CN101654691B

CN101654691B - Method for amplifying and typing HLA gene and relevant primer thereof

Info

Publication number: CN101654691B
Application number: CN2009101742031A
Authority: CN
Inventors: 李剑; 瞿京辉; 杜金伟; 王莉萍; 张红云; 田中�明; 黄常健; 许婷婷; 沈苗忠; 杨华志; 甄贺富; 陈浩; 潘捷; 余艳华; 陈演华; 廖宽震; 姜范波; 华桑; 刘丹; 叶葭
Original assignee: SHENZHEN HUADA GENE HEALTH TECHNOLOGY Co Ltd
Current assignee: Bgi Diagnosis Co ltd; BGI Shenzhen Co Ltd
Priority date: 2009-09-23
Filing date: 2009-09-23
Publication date: 2013-12-04
Anticipated expiration: 2029-09-23
Also published as: WO2011035550A1; CN101654691A

Abstract

The invention provides a method for amplifying an HLA gene and a specificity primer pair used by the method and also provides a method for typing the HLA gene and an amplifying primer pair and a sequencing primer pair which are used by the method.

Description

HLA gene amplification and methods of genotyping and relevant primer thereof

Technical field

The present invention relates to biology field, particularly, the present invention relates to amplification and classifying method for HLA-A, HLA-B and HLA-C gene, and the Auele Specific Primer used in described method.

Background technology

Human leucocyte antigen, HLA (human leukocyte antigen), be regulation and control human body specific immune response and the oligogene system that determines the disease susceptibility individual difference, closely related with the rejection of allogeneic organ transplantation.

The HLA system plays an important role at aspects such as antigen recognition, antigen presentation, immunne response and regulation and control, destruction exotic antigen target cells, is the essential substance basis that causes immunological rejection.Graft cell surface I class and II class antigen are all strong transplantation antigens, and humoral immunization and cellular immunization have all participated in the rejection to graft, no matter are the transplanting of recessive allele organ, tissue or cell, and for HLA between acceptor, matching is successful key.

The HLA typing method of international standard is PCR-SSP (sequence specific primer-oligomerization polymerase chain reaction) at present, PCR-SSO (polymerase chain reaction oligonucleotide probe hybridization) and PCR-SBT (polymerase chain reaction product sequencing based type).

The principle of SSP is to design a whole set of allelotrope group-specific primers, by round pcr, obtains the special amplified production of HLA type, by electrophoretic analysis, determines the HLA type.Its shortcoming is to be difficult for automatization; Can not detect new allelotrope; Test kit needs constantly upgrading; Detection signal is simulating signal.

The principle of SSO is to design the special oligonucleotide sequence of HLA type as probe, the PCR product is carried out to mark, with PCR product (gene DNA to be detected) and probe hybridization.Judge HLA gene type by detection signal.Shortcoming is to detect new allelotrope, and resolving power is not high enough; Detection signal is simulating signal.

SBT a kind ofly carries out determining nucleic acid sequence by the DNA to after amplification, thus the method for judgement HLA type.For the analysis of gene structure, SBT be the most intuitively, method the most accurately.Differentiate by PCR-SSP or PCR-SSO method the allelotrope made new advances, must be confirmed by order-checking.For example, but current existing SBT method remains in some technical problems, and its PCR primer is to HLA-A mostly, B, the exon 2 in C site, 3,4 is increased, and when certain several allelotrope Nucleotide difference is outside amplification region, just can't be distinguished; Too much, cost is higher, overlong time etc. in the PCR reaction.

In sum, this area still needs improved HLA gene amplification and classifying method, in order to the HLA gene is carried out to the full-length gene amplification, and the somatotype realize more accurately, resolving power is higher.

