WO2012000150A1

WO2012000150A1 - Pcr primers for determining hla-a,b genotypes and methods for using the same

Info

Publication number: WO2012000150A1
Application number: PCT/CN2010/001813
Authority: WO
Inventors: 李剑; 刘莹; 陈仕平; 张彩芬
Original assignee: 深圳华大基因科技有限公司
Priority date: 2010-06-30
Filing date: 2010-11-12
Publication date: 2012-01-05
Also published as: CN101921842B; CN101921842A

Abstract

The present invention discloses PCR primers for determining HLA-A,B genotypes and the methods for using the same. The present invention also discloses kits for determining HLA-A,B genotypes, which comprise the PCR primers.

Description

HLA-A, PCR primers for B genotyping and methods of use thereof

The invention relates to the field of nucleic acid sequencing technology, in particular to the field of PCR sequencing technology. In particular, the present invention provides PCR primers for HLA-A, B (second generation sequencing) genotyping. In another aspect, the methods of the invention involve a method of typing DNA sequences, particularly a high resolution typing method for HLA genes. Background technique

Human leukocyte antigen (HLA), one of the most highly recognized gene systems discovered to date, is the main gene system that regulates human-specific immune responses and determines individual differences in disease susceptibility. The rejection of allogeneic organ transplantation is closely related. The study found that the higher the degree of HLA-related gene matching between donor and recipient, the higher the resolution and the longer the graft survival time.

Current international standard HLA genotyping technologies include PCR-SSP (sequence-specific primer polymerase chain reaction), PCR-SSO (polymerase chain reaction oligonucleotide probe hybridization) and PCR-SBT (polymerase chaining) The reaction product was directly sequenced and classified).

The principle of HLA-SSP is to design a set of allele-specific primers, and obtain HLA type-specific amplification products by PCR technology, and determine the HLA type by electrophoresis analysis. The principle of HLA-SSO is to design an HLA-type specific oligonucleotide sequence as a probe, label the PCR product, and hybridize with the PCR product (gene DNA to be detected). The HLA type is determined by detecting the fluorescent signal. The detection signals of HLA-SSP and HLA-SSO are analog signals, and the resolution can only reach the low level and can not detect the new allele. HLA-SBT is a region related to HLA gene (HLA-A/B genotyping is generally simultaneous amplification of 2, 3, 4 exons for typing, and PCR products are all longer than lkb) PCR amplification The amplified DNA product is directly subjected to Sanger sequencing (capillary microelectrophoresis) to determine the nucleic acid sequence, thereby determining the HLA genotype high-resolution typing method, which has the characteristics of being intuitive, high-resolution and capable of detecting new alleles. HLA-SBT's complex experimental procedures, low throughput and high cost make it difficult to apply to large-scale HLA high-resolution typing projects.

HLA-SBT based on the second generation sequencing method represented by Illumina GA (Illumina's Genome Analyzer sequencer) and Roche 454 (Roche) (hereinafter referred to as the new sequencing technology) is also a DNA amplified by PCR. The product directly measures the nucleic acid sequence to determine the HLA genotype high-resolution typing method. In addition to the original intuitive, high-resolution and capable of detecting new alleles, it also has single-molecule sequencing characteristics. Combined with PCR-index/barcode technology, a primer primer can be synthesized by adding a primer index to the 5th end of the PCR primer. A unique primer label can be introduced into each sample during the PCR process, so that the sample can be used in the second. In the detection process of DNA sequencing technology, except for the PCR step, which must be processed one by one, other experiments can mix multiple samples and process them at the same time. Finally, the detection result of each sample can be retrieved through its unique primer label sequence; The method has the characteristics of low cost, large flux and multiple different gene loci that can simultaneously detect a large number of samples. However, compared with the first-generation sequencing technology (sequencing technology based on the Sanger sequencing principle), the DNA length of the sequencing library that can be used for the new sequencing technology can not be too long (Illunina GA's maximum applicable length is 700bp), plus The new sequencing technology is generally short, and the current Illumina GA bidirectional read length can only reach 200bp. The PCR primers originally used for the HLA-SBT method are no longer applicable. Combined with the characteristics of the new HLA sequencing technology, the length of the PCR product should not exceed 700 bp. Summary of the invention

In view of the fact that the existing new sequencing technology requires the length of the DNA template and the short read length of the new sequencing technology, the PCR primers originally used for the HLA-SBT method are no longer suitable for the HLA high-resolution typing method based on the new sequencing technology. The present invention devised a novel set of PCR primers with specificity and conservation of the exons 2, 3 and 4 of the HLA-Α, Β gene, respectively, and the PCR product length is not more than 700 bp, which is especially suitable for Illumina. GA (currently the maximum DNA length for Illumina GA is 700bp). The set of PCR primers provided by the present invention can be used for large-scale, high-throughput and low-cost HLA genotyping of subjects, particularly humans.

