2+를 처리하여 30분 이상 효소를 안정화 시킨 후 10mM L-ribulose를 기질로 70℃에서 10분간 반응한 후 2M HCl을 이용하여 효소의 활성을 정지시키고 분석하였다. 이때 wild에 비해 L-ribose의 생성량이 높은 잔기를 골라 마크로젠 사에 sequencing을 의뢰하여 변이가 된 잔기를 확인하였다.
실시예 13: 또 다른 점돌연변이체 제조
변이가된 잔기들을 QuickChange사 site directed mutagenesis kit(Stratagene; SDM)를 이용하여 각 하나의 점돌연변이체를 만들고, 이렇게 제조된 점변이체들의 활성을 wild와 비교해서 그 잔기활성이 증가한 잔기를 선별하였다. 도 16은 W17R, K21E, E67G, N74T, N90D, K105R, K124R, L129F, R142C, T238I 이상 9개의 잔기에서 활성이 증가함을 확인한 결과이고, 이 중에서 W17R, N90D, 그리고 L129F에서 역가가 1.5배 이상 증가한 것을 확인하였다. 따라서 각 W17R, N90D, 그리고 L129F의 잔기의 가장 최적 아미노산으로 활성이 가장 높은 잔기를 찾아낸 결과 도 17 내지 19에 알 수 있는 것과 같이, W17Q, N90A, L129F임을 확인할 수 있었다.
위와 동일한 방법으로 점돌연변이체를 만들어 제조된 점변이체들의 활성을 wild와 비교해서 그 잔기활성이 증가한 잔기를 추가 선별하였다. 도 20에서 알 수 있는 바와 같이, 기존 선택된 3가지 변이체인 W17R, N90D, 그리고 L129F의 잔기에 돌연변이체를 유도한 삼중 돌연변이체 및 이 삼중 돌연변이체에 R193A를 추가적으로 변이를 일으킨 사중 돌연변이체에서 그 활성이 가장 높게 증가함을 확인할 수 있었다.
실시예 14: 변이체 만노스-6-인산 이성화효소의 제조
변이체 만노스-6-인산 이성화효소를 대량 생산하기 위하여, 상기 실시예 10 이하에서 제작하고, 냉동 보관된 재조합 대장균 ER 2566 균주를 LB 배지 3 ㎖이 들어있는 시험관(test tube)에 접종하고 600 ㎚에서 흡광도가 2.0이 될 때까지 37℃의 진탕 배양기로 종균 배양을 실시하였다. 그 다음 상기 종균 배양된 배양액을 LB 배지 500 ㎖이 들어있는 2,000 ㎖ 플라스크에 첨가하여 본 배양을 실시하였다. 또한, 600 ㎚에서의 흡광도가 0.6이 될 때, 0.1 mM 아이피티지(Isopropyl β-D-1-thiogalactopyranoside; IPTG)를 첨가하여 변이체 만노스 6-인산 이성화효소의 대량 발현을 유도하였다. 상기 과정 중의 교반 속도는 200 rpm, 배양 온도는 37℃가 유지하도록 조절하고, 아이피티지를 첨가한 후에 같은 조건으로 5시간동안 배양하였다.
또한, 상기와 같이 과발현되어 생산된 만노스-6-인산 이성화효소는, 상기 형질전환된 균주의 배양액을 6,000× g로 4℃에서 30분 동안 원심분리하고, 0.85% 염화나트륨(NaCl)으로 두번 세척한 다음 50 mM 피페스 완충용액과 0.1 mM 단백분해 효소 저해제(phenylmethylsulfonyl fluoride)를 첨가하여 상기 세포 용액을 초음파파쇄기(sonicator)로 파쇄하였다. 상기 세포 파쇄물은 65℃에서 10분간 열처리를 한 후 다시 13,000× g로 4℃에서 20분 동안 원심분리하고 세포 펠렛은 제거한 다음 세포 상등액만을 얻어 고속 단백질 액체 크로마토그라피(fast protein liquid chromatography system(Bio-Rad Laboratories, Hercules, CA, USA))에 친화성 수지인 히스트랩 에이치피(His TrapTM HP) 흡착 컬럼을 장착 하여 엘-리보스 생산에 사용되는 효소액으로서 분리하였다.