Summary of the invention

For solving above-mentioned the problems of the prior art, the invention provides a kind of new HLA gene amplification method, it is characterized in that using amplimer of the present invention to carrying out pcr amplification, the sequence that described amplimer is right and sequence numbering (SEQ ID NO :) are shown in following table 1:

Table 1:PCR amplimer pair

The primer title	Sequence 5 ' → 3 '	Length	SEQ ID NO：
				A-F	TCTCAGGGTCTCAGGCCCCGAA	22	1
A-R	GCAGAAACAAAGTCAGGGTTCTTCA	25	2
				B-F	GGCTCTCAGGGTCTCAGGCT	20	3
B-R	CTCTAAACAGCCCACCACACACG	23	4
				C-F	GGTTCTAGAGAAGCCAATCAGCGTCT	26	5
C-R	AGGCAGCTGTCTCAGGCTACAGAAC	25	6

In the methods of the invention, primer pair A-F and A-R are for increasing the HLA-A section, and primer pair B-F and B-R are for increasing the HLA-B section, and primer pair C-F and C-R are for increasing the HLA-C section.Use amplimer pair of the present invention, can react the full-length gene that amplifies HLA-A, HLA-B or HLA-C by PCR.

Owing to reacting the full-length gene that amplifies HLA-A, HLA-B or HLA-C by PCR, therefore, method of the present invention particularly advantageously can be used for carrying out the HLA gene type.With existing PCR-SBT method, compare, owing to using method of the present invention and amplimer to the full-length gene that can increase, therefore when further carrying out somatotype, can avoid can't carrying out the problem of effective somatotype when certain several allelotrope Nucleotide is positioned at outside amplification region.

In addition, the invention provides a kind of improved HLA methods of genotyping, described method comprises:

(1) use pcr amplification primer of the present invention to HLA-A to be measured, HLA-B and/or the HLA-C full-length gene of increasing,

(2) use sequencing primer of the present invention to be increased to the PCR product, each exon of HLA-A, HLA-B and/or HLA-C increases respectively, then each exon amplified is checked order, and the standard sequence in sequencing result and database is compared, thereby determined the gene type result.

The sequence of wherein said each sequencing primer and sequence numbering (SEQ ID NO :) are shown in following table 2.

Table 2: sequencing primer

The primer title	Sequence 5 ' → 3 '	Length	SEQ ID NO：
				A1F	CACCGGGACTCAGATTCT	18	7
A2F	CTCTGCGGGGAGAAGC	16	8
				A3F	GGTTTCATTTTCAGTTTA	18	9
A4F	ACAGATGCAAAATGCCT	17	10
				A5F	CAGGGTCAGGGCCCCTCA	18	11
A6F	GGTTCCTCTAGGACCTTA	18	12
				B1F	GTCCCAGTTCTAAAGTC	17	13
B2F	AGCCGCGCCGGGAGGA	16	14
				B3F	ACCCGGTTTCATTTTCAGT	19	15
B4F	GGTCACATGGGTGGTCC	17	16
				B5F	GTAAGGAGGGGGATGAG	17	17
B6F	TCTCATGGCCCTGCTTC	17	18
				C1F	ATCAGCGTCTCCGCAGT	17	19
C2F	GGTCGGGCGGGTCTCA	16	20
				C3F	GTTTAGGCCAAAATCC	16	21
C4F	GGCTGGCGTCTGGGTTCT	18	22
				C5F	AAGTCCTGGAGCCCTTCA	18	23
C6F	TCCAAGACTAGGAGGTTC	18	24

On the other hand, the invention provides as above the new amplimer for HLA gene amplification and/or somatotype shown in table 1 and table 2 to and sequencing primer, they have the polynucleotide sequence shown in SEQ ID NO:1 to SEQID NO:24 any one.

On the other hand, it is a kind of for carrying out the test kit of HLA gene type that the present invention also provides, described test kit comprise pcr amplification primer of the present invention to and sequencing primer.

Apply amplimer provided by the invention to sequencing primer and methods of genotyping, can the amplification full-length gene basis on carry out gene type.Therefore in terms of existing technologies, accuracy rate and the resolving power of somatotype are higher, have also saved time and cost simultaneously.

The accompanying drawing explanation

Fig. 1 is HLA-A amplified production electrophorogram.

Fig. 2 is HLA-B amplified production electrophorogram.

Fig. 3 is HLA-C amplified production electrophorogram.

Fig. 4 is HLA-A exon 2,3,4 exemplary order-checking collection of illustrative plates.

