CN115125295A - Genotyping standard substance for multi-site sustainable use - Google Patents

Abstract

The invention belongs to the technical field of gene sequencing standard products, and provides a genotyping standard product for multi-site sustainable use, the standard product includes PTC-HEX, PTC-FAM and PTC-H; wherein, PTC-HEX The PCR products of PTC-FAM include rs25487(G), rs1042522(C) and rs1048943(A); the PCR products of PTC‑FAM include rs25487(A), rs1042522(G) and rs1048943(T), and the PCR products of PTC‑H include PTC‑ HEX. This standard is a genotyping standard that can be used for multi-locus SNP typing after DNA structure modification. The standard can be replicated by single-primer PCR amplification, so that the standard can be used sustainably and the cost of standard preparation can be greatly reduced.

Description

A genotyping standard for multi-locus sustainable use

technical field

The invention belongs to the field of molecular biology technology genotyping, and specifically discloses a standard product suitable for multi-locus genotyping.

Background technique

SNP (Single nucleotide polymorphism) is a single nucleotide polymorphism, which is a point mutation caused by the transformation, translocation, insertion or deletion of a single base at a specific nucleotide position in the genomic DNA, resulting in differences between groups and individuals . With the rapid development of sequencing technology and bioinformatics analysis, massive genomics data has laid the foundation for SNP molecular markers, and tens of thousands of SNP polymorphisms are being continuously discovered and widely used in the diagnosis of genetic diseases, pathogenic Disease candidate gene research, drug screening research, molecular marker-assisted breeding, population genetic research, etc. Therefore, the authenticity verification and subsequent development and utilization of SNP markers have become particularly important.

Common SNP loci generally have two alleles, also known as bialleles. Therefore, in a population, there are generally three genotypes at a SNP site of each individual: the genotype of the pre-mutation site (homozygous 1), the genotype of the post-mutation site (homozygous 2), the genotype of the site before and after the mutation Coexistence of loci genotypes (heterozygous). Usually through SNP detection technology, it is determined which of the above three genotypes the genotype of each SNP site of each individual belongs to. There are three common SNP detection platforms: high-throughput sequencing platform, medium-throughput gene chip detection platform, bottom-throughput electrophoresis detection platform, fluorescence quantitative PCR detection platform, enzyme label detection platform, etc. Among them, the low-throughput SNP detection platform is the most widely used and popular.

SUMMARY OF THE INVENTION

Low-throughput SNP detection platforms often require 3 genotype standards for each SNP locus for reference-assisted SNP detection. There are two common SNP detection standards: one is to select 3 genotype samples from known genotype samples as the standard; the other is to synthesize the gene sequence of the known genotype as the standard. However, these two standards have their drawbacks in multi-locus SNP detection: the former requires 3 genotypes of standards for each SNP locus, resulting in a large number of tubes for multi-locus SNP standards and storage It is difficult to obtain and error-prone; and after each batch of standard products is used, it is necessary to resample and extract DNA to prepare standard products, which may cause difficulties in re-obtaining samples and increase the cost of DNA extraction. The latter gene synthesis cost is high, especially the multi-site gene synthesis cost is even higher. After the standard product is used, high-cost gene synthesis needs to be carried out again.

Aiming at the deficiencies of the existing SNP standard products, the present invention strives to develop a low-cost, sustainable genotyping standard product that can be used for multi-site SNP typing.

A genotyping standard for sustainable use at multiple sites, including PTC-HEX, PTC-FAM and PTC-H; wherein the PCR products of PTC-HEX include rs25487(G), rs1042522(C) and rs1048943 (A); The PCR products of PTC-FAM include rs25487(A), rs1042522(G) and rs1048943(T), and the PCR products of PTC-H include PTC-HEX, wherein:

The gene sequence of the rs25487(G) is: 5'-[HEX]CGGCTGCCCTCCCGGAGGTAAG[BHQ1];

The gene sequence of the rs1042522(C) is: 5'-[HEX]CTGCTCCCCCCCGTGGCCCC[BHQ1];

The gene sequence of the rs1048943(A) is: 5'-[HEX]CGGTGAGACATTGCCCGCT[BHQ1];

The gene sequence of the rs25487(A) is: 5'-[6FAM]CGGCTGCCCTCCCAGAGGTAAG[BHQ1];

The gene sequence of the rs1042522(G) is: 5'-[6FAM]CTGCTCCCCGCGTGGCCCC[BHQ1];

The gene sequence of rs1048943(T) is: 5'-[6FAM]CGGTGAGACCGTTGCCCGCT[BHQ1].