실시예 15: 돌연변이체 만노스-6-인산 이성화효소의 금속 특이성 조사
본 발명의 금속 이온에 대한 특이성을 조사하기 위하여, 상기 실시예 11 이하에서 제조된 효소 활성은 10mM EDTA를 처리하고 금속 이온 (Mn2+, Co2+)을 첨가하여 반응시킨 후 다음과 같이 활성을 측정하였다. 상기 효소 반응은 10 mM 엘-리불로스, 각각의 금속 이온과 2 unit/㎖ 효소가 포함된 50 mM 피페스 완충용액(pH 7.0)을 사용하여 70℃에서 10분 동안 수행하였고, 다시 최종 농도 200 mM 염화수소를 첨가하여 상기 반응을 정지시켰다. 효소 활성은 엘-리불로스를 기질로 사용하여 측정되었고, 상기 효소 활성의 효소 1 unit은 pH 7.0와 70℃에서 분당 1umole의 엘-라이보스를 생산하는 양으로 정의하여 비교분석을 하였다. 또한, 효소 활성의 측정 시 엘-리보스 농도 및 엘-리불로스 농도 분석은 전기화학적 검출기(electrochemical detector) 및 카보팩 피에이(CarboPacPA) 컬럼이 장착된 바이오 액체 크로마토그래피(Bio-LC) 시스템(Dionex ICS-3000, Sunnylvale, CA)을 이용하여 진행되었다. 이때, 상기 카보팩 피에이(CarboPacPA) 컬럼은 30℃에서 1 ㎖/분 속도로 200 mM 수산화나트륨을 통과시키도록 하였다.
그 결과, 도 21에서 알 수 있는 바와 같이, 실험한 금속염 중 지오바실러스 써모디니트리피칸스(Geobacillus thermodenitrificans) 유래의 변이체 만노스-6-인산 이성화 효소에 의한 리보스 이성화에 코발트(Co2+)가 가장 효과적이었다. 농도별 테스트 결과 금속염 모두 최적농도는 1 mM이었다. 변이체 만노스-6-인산 이성화효소는 1 mM 코발트 금속 이온의 영향을 받는 것으로 나타나, 본 발명의 만노스 6-인산 이성화효소는 금속 이온에 대해 의존성 효소인 것을 확인하였다.
실시예 16: pH 및 온도가 변이체 만노스 6-인산 이성화효소 활성에 미치는 영향
상기 실시예 10 이하에서 분리한 변이체 만노스-6-인산 이성화효소의 pH 및 온도 변화에 따른 활성도를 다음과 같이 확인하였다. 다양한 pH 및 온도 조건 하에서 효소와 기질을 반응시키고 효소 활성을 비교하였다.
1: pH가 변이체 만노스-6-인산 이성화효소에 미치는 영향
상기 효소에 대한 pH 효과를 조사하기 위하여, 기질로서 변이체 만노스-6-인산 이성화효소는 10 mM 엘-리불로스, 1 mM 코발트, 2 unit/㎖ 효소가 포함된 50 mM 피페스 완충용액을 사용하여 pH 6.5에서부터 8.5 범위까지 효소 반응을 실시하였다. 구체적으로, 효소반응은 70℃에서 10분 동안 수행하고 다시 최종 농도 200 mM 염화수소를 첨가하여 상기 반응을 정지시켰다. 그 결과, 도 22에 나타난 바와 같이, 최적 pH는 변이체 만노스-6-인산 이성화효소가 7.0인 것을 알 수 있었다.
2: 온도가 변이체 만노스-6-인산 이성화효소에 미치는 영향
상기 효소에 대한 온도 효과를 조사하기 위하여, 각각 효소 반응은 온도 55℃에서 80℃ 범위까지 변이체 만노스-6-인산 이성화 효소는 10 mM 리불로스, 1 mM 코발트와 2 unit/㎖ 효소가 포함된 pH 7.0인 50 mM PIPES 완충용액을 사용하여 각각 10분 동안 반응을 실시하였다. 그 다음 최종 농도 200 mM 염화수소를 첨가하여 상기 반응을 정지시켰다. 그 결과, 도 23에 나타난 바와 같이, 최적 온도는 두 효소 모두 70℃인 것을 알 수 있었다.
