CN113136433A

CN113136433A - Kit for simultaneously detecting multiple SNP sites related to tumor susceptibility

Info

Publication number: CN113136433A
Application number: CN202110512063.5A
Authority: CN
Inventors: 殳晓强; 胡志刚; 陈琦; 郭惠民
Original assignee: Zhejiang Dipu Diagnosis Technology Co ltd
Current assignee: Zhejiang Dipu Diagnosis Technology Co ltd
Priority date: 2021-05-11
Filing date: 2021-05-11
Publication date: 2021-07-20

Abstract

The invention discloses a kit for simultaneously detecting multiple tumor susceptibility related Single Nucleotide Polymorphism (SNP) sites and application thereof. The invention designs the amplification primer and the single base extension primer of each site, and performs mass spectrometry on the specific product through multiple PCR and multiple single base extension reactions to judge the genotype of each site.

Description

Kit for simultaneously detecting multiple SNP sites related to tumor susceptibility

Technical Field

The invention belongs to the technical field of gene detection, and relates to a kit for simultaneously detecting multiple tumor susceptibility related Single Nucleotide Polymorphism (SNP) sites and application thereof. The invention designs an amplification primer and a single base extension primer of each site, and performs mass spectrometry on specific products through multiple PCR and multiple single base extension reactions to judge the genotype of each site.

Background

In 2019, month 1, the national cancer center released the latest national cancer statistics for the first phase. The national tumor registration center is responsible for national tumor registration data collection, quality control, summarization, analysis and release. The malignant tumor (cancer) has become one of the main public health problems seriously threatening the health of Chinese population, according to the latest statistical data, the death of the malignant tumor accounts for 23.91 percent of the total death causes of residents, and the morbidity and the mortality of the malignant tumor are in a continuously rising state in recent ten years, the medical cost caused by the malignant tumor exceeds 2200 hundred million every year, and the prevention and control situation is severe.

In 2015, about 392.9 million people with malignant tumor and 233.8 million people with death. On average, over 1 million people per day were diagnosed with cancer, and 7.5 people per minute were diagnosed with cancer. The cancer burden is in a continuously rising state compared to historical data. Over the last 10 years, the incidence of malignancy has remained on the order of 3.9% and mortality has remained 2.5% per year.

Lung cancer, liver cancer, upper digestive system tumor, colorectal cancer, female breast cancer and the like are still main malignant tumors in China. Lung cancer is the first disease in men and breast cancer is the first disease in women. The malignant tumor of men is relatively high in incidence rate compared with women, and the incidence spectrum has larger difference. Thyroid cancer has increased greatly in recent years, and is currently located at the 4 th position in the malignant tumor incidence spectrum of women. The rising trend of prostate cancer in men in recent years is obvious, and the prostate cancer is located at the 6 th onset of the disease in men.

The TP53 gene, also known as P53, is a cancer suppressor gene that encodes a protein with a molecular weight of 53 kDa. One of the important roles of the P53 protein is in regulating cell division and proliferation. The division and proliferation of cells in the body are constantly regulated and controlled by 'instructions', and each cell plays its own role and maintains the stable operation of the interior of the body together. In some cases, inhibition or loss of the gene may reduce or eliminate the cancer suppressive effect. P53 is one of the most important cancer suppressor genes, and more than 50% of all malignant tumors have tumorigenesis related to rs1042522 site mutation of P53 gene.

The NQO1 gene encodes reduced coenzyme/quinone oxidoreductase. NQO1 enzyme belongs to II-phase metabolic enzyme, and forms a metabolic network for exogenous toxic substances in vivo together with other I and II-phase metabolic enzymes, and plays an important role in detoxification and metabolism of organisms. The rs1800566 polymorphism of NQO1 reduces the detoxification ability of NQO1 enzyme to chemical substances, resulting in increased tumor risk.

The CYP2E1 gene codes cytochrome P4502E1 enzyme, CYP2E1 enzyme is mainly distributed in liver, most of the most suitable substrates are lipophilic small molecular compounds, including benzene, ethanol, chloroethylene, nitrosamine and the like, and most of the most suitable are precancerogen and prototoxicant. Current research shows that rs3813867 polymorphism of CYP2E1 gene can change expression and activity of coded enzyme, thus being related to various tumor susceptibility.

The ADH1B gene encodes a protein that is a member of the alcohol dehydrogenase family. Members of this family of enzymes metabolize a variety of substances, including ethanol, retinol, other aliphatic alcohols, and the like. Research shows that the polymorphism of the ADH1B gene rs1229984 can cause the change of enzyme activity, influence the speed of converting ethanol and the like into acetaldehyde in vivo and further cause different risks of related tumors.