Fig. 5 is the new genotypic order-checking collection of illustrative plates detected.

Embodiment

The inventor, by HLA-A, HLA-B and HLA-C gene order are carried out to bioinformatic analysis, finds each gene locus conserved sequence at 5 ' and 3 ' non-translational region, has designed the specific PCR primer of some HLA full-length genes that can increase.Use amplimer pair of the present invention, can react the full-length gene that amplifies HLA-A, HLA-B or HLA-C by PCR.

In one embodiment of the invention, use the full-length gene of the amplimer of SEQ ID NO:1 and SEQ ID NO:2 to amplification HLA-A.In another embodiment of the invention, use the full-length gene of the amplimer of SEQ ID NO:3 and SEQ ID NO:4 to amplification HLA-B.In another embodiment of the invention, use the full-length gene of the amplimer of SEQ ID NO:5 and SEQ ID NO:6 to amplification HLA-A.

Therefore according to a further aspect in the invention, provide a kind of improved HLA methods of genotyping, described method comprises:

(2) use sequencing primer of the present invention to be increased to the PCR product, increase respectively each exon of HLA-A, HLA-B and/or HLA-C, then checked order to each exon amplified, and the standard sequence in sequencing result and database compared, thereby determine the gene type result

The sequence of wherein said each sequencing primer and sequence numbering (SEQ ID NO :) are shown in table 2.

In one embodiment of the invention, wherein use the 1-7 exon of the sequencing primer amplification HLA-A of SEQ ID NO:7 to SEQ ID NO:12; Use the 1-7 exon of the sequencing primer amplification HLA-B of SEQ ID NO:13 to SEQ IDNO:18; Use the 1-7 exon of the sequencing primer amplification HLA-C of SEQ ID NO:19 to SEQ ID NO:24.

According to a further aspect in the invention, also provide each primer for HLA gene amplification and/or somatotype, they have the polynucleotide sequence shown in SEQ ID NO:1 to SEQ ID NO:24 any one.

According to a further aspect in the invention, also provide a kind of for carrying out the test kit of HLA gene type, described test kit comprise pcr amplification primer of the present invention to and sequencing primer.Optionally, also comprise working instructions in described test kit.

Embodiment

Propose following examples, in order to make those of ordinary skills understand better the present invention, described embodiment, only for exemplary purpose, is not intended to limit the scope of the present disclosure.Endeavoured to ensure the accuracy of relevant numeral (as quantity, temperature etc.), but should consider that meeting exists some errors and deviation.Except as otherwise noted, otherwise umber is parts by weight, and temperature be take ℃ as unit or is envrionment temperature, and pressure approaches or equals normal atmosphere.

Embodiment 1. is used HLA classification system of the present invention to carry out the somatotype detection to the sample of known type.

In the present embodiment, adopt pcr amplification primer of the present invention to and sequencing primer, the genotypic human blood sample of 20 routine known HLA is carried out to HLA-A, B, the hrr gene somatotype in C site.The concrete steps of test are as follows:

1. utilize salting-out process to extract genomic dna.

Testing sequence is as follows:

(1) operated in Biohazard Safety Equipment, draw 200 μ l and mix whole blood in 2ml EP pipe, EO is closed Biohazard Safety Equipment by flow process.

(2) add 700 μ l erythrocyte cracked liquids in described EP pipe, vibrate 15 seconds, the centrifugal 1min of 14,000rpm.

(3) abandoning supernatant to transferring on thieving paper, is discharged remaining liq by described EP tube opening as far as possible.

(4) add 10 μ l (10mg/ml) Proteinase Ks and 300 μ l karyorhexis liquid in described EP pipe, vibrate 15 seconds, then add 20 μ l SDS (20%), vibrate 15 seconds.

(5) the EP pipe is hatched to 30min at 56 ℃, then with the centrifugal 3min of 14,000rpm.

(6) add 1ml dehydrated alcohol (20 ℃ of precoolings) in described EP pipe, put upside down the Ep pipe 15 to 20 times, until linear DNA forms.

(7) with the centrifugal 2min of 14,000rpm, supernatant discarded.