Among them, the concentration of rs25487(G) is 52.2-65.3ng/μL, the concentration of rs1042522(C) is 59.5-74ng/μL, the concentration of rs1048943(A) is 47-82.1ng/μL, and the concentration of rs25487(A) is 59.5-74ng/μL. The concentration of rs1042522(G) was 53.2-59.5ng/μL, the concentration of rs1048943(T) was 42.9-69.6ng/μL, the concentration of PTC-HEX was 52.4-73.2ng/μL, The concentration of PTC-HEX is 47.7～60ng/μL;

Wherein, the genotyping standard is used to simultaneously and continuously detect three SNP sites, whose names are respectively rs25487(G/A), rs1042522(C/G), and rs1048943(A/G).

beneficial effect

Low-throughput SNP detection platforms often require 3 genotype standards for each SNP locus for reference-assisted SNP detection. There are two common SNP detection standards: one is to select 3 genotype samples from known genotype samples as the standard; the other is to synthesize the gene sequence of the known genotype as the standard. However, these two standards have their drawbacks in multi-locus SNP detection: the former requires 3 genotypes of standards for each SNP locus, resulting in a large number of tubes for multi-locus SNP standards and storage It is difficult to obtain and error-prone; and after each batch of standard products is used, it is necessary to resample and extract DNA to prepare standard products, which may cause difficulties in re-obtaining samples and increase the cost of DNA extraction. The latter gene synthesis cost is high, especially the multi-site gene synthesis cost is even higher. After the standard product is used, high-cost gene synthesis needs to be carried out again. To address the existing problems mentioned above, we have developed a genotyping standard for sustainable use at multiple loci. The invention has three major advantages: firstly: based on the consideration of the preparation cost of the standard product, the invention provides the standard product according to the number of different SNP sites, thereby greatly reducing the preparation cost of the standard product. Second: a set of new standard products has only 3 tubes, each tube fuses a genotype of each SNP locus, which is easy to store and suitable for multi-locus SNP detection. Third: The new standard product is modified by DNA structure, and the standard product can be replicated by single-primer PCR amplification, so that the standard product can be used sustainably and greatly reduces the cost of standard product re-preparation.

Description of drawings

Figure 1: The results of the genotyping verification of the standard product of Example 1.

Figure 2: Commonly used adapter sequences for sequencing on the Illumina platform.

Figure 3: The results of the genotyping verification of the standard product of Example 2.

Detailed ways

In order to make the technical means, creation features, achievement goals and effects of the present invention easy to understand and understand, the present invention will be further explained below in conjunction with the specifics.

All the raw materials in the present invention, their sources are not particularly limited, can be purchased in the market or prepared according to conventional methods well known to those skilled in the art. All raw materials in the present invention are not particularly limited in their purity, and the present invention preferably adopts analytical purity or conventional purity used in the field of composite materials.

In the embodiment, the genotyping detection product of "Cancer Suppression Satellite TV" on the market is selected for detailed description. The genotyping test product of "Tumor Suppressor Satellite TV" contains three SNP loci, whose names (genotypes) are rs25487 (G/A), rs1042522 (C/G), and rs1048943 (A/G).

Based on cost considerations, Example 1 is preferred for the preparation of standards with 5 or less SNP sites; Example 2 is preferred for the preparation of standards with more than 5 SNP sites.

Example 1

1. SNP site primer design

The primer design can be based on the TaqMan probe or the primer sequences that come with the probe products of other fluorescent quantitative PCR-based detection platforms (Table 1), and a unified amplification primer sequence (Table 2) is added to the 5' end. It is also possible to obtain the gene sequence through the rs number, use the primer design software or website to design primers, and add the unified amplification primer sequence to the 5' end of the designed primer sequence (Table 2).