MTHFR is a methylene tetrahydrofolate reductase protein coding gene and mainly has the function of converting 5, 10-methylene tetrahydrofolate into 5-methyl tetrahydrofolate with biological function in a folate metabolism pathway. 5-methyltetrahydrofolate can further enter the methyl transport pathway, indirectly provide methyl groups for DNA methylation and protein methylation through the process of homocysteine demethylation and keep homocysteine levels in the blood at a low level. The research shows that the polymorphism of MTHFR rs1801131 and rs1801133 can change the expression and activity of methylenetetrahydrofolate reductase and is related to various tumor susceptibility.

The CYP1A1 gene encodes cytochrome P4501A 1. The protein is an important main enzyme for activating polycyclic aromatic hydrocarbon carcinogenic substances. Activated CYP1a1 converts various environmental organic substances such as polycyclic aromatic hydrocarbons into cytotoxins or other carcinogens, thereby increasing the risk of cancer development. Research shows that the sites rs1048943 and rs4646903 of CYP1A1 gene are related to the occurrence of various cancers.

The ALDH2 gene is a gene encoding mitochondrial acetaldehyde dehydrogenase, has dehydrogenase activity, and plays a major role in the oxidation of acetaldehyde in the human body (i.e., is directly related to the ability to metabolize alcohol in the body). Research shows that the rs671 site polymorphism of ALDH2 gene can influence the activity of dehydrogenase activity, and the variation of the gene is related to the susceptibility of esophageal squamous cell carcinoma.

TNF is the gene of tumor necrosis factor produced by monocyte and macrophage, the protein coded by said gene is a multifunctional cell factor, it can obviously induce macrophage to inhibit bacterial growth, and can induce several cell factors to produce the activity of indirectly regulating immunocyte, and can raise specific immune protection function. It can not only promote the proliferation and differentiation of osteoclast precursor cell, but also has several effects on osteoblast. Research shows that the polymorphism of the rs1800629 locus of the TNF gene is related to various cancer susceptibilities.

LTA lymphotoxin, also known as tumor necrosis factor beta (TNF-a), is two closely related cytokines, belonging to the TNF family, whose soluble forms both bind to the same cell surface receptor in a trimeric manner, producing completely similar but not identical effects. One of them is that they can kill some tumor cells directly. Research shows that polymorphism of LTA gene rs909253 site can change activity of tumor necrosis factor beta and lose killing effect on tumor cells.

MSH2 mismatch repair gene is a group of genetic susceptibility genes separated from hereditary nonpolyposis carcinoma of large intestine, and any gene mutation in the system can cause defect of cellular mismatch repair function, and as a result, genetic instability is generated, and the gene is expressed as replication error or microsatellite instability, so that tumors are easy to generate. The research shows that the rs2303428 site polymorphism can influence the cellular mismatch repair function and is related to susceptibility of various tumors.

The protein encoded by XRCC1 can effectively repair the breakage of single-stranded DNA caused by ionizing radiation and alkylate. The protein encoded by XRCC1 interacts with DNA ligase III, polymerase beta, poly ADP ribose transferase, and participates in base excision repair of DNA. Numerous studies have shown that the polymorphism of the rs25487 site in the XRCC1 gene is closely related to carcinogenesis.

The main function of MLH1 human mismatch repair gene is to repair the mismatching in DNA strand for some reason. They are capable of recognizing and repairing mismatches generated by insertions, deletions or single nucleotide mutations during DNA replication, thereby greatly reducing genomic microsatellite instability (MSI) and maintaining genomic stability. The research shows that the rs63750447 site polymorphism can influence the cellular mismatch repair function and is related to susceptibility of various tumors.

The microsomal epoxide hydrolase encoded by the EPHX1 gene is an important biotransformation phase II metabolic enzyme, catalyzing the hydrolysis of various epoxidation intermediates to trans-dihydrodiol which is more soluble in water and is discharged out of the body, and the EPHX1 polymorphism leads to an altered enzymatic activity by affecting protein stability. The rs1051740 site polymorphism increases tumor susceptibility through interaction with environmental factors.

The COMT gene encodes catechol-O-methyltransferase, a major enzyme of catecholamine metabolism, an enzyme widely present in the human body, which catalyzes the 3 rd hydroxymethylation of catecholamine in the presence of magnesium ions. The COMT has gene polymorphism, and the polymorphism of the rs4680 site influences the activity of the COMT, thereby determining the decomposition speed of different estrogen metabolites.

The biological function of VDR in vivo is mainly to mediate the cell action of vitamin D, and the VDR in intestinal tract can increase the absorption of calcium and phosphorus in small intestine. In addition, the level of VDR is also related to the degree of differentiation of human tumor cell lines, and human tumor tissue cells have a lower level of VDR than their normal cells. Research shows that polymorphism of the rs731236 and rs1544410 site of the VDR gene can influence differentiation degree of tumor cell strains.