(8) add 1ml 70% ethanol in described EP pipe, repeatedly put upside down the Ep pipe, then with the centrifugal 2min of 14,000rpm, supernatant discarded.

(9) open described Ep pipe, room temperature places 10 to 15min, after the ethanol volatile dry of tube wall, adds 100 μ l left and right distilled water.

2.PCR amplification

Use respectively the genomic dna extracted in different primer pair amplification step 1.Use A-F (SEQ ID NO:1) and A-R (SEQ ID NO:2) primer pair to carry out the amplification of HLA-A somatotype; Use B-F (SEQ ID NO:3) and B-R (SEQ ID NO:4) primer pair to carry out the amplification of HLA-B somatotype; Use C-F (SEQ ID NO:5) and C-R (SEQ ID NO:6) primer pair to carry out the amplification of HLA-C somatotype.Amplification procedure while using different primer pairs to be increased is all similar with reaction system.

Described pcr amplification process is:

96℃2min

95 ℃ of 30s → 60 ℃ 30s → 72 ℃ of 3min (* 35 circulations)

15℃∞

Described PCR reaction system is 25 μ l, and its table composed as follows is listed, wherein 2 * GC BufferI (Mg ²⁺Plus) and LA Taq enzyme all purchased from precious biotechnology (Dalian) company limited (Takara):

Takara 2×GC buffer I(Mg ²⁺plus)	12.5μl
		DNTP mixture (each 2.5mM)	4.0μl
Amplimer is to (F primer and each 10pmol/l of R primer)	1.0μl

Takara LA Taq enzyme (5U/ μ l)	0.3μl
		DNA profiling	3.0μl
ddH ₂O	4.2μl

The electrophorogram of amplified production is shown in Fig. 1 to Fig. 3.Fig. 1,2,3 is respectively the amplified production electrophorogram of HLA-A, B, C, and scheming leftmost white streak is the Marker mark.Be followed successively by from top to bottom 2000bp, 1000bp, 500bp, 200bp, 100bp and 50bp.Respectively corresponding each experimenter's of dextrosinistral each swimming lane sample in figure.

Can find out from Fig. 1-3, apply primer of the present invention, the fragment length increased is all in the 3200bp left and right.The exon 2 of HLA-A, B, C, 3 and 4 if only increase, clip size is about 1.3KB.Therefore can prove, use can the increase total length of HLA-A, HLA-B and HLA-C gene of method of the present invention and primer.

3. utilize millipore purifying plate to carry out the PCR product purification.

With the marking pen hole that mark need to be used on 96 hole PCR product purification plates, and add 50 μ l ultrapure waters in the hole of using to needs, sealed membrane is pasted in the residue hole, standing 15 minutes of room temperature or be connected on the suction filtration system, with-10Pa suction filtration 5 minutes, when taking off the purifying plate, the suction filtration system all to blot the liquid that remains in purifying plate bottom leakage fluid dram at thieving paper at every turn.

PCR product to be purified is centrifugal, 4000rpm * 1 minute.Add 100 μ l ultrapure waters in each PCR reaction system.Then the purifying plate that adds PCR product to be purified is connected on the suction filtration system, regulate vacuum tightness to weather gage and show-10 ± 1Pa, suction filtration is to till noresidue liquid on the micropore regenerated fibre film of purifying plate bottom, and is viewed as without complete liquid level specular gloss common 10 to 15 minutes under illumination.

To adding 20-50 μ l ultrapure water or TE in the hole of containing PCR product to be purified to micropore regenerated fibre film; At room temperature, the middle-grade velocity fluctuation purifying plate of use micro oscillator 5 minutes, shift in the corresponding aperture of whole liquid to one block 96 new hole PCR plates in respective aperture.

Reclaim the PCR product of purifying with ultrapure water or TE as required, the product that need carry out sequencing reaction can only reclaim with ultrapure water, and the volume of recovery determines according to PCR product electrophoresis appraisal before purifying, is generally 20-50 μ l.

4. use sequencing primer to carry out the amplification of product.