도 22는 본 발명의 변이체 만노스-6-인산 이성화 효소의 pH에 따른 효소 활성도를 조사하여 나타낸 것이다. 도 23은 본 발명의 변이체 만노스-6-인산 이성화 효소의 온도에 따른 효소 활성도를 조사하여 나타낸 것이다.
3: 변이체 만노스-6-인산 이성화효소의 온도 안정성 조사
만노스-6-인산 이성화효소의 온도 안정성을 조사하기 위하여, 온도 60℃에서 80℃까지의 범위에서 10 mM 리불로스, 1 mM 코발트, 2 unit/㎖ 효소가 포함된 pH 7.0인 50 mM PIPES 완충용액을 사용하여 각각 6시간동안 효소의 활성의 변화를 진행시켰다. 반응이 끝난 다음, 최종 농도 200 mM 염화수소를 첨가하여 상기 반응을 정지시키고, 변이체 만노스-6-인산 이성화효소 효소의 활성을 측정하였다.
도 24는 본 발명의 변이체 만노스-6-인산 이성화효소의 온도 안정성 측정 결과를 나타낸 것이다. 상기 도 24의 그래프에서 온도 표기는 60℃, 65℃, 70℃, 75℃ 및 80℃로 각각 나타내었다.
그 결과 도 24 에 나타난 바와 같이, 온도 70℃까지 그 활성이 반까지 떨어지지 않음을 확인할 수 있었다.
실시예 17: 변이체 만노스-6-인산 이성화효소를 이용한 효소의 반응속도론
상기 실시예 11 이하에서 제조된 변이체 만노스-6-인산 이성화효소를 이용한 각 효소들의 반응속도론에 관한 실험을 진행하였다. 이는 엘-리불로스를 각 10mM부터 2M의 기질을 이용하여 실험을 진행한 결과 도 25에 나타난 바와 같이, 각 변이체들의 절대적인 속도론적인 비교를 진행하였을 때 야생형, 단일변이체, 이중변이체, 삼중변이체의 Kcat/Km 값이 각각 93, 130, 536, 621로 나타났다.
실시예 18: 변이체 만노스-6-인산 이성화효소를 이용한 엘-리보스의 생산
상기 실시예 11 이하에서 제조된 변이체 만노스-6-인산 이성화효소를 이용한 엘-리보스의 생산 방법을 개발하기 위하여, 상기에서 확인한 효소의 최적 pH 7.0 및 효소활성이 절반으로 줄어든 시간을 고려한 온도(70 ℃)에서 2 unit/㎖ 만노스-6-인산 이성화효소를 1.8 g/L 엘-리불로스를 가지고 엘-리보스의 시간별 생산량을 측정하였다.
도 26은 기질로서 농도 1.8 g/L의 엘-리불로스에서 본 발명의 변이체 만노스-6-인산 이성화 효소에 의한 엘-리보스의 생산량을 나타낸 그래프로, 1.8 g/L 엘-리불로스로부터 반응 2시간 후에 1.26 g/L 리보스를 얻어 약 70% 전환수율을 나타내었다. 따라서, 엘-리보스를 2시간에 1.26 g/L 생산함을 확인할 수 있었다.
상기는 보고된 생물학적 엘-아라비노스로부터 엘-리보스 생산에서 가장 높은 생산성 및 생산농도로, 본 발명에 따른 엘-리보스 생산 방법은 생산성, 생산 농도 및 정제의 용이함 등에서 종래 기술인 발효법과 화학합성법보다 훨씬 우수하다는 것을 알려주는 결과이다.
이상으로 본 발명 내용의 특정부분을 상세히 기술하였는바, 당업계의 통상의 지식을 가진 자에게 있어서, 이러한 구체적 기술은 단지 바람직한 실시양태일 뿐이며, 이에 의해 본 발명의 범위가 제한되는 것이 아닌 것은 명백할 것이다. 따라서 본 발명의 실질적인 범위는 첨부된 청구항들과 그것들의 등가물에 의하여 정의된다고 할 것이다.