GSTP1, glutathione-S-transferase P1, is a member of a family of GSTs responsible for the metabolism of various carcinogens. GSTP1 belongs to the pi class, and functions to bind various electrophilic compounds, such as drugs, environmental toxins, oxidized chain products, etc., to glutathione and to the next metabolic step. The coding gene of GSTP1 has polymorphism, and rs1695 site variation can change the ability of corresponding enzyme to activate or inactivate heterologous substrates, and may increase the risk of individual tumor.

The ESR1 gene encodes the estrogen receptor, a ligand-activated transcription factor, and is composed of several domains important for hormone binding, DNA binding, and transcriptional activation. The protein is located in nucleus and can form homodimer or heterodimer with estrogen receptor 2. Estrogens and their receptors are important for sexual development and reproductive function, but also play an important role in other tissues such as bone. The ESR1 gene rs2234693 and rs9340799 site polymorphism is related to various cancers.

Cytochrome CYP1B1 is a member of the cytochrome P450(CYP) oxidase superfamily, the CYP1 family, and is expressed primarily in extrahepatic tissues. CYP1B1 catalyzes the metabolism of a number of endogenous (e.g., estrogens) and exogenous compounds including environmental pro-carcinogens (e.g., polycyclic aromatic hydrocarbons) and drugs. CYP1B1 was highly expressed in tumor tissues, and was not expressed or was low expressed in normal tissues. The rs1056836 site polymorphism of the CYP1B1 gene is related to the development of various tumors.

CYP17A1 is one of P450 enzyme family members, is positioned in endoplasmic reticulum of cells, and CYP17A1 is involved in the biosynthesis of sex hormone, so that the gene polymorphism can directly influence the synthesis level of the sex hormone in vivo, thereby influencing the action path and the action effect. When the site rs743572 of CYP17A1 gene is mutated, so that the expression quantity is increased or the enzyme activity is enhanced, the sex hormone secretion is excessive, and the estrogen is a biochemical factor for increasing the endometrial cancer. Thus, increased CYP17a1 enzyme activity may lead to an increased risk of developing uterine cancer.

MMP7 gene matrix metalloprotease is a proteolytic enzyme which depends on metal zinc ions, plays an important role in degradation of extracellular matrix (ECM), tissue reconstruction and regulation of various soluble factors in cells, is a proteolytic enzyme which is closely related to tumorigenesis, invasion and metastasis, is closely related to the occurrence of a plurality of malignant tumors, and is related to the polymorphism of the rs11568818 site.

The SOD2 gene encodes manganese superoxide dismutase. Manganese superoxide dismutase catalyzes superoxide ions (O2-) to be decomposed into H2O2 and oxygen (O2) in mitochondria so as to eliminate superoxide ion free radicals generated by an electron transfer system of a mitochondrial respiratory chain. Superoxide ion free radical O2-is a kind of active oxygen generated by organisms in the process of utilizing oxygen, and if the generation of free radicals in organisms is excessive, the dynamic equilibrium in the body is destroyed, and the cells are damaged. More and more researches show that O2-in the human body is related to diseases such as cancer and the like. Research shows that the rs4880 site mutation can increase superoxide ion free radicals.

MTRR codes 5-methyltetrahydrofolate-homocysteine methyltransferase reductase, referred to as methionine synthetase reductase. The rs1801394 site mutation of MTRR is the main cause of folate/methylvitamin deficiency type E, and is also one of the main causes of homocysteine and folic acid metabolism abnormality.

EGF is a growth factor present in the human body, and its main function is to promote the division of skin cells. The research shows that: the very trace amount of EGF can strongly stimulate cell growth, inhibit the expression of aging genes, prevent skin aging and keep the components of the skin in the optimal physiological state. The rs4444903 site polymorphism has been shown to affect the activity of EGF gene.

At present, the research on the relevance of tumor susceptibility and SNP mostly focuses on the research on the relevance of tumor susceptibility at a single site or a plurality of sites of a certain gene, and the reference susceptibility standards are different when different genes are researched, so that the research on the interaction between the genes is less, and the establishment of a multi-gene and multi-site tumor susceptibility evaluation system is difficult. Therefore, it is urgently needed to establish a rapid, stable, high-throughput, low-price and simple-operation detection method, screen the SNP related to the tumor susceptibility, and evaluate the risk degree of the tumor susceptibility according to the genotype of the SNP, so as to achieve the effect of early screening of high-risk susceptible individuals.

Disclosure of Invention

Although the tumor susceptibility related gene locus related to the invention is disclosed and reported by the prior art, how to establish a detection kit capable of simultaneously detecting a plurality of tumor susceptibility related SNPs has important social value.

The invention can detect 29 variation sites in 25 genes in one hole. For the simultaneous detection of a plurality of variant sites, the specificity of primers of each site of blast family gene fragments needs to be considered simultaneously in design, namely, for sites which are relatively close to each other in the same gene, PCR primers cannot span two sites; and the amplification of pcr primers at multiple variation sites is required to be synchronously performed, and the amplification efficiency is relatively consistent. There is no ready method for designing a single well assay for multiple mutation sites, and it requires creative efforts to those skilled in the art to be able to perform the assay.