The technical solution adopted by the present invention is to plant all the latest HLA-A/B gene sequences from the IMGT/HLA Internet site (http://www.ebi.ac.uk/imgt/hla/) and then save them to the local disk. As the HLA-A data set; simultaneously download all the latest non-HLA-A HLA-I gene sequences as comparative data sets. The two data sets were compared, and the conserved and specific sequences of each gene locus were searched for both ends and inside of exons 2, 3, and 4, and the designed PCR primer sequences were compared with the human genome sequence for homology. Since the HLA-A/B gene has high sequence similarity to other genes belonging to the HLA class I molecule, try to ensure primer 3 and terminal specificity when designing PCR primers, and ensure that the primers amplify the HLA-A/B gene. Specificity. At the same time, the length of the PCR product is less than 700 bp, and the annealing temperature of the positive and negative primers is substantially the same.

Multiple pairs of candidate HLA-A/B primers that meet the design requirements were used to amplify a small number of template DNAs with common serotypes of HLA-A/B, and the most conservative and specific ones were selected for amplification 2 , 6 pairs of HLA-A/B PCR primers for exon 3, exon 4. Based on the selected 6 pairs of PCR primers, 95 sets of label primers were designed to amplify 95 DNA templates with common serotypes of HLA-A/B. The HLA type of this part of the template includes all common HLA- A/B serotype). All PCR products were mixed in equal amounts and sequenced with Illumina GA Pair-End 100. The assembled sequencing results were compared to the original typing results to verify the conservation and specificity of the PCR primers.

The HLA-Α, Β-site primers designed by the present invention, that is, the PCR primers for 6 pairs of HLA-A/B for amplifying exons 2, 3, and 4, respectively, are shown in Table 1.

Table 1 HLA-Α, Β site PCR primers

In one aspect, the invention provides a set of PCR primers for HLA-A, B genotyping, characterized in that the PCR primers are shown in Table 1. Another aspect of the invention provides a method for sequencing of the PCR primers shown in Table 1, comprising:

Providing a sample, in particular a blood sample, preferably from a mammal, in particular a human;

Amplification: The PCR primer is used to amplify DNA derived from a blood sample to obtain a PCR product, and the PCR product is purified;

Sequencing: The PCR product is sequenced by Sanger sequencing or second generation sequencing (eg HiSeq 2000, Illumina GA and Roche454)

Another aspect of the present invention provides the use of the PCR primers shown in Table 1 for HLA genotyping, characterized in that the PCR primers described above are used for assembly and alignment analysis according to the sequencing results obtained by the above methods, and the sequencing results are obtained. The HLA genotyping results were obtained by comparison with standard sequences in the database.

In another aspect, the present invention provides a kit for performing HLA genotyping, which comprises the PCR primer of the present invention.

In another aspect of the invention, a method of HLA typing is provided, comprising:

1) providing n samples, n being an integer greater than or equal to 1, the sample preferably being from a mammal, more preferably a human, in particular a human blood sample;

2) divide the n samples to be analyzed into m groups, m is an integer and n > m > l ;

3) Amplification: For each sample, a pair of label primers are used, and in the presence of a template from the sample, PCR amplification is carried out under conditions suitable for amplifying the nucleic acid of interest, wherein each pair of label primers comprises primers The label's forward label primer and reverse label primer (both may be degenerate primers), wherein the forward label primer and the reverse label primer may contain the same or different primer labels; the primers in the label primer pair used for different samples Labels are different from each other; 4) mixing: mixing PCR amplification products of each sample to obtain a PCR product library;

5) interruption: the resulting PCR product library is incompletely interrupted;

6) Database construction: Combine the library linker technology to construct a PCR-Free sequencing library from the interrupted PCR product library, and recover all the lengths of the sequencer from the maximum read length of the sequencer used to the longest DNA length range used by the sequencer used. DNA bands, different library adapters can be added to the library to distinguish different PCR-Free sequencing libraries;

7) Sequencing: The recovered DNA mixture is sequenced using a second-generation sequencing technique, preferably a Pair-End technique (eg, IHumina GA), to obtain a sequence of the interrupted DNA;

8) Stitching: Based on the different library linker sequences of each library and the unique primer tags of each sample, the obtained sequencing results are in one-to-one correspondence with the samples, and the alignment products (for example, Blast, BWA program) are used to locate the PCR products. On the corresponding DNA reference sequence, the complete target nucleic acid is spliced from the sequence of the broken DNA by sequence overlap and linkage.