In this example, the ThermoFisher TaqMan probe was used for the experiment. The primers were directly selected from the primer sequences of the ThermoFisher TaqMan probe products, and a unified amplification primer sequence was added to the 5' end. Message as follows:

Table 1: ThermoFisher TaqMan probe product comes with primer probe sequence information table

Table 2: Fusion primer information table for preparing universal primer sequences by adding standards at the 5' end

2. Sample Preparation

Three SNP loci, for each SNP locus, prepare two samples of homozygous genotypes. The sample information is as follows.

Table 3: Sample Information Sheet

sample name genotype Amplification primers Probe fluorophore 1 rs25487(G) rs25487-primer pair HEX 2 rs25487(A) rs25487-primer pair 6FAM 3 rs1042522(C) rs1042522-primer pair HEX 4 rs1042522(G) rs1042522-primer pair 6FAM 5 rs1048943(A) rs1048943-primer pair HEX 6 rs1048943(T) rs1048943-primer pair 6FAM

3. SNP sequence amplification

Using the corresponding PCR amplification primers, the SNP gene sequences of the samples were amplified respectively, and purified by 0.8X magnetic beads. After purification, the names of the amplified products were consistent with the genotype names in Table 1. The DNA content of the amplified product was detected using a Qubit3.0 instrument.

1) PCR amplification system:

Table 4: PCR amplification system

2) PCR amplification procedure:

Pre-denaturation at 95 °C for 3 min; denaturation at 95 °C for 30 sec, annealing at 56 °C for 30 sec, extension at 72 °C for 45 sec, a total of 25 cycles; final extension at 72 °C for 5 min; storage at 4 °C.

3) 0.8X magnetic bead purification scheme:

Novozyme VAHTS DNAClean Beads are used for the purification of the product of the present invention. Before purification, the magnetic bead solution is taken out from 2 to 8°C 30 minutes in advance, and the temperature is allowed to equilibrate to room temperature by standing. Vortex to fully mix the magnetic bead solution, add 40 μl of magnetic bead solution to 50 μl of DNA amplification product, use a pipette to gently pipette 10 times to mix well, and incubate at room temperature for 10 min to bind DNA to the magnetic beads. Place the sample on a magnetic stand and remove the supernatant carefully after the solution is clear (about 5 min). Keeping the sample on the magnetic stand, add 200 μl of freshly prepared 80% ethanol to rinse the magnetic beads, incubate at room temperature for 30 sec, and carefully remove the supernatant. Add 200 μl of freshly prepared 80% ethanol again to rinse the magnetic beads, incubate at room temperature for 30 sec, and carefully remove the supernatant. Keep the sample on the magnetic stand and dry the magnetic beads at room temperature for about 5-10min. Remove the sample from the magnetic stand, add 50 μl Nuclease-free Water, vortex or use a pipette to mix well, and let it stand at room temperature for 2 min. After standing on a magnetic stand for 5 min until the solution is clarified, carefully pipette the supernatant into a new nuclease-free centrifuge tube, and mark it for use.

4) PCR product quality control

Table 5: Amplification product quality control results

PCR product name Concentration ng/μL Volume μL Total μg rs25487(G) 52.2 50 2.61 rs25487(A) 48.1 50 2.405 rs1042522(C) 59.5 50 2.975 rs1042522(G) 53.2 50 2.66 rs1048943(A) 47.0 50 2.35 rs1048943(T) 42.9 50 2.145

4. Multisite Standard Preparation

The above 6 tubes of amplification products were prepared into 3 tubes of multi-site standards. The mixing scheme is as follows:

Table 6: Multisite Standard Mixing Protocol Table

Use the Qubit3.0 instrument to detect the concentration of the prepared standard and dilute it to 10ng/μL for use.

5. Genotyping Validation

The present invention uses the ABI QuantStudio6 real-time fluorescence quantitative PCR instrument to carry out the standard product genotyping verification experiment, and each standard product is repeated three times.

1) Genotyping system:

Table 7: Standard Genotyping Verification System

2) Genotyping procedure:

Pre-Amp: 60°C/30s, Amplication: 95°C/10min; 95°C/30s, 60°C/1min*, 40 cycles; Post-Amp: 60°C/30s.