In view of this, the invention provides a high-efficiency detection kit for tumor susceptibility related gene locus variation, which comprises a single reaction system, 29 variation loci of 25 tumor susceptibility related genes are amplified, single base extension is carried out at the variation loci, and ddNTP is used as an extension raw material to extend one base at the variation loci. The extended product is desalted and purified and then is detected by a flight time mass spectrum, the molecular masses of the extended product are different at different sites and different variations, and the flight speeds of the extended product in a vacuum tube are different, so that the molecular mass of the product is judged, and the genotype of the site is judged.

In order to achieve the purpose, the invention provides the following technical scheme:

the invention aims to provide a kit for detecting the variation of tumor susceptibility related gene loci, wherein the tumor susceptibility related gene loci are selected from more than 15 mutation loci, preferably more than 20 mutation loci, and more preferably all 29 mutation loci of the following 25 genes; the 29 mutation sites are selected from the rs1042522 site of the TP53 gene; locus rs1800566 of NQO1 gene; the rs3813867 site of the CYP2E1 gene; rs1229984 site of ADH1B gene; locus rs1801131 and rs1801133 of MTHFR gene; CYP1A1 gene rs1048943, rs 46903 locus; rs671 site of ALDH2 gene; rs1800629 locus of TNF gene; LTA gene rs909253 site; rs2303428 locus of MSH2 gene; rs25487 site of XRCC1 gene; rs63750447 site of MLH1 gene; rs1051740 locus of EPHX1 gene; rs4680 site of COMT gene; EGF gene rs4444903 locus; the rs731236 and rs1544410 loci of VDR genes; rs1695 site of GSTP1 gene; ESR1 gene rs2234693, rs9340799 site; the rs1056836 locus of CYP1B1 gene; the rs743572 site of CYP17A1 gene; rs11568818 site of MMP7 gene; rs4880 locus of SOD2 gene; rs1801394 locus of MTRR gene; rs80357973 and rs80358557 sites of BRCA1/2 genes; the detection reagent of the 29 mutation sites respectively comprises SEQ ID NO.1 and SEQ ID NO.2, SEQ ID NO.3 and SEQ ID NO.4, SEQ ID NO.5 and SEQ ID NO.6, SEQ ID NO.7 and SEQ ID NO.8, SEQ ID NO.9 and SEQ ID NO.10, SEQ ID NO.11 and SEQ ID NO.12, SEQ ID NO.13 and SEQ ID NO.14, SEQ ID NO.15 and SEQ ID NO.16, SEQ ID NO.17 and SEQ ID NO.18, SEQ ID NO.19 and SEQ ID NO.20, SEQ ID NO.21 and SEQ ID NO.22, SEQ ID NO.23 and SEQ ID NO.24, SEQ ID NO.25 and SEQ ID NO.26, SEQ ID NO.27 and SEQ ID NO.28, SEQ ID NO.29 and SEQ ID NO.30, SEQ ID NO.31 and SEQ ID NO.32, SEQ ID NO.33 and SEQ ID NO.34, SEQ ID NO.35 and SEQ ID NO.35, SEQ ID NO.38 and SEQ ID NO.38, primer pairs shown as SEQ ID NO.41 and SEQ ID NO.42, SEQ ID NO.43 and SEQ ID NO.44, SEQ ID NO.45 and SEQ ID NO.46, SEQ ID NO.47 and SEQ ID NO.48, SEQ ID NO.49 and SEQ ID NO.50, SEQ ID NO.51 and SEQ ID NO.52, SEQ ID NO.53 and SEQ ID NO.54, SEQ ID NO.55 and SEQ ID NO.56, and SEQ ID NO.57 and SEQ ID NO. 58; the kit contains the primer pair corresponding to the mutation site to be detected, and the primer pairs in the kit are packaged in the same way. The invention reasonably designs the primer pair, so that the primers can simultaneously amplify and detect a plurality of polymorphic sites in one hole through the same package, and the primers have strong detection specificity, high sensitivity and no interference among the polymorphic sites, and can be applied to screening of the tumor susceptibility of high risk groups.

Preferably, the 29 mutation site detection reagents further comprise single-base nucleic acid primers shown in SEQ ID No. 59-SEQ ID No.87, wherein the single-base nucleic acid primers can specifically bind to a target in a single-base extension reaction, extend one base and can type a target gene site.

Preferably, the kit further comprises PCR amplification reagents comprising 10 XPCR Buffer with 20mM, 25mM MgCl₂25mM dNTP Mix, 0.5. mu.M Primer Mix and 5U/. mu.l PCR Enzyme.

Preferably, the kit further comprises an SAP Enzyme digestion treatment reagent, wherein the SAP Enzyme digestion treatment reagent comprises SAP Buffer and SAP Enzyme.