In a specific embodiment of the present invention, in the method described above, the binding library linker technology, constructing a PCR-free sequencing library from the disrupted PCR product library means using m library linkages to 4 a library of m PCR products obtained by adding a linker, wherein each PCR product library uses a different library linker to construct m linker tag sequencing libraries; m linker tag sequencing libraries are equimolarly mixed to construct a mixture Linker tag sequencing library. The method of ligating the library linker means that the DNA ligase is directly ligated without a PCR program.

In a specific embodiment of the invention, in the method described above, each A pair of primer tags and PCR primer pairs are combined into a pair of tag primers, and the 5th ends of the forward and reverse PCR primers have (or are optionally joined by a linker sequence) a forward primer tag and a reverse primer tag, respectively.

In a specific embodiment of the present invention, in the method described above, the PCR primer is a PCR primer for amplifying a specific gene of HLA, preferably for amplifying HLA-A/B 2, 3 PCR primers for exon 4 and exon 2 of HLA-DRB1, preferably the PCR primers are shown in Table 3.

A set of PCR primers for HLA genotyping provided by the present invention, wherein

1) 6 pairs of PCR primers amplified the sequence of exon 2, 3, and 4 of HLA-A and B, and the length of PCR products was within 700 bp.

2) Primers are well conserved and have good specificity. DRAWINGS

Figure 1: The electrophoresis results of the corresponding exon PCR products of sample No. 1 HLA-A/B/DRB1. From the electropherogram, the PCR product is a series of single bands with a fragment size of 300bp-500bp, wherein lane M is the molecular weight marker. (DL 2000, Takara), Lanes 1-7 are HLA-A/B/DRB1 exons (A2, A3, A4, B2, B3, B4, DRBl-2) PCR amplification products , Negative control (N) without amplified bands. The results for the other samples are similar.

Figure 2: DNA electrophoresis after HLA-Mix is interrupted (before and after tapping), and the tapping area is 450-750 bp. Lane M is a molecular weight marker (NEB-50bp DNA Ladder), lane 1 is the electrophoresis of HLA-Mix before tapping, and lane 2 is the gel of HLA-Mix after tapping.

Figure 3: Screenshot of the sample consensus sequence constructor, which illustrates the splicing of PCR products based on the overlap between primer tags and DNA fragments. The complete sequence. A query for HLA typing naming can be found at http://www.ebi.ac.uk/imgt/hla/align.html. From the result output column on the left, we see the results of all coding sequences of A*02:03:01 A*ll:01:01, where the sequence of exon 2 is identical to the original known result of template No. 1. detailed description

The embodiments of the present invention are described in detail below with reference to the accompanying drawings.

In the embodiment of the present invention, the PCR primers of the present invention and the PCR primers of the HLA-DRB1 exon 2 are used to perform HLA-A/B/DRB1 PCR amplification on 95 blood samples of common HLA genotypes. The amplified product was sequenced by IHumina GA Pair-End 100, and the sequencing results were obtained by assembly and comparative analysis. Example 1

Sample extraction

DNA was extracted from 95 blood samples of known HLA-SBT typing (Chinese Hematopoietic Stem Cell Donor Database (hereinafter referred to as "Zhonghua Marrow Bank") using a KingFisher Automatic Extractor (Thermo Corporation, USA). The main steps are as follows: Take out the deep hole plate and one shallow hole plate of 6 Kingfisher automatic extractor. Add a certain amount of matching reagents according to the instructions and mark them. Place all the well plates with reagents as required. In the corresponding position, select the program "Bioeasy_200ul Blood DNA-KF.msz" and press "star" to execute the program for nucleic acid extraction. At the end of the program, the lOOul elution product in the plate Elution is collected. DNAO Example 2

Different PCR tag primers can be made by synthesizing PCR primers with different primer tags at the 5' end, such that different PCR tag primers can be used for different samples, the PCR primers are for HLA-A/B 2, 3, 4 Exon exon and PCR primers for exon 2 of HLA-DRB1. Primer tags are then introduced at both ends of the PCR product by PCR to specifically label PCR products from different samples.

95 sets of PCR primers were used to amplify 95 DNA samples, each set of PCR tag primers consisting of a pair of bidirectional primer tags (Table 2) and exons 2, 3, 4 for amplifying HLA-A/B and A PCR primer consisting of exon 2 of HLA-DRB1 (Table 3), wherein each forward PCR primer has a forward primer label attached to a pair of primer tags at the 5' end, and a 5' end of the reverse PCR primer is ligated. A reverse primer label for a pair of primer tags. The primer tag is added directly to the 5, end of the PCR primer when the primer is synthesized.