3) Genotyping results: see Figure 1

6. Continuous use of standard products

The standard product prepared in this scheme is amplified by fusion primers to obtain the SNP sequence of the standard product. The fusion primer structure consists of two parts, one part is the universal primer sequence prepared by the standard product, and the other part is the SNP site gene amplification primer sequence. When the volume of the standard product is too small, only 1ul of the standard product is needed, and the standard product is used to prepare universal primers for PCR amplification and purification, and then continue to use.

In addition to the advantages of fusing each gene of multi-locus SNP into one tube, the standard product of the invention is easy to store and use, and a new round of standard product can be prepared by simple single-primer PCR, so that the standard product can be easily stored and used. Use continuously. Compared with the preparation of standard products by gene synthesis, the preparation cost is greatly reduced.

Example 2

1. SNP site primer design

For primer design, the primer sequences that come with TaqMan probes or other fluorescent quantitative PCR-based detection platform probe products can be directly used. The gene sequence can also be obtained through the rs number, and primers can be designed by using primer design software or website.

In the present invention, the Thermo Fisher TaqMan probe is used for the experiment, and the primers are directly selected from the primer sequences of the Thermo Fisher TaqMan probe product. The detailed information is the same as Table 1: Thermo Fisher TaqMan probe product comes with primer probe sequence information table.

2. Sample Preparation

Three SNP loci, for each SNP locus, two samples of homozygous genotypes were prepared, and the sample information was the same as the sample information table in Table 2.

3. SNP sequence amplification

Using the corresponding PCR amplification primers, the SNP gene sequences of the samples were amplified respectively, and purified by 0.8X magnetic beads. After purification, the names of the amplified products were consistent with the genotype names in Table 1. The DNA content of the amplified product was detected using a Qubit3.0 instrument.

1) The PCR amplification system is shown in Table 3.

Table 8: PCR amplification system

2) PCR amplification procedure:

Pre-denaturation at 95 °C for 3 min; denaturation at 95 °C for 30 sec, annealing at 56 °C for 30 sec, extension at 72 °C for 45 sec, a total of 25 cycles; final extension at 72 °C for 5 min; storage at 4 °C.

3) 0.8X magnetic bead purification scheme:

Novozyme VAHTS DNAClean Beads are used for the purification of the product of the present invention. Before purification, the magnetic bead solution is taken out from 2 to 8°C 30 minutes in advance, and the temperature is allowed to equilibrate to room temperature by standing. Vortex to fully mix the magnetic bead solution, add 40 μl of magnetic bead solution to 50 μl of DNA amplification product, use a pipette to gently pipette 10 times to mix well, and incubate at room temperature for 10 min to bind DNA to the magnetic beads. Place the sample on a magnetic stand and remove the supernatant carefully after the solution is clear (about 5 min). Keeping the sample on the magnetic stand, add 200 μl of freshly prepared 80% ethanol to rinse the magnetic beads, incubate at room temperature for 30 sec, and carefully remove the supernatant. Add 200 μl of freshly prepared 80% ethanol again to rinse the magnetic beads, incubate at room temperature for 30 sec, and carefully remove the supernatant. Keep the sample on the magnetic stand and dry the magnetic beads at room temperature for about 5-10min. Remove the sample from the magnetic stand, add 50 μl Nuclease-free Water, vortex or use a pipette to mix well, and let it stand at room temperature for 2 min. After standing on a magnetic stand for 5 min until the solution is clarified, carefully pipette the supernatant into a new nuclease-free centrifuge tube, and mark it for use.

4) PCR product quality control

Table 9: Amplification product quality control results

PCR product name Concentration ng/μL Volume μL Total μg rs25487(G) 65.3 50 3.27 rs25487(A) 53.2 50 2.66 rs1042522(C) 74 50 3.70 rs1042522(G) 59.5 50 2.98 rs1048943(A) 82.1 50 4.11 rs1048943(T) 69.6 50 3.48

4. Multisite Standard Preparation

The above 6 tubes of amplification products were prepared into 3 tubes of multi-site standards. The mixing scheme is as follows:

Table 10: Multisite Standard Mixing Protocol Table

Use the Qubit3.0 instrument to detect the concentration of the prepared standard and dilute it to 10ng/μL for use.