Preferably, the kit further comprises a single-base extension reaction reagent, wherein the single-base extension reaction reagent comprises iPLEX Buffer, iPLEX Termination Mix, extended Primer Mix and iPLEX Enzyme.

The invention also aims to provide a method for detecting the tumor susceptibility related genes by using the kit, which comprises the following steps:

the method for detecting the tumor susceptibility related gene by using the kit comprises the following steps:

1) preparing genome DNA of a sample to be detected, wherein the sample is blood, saliva, oral swab and hairy root from human;

2) taking the extracted genome DNA as a template, mixing primers shown in SEQ ID NO. 1-SEQ ID NO.58 into a tube, performing multiplex PCR amplification, performing SAP enzyme digestion on an amplification product, mixing a single-base extension primer shown in SEQ ID NO. 59-SEQ ID NO.87 into the tube, performing single-base extension reaction, dissociating and adsorbing time-of-flight mass spectrometry by matrix-assisted laser after the reaction is finished, and finally analyzing the genotype of a detection site by Typer software.

Preferably, in the step 2), the PCR amplification condition is pre-denaturation at 95 ℃ for 2 min; denaturation at 95 ℃ for 30s, annealing at 60 ℃ for 30s, extension at 72 ℃ for 60s, and 45 cycles; stretching for 5min at 72 ℃.

Preferably, the SAP enzyme digestion treatment condition is that the temperature is kept for 40min at 37 ℃; keeping the temperature at 85 ℃ for 5 min.

Preferably, the conditions of the single base extension reaction are pre-denaturation at 95 ℃ for 30 s; denaturation at 95 ℃ for 5sec, annealing at 52 ℃ for 5sec, and elongation at 80 ℃ for 5sec for 40 cycles, with 5 cycles of annealing and elongation intervening in each cycle; finally, stretching for 3min at 72 ℃.

The invention has the beneficial effects that: the invention screens the genes related to the tumor susceptibility through a large amount of literature and market research. By designing a multiple PCR amplification primer and a single base extension primer and combining a matrix assisted laser desorption time-of-flight mass spectrometry technology, 29 polymorphic sites can be simultaneously detected in one hole, and the method has the characteristics of strong detection specificity, high sensitivity (the minimum detection limit can reach 0.2ng/ul), rapidness, stability, high flux, low price, simplicity and convenience in operation and the like, and can be applied to screening of tumor susceptibility of high risk groups.

Drawings

In order to make the object, technical scheme and beneficial effect of the invention more clear, the invention provides and explains the following drawings:

FIG. 1 shows a mass spectrometry map of TP53 gene-related sites (A: rs1042522)

FIG. 2 is a diagram of NQO1 gene locus mass spectrometry (A: rs1800566)

FIG. 3 is a diagram of mass spectrometry of the locus related to CYP2E1 gene (A: rs3813867)

FIG. 4 is the ADH1B gene-associated site mass spectrometry (A: rs1229984)

FIG. 5 is a diagram showing the mass spectrometry of MTHFR gene-related sites (A: rs 1801131; B: rs1801133)

FIG. 6 is a mass spectrum of CYP1A1 gene-related site (A: rs 1048943; B: rs4646903)

FIG. 7 shows the mass spectrometric analysis of the site related to the ALDH2 gene (A: rs671)

FIG. 8 shows the mass spectrometric analysis of the relevant site of TNF gene (A: rs1800629)

FIG. 9 shows the LTA gene-associated site mass spectrometry (A: rs909253)

FIG. 10 shows the MSH2 gene-associated site mass spectrometry (A: rs2303428)

FIG. 11 is the XRCC1 gene associated site mass spectrum analysis chart (A: rs25487)

FIG. 12 is a mass spectrum of MLH1 gene-associated site (A: rs63750447)

FIG. 13 is the mass spectrum analysis chart of the locus related to the EPHX1 gene (A: rs1051740)

FIG. 14 is a mass spectrum of the site related to the COMT gene (A: rs4680)

FIG. 15 is an EGF gene associated locus mass spectrometry (A: rs4444903)

FIG. 16 is a chart of mass spectrometry of VDR gene-associated sites (A: rs 731236; B: rs1544410)

FIG. 17 is a mass spectrum of GSTP1 gene-related site (A: rs1695)

FIG. 18 is a diagram of ESR1 gene-related site mass spectrometry (A: rs 2234693; B: rs9340799)

FIG. 19 is a drawing showing the mass spectrometry of the locus related to the CYP1B1 gene (A: rs1056836)

FIG. 20 is a drawing showing the mass spectrometry of the locus related to the CYP17A1 gene (A: rs743572)

FIG. 21 is a mass spectrometric analysis diagram of MMP7 gene-associated site (A: rs11568818)

FIG. 22 shows the mass spectrometric analysis of the locus related to SOD2 gene (A: rs4880)

FIG. 23 is a diagram showing the mass spectrometry of MTRR gene-associated locus (A: rs1801394)

FIG. 24 is a mass spectrum of BRCA1/2 gene-related locus (A: rs 80357973; B: rs80358557)

Detailed Description

The present invention is further described with reference to the following drawings and specific examples so that those skilled in the art can better understand the present invention and can practice the present invention, but the examples are not intended to limit the present invention.