Claims (8)

  1. a) 서열번호 1에 기재된 만노스 6-인산 이성화효소 (mannose 6-phosphate isomerase)의 21번, 74번, 134번 잔기의 아미노산을 각각 라이신(K), 아스파라진(N), 메티오닌(M)에서 각각 글루탐산(E), 트레오닌(T), 아르지닌(R)으로 변환시킨 돌연변이체;
    b) 서열번호 1에 기재된 만노스 6-인산 이성화효소 (mannose 6-phosphate isomerase)의 67번, 238번 잔기의 아미노산을 각각 글루탐산(E), 트레오닌(T)에서 각각 글라이신(G), 아이소루신(I)으로 변환시킨 돌연변이체;
    c)서열번호 1에 기재된 만노스 6-인산 이성화효소 (mannose 6-phosphate isomerase)의 124번, 129번 잔기의 아미노산을 각각 라이신(K), 루신(L)에서 각각 아르지닌(R), 페닐알라닌(F)으로 변환시킨 돌연변이체;
    d) 서열번호 1에 기재된 만노스 6-인산 이성화효소 (mannose 6-phosphate isomerase)의 90번 잔기의 아미노산을 아스파라진(N)에서 알라닌(A), 아스파트산(D), 히스티딘(H) 또는 류신(L)으로 변환시킨 돌연변이체;
    e)서열번호 1에 기재된 만노스 6-인산 이성화효소 (mannose 6-phosphate isomerase)의 129번 잔기의 아미노산을 류신(L)에서 페닐알라닌(F), 또는 타이로신(Y)으로 변환시킨 돌연변이체;
    f)서열번호 1에 기재된 만노스 6-인산 이성화효소 (mannose 6-phosphate isomerase)의 90번 잔기의 아미노산을 아스파라진(N)에서 알라닌(A), 아스파트산(D), 히스티딘(H) 또는 류신(L)으로 변환시키고, 서열번호 1에 기재된 만노스 6-인산 이성화효소 (mannose 6-phosphate isomerase)의 129번 잔기의 아미노산을 류신(L)에서 페닐알라닌(F), 또는 타이로신(Y)으로 변환시킨 돌연변이체;
    g)서열번호 1에 기재된 만노스 6-인산 이성화효소 (mannose 6-phosphate isomerase)의 17번 잔기의 아미노산을 트립토판(W)에서 글루타민(Q)으로 변환시킨 돌연변이체;
    h)서열번호 1에 기재된 만노스 6-인산 이성화효소 (mannose 6-phosphate isomerase)의 17번 잔기의 아미노산을 트립토판(W)에서 글루타민(Q)으로 변환시키고, 서열번호 1에 기재된 만노스 6-인산 이성화효소 (mannose 6-phosphate isomerase)의 90번 잔기의 아미노산을 아스파라진(N)에서 알라닌(A)으로 변환시키고, 서열번호 1에 기재된 만노스 6-인산 이성화효소 (mannose 6-phosphate isomerase)의 129번 잔기의 아미노산을 류신(L)에서 페닐알라닌(F)으로 변환시킨 돌연변이체;
    i)서열번호 1에 기재된 만노스 6-인산 이성화효소 (mannose 6-phosphate isomerase)의 193 잔기의 아미노산을 알기닌(R)에서 알라닌(A)으로 변환시킨 돌연변이체; 및
    j)서열번호 1에 기재된 만노스 6-인산 이성화효소 (mannose 6-phosphate isomerase)의 17번 잔기의 아미노산을 트립토판(W)에서 글루타민(Q)으로 변환시키고, 서열번호 1에 기재된 만노스 6-인산 이성화효소 (mannose 6-phosphate isomerase)의 90번 잔기의 아미노산을 아스파라진(N)에서 알라닌(A)으로 변환시키고, 서열번호 1에 기재된 만노스 6-인산 이성화효소 (mannose 6-phosphate isomerase)의 129번 잔기의 아미노산을 류신(L)에서 페닐알라닌(F)으로 변환시키고, 서열번호 1에 기재된 만노스 6-인산 이성화효소 (mannose 6-phosphate isomerase)의 193 잔기의 아미노산을 알기닌(R)에서 알라닌(A)으로 변환시킨 돌연변이체로 구성된 군으로부터 선택된 만노스 6-인산 이성화효소 돌연변이체.
  2. 제1항의 만노스 6-인산 이성화효소 돌연변이체를 코딩하는 유전자.
  3. 제 2항에 있어서,
    상기 만노스-6-인산 이성화효소 돌연변이체를 코딩하는 유전자는 서열번호 2 내지 서열번호 11로 구성된 군으로부터 선택된 유전자.
  4. 제 2항 또는 제 3항의 만노스 6-인산 이성화효소 유전자를 포함하는 재조합 발현 벡터.
  5. a) 제 2항 또는 제 3항 중 어느 한 항의 유전자를 포함하는 발현벡터를 제조하고;
    b) 상기 발현벡터로 형질전환된 미생물을 배양하고;
    c) 상기 미생물로부터 만노스 6-인산 이성화효소를 분리하는 단계를 포함하는 제 1항의 만노스 6-인산 이성화효소 돌연변이를 제조하는 방법.
  6. 제 1항의 만노스 6-인산 이성화효소 돌연변이체를 이용하여 리보스를 생산하는 방법.
  7. 제 6항에 있어서, 상기 리보스는 L-리보스(L-ribose)이고, L-리불로오스(L-ribulose)를 기질로 사용하여 생산되는 것을 특징으로 하는 리보스를 생산하는 방법.
  8. 제 1항의 만노스 6-인산 이성화효소 돌연변이체를 포함하는 리보스 생산용 조성물.
PCT/KR2011/005149 2010-07-14 2011-07-13 지오바실러스 써모디니트리피칸스 유래 만노스-6-인산 이성화효소의 변이체 및 이를 이용한 엘-리보스 생산방법 WO2012008748A2 (ko)