The 95 DNAs obtained in the sample extraction step of Example 1 were sequentially numbered 1-95, and the PCR reaction was carried out in a 96-well plate for 7 plates, numbered HLA-P-A2, HLA-P-A3, HLA. -P-A4, HLA-P-B2, HLA-P-B3, HLA-P-B4 and HLA-P-DRB1-2 (A2/3/4, B2/B3/B4, DRB1-2 for amplification) Site), a negative control without template was set in the plate, and the primer used in the negative control was the same as the corresponding primer of template 1. At the same time as the experiment, record the sample number information corresponding to each pair of primer labels.

Table 2, Primer Label Information

-οι-

£18T00/010ZN3/X3d OSTOOO/ZIOZ OAV -II-

100/010ZN3/X3d OSTOOO/ZIOZ OAV -z\-

100/010ZN3/X3d- OSIOOO/ZTOZ OAV PI-75 ATCGACTATGCT CGATCATATGAG G3 75

PI-76 ATACTAGCATCA TCATGCTGACGA G4 76

PI-77 CACTGACGCTCA CACTACATCGCT G5 77

PI-78 TCGCTCATCTAT TAGTACAGAGCT G6 78

PI-79 TGTATCACGAGC ATGATCGTATAC G7 79

PI-80 TACTGCTATCTC CGCTGCATAGCG G8 80

PI-81 CGCGAGCTCGTC ACTCGATGAGCT G9 81

PI-82 TAGAGTCTGTAT TGTCTATCACAT G10 82

PI-83 TACTATCGCTCT TATGTGACATAC Gil 83

PI-84 TAGATGACGCTC TACTCGTAGCGC G12 84

PI-85 TCGCGTGACATC ATCTACTGACGT HI 85

PI-86 ACACGCTCTACT ACAGTAGCGCAC H2 86

PI-87 TACATAGTCTCG CTAGTATCATGA H3 87

PI-88 TGAGTAGCACGC TCGATCATGCAG H4 88

PI-89 TAGATGCTATAC TACATGCACTCA H5 89

PI-90 ATCGATGTCACG CAGCTCGACTAC H6 90

PI-91 ATCATATGTAGC CTCTACAGTCAC H7 91

PI-92 TAGCATCGATAT AGATAGCACATC H8 92

PI-93 TGATCGACGCTC CTAGATATCGTC H9 93

PI-94 TGCAGCTCATAG TACAGACTGCAC H10 94

PI-95 CGACGTAGAGTC CAGTAGCACTAC Hl l 95

Table 3, PCR primers for amplifying the corresponding exons of HLA-A/B/DRB1 before the primer label was added Primer number primer sequence primer use product length

A-F2 CCTCTGYGGGGAGAAGCAA Expand HLA-A gene 2

480bp

A-R2 ATCTCGGACCCGGAGACTG exon

A-F3 CGGGGCCAGGTTCTCACAC Expands HLA-A gene 3

410bp

A-R3 GGYGATATTCTAGTGTTGGTCCCAA exon

A-F4 GTGTCCCATGACAGATGCAAAA Expand HLA-A gene 4

430bp

A-R4 GGCCCTGACCCTGCTAAAGG exon

B-F2 AGGAGCGAGGGGACCGCA Expand HLA-B gene 2

400bp

B-R2 CGGGCCGGGGTCACTCAC exon

B-F3 CGGGGCCAGGGTCTCACA expansion HLA-B gene 3

370bp

B-R3 GAGGCCATCCCCGGCGAC exon

B-F4 GCTGGTCACATGGGTGGTCCTA expansion HLA-A gene 4

380bp

B-R4 CTCCTTACCCCATCTCAGGGTG exon

D2-F1 CACGTTTCTTGGAGTACTCTA

D2-F2 GTTTCTTGTGGCAgCTTAAgTT

D2-F3 CCTGTGGCAGGGTAAGTATA

D2-F4 GTTTCTTGAAGCAGGATAAGTT Expansion HLA-DRB1 base

300bp

D2-F5 GCACGTTTCTTGGAGGAGG due to exon 2

D2-F6 TTTCCTGTGGCAGCCTAAGA

D2-F7 GTTTCTTGGAGCAGGTTAAAC

D2-R CCTCACCTCGCCGCTGCAC

D2-F1, D2-F2, D2-F3, D2-F4, D2-F5, D2-F6, D2-F7 are forward primers for amplifying HLA-DRB1 exon 2, and D2-R is for amplifying HLA- Reverse primer for exon 2 of DRB1.