Based on extensive studies and experiments, 29 variant sites of 25 genes were finally selected: TP53 (site rs 1042522); NQO1(rs 1800566); CYP2E1(rs 3813867); ADH1B (rs 1229984); MTHFR (rs1801131, rs 1801133); CYP1a1(rs1048943, rs 4646903); ALDH2(rs 671); TNF (rs 1800629); LTA (rs 909253);

MSH2(rs2303428)；XRCC1(rs25487)；MLH1(rs63750447)；EPHX1(rs1051740)；

COMT(rs4680)；EGF(rs4444903)；VDR(rs731236、rs1544410)；GSTP1(rs1695)；

ESR1(rs2234693, rs 9340799); CYP1B1(rs 1056836); CYP17a1(rs 743572); MMP7(rs 11568818); SOD2(rs 4880); MTRR (rs 1801394); BRCA1/2(rs80357973, rs80358557), which cover common variation sites of tumor susceptibility.

By designing multiple PCR primers and single-base extension primers covering the sites and combining matrix-assisted laser dissociation adsorption time-of-flight mass spectrometry technology, the sites are efficiently, accurately, cheaply and rapidly detected, the designed primer sequences are shown in table 1, and the single-base extension primers are shown in table 2:

TABLE 1 multiplex PCR primers

TABLE 2 Single base extension primers

Gene (locus)	Extension primer (Ext P)
		TP53 rs1042522	TAGG AGC TGC TGG TGC AGG GGC CAC G(SEQ ID NO.59)
NQO1 rs1800566	ccGGCTTCCAAGTCTTAGAA(SEQ ID NO.60)
		CYP2E1 rs3813867	TTGG TTG TGC TGC ACC TAA CAC TGC A(SEQ ID NO61)
ADH1B rs1229984	GGTGGCTGTAGGAATCTGTC(SEQ ID NO.62)
		MTHFR rs1801131	GAAGACTTCAAAGACACTT(SEQ ID NO.63)
MTHFR rs1801133	GTGTC TGC GGG AG(SEQ ID NO.64)
		CYP1A1 rs1048943	GA AGA GAA AGA CCT CCC AGC GGG CAA(SEQ ID NO.65)
CYP1A1 rs4646903	TGTT TCA CTG TAA CCT CCA CCT CC(SEQ ID NO.66)
		ALDH2 rs671	ACTCACAGTTTTCACTT(SEQ ID NO.67)
TNF rs1800629	caCTGGAGGCTGAACCCCGTCC(SEQ ID NO.68)
		LTA rs909253	TCA CAC ATT CTC TGT TTC TGC CAT G(SEQ ID NO.69)
MSH2 rs2303428	TACCTCCCATATTGGGGCCTACA(SEQ ID NO.70)
		XRCC1 rs25487	AGGG TTG GCG TGT GAG GCC TTA CCTC(SEQ ID NO.71)
MLH1 rs63750447	aCCGGGAATCTGTACGA(SEQ ID NO.72)
		EPHX1 rs1051740	A AGC AGG TGG AGA TTC TCA ACA GA(SEQ ID NO.73)
COMT rs4680	CACACCTTGTCCTTCA(SEQ ID NO.74)
		EGF rs4444903	ATGG AAA GTT CCA GC(SEQ ID NO.75)
VDR rs731236	GACGCCGCGCTGAT(SEQ ID NO.76)
		VDR rs1544410	CTGAGTATTGGGAATG(SEQ ID NO.77)
GSTP1 rs1695	TGTAGATGAGGGAGA(SEQ ID NO.78)
		ESR1 rs2234693	ACAGAGACAAAGCATAAAAC(SEQ ID NO.79)
ESR1 rs9340799	GGGACCAATGCTCATCCCAACTC(SEQ ID NO.80)
		CYP1B1 rs1056836	ctTCCGGGTTAGGCCACTTCA(SEQ ID NO.81)
CYP17A1 rs743572	TTGC CAC AGC TCT TCT ACT CCA C(SEQ ID NO.82)
		MMP7 rs11568818	ggcGGAAGCACACAATGTATT(SEQ ID NO.83)
SOD2 rs4880	GCAG CTG GCT CCG G(SEQ ID NO.84)
		MTRR rs1801394	CATGT ACC ACA GCT TGC TCA CA(SEQ ID NO.85)
BRCA1 rs80357973	CTCTGTCTCCAGCA(SEQ ID NO.86)
		BRCA2 rs80358557	ttGGATGTTCTTCAAAGATATTGAAGAA(SEQ ID NO.87)

Reagents used in this example: a radix asparagi whole blood extraction kit (DP348-02),

Pro，PCR Reagent And

Kit CPM (10x 384). Multiplex PCR and extension primers were synthesized from 5OD per tube from Baileger Biotechnology, Inc., Shanghai.