Applications Claiming Priority (6)

Application Number Priority Date Filing Date Title
KR10-2010-0067901 2010-07-14
KR1020100067901A KR101063961B1 (ko) 2010-07-14 2010-07-14 신규한 만노스-6-인산 이성화효소 돌연변이체 및 그 용도
KR10-2010-0103592 2010-10-22
KR1020100103592A KR101155507B1 (ko) 2010-10-22 2010-10-22 신규한 만노스-6-인산 이성화효소 돌연변이체 및 그 용도
KR10-2011-0049206 2011-05-24
KR1020110049206A KR101282998B1 (ko) 2011-05-24 2011-05-24 지오바실러스 써모디니트리피칸스 만노스 6 인산 이성화효소의 변이체 및 이를 이용한 엘-리보스 생산방법

Publications (3)

Publication Number Publication Date
WO2012008748A2 true WO2012008748A2 (ko) 2012-01-19
WO2012008748A9 WO2012008748A9 (ko) 2012-04-05
WO2012008748A3 WO2012008748A3 (ko) 2012-06-21

Family

ID=45469923

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2011/005149 WO2012008748A2 (ko) 2010-07-14 2011-07-13 지오바실러스 써모디니트리피칸스 유래 만노스-6-인산 이성화효소의 변이체 및 이를 이용한 엘-리보스 생산방법

Country Status (1)

Country Link
WO (1) WO2012008748A2 (ko)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1994020627A1 (en) * 1993-03-02 1994-09-15 Sandoz Ltd. Mannose or xylose based positive selection
US6495317B1 (en) * 1996-10-15 2002-12-17 Board Of Trustees Of Michigan State University DNA encodingmannose 6-phosphate reductase and recombinants produced therefrom
EP1818398A1 (en) * 2006-02-14 2007-08-15 Universiteit Leiden Methods and means for metabolic engineering and improved product formation by micro-organisms
JP2009107957A (ja) * 2007-10-29 2009-05-21 Oriza Yuka Kk 保水用組成物

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1994020627A1 (en) * 1993-03-02 1994-09-15 Sandoz Ltd. Mannose or xylose based positive selection
US6495317B1 (en) * 1996-10-15 2002-12-17 Board Of Trustees Of Michigan State University DNA encodingmannose 6-phosphate reductase and recombinants produced therefrom
EP1818398A1 (en) * 2006-02-14 2007-08-15 Universiteit Leiden Methods and means for metabolic engineering and improved product formation by micro-organisms
JP2009107957A (ja) * 2007-10-29 2009-05-21 Oriza Yuka Kk 保水用組成物

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
DATABASE PROTEIN [Online] 28 April 2010 'mannnose-6 phosphate isomelase [Geobacillus thermodenitrificans NG80-2]' Database accession no. YP_001127480 *
SOO-JIN YEON ET AL.: 'Characterization of a mannose-6-phosphate isomerase from Geobacillus thermodenitrificans that converts monosaccharides' BIOTECHNOL LETT. vol. 31, no. 8, 2009, pages 1273 - 1278 *