The PCR procedure for HLA-A/B/DRB1 is as follows: 96 X: 2min

95 X: 30s -> 60X 30s ^72 X: 20s (32cycles) 15X oo

The PCR reaction system of HLA-A/B is as follows

The PCR reaction system of HLA-DRB1 is as follows:

Promega Taq ( 5U/ul ) 0.2ul

DNA (about 20 ng/ul) 5.0ul

ddH ₂ 0 4.8ul

Total 25.0ul

Wherein, PI _nr A/B/D2-F _{1/2 5/6/7} represents primer 5, and the F-primer of HLA-A/B/DRB1 with the nth forward primer tag sequence (Table 1) at the end, PI _Nr A/B/D2-R _2/3/4 denotes primer 5, the R primer of HLA-A/B/DRB1 with the nth reverse primer tag sequence at the end (here n < 95 ), and so on . And each sample corresponds to a specific set of PCR primers ( PI _nr A/B/D2-F _{1/2/3/4/s/6/7} PI _n A/B/D2-R _2/3/4 )

The PCR reaction was run on a Bio-Rad PTC-200 PCR machine. After the PCR was completed, 2 ul of the PCR product was detected by 1% agarose gel electrophoresis. Figure 1 shows the results of electrophoresis of the corresponding exon PCR product of sample No. 1 HLA-A/B/DRB1. The DNA molecular marker is DL 2000 ( Takara), and a series of fragments with a fragment size of 300bp-500bp are shown on the gel map. The HLA-A/B/DRB1 exons of sample No. 1 (A2 A3 A4 B2 B3 B4 DRB1-2 ) were successfully amplified by PCR, and the negative control (N) had no amplified bands. The results of other samples are similar to this. Example 3

PCR product mixing and purification

From the remaining PCR product of 96-well plate HLA-P-A2 (except the negative control), 20 ul each was mixed in a 3 ml EP tube, labeled as HLA-A2-Mix, and the same operation was performed on the other 6 96-well plates. , labeled HLA-A3-Mix HLA-A4-Mix HLA-B2-Mix HLA-B3-Mix, HLA-B4-Mi and HLA-D2-Mix, oscillating and mixing from HLA-A2-Mix HLA-A3- Mix HLA-A4-Mix HLA-B2-Mix HLA-B3-Mix HLA-B4-Mix and 200 ul of HLA-D2-Mix was mixed in a 3 ml EP tube, labeled as HLA-Mix, and 500 ul of DNA mixture from HLA-Mix was purified by Qiagen DNA Purification kit (QIAGEN). See the instructions), 200 ul of DNA obtained was purified, and the concentration of HLA-Mix DNA was determined to be 48 ng/ul by Nanodrop 8000 (Thermo Fisher Scientific). Example 4

Interruption of PCR products and construction of Illumina GA PCR-Free sequencing library

DNA interruption

A total of 5 ug of DNA from the purified HLA-Mix was disrupted on Covaris S2 (Covaris) using Covaris microTube with AFA fiber and Snap-Cap. The breaking conditions are as follows:

Frequency sweeping

2. Purification after interruption

All the disrupted products of HLA-Mix were recovered and purified by QIAquick PCR Purification Kit and dissolved in 37.5 ul of EB (QIAGEN Elution Buffer);

3. End repair response

DNA end-repairing reaction of HLA-Mix purified after interruption, such as The following (reagents are all purchased from Enzymatics):

DNA 37.5μί

H ₂ 0 37.5 μί Polynucleotide Kinase Bufferi B904 ) 10 dNTP mixture (10 mM each) ( Solution Set ( lOmM each ) ) 4

T4 DNA Polymerase (T4 DNA Polymerase) 5 μL·

Klenow Fragment (Kleno Fragment)

T4 Polynucleotide Kinase 5μL Total volume 100

The reaction conditions were: Thermomixer (Eppendorf) 20 warm bath 30 miii.

The reaction product was recovered by QIAquick PCR Purification Kit and dissolved in 34 μM EB (QIAGEN Elution Buffer).

4. 3, end plus A reaction

The DNA was recovered in the previous step, and the end was added with A reaction. The system was as follows (reagents were purchased from Enzymatics):

DNA obtained in the previous step 32

10x blue buffer ( 10x blue buffer ) 5 μL· dATP (lmM, GE) 10 μΐ

Klenow (3'-5' exo-) 3 Total volume 50

The reaction conditions were: Thermomixer 37 warm bath for 30 min. The reaction product was recovered and purified by a MiniElute PCR Purification Kit (QIAGE) and dissolved in a 13 μM solution (QIAGEN Elution Buffer).

5. Linking Illumina GA PCR-Free library adaptor The term "PCR-Free library adaptor" refers to a designed base that is designed to assist in the immobilization of DNA molecules on sequencing chips and to provide universal sequencing primers. The binding site of the PCR-Free library linker can be directly ligated to the DNA fragment in the sequencing library by DN A ligase. The introduction process of the linker is called PCR-Free library linker because there is no PCR involved.