5. Standard Library Construction

V3(ND607)试剂盒，通过末端修复、A接头连接、纯化、PCR扩增、产物纯化等过程，完成标准品文库构建。构建成功的标准品文库中，所有SNP序列均统一连接了illumina平台测序常用接头序列(图2)。后续标准品即将用完时，只需使用统一引物序列(表11)进行PCR扩增、纯化后，即可等到新一轮标准品，实现标准品可持续使用的目标。The standard product library of the present invention is constructed using VAHTSTM Universal DNALibrary Prep Kit for

The V3(ND607) kit completes the standard library construction through the process of end repair, A-linker ligation, purification, PCR amplification, and product purification. In the successfully constructed standard library, all SNP sequences were uniformly connected to the commonly used linker sequences for sequencing on the illumina platform (Figure 2). When the follow-up standard is about to run out, just use the unified primer sequence (Table 11) for PCR amplification and purification, and then wait for a new round of standard to achieve the goal of sustainable use of the standard.

Table 11: Standard Preparation Universal Primer Sequences

name Primer sequence Primer F AATGATACGGCGACCACCGAGATC Primer R CAAGCAGAAGACGGCATACGAGAT

6. Genotyping Validation

The present invention uses the ABI QuantStudio6 real-time fluorescence quantitative PCR instrument to carry out the standard product genotyping verification experiment, and each standard product is repeated three times.

1) The genotyping system is shown in Table 7.

2) Genotyping procedure:

Pre-Amp: 60°C/30s; Amplication: 95°C/10min, 95°C/30s, 60°C/1min*, 40 cycles; Post-Amp: 60°C/30s.

3) Genotyping results: see Figure 3

7. Continuous use of standard products

The standard products prepared in this scheme are constructed by PCR product library to obtain a standard product library with a unified linker sequence. When the volume of the standard product is too small, only 1ul of the standard product is needed, and the standard product is used to prepare universal primer sequences for PCR amplification and purification, and then continue to use.

The standard product of the present invention has the advantages of fusing each gene of the multi-site SNP into one tube, which is easy to store and use, and can also prepare a new round of standard product through simple single-primer PCR, so that the standard product can be easily stored and used. Use continuously. Compared with the preparation of standard products by gene synthesis, the preparation cost is greatly reduced.

The gene sequences of rs25487, rs1042522 and rs1048943 are as follows:

>rs25487

GAGATGGGAGTCTCGCTCTGTCACCCAGGCCAGAGTGCAGTGGCACGATTTTGGCTTCCAGGTTCAAGCGATTCTCCTGCCTCAGCCTTCCGAGTAACTGGGATTACAGGCGTGCGCCACCAAGCCCAGCTAATTTTTGTGTTTTTAGTAGAGATGGGGTTTCACCATGTTGGCCAGGCTGGTCTCGAACTTCTGACCTCAAGTGATCCACCTGCCTCAGCCTCCCAGAGTGCTGGGATTACAGGCGTGAGCCACTGCACCGGGACTCACTTTGAATGAATGAATATGGACCCTAACACTTGTTCTCCCACCCCTGAGTTTTTGCACAAACTGCTCCTCCAGCCTTTTCTGATAAGCAGGCTTCACAGAGCCCTCTGTGACCTCCCAGGCAGGTCCTCCTTCCCTCATCTGGAGTACCCCAGCCCCTGCCCCGCTCCTCTCAGTAGTCTGCTGGCTCTGGGCTGGGACCACCTGTGTTCTCCGCTGGCAGGCCCCAGTCTGACTCCCCTCCAGATTCCTGGCATTGCCCAGCACAGGATAAGGAGCAGGGTTGGCGTGTGAGGCCTTACCTCTGGGAGGGCAGCCGCCGACGCATGCGGTGACAGTCCAGCACCCACTCCTTACGCACGATGCGGCCTCCCAGGCCTAGGACCTGGCTGTACTTGGGGGTGTTGGCAAAGGCACAGCTGGTGGGGGGCAGAAGTGAAGATGCCAGTTAGGTGTGATCTGAGGGGCAAAGGGGAACGAGACAGGGGAGACAGACAGAGAGAGAGAGAGACAGACAGACAGACAGATCATGAGATTGAGGTGGGAGAAACAAAAAGAGGTTGGAGACCAAGGGAGAGATGCAAAAATCAGAGAGAAGACAAAGGCTACAGAATGCAGTGAGAAAGAAAGCAAGTGAGAGAGAGAGAAAGCATGCAGCATAGTGGACACAGAGAAAGCACAAGGTGGAGGAGACACAGGGAGCTGGGGGAGAAACTGCAGCGGCGCAGGGAGG GGGGCGCAAGCCTACATGAGGTGCGTGCTGTCCCGGGTCCAGTCTGGCCGATACTTGGCCCCAAGCTCTAGGGCCTTATCTCGCAGCTCGGAGCGGAAGGGGTTCTGGAAGCCACTCAGCACCACTACCACACCCTGAAGGATCTTCCCCAGCTCCTCTGGGCCAGCTCGGGGTCGTCTGGGCTCGGTGCCTTCTCCTCGGGGTTTGCCTGTCACTGCCCCCTGTGCTCGGGCAGGGACTG