Sample preparation:

a) collecting a specimen: the whole blood sample is prepared by conventionally taking 5ml of venous blood in an EDTA anticoagulation tube, and the blood can be immediately detected after being taken, and can also be stored at 4 ℃ for subsequent use.

b) Extraction of whole blood genomic DNA: referring to the extraction instruction procedure of Tiangen whole blood extraction kit (DP348-02), the absorbance OD260/280 of the extracted DNA is between 1.7 and 2.0, and then the sample is diluted to 10 ng/. mu.L for the next PCR reaction.

Primer dilution:

a) the primer dry powder for multiplex amplification was dissolved in ultrapure water to prepare a 100. mu.M stock solution, and mixed so that the final concentration of each amplification primer was 0.5. mu.M.

b) The dry powder of the extended primers was dissolved with ultrapure water to prepare a 500. mu.M stock solution, which was mixed and prepared and adjusted on a mass spectrometer until the peak heights of the primers were relatively uniform, i.e., the lowest peak height was greater than one-half of the highest peak height.

The detection method comprises the following steps:

a) and (3) PCR amplification:

the following reaction system was prepared:

PCR amplification procedure: pre-denaturation at 95 ℃ for 2 min; denaturation at 95 ℃ for 30s, annealing at 60 ℃ for 30s, extension at 72 ℃ for 60s, and 42 cycles; stretching for 5min at 72 ℃.

SAP enzyme digestion treatment, the enzyme digestion reaction system is as follows:

this was added to 5. mu.L of the reaction product of the first round, for a total of 7. mu.L, and the following reaction was carried out: keeping the temperature at 37 ℃ for 40 min; keeping the temperature at 85 ℃ for 5 min;

the single base extension reaction is carried out to prepare the following reaction system:

this was added to the 7. mu.L reaction product of the previous run, for a total of 9. mu.L, and the following reaction was carried out: pre-denaturation at 95 ℃ for 30 s; denaturation at 95 ℃ for 5sec, annealing at 52 ℃ for 5sec, and elongation at 80 ℃ for 5sec for 40 cycles, with 5 cycles of annealing and elongation intervening in each cycle; finally, stretching for 3min at 72 ℃.

After the completion of the extension reaction, 16. mu.L of ultrapure water was added to the product. The experiment uses a fully automatic 384-well modular system (DP-TOF time-of-flight mass spectrometry) with a chip preparation module. Transferring the sample to a chip preparation module of a flight time mass spectrometer, putting a chip into the module, setting a program, and automatically performing product desalting, sample application chip and product flight steps by a machine. After the flight is finished, the data are analyzed by the self-contained software of the machine.

Example 1, example of accuracy

In the embodiment, 8 whole blood samples are selected and tested by the method and verified by a sanger sequencing method, and the verification result is 100% consistent with that of the method.

Taking one example of the results, the results of mass spectrometry are shown in table 3 below:

TABLE 3 Mass Spectrometry results

The gold standard method with simultaneous sequencing was as follows:

1) sample preparation procedures were the same as described above

2) PCR amplification reagents used: go Taq Hot Start Polymerase from Promega

3) Preparation of primers

A) Designing corresponding specific primers aiming at each site

B)29 pairs of primers were synthesized from Shanghai Bailegg Biotechnology, Inc. at 1OD per tube.

C) Each tube of primer was diluted to 10. mu.M

PCR amplification was performed separately for each site

4) The PCR product was sent to Shang Zhou Shang ya Biotech Co., Ltd for sequencing, and partial sequencing results were analyzed as shown in Table 4 below.

TABLE 4 sequencing results

Example 2 sensitivity example

In the embodiment, 4 whole blood samples are selected, the concentrations are respectively diluted to 10ng/ul, 5ng/ul, 2.5ng/ul, 1ng/ul, 0.5ng/ul, 0.2ng/ul and 0.1ng/ul, three times of experiments are repeated on samples with different gradient concentrations, sanger sequencing is used as a reference method, and the verification result shows that the lowest detection limit can reach 0.2 ng/ul.

The minimum detection limit is given as an example, and the results of mass spectrometry are shown in table 5 below:

TABLE 5 Mass Spectrometry results

The gold standard method of sequencing was as follows:

1) sample preparation procedures were the same as described above

2) PCR amplification reagents used: go Taq Hot Start Polymerase from Promega

3) Preparation of primers

A) Designing corresponding specific primers aiming at each site

C) Each tube of primer was diluted to 10. mu.M

PCR amplification was performed separately for each site

4) The PCR product was sent to Shang Zhou Shang ya Biotech Co., Ltd for sequencing, and partial sequencing results were analyzed as shown in Table 6 below.