Use respectively the amplification of checking order of the PCR product of purifying in different primer pair steps 3.Use 1,2 of A1F (SEQ ID NO:7), A2F (SEQ ID NO:8), A3F (SEQ ID NO:9), A4F (SEQID NO:10), A5F (SEQ ID NO:11) and A6F (the SEQ ID NO:12) HLA-A that increases respectively, 3,4,5 and 6,7 exons (wherein using A6F can simultaneously amplify the 6th and the 7th exon); Use 1,2 of B1F (SEQ ID NO:13), B2F (SEQ ID NO:14), B3F (SEQID NO:15), B4F (SEQ ID NO:16), B5F (SEQ ID NO:17) and B6F (the SEQ ID NO:18) HLA-B that increases respectively, 3,4,5 and 6,7 exons (wherein use B6F can simultaneously increase the 6th and the 7th exon); Use 1,2 of C1F (SEQ ID NO:19), C2F (SEQ IDNO:20), C3F (SEQ ID NO:21), C4F (SEQ ID NO:22), C5F (SEQ ID NO:23) and C6F (the SEQ ID NO:24) HLA-C that increases respectively, 3,4,5 and 6,7 exons (wherein use C6F can simultaneously increase the 6th and the 7th exon); The condition of each amplified reaction that checks order and reaction system are all identical.

The condition of described order-checking amplified reaction is:

96℃2min

96 ℃ of 10s → 55 ℃ 5s → 60 ℃ of 2min (25 circulations)

15℃∞

The system of reaction is 5 μ l, and its table composed as follows is listed, and wherein 2.5 * Bigdye and 5 * Buffer are all purchased from Applied biosystems (Applied Biosystems, ABI):

The PCR product	1μl
		Primer (3.2pmol/l)	1μl
ABI 2.5×Bigdye	0.3μl
		ABI 5×Buffer	0.85μl
ddH ₂O	1.85μl

5.EDTA/ the product of dehydrated alcohol purifying order-checking amplification.

Basic step is: take off the trim of sequencing reaction plate, centrifugal 3000g * 1 minute.Every 5 μ l reaction systems at 96 hole Sptting plates add 0.125mol/L EDTA-Na ₂Solution 2 μ l, 85% ethanol 33 μ l, cover silicagel pad, fully vibrates 3 minutes, 4 ℃ of centrifugal 3000g * 30 minute.Take out Sptting plate after centrifugal end, open silicagel pad, Sptting plate is inverted on thieving paper and is carried out the heterogeneous example showing an absence of inverse disconnection between the middle term and the major term heart, stop immediately centrifugal when centrifugal force reaches 185g.Add 70% ethanol 50 μ l in every hole of 96 orifice plates, cover silicagel pad, vibration 1.5min, 4 ℃ of centrifugal 3000g * 15 minute.Sptting plate is placed in to the lucifuge ventilation 30 minutes, air-dry extremely without the ethanol smell.Add 10 μ l (the 384 every holes of orifice plate add 8 μ l) HI-DI methane amide in every hole of 96 orifice plates, the cap seal membrana oralis, centrifugal with 1000 ± 100rpm after vibrating 5 seconds.

6. carry out the exon order-checking on ABI 3730XL.

Use ABI 3720solexa sequenator to be checked order to purified order-checking amplified production.An exemplary sequencing result is shown in Fig. 4.

The standard sequence that then will check order in the HLA somatotype of announcing in acquired results and the IMGT of international organization database (http://www.ebi.ac.uk/imgt/) is compared; Draw the matching rate of sample sequence and standard sequence by comparison; Just draw the somatotype conclusion of sample sequence according to matching rate.The contrast of the somatotype result that detected result and sample are original sees the following form 3 (inquiry about the name of HLA somatotype is found in http://www.ebi.ac.uk/imgt/hla/align.html).

The somatotype result contrast that this analytical results of table 3 and sample are known

As can be seen from Table 3, the gene type result somatotype result original with sample of using the inventive method to carry out HLA-A, HLA-B and HLA-C conforms to fully, thereby proved reliability of the present invention.

Embodiment 2. utilizes the allelotrope that system discovery of the present invention is new.