The product after addition of A was ligated to the Illumina GA PCR-Free library linker, and the system was as follows (reagents were purchased from Illumina):

DNA obtained in the previous step Ι ΐμί

2\ Rapid ligation buffer ( 2x Rapid ligation buffer )

PCR-free oligonucleotide linker mix (30mM) (PCR-free Adapter Ιμί

Oligo mix )

T4 DNA Ligase (Rapid, L603-HC-L) 3μL · Total volume 30 μL

The reaction conditions were: Thermomixer 20" C bath for 15 min.

The reaction product was purified by Ampure Beads (Beckman Coulter Genomics) and dissolved in 50 ul of deionized water. The DNA concentration was determined by real-time PCR (QPCR) as follows:

6. Tapping recycling

30 L of HLA-Mix was recovered with 2% low melting point agarose gel. Electrophoresis conditions are 100V, 100min. The DNA marker is a 50 bp DNA marker from NEB. The taper recovers a DNA fragment of 450-750 bp in length (Fig. 2). The recovered product was recovered and purified by QIAquick PCR Purification Kit (QIAGEN). After purification, the volume was 32 ul. The DNA concentration was 10.16 nM by real-time PCR (QPCR). Example 5

Illumina GA sequencing

According to the QPCR test results, lOpmol DNA was sequenced using the Illumina GA PE-100 program. For details, see the Illumina GA operating instructions (Illumina).

GA H x ). Example 6

Result analysis

The sequencing result of Illumina GA is a series of DNA sequences. By searching the sequence of the positive and negative primers in the sequencing results and the primer sequences, the sequencing results of each of the primers corresponding to the primers HLA-A/B/DRB 1 are established. Database. The sequencing results of each exon are mapped to the reference sequence of the corresponding exon by BWA (Burrows-Wheeler Aligner) (reference sequence source: http://www.ebi.ac.uk/imgt/hla/) Build consistency across databases

(consistency) sequence, and then the DNA sequence in the database is screened and sequenced for error correction. Corrected DNA sequence through sequence overlap and linkage

The (pair-End linkage) relationship can be assembled into the corresponding sequence of each exon of HLA-A/B/DRB1. The resulting DNA sequence is aligned with the sequence database of the corresponding exons of HLA-A/B/DRB 1 in the IMGT HLA professional database, and the sequence alignment results are obtained. The 100% match is the HLA-A/B/DRB1 genotype of the corresponding sample. A screenshot of the exon 2 consensus sequence constructor for the HLA-A site of sample No. 1 illustrated in Figure 3 can be seen.

For all 95 samples, the results obtained were completely consistent with the original known classification results. The specific results of samples 1-32 are as follows:

Sample No. Original -A/B/DRB1 Type

1 A*02:03 A*ll:01 B' ^k 38:02 B*48:01 DRB1 *14:54 DRB1*15:01

2 A*01:01 A*30:01 B' ^k 08:01 B' ^fc 13:02 DRB1 "03:01 DRB1*07:01

3 A*01:01 A*02:01 B'"15:11B' ^fe 47:01 DRB1' *13:02 DRB1*15:01

4 A*24:08 A*26:01 B*40:01 B' ^fe 51:01 DRB1 ^fc 04:04 DRB1*09:01

5 A*01 :01 A*24:02 B' ^k 54:01 B'"=55:02DRB1' *04:0S DRB1*09:01

6 A*01 :01 A*03:02 B ^j 45:11 B' 7:01 DRBl'"10:01 DRB1*14:54

7 A*ll:01 A*30:01 B' ^k 13:02 B' ^k 15:18 DRB1' ^fc 04:04 DRB1*07:01

8 A*01 :01 A*02:01 B*35:03 B' ^k 81 :01 DRBl' ^k ll:01 DRB1*15:01

9 A*02:06 A*31:01 B ^j ^27:07 B ^j 40:02 DRBl'"=03:01 DRB1*13:02

10 A*01 :01 A*66:01 B ^j 37:01 49:01 DRBl'"=10:01 DRB1*13:02

11 A*01:01 A*03:01 35:01 ^K 52:01 DRBl' ^OI JOI DRB1*15:02

12 A*ll:01 A*ll:01 B ^{J k} 15:01 B ^J 45:05 DRBl'"04:06 DRB1H5:01

13 A*01:01 A*ll:02 B ^{J k} 07:02 45:02 DRBl' ^09:01 DRB1*15:01

14 A*01:01 A*02:01 B ^jk 52:01 ^67:01 DRBl'"=15:02 DRB1*16:02

15 A*01:01 A*02:05 B ^j 5:17 ^k 50:01 DRBl' ^k 07:01 DRB1*15:01

16 A*01:01 A*ll:01 B ^{J k} 37:01 B ^{J k} 40:02 DRBl' •=10:01 DRB1 *12:02

17 A*24:07 A*32:01 B ^J 35:05 B ^{J k} 40:01 DRBl'"03:01 DRB1*04:05

18 A*ll:01 A*24:02 43:01 B ^jk 35:01 DRBl' 46:02 DRB1*16:02

19 A*ll:01 A*ll:01 40:02 ^k 55:12 DRBl'"04:05 DRB1*15:01

20 A*02:ll A*24:02 B*40:01 B ^{j fc} 40:06 DRBl' 41:01 DRB1*15:01

21 A*01:01 A*02:06 ^fc 51:01 B" ^k 57:01 DRBl^ ^k 07:01 DRB1*12:01

22 A*01:01 A*29:01 B*07:05 45:01 DRBl ' ^04:05 DRB1*07:01

23 A*01:01 A*02:07 '37:01 46:01 DRB1 ^J ^04:03 DRB1*10:01

24 A*24:85 A*30:01 B" 13:02 B ^V 5:02 DRB1 ^J ^K 07:01 DRB1*15:01

25 A*ll:01 A*31:01 ^07:06 1:01 ORBV 42:02 DRB1*14:05

26 A*01:01 A*ll:01 '46:01 B"'57:01 ORBV ^k 07:01 DRB1*08:03

27 A*01:01 A*02:01 B*15:18 B" '37:01 ORBV ^4:01 DRB1*15:01

28 A*01:01 A*24:02 B" 37:01 B"'46:01 ORBV ^k 09:01 DRB1*10:01

29 A*26:01 A*66:01 B*40:40 B*41:02 ORBV ^k 12:01 DRB1*15:01

30 A*02:01 A*29:02 B" 13:02 45:01 ORBV ^k 03:01 DRB1 *12:02

31 A*01:01 A*ll:03 15:01 57:01 ORBV ^07:01 DRB1*15:01 32 A * ll: 01 A * 26: 01 B * 35: 03 B * 38:! 01 DRB1 "11:03 measured sample number of HLA-A / B / DRBl typed

1 A*02:03 A*ll:01 B'"3S:02 B ^fc 48:01 DRB1' ^fc 14:54 DRB1*15:01

2 A*01:01 A*30:01 B*08:01 B*13:02 DRB1' ^3⁄4 03:01 DRB1*07:01

3 A*01:01 A*02:01 B' ^k 15:ll B*47:01 DRBl^ ^ 13:02 DRB1*15:01

4 A*24:08 A*26:01 B' ^k 40:01 B' ^fc 51:01 DRB1' ^04:04 DRB1*09:01

5 A*01:01 A*24:02 B'"=54:01 B *55:02 DRB1' ^3⁄4 04:05 DRB1 *09:01

6 A*01:01 A*03:02 B'"15:11B' ^k 37:01 DRB1 ^{J fe} 10:01 DRB1*14:54

7 A*ll:01 A*30:01 B'"13:02B'"15:18 DRBl ^j ^04:04 DRB1*07:01

8 A*01:01 A*02:01 B' 5:03 B' ^k 81:01 DRBl ^j 1:01 DRB1*15:01

9 A*02:06 A*31:01 B*27:07 B' 0:02 DRBV ^03:01 DRB1 *13:02

10 A*01 :01 A*66:01 B*37:01 B*49:01 DRBV ^k 10:01 DRB1*13:02

11 A*01:01 A*03:01 "35:01 B' "52:01 ORBV ^1:01 DRB1*15:02

12 A*ll:01 A*ll:01 B ^j 5:01 B' 45:05 DRBV ^04:06 DRB1*15:01

13 A*01:01 A*ll:02 B' ^7:02 B' 45:02 DRBV ^fc 09:01 DRB1*15:01

14 A*01:01 A*02:01 ^k 52:01 B' ^67:01 DRBV 45:02 DRB1*16:02

15 A*01:01 A*02:05 ' 45: 17 ^50:01 DRBV ^k 07:01 DRB1*15:01

16 A*01:01 A*ll :01 ^k 37:01 B' ^k 40:02 DRBV 0:01 DRB1*12:02

17 A*24:07 A*32:01 ^k 35:05 B' ^k 40:01 ORBV '03:01 DRB1*04:05

18 A*ll:01 A*24:02 B ^{J k} 13:01 ^fe 35:01 DRBV = 16:02 DRB1*16:02

19 A*ll:01 A*ll:01 B ^{j fc} 40:02 B' ^fe 55:12 DRBV ^04:05 DRB1*15:01

20 A*02:ll A*24:02 B ^vk 40:01 40:06 ORBV 41:01 DRB1*15:01

21 A*01:01 A*02:06 B ^{J k} 51:01 B ^{J k} 57:01 DRB1" (07:01 DRB1*12:01

22 A*01:01 A*29:01 ^k 07:05 B ^j 45:01 DRB1"'04:05 DRB1 *07:01

23 A * 01: 01 A * 02: 07 k 37:01 fe 46:01 DRB1 "= 04: 03 DRB1 * 10: 01

24 A*24:85 A*30:01 13:02 B ^J 5:02 DRBV '07:01 DRB1*15:01

25 A*ll:01 A*31:01 B*07:06 ^k 51:01 DRBV 12:02 DRB1*14:05

26 A*01:01 A*ll:01 B"'46:01 ^k 57:01 ORBV '07:01 DRB1*08:03

27 A*01:01 A*02:01 B" '15:18 37:01 DRB1*04:01 DRB1*15:01

28 A*01:01 A*24:02 B''37:01B' ^k 46:01 DRB 09:01 DRB1 *10:01

29 A*26:01 A*66:01 40:40 =41:02 DRB1* 12:01 DRB1*15:01

30 A*02:01 A*29:02 B* '13:02 B" '45:01 DRBl* 03:01 DRB1*12:02

31 A*01:01 A* 11 :03 B* 15:01 7:01 DRB1* 07:01 DRB1*15:01

32 A*ll:01 A*26:01 B*35:03 '38:01 DRB1 " 11:03 DRB1*14:04 Note: DRB1* 1201 in HLA-DRBl type is not excluded

The possibility of DRB1*1206/1210/1217, DRB1*1454 does not exclude DRB1*1401 The possibility, because the above alleles are identical in the sequence of exon 2 of HLA-DRB1. Although specific embodiments of the invention have been described in detail, those skilled in the art will understand. Various modifications and substitutions may be made to those details in light of the teachings of the invention, which are within the scope of the invention. The full scope of the invention is given by the appended claims and any equivalents thereof. references

[1]. http://www.ebi.ac.ukyimgt/hla/stats.html

[2]. Tiercy J M. Molecular basis of HLA polymorphism: implications in clinical transplantation. [J]. Transpl Immunol, 2002, 9: 173-180.

[3]. C. Antoine, S. Miiller, A. Cant, et al. Long-term survival and transplantation of haemopoietic stem cells for immunodeficiencies: report of the European experience. 1968-99.

[J], The Lancet, 2003, 9357: 553-560.

[4]. H. A. Erlich, G. Opelz, J. Hansen, et al. HLA DNA Typing and Transplantation.

[J]. Immunity, 2001, 14: 347-356.

[5]. Lillo R, Balas A, Vicario JL, et al. Two new HLA class allele, DPBl*02014, by sequence-based typing. [J]. Tissue Antigens, 2002, 59: 47-48.

[6]. A. Dormoy, N. Froelich . Leisenbach, et al. Mono-allelic amplification of exons 2-4 using allele group-specific primers for Sequence-based typing (SBT) of the HLA-A, -B and -C genes: Preparation and validation of ready-to-use pre-SBT mini-kits. [J]. Tissue Antigens, 2003, 62: 201-216 .

[7], Elaine R. Mardis. The impact of next-generation sequencing technology on genetics. [J]. Trends in Genetics. 2008, 24: 133-141.

[8]. Christian Hoffmannl, Nana Minkahl, Jeremy Leipzig. DNA bar coding and pyrosequencing to identify rare HIV drug resistance mutations. [J]. Nucleic Acids Research, 2007, 1-8

[9]. Sayer D, Whidborne R, Brestovac B. HLA-DRBl DNA sequencing based typing: an approach suitable for high throughput typing including unrelated bone marrow registry donors. [J]. Tissue Antigens. 2001, 57(l):46 -54.

Claims

Rights request

1. A set of PCR primers for HLA-A, B genotyping, characterized in that the PCR primers are as shown in Table 1, preferably the analysis is based on sequencing, including second generation sequencing, and Sanger method .

2. A method for sequencing of a PCR primer according to claim 1, comprising: providing a sample, in particular a blood sample, preferably from a mammal, in particular a human;

Sequencing: The PCR product is sequenced, either by Sanger sequencing or by second generation sequencing (eg, HiSeq 2000, Illumina GA, and Roche454).

The use of the PCR primer according to claim 1 for HLA genotyping, characterized in that the PCR primer according to claim 1 is used, and the results obtained by the method according to claim 2 are assembled and aligned, and The sequencing results were compared with the standard sequences in the database to obtain HLA genotyping results.

A kit for performing HLA genotyping, which comprises the PCR primer of claim 1.