Also Published As

Publication number Publication date
WO2012008748A9 (ko) 2012-04-05
WO2012008748A3 (ko) 2012-06-21

Similar Documents

Publication Publication Date Title
WO2018182345A1 (ko) 타가토스 생산용 조성물 및 이를 이용한 타가토스 제조방법
WO2019027267A2 (ko) Atp 포스포리보실 전이효소 변이체 및 이를 이용한 l-히스티딘 생산방법
WO2014196811A1 (ko) 타가토스의 제조방법
WO2018182354A1 (ko) 타가토스 생산용 조성물 및 이를 이용한 타가토스 제조방법
WO2017018863A1 (ko) 전환 활성이 향상된 헥수론산 c4-에피머화 효소 변이체 및 이를 이용한 d-타가토스의 제조 방법
WO2018021896A1 (ko) D-타가토스 전환 활성이 향상된 헥수론산 c4-에피머화 효소 변이체 및 이를 이용한 d-타가토스의 제조 방법
WO2018182355A1 (ko) 타가토스 생산용 조성물 및 이를 이용한 타가토스 제조방법
WO2018093153A1 (ko) 신규한 d-사이코스 3-에피머화 효소 및 이를 이용한 d-사이코스의 제조 방법
WO2015093831A1 (ko) Ｄ（－）２，３－부탄디올의 생성능이 증강된 재조합 미생물 및 이를 이용한 ｄ（－）２，３－부탄디올의 생산 방법
WO2019027173A2 (ko) 신규한 싸이코스-6-인산 탈인산효소, 상기 효소를 포함하는 사이코스 생산용 조성물, 상기 효소를 이용하여 사이코스를 제조하는 방법
WO2015133678A1 (ko) 향상된 전환 활성을 가지는 l-아라비노스 이성화효소 변이체 및 이를 이용한 d-타가토스의 생산 방법
WO2014148754A1 (ko) 2,3-부탄디올의 생성능이 증강된 재조합 미생물 및 이를 이용한 2,3-부탄디올의 생산 방법
WO2012102552A2 (ko) 3,6-안하이드로-ｌ-갈락토오스에 작용하는 신규한 3,6-안하이드로-ｌ-갈락토오스 데히드로게나제와 이 효소를 이용한 3,6-안하이드로 갈락토닉산의 생산
WO2019098723A1 (ko) 신규한 d-사이코스 3-에피머화 효소 및 이를 이용한 d-사이코스의 제조 방법
KR101081604B1 (ko) 두 단계 효소반응에 의한 엘-아라비노스로부터 엘－리보스의 생산 방법
WO2012008748A9 (ko) 지오바실러스 써모디니트리피칸스 유래 만노스-6-인산 이성화효소의 변이체 및 이를 이용한 엘-리보스 생산방법
WO2014137148A1 (ko) 향상된 전환 활성을 가지는 l-아라비노스 이성화효소 변이체 및 이를 이용한 d-타가토스의 생산 방법
WO2011049409A2 (ko) 신규한 만노스-6-인산 이성화효소, 그 돌연변이체 및 그 용도
WO2019112368A1 (ko) 신규한 사이코스-6-인산 탈인산효소, 상기 효소를 포함하는 사이코스 생산용 조성물, 상기 효소를 이용하여 사이코스를 제조하는 방법
WO2017164616A1 (en) Methods for preparing 3'-amino-2',3'-dideoxyguanosine by using nucleoside phosphorylases derived from bacillus and adenosine deaminase derived from lactococcus
WO2015046978A1 (ko) 2,3-부탄디올의 생성능이 증강된 재조합 미생물 및 이를 이용한 2,3-부탄디올의 생산 방법
WO2020067786A1 (ko) 신규 과당-4-에피머화 효소 및 이를 이용한 타가토스의 제조 방법
KR101063960B1 (ko) 신규한 만노스-6-인산 이성화효소 및 그 변이체 및 그 용도
KR101063961B1 (ko) 신규한 만노스-6-인산 이성화효소 돌연변이체 및 그 용도
WO2021029688A1 (ko) 신규 과당-4-에피머화 효소 및 이를 이용한 타가토스의 제조 방법

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 11807033

Country of ref document: EP

Kind code of ref document: A2

NENP Non-entry into the national phase in:

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 11807033

Country of ref document: EP

Kind code of ref document: A2