TABLE 6 sequencing results

Example 3, specific examples

In this example, 4 samples of whole blood were selected and endogenous interfering substances including bilirubin, triglyceride and hemoglobin were added to the whole blood samples in a ratio or volume such that bilirubin was mixed in at a concentration of 50. mu.M, 200. mu.M and 342. mu.M, triglyceride was mixed in at a concentration of 5mM, 20mM and 37mM, and hemoglobin was mixed in at a concentration of 0.2mg/mL, 1mg/mL and 2 mg/mL. After the endogenous interferents with different concentrations are added to the 4 samples, all the sites can be normally detected, the detection result is consistent with the known detection result of the samples, and the experimental results are shown in table 7.

TABLE 7 results of endogenous interference sample experiments

While the foregoing is directed to the preferred embodiment of the present invention, it will be understood by those skilled in the art that various changes and modifications may be made without departing from the spirit and scope of the invention as defined in the appended claims. Any obvious modifications to the disclosure, which would occur to one skilled in the art, without departing from the true spirit of the disclosure, would constitute a violation of the patent rights afforded by the disclosure and would bear corresponding legal responsibility.

Sequence listing

<110> Zhejiang Ding Spectrum diagnostic technique Co., Ltd

<120> kit for simultaneously detecting multiple SNP sites related to tumor susceptibility

<160> 87

<170> SIPOSequenceListing 1.0

<210> 1

<211> 32

<212> DNA

<213> Unknown (Unknown)

<400> 1

acgttggatg gggacagaag atgacagggg cc 32

<210> 2

<211> 28

<212> DNA

<213> Unknown (Unknown)

<400> 2

acgttggatg cccaggtcca gatgaagc 28

<210> 3

<211> 37

<212> DNA

<213> Unknown (Unknown)

<400> 3

acgttggatg gcaaaataca gtggtgtctc atcccaa 37

<210> 4

<211> 28

<212> DNA

<213> Unknown (Unknown)

<400> 4

acgttggatg ttctgtatcc tcagagtg 28

<210> 5

<211> 31

<212> DNA

<213> Unknown (Unknown)

<400> 5

acgttggatg cctctgccag aggccaacgc c 31

<210> 6

<211> 29

<212> DNA

<213> Unknown (Unknown)

<400> 6

acgttggatg ttggttgtgc tgcacctaa 29

<210> 7

<211> 33

<212> DNA

<213> Unknown (Unknown)

<400> 7

acgttggatg gcctcatggc ctaaaatcac agg 33

<210> 8

<211> 32

<212> DNA

<213> Unknown (Unknown)

<400> 8

acgttggatg ctctttattc tgtagatggt gg 32

<210> 9

<211> 36

<212> DNA

<213> Unknown (Unknown)

<400> 9

acgttggatg ggtttggttc tcccgagagg taaaga 36

<210> 10

<211> 28

<212> DNA

<213> Unknown (Unknown)

<400> 10

acgttggatg ctacctgaag agcaagtc 28

<210> 11

<211> 33

<212> DNA

<213> Unknown (Unknown)

<400> 11

acgttggatg cttcacaaag cggaagaatg tgt 33

<210> 12

<211> 28

<212> DNA

<213> Unknown (Unknown)

<400> 12

acgttggatg acttgaagga gaaggtgt 28

<210> 13

<211> 33

<212> DNA

<213> Unknown (Unknown)

<400> 13

acgttggatg gctgaattcc acccgttgca gca 33

<210> 14

<211> 30

<212> DNA

<213> Unknown (Unknown)

<400> 14

acgttggatg tgggcaagcg gaagtgtatc 30

<210> 15

<211> 33

<212> DNA

<213> Unknown (Unknown)

<400> 15

acgttggatg gtgtgcctgc ggccccaact act 33

<210> 16

<211> 28

<212> DNA

<213> Unknown (Unknown)

<400> 16

acgttggatg ctgaggtggg agaatcgt 28

<210> 17

<211> 32

<212> DNA

<213> Unknown (Unknown)

<400> 17

acgttggatg ggtggctaca agatgtcggg ga 32

<210> 18

<211> 28

<212> DNA

<213> Unknown (Unknown)

<400> 18

acgttggatg aggtcccaca ctcacagt 28

<210> 19

<211> 33

<212> DNA

<213> Unknown (Unknown)

<400> 19

acgttggatg aggaaacaga ccacagacct ggt 33

<210> 20

<211> 28

<212> DNA

<213> Unknown (Unknown)

<400> 20

acgttggatg aggaggtcgt cactaaac 28

<210> 21

<211> 37

<212> DNA

<213> Unknown (Unknown)

<400> 21

acgttggatg cttctctgtc tctgactctc catctgt 37

<210> 22

<211> 31

<212> DNA

<213> Unknown (Unknown)