>rs1042522

TATTTTTTTGTAGAGACGAGGTTTCATCATGTTACCCAGGCTGGTCTTGAACTCCTGGGCTCAGGTGATCTGCCTGCCTTGGCCTCTTTGAGAGTGCTGGGATTGCAGGTGTGAGCCACCAAGCCTGGTCAGGAGCTTATTTTCAAAAGCCAAGGAATACACGTGGATGAAGAAAAAGAAAAGTTCTGCATCCCCAGGAGAGATGCTGAGGGTGTGATGGGATGGATAAAAGCCCAAATTCAAGGGGGGAATATTCAACTTTGGGACAGGAGTCAGAGATCACACATTAAGTGGGTAAACTATAAAAAAACACTGACAGGAAGCCAAAGGGTGAAGAGGAATCCCAAAGTTCCAAACAAAAGAAATGCAGGGGGATACGGCCAGGCATTGAAGTCTCATGGAAGCCAGCCCCTCAGGGCAACTGACCGTGCAAGTCACAGACTTGGCTGTCCCAGAATGCAAGAAGCCCAGACGGAAACCGTAGCTGCCCTGGTAGGTTTTCTGGGAAGGGACAGAAGATGACAGGGGCCAGGAGGGGGCTGGTGCAGGGGCCGCCGGTGTAGGAGCTGCTGGTGCAGGGGCCACGGGGGGAGCAGCCTCTGGCATTCTGGGAGCTTCATCTGGACCTGGGTCTTCAGTGAACCATTGTTCAATATCGTCCGGGGACAGCATCAAATCATCCATTGCTTGGGACGGCAAGGGGGACTGTAGATGGGTGAAAAGAGCAGTCAGAGGACCAGGTCCTCAGCCCCCCAGCCCCCCAGCCCTCCAGGTCCCCAGCCCTCCAGGTCCCCAGCCCAACCCTTGTCCTTACCAGAACGTTGTTTTCAGGAAGTCTGAAAGACAAGAGCAGAAAGTCAGTCCCATGGAATTTTCGCTTCCCACAGGTCTCTGCTAGGGGGCTGGGGTTGGGGTGGGGGTGGTGGGCCTGCCCTTCCAATGGATCCACTCACAGTTTCCATAGGTCTGAAAATGTTTCCTGACTCAGAGGGGGCTCGAC GCTAGGATCTGACTGCGGCTCCTCCATGGCAGTGACCCGGAAGGCAGTCTGGCTGCTGCAAGAGGAAAAGTGGGGATCCAGCATGAGACACTTCCAACCCTGGGTCACCTGGGCCTGCAGAGAAGGAACCCCCTCCCCCAA