In the present embodiment, use the human blood sample of a plurality of unknown gene types of primer pair of the present invention to carry out somatotype, the method for using as described in Example 1.Through the genotype of finding one of them sample and the existing genotype of putting down in writing in database all not identical (sequencing result is shown in Fig. 5) of checking order, as shown in circle in figure, the Nucleotide of the 4th exon the 695th position of the HLA-C gene of this sample is G, and in database, the Nucleotide of this position is T, therefore illustrate that this sample is a HLA-C neomorph.Proof, utilize method of the present invention can find new allelotype thus.

It will be apparent to one skilled in the art that under the prerequisite that does not deviate from scope and spirit of the present invention and can carry out various modifications and changes to the present invention.By considering the present invention's specification sheets disclosed herein and example, other embodiments of the present invention are apparent to those skilled in the art.This specification sheets and embodiment should only regard exemplary purposes as, and the real scope and spirit of the present invention illustrate in appending claims.

Reference

[1].Tiercy J M.Molecular basis of HLA polymorphism：implications in clinicaltransplantation.[J].Transpl Immunol，2002，9：173-180.

[2].Gonzalez-Roces，SM.V，Alvarez，S.Gonzalez，et al.HLA-B27 polymorphism andworldwide susceptibility to ankylosing spondylitis.[J].Tissue Antigens，1997，49：116.

[3].Pera C，Deffins L，Marabito A，et al.HLA-A typing：Comparison between serology，the amplification refractory mutation system with polymerase chain reactionand sequencing.[J].Tissue Antigens，1997，50：372-379.

[4]Lillo R，Balas A，Vicario JL，et al.Two new HLA class allele，DPB1*02014，bysequence-based typing.[J].Tissue Antigens，2002，59：47-48.

[5].Dunn PP，Carter V，Dunn A，et al.Identification of an HLA-B7 serologicalvariant and its characterization by sequencing based typing.[J].TissueAntigens，2000，55：71-73.

[6].Al-Hussein K A，Rama N R，Butt A I，et al.HLA class II sequence based typingin normal Saudi individuals.[J].Tissue Antigens，2002，60：259-261.

[7].D.C.Sayer，D.M.Goodridge.Pilot study：assessment of interlaboratoryvariability of sequencing-based typing DNA sequence data quality.[J]TissueAntigens，2007，69 Suppl.1(66 68)

[8].K.Kotsch，J.Wehling，R.Blasczyk.Sequencing of HLA class II genes basedon the conserved diversity of the non-coding regions：sequencing based typingof HLA-DRB genes.[J].Tissue Antigens，1999：53：486497.

[9].K.R.Miao，Q.Q.Pan，R.C.Tang，et al.The polymorphism and haplotypeanalysi s of HLA-A，-B and-DRB1 genes of population in Jiangsu province ofChina.[J].International Journal of Immunogenetics，2007，34：419424.

Sequence table

<110 > Shenzhen Huada Genetic Technology Co., Ltd

<120 > HLA gene amplification and methods of genotyping and relevant primer thereof

<130>CP1091110/CB

<160>24

<170>PatentIn version 3.3

<210>1

<211>22

<212>DNA

<213 > artificial sequence

<400>1

tctcagggtc tcaggccccg aa 22

<210>2

<211>25

<212>DNA

<213 > artificial sequence

<400>2

gcagaaacaa agtcagggtt cttca 25

<210>3

<211>20

<212>DNA

<213 > artificial sequence

<400>3

ggctctcagg gtctcaggct 20

<210>4

<211>23

<212>DNA

<213 > artificial sequence

<400>4

ctctaaacag cccaccacac acg 23

<210>5

<211>26

<212>DNA

<213 > artificial sequence

<400>5

ggttctagag aagccaatca gcgtct 26

<210>6

<211>25

<212>DNA

<213 > artificial sequence

<400>6

aggcagctgt ctcaggctac agaac 25

<210>7

<211>18

<212>DNA

<213 > artificial sequence

<400>7

caccgggact cagattct 18

<210>8

<211>16

<212>DNA

<213 > artificial sequence

<400>8

ctctgcgggg agaagc 16

<210>9

<211>18

<212>DNA

<213 > artificial sequence

<400>9

ggtttcattt tcagttta 18

<210>10

<211>17

<212>DNA

<213 > artificial sequence

<400>10

acagatgcaa aatgcct 17

<210>11

<211>18

<212>DNA

<213 > artificial sequence

<400>11

cagggtcagg gcccctca 18

<210>12

<211>18

<212>DNA

<213 > artificial sequence

<400>12

ggttcctcta ggacctta 18

<210>13

<211>17

<212>DNA

<213 > artificial sequence

<400>13

gtcccagttc taaagtc 17

<210>14

<211>16

<212>DNA

<213 > artificial sequence

<400>14

agccgcgccg ggagga 16

<210>15

<211>19

<212>DNA

<213 > artificial sequence

<400>15

acccggtttc attttcagt 19

<210>16

<211>17

<212>DNA

<213 > artificial sequence

<400>16

ggtcacatgg gtggtcc 17

<210>17

<211>17

<212>DNA

<213 > artificial sequence

<400>17

gtaaggaggg ggatgag 17

<210>18

<211>17

<212>DNA

<213 > artificial sequence

<400>18

tctcatggcc ctgcttc 17

<210>19

<211>17

<212>DNA

<213 > artificial sequence

<400>19

atcagcgtct ccgcagt 17

<210>20

<211>16

<212>DNA

<213 > artificial sequence

<400>20

ggtcgggcgg gtctca 16

<210>21

<211>16

<212>DNA

<213 > artificial sequence

<400>21

gtttaggcca aaatcc 16

<210>22

<211>18

<212>DNA

<213 > artificial sequence

<400>22

ggctggcgtc tgggttct 18

<210>23

<211>18

<212>DNA

<213 > artificial sequence

<400>23

aagtcctgga gcccttca 18

<210>24

<211>18

<212>DNA

<213 > artificial sequence

<400>24

tccaagacta ggaggttc 18

Claims

1. a HLA gene amplification method, is characterized in that the amplimer that uses SEQ ID NO:1 and SEQ ID NO:2 is to carrying out pcr amplification, amplification HLA-A gene.

2. the HLA gene amplification method of claim 1, it is characterized in that also using the amplimer of SEQ ID NO:3 and SEQ ID NO:4 to carrying out pcr amplification, amplification HLA-B gene, and/or also use the amplimer of SEQ ID NO:5 and SEQ ID NO:6 to carrying out pcr amplification, amplification HLA-C gene.

3. the HLA gene amplification method of claim 2, is characterized in that the amplimer that uses SEQ ID NO:3 and SEQ ID NO:4 is to carrying out pcr amplification, amplification HLA-B gene.

4. the HLA gene amplification method of claim 2, is characterized in that the amplimer that uses SEQ ID NO:5 and SEQ ID NO:6 is to carrying out pcr amplification, amplification HLA-C gene.

5. the HLA gene amplification method of claim 2, is characterized in that using SEQ ID NO:3 and SEQ ID NO:4, and the amplimer of SEQ ID NO:5 and SEQ ID NO:6 is to carrying out pcr amplification, amplification HLA-B and HLA-C gene.

6. a HLA methods of genotyping, described method comprises:

(1) amplimer that uses SEQ ID NO:1 and SEQ ID NO:2 is to carrying out pcr amplification, the full-length gene of the HLA-A of amplification sample to be tested,

(2) use the sequencing primer of SEQ ID NO:7 to SEQ ID NO:12 to be increased to the PCR product, each exon of amplification HLA-A, then checked order to each exon amplified, and the standard sequence in sequencing result and database compared, thereby determine the gene type result

Described HLA methods of genotyping is not used in diagnostic purpose.

7. the HLA methods of genotyping of claim 6, wherein:

In (1) of described method, also comprise that the amplimer that uses SEQ ID NO:3 and SEQ ID NO:4 is to carrying out pcr amplification, amplification HLA-B gene, and/or the amplimer that uses SEQ ID NO:5 and SEQ ID NO:6 is to carrying out pcr amplification, amplification HLA-C gene;

In (2) of described method, also comprise and use the sequencing primer of SEQ ID NO:13 to SEQ ID NO:18 to be increased to the PCR product, each exon of amplification HLA-B, and/or use the sequencing primer of SEQ ID NO:19 to SEQ ID NO:24 to be increased to the PCR product, each exon of amplification HLA-C, then each exon amplified is checked order, and the standard sequence in sequencing result and database is compared, thereby determined the gene type result.

8. the HLA methods of genotyping of claim 7, use the amplimer of SEQ ID NO:3 and SEQ ID NO:4 to carrying out pcr amplification, amplification HLA-B gene, use the sequencing primer of SEQ ID NO:13 to SEQ ID NO:18 to be increased to the PCR product, each exon of amplification HLA-B, then each exon amplified is checked order, and the standard sequence in sequencing result and database is compared, thereby determined the gene type result.

9. the HLA methods of genotyping of claim 7, use the amplimer of SEQ ID NO:5 and SEQ ID NO:6 to carrying out pcr amplification, amplification HLA-C gene, use the sequencing primer of SEQ ID NO:19 to SEQ ID NO:24 to be increased to the PCR product, each exon of amplification HLA-C, then each exon amplified is checked order, and the standard sequence in sequencing result and database is compared, thereby determined the gene type result.

10. the HLA methods of genotyping of claim 7, used SEQ ID NO:3 and SEQ ID NO:4, and the amplimer of SEQ ID NO:5 and SEQ ID NO:6 is to carrying out pcr amplification, amplification HLA-B and HLA-C gene; And use the sequencing primer of SEQ ID NO:13 to SEQ ID NO:18 and the sequencing primer of SEQ ID NO:19 to SEQ ID NO:24 to be increased to the PCR product, each exon of HLA-B and HLA-C increases respectively, then each exon amplified is checked order, and the standard sequence in sequencing result and database is compared, thereby determine the gene type result.

A 11. primer sets, comprise that the amplimer of SEQ ID NO:1 to SEQ ID NO:6 is to the sequencing primer with SEQ ID NO:7 to SEQ ID NO:24, wherein SEQ ID NO:1 and SEQ ID NO:2 are used also corresponding SEQ ID NO:7 to SEQ ID NO:12 as sequencing primer, the PCR product to be increased as the pcr amplification primer in pairs; SEQ ID NO:3 and SEQ ID NO:4 use in pairs as the pcr amplification primer and corresponding SEQ ID NO:13 to SEQ ID NO:18 is increased to the PCR product as sequencing primer; And SEQ ID NO:5 and SEQ ID NO:6 use in pairs as the pcr amplification primer and corresponding SEQ ID NO:19 to SEQ ID NO:24 is increased to the PCR product as sequencing primer.

12. one kind for carrying out the test kit of HLA gene type, described test kit comprises the pcr amplification primer pair of SEQ ID NO:1 and SEQ ID NO:2, and the sequencing primer of SEQ ID NO:7 to SEQ ID NO:12.

13. the test kit of claim 12, the pcr amplification primer that also comprises SEQ ID NO:3 and SEQ ID NO:4 in wherein said test kit to and the sequencing primer of SEQ ID NO:13 to SEQ ID NO:18, and/or the pcr amplification primer that also comprises SEQ ID NO:5 and SEQ ID NO:6 to and the sequencing primer of SEQ ID NO:19 to SEQ ID NO:24.

14. the test kit of claim 13, wherein said test kit comprises the pcr amplification primer pair of SEQ ID NO:3 and SEQ ID NO:4, and the sequencing primer of SEQ ID NO:13 to SEQ ID NO:18.

15. the test kit of claim 13, wherein said test kit comprises the pcr amplification primer pair of SEQ ID NO:5 and SEQ ID NO:6, and the sequencing primer of SEQ ID NO:19 to SEQ ID NO:24.

16. the test kit of claim 13, the pcr amplification primer that wherein said test kit comprises SEQ ID NO:3 and SEQ ID NO:4 to and the sequencing primer of SEQ ID NO:13 to SEQ ID NO:18, and the pcr amplification primer of SEQ ID NO:5 and SEQ ID NO:6 to and the sequencing primer of SEQ ID NO:19 to SEQ ID NO:24.