>rs1048943

AGGGTCCTGGTTTGGCTAGTTCTAACTTGCTGAAGCCAGTCAG CACCCTCACAGAG CCAGCTAGGTACTGGGCCCAGGGGCTTCCAGAGAGTTCTTCAGAGCTTCTCAGAGGCCTAAGGACCTCCTAACCCTAGCAGG CCTCCTGGCTCAAGCACAACTTGGGAAGGCTCCATCAGCATCTATGTGGCCCTGTTTTACCTGTTGTCTCTGGAGGGTGTGCAGAGGCAAGTCCAGGGTAGGGGCAGGCAGGATCCCTTAGGCTTGCCCACAGCCCAGATAGCAAAACTGCAGCCAGATCAGTGTCTATGAGTTTCAGGCTGAACCTTAGACCACATAGGCCAGCCTGCTGGTCTGGCTGCCCAACCAGACCAGGTAGACAGAGTCTAGGCCTCAGGGCTCTCAAGCACCTAAGAGCGCAGCTGCATTTGGAAGTGCTCACAGCAGGCATG CTTCATGGTTAG CCCATAGATGGGGGTCATGTCCACCTTCACGCCCAGTGGCACGCTGAATTCCACCCGTTGCAGCAGGATAGCCAGGAAGAGAAAGACCTCCCAGCGGGCAATGGTCTCACCGATACACTTCCGCTTGCCCATGCCAAAGATAATCACCTTCTCACTTAACACCTTGTCGATAGCACCATCAGGGGTGAGAAACCGTTCAGGTAGGAACTCAGATGGGTTGACCCATAGCTTCCTGTAACCAGAGGGAGACAGCTGAAGTGGCAGTTCAGGGCTCAGAAGTGTCAAGTGAGTGGAGCTCCAGCCCCAAAGGATAGAGGACAGGCAAGCAGCCCATGGACAGGAGGATCAATGCAATGATTGTATTAATCATATATAAGAGCTTAAGAGGGTGGACCCAGCCTTTCCTCTGCATCTCTGAACTTACTGGTCATGGTTGATCTG CCACTGGTTTACAAAGACACAACGCCCCTTGGGGATGTAAAAGCCTTTCAAACTTGTGTCTCTTGTTGTGCTAGGGAGAAAGGAAGCTCAGT CAGGCTCAGGGCAACAGGCAAATCTCCCTGTCTCCCATGCCGTGTCCCTCCCACTAACCCTAATCAGGTATGTGGTCCGGAGTAAGATCAGTAACAGACAGCAGTGGCTCCATGGGGCCTTACCTGTGGGGGATGGTGAAGGGGACGAAGGAAGAGTGTCGGAAGGTCTCCAGGATGAAGGCCTCCATA

Claims (3)

1. a genotyping standard for multi-site sustainable use, is characterized in that: described standard comprises PTC-HEX, PTC-FAM and PTC-H; Wherein, the PCR product of PTC-HEX comprises rs25487 (G), rs1042522(C) and rs1048943(A); PCR products of PTC-FAM include rs25487(A), rs1042522(G) and rs1048943(T), and PCR products of PTC-H include PTC-HEX, including: The gene sequence of the rs25487(G) is: 5'-[HEX]CGGCTGCCCTCCCGGAGGTAAG[BHQ1]; The gene sequence of the rs1042522(C) is: 5'-[HEX]CTGCTCCCCCCCGTGGCCCC[BHQ1]; The gene sequence of the rs1048943(A) is: 5'-[HEX]CGGTGAGACATTGCCCGCT[BHQ1]; The gene sequence of the rs25487(A) is: 5'-[6FAM]CGGCTGCCCTCCCAGAGGTAAG[BHQ1]; The gene sequence of the rs1042522(G) is: 5'-[6FAM]CTGCTCCCCGCGTGGCCCC[BHQ1]; The gene sequence of rs1048943(T) is: 5'-[6FAM]CGGTGAGACCGTTGCCCGCT[BHQ1]. 2. The genotyping standard for sustainable use at multiple sites according to claim 1, wherein the concentration of the rs25487(G) is 52.2-65.3ng/μL, and the concentration of the rs1042522(C) The concentration of rs1048943(A) was 59.5-74ng/μL, the concentration of rs1048943(A) was 47-82.1ng/μL, the concentration of rs25487(A) was 48.1-53.2ng/μL, the concentration of rs1042522(G) was 53.2-59.5ng/μL, and the concentration of rs1048943 The concentration of (T) was 42.9-69.6 ng/μL, the concentration of PTC-HEX was 52.4-73.2 ng/μL, and the concentration of PTC-HEX was 47.7-60 ng/μL. 3. the application of the genotyping standard product for multi-site sustainable use according to claim 1, it is characterized in that: described genotyping standard product is used for simultaneously continuously detecting three SNP sites, its The names are rs25487(G/A), rs1042522(C/G), and rs1048943(A/G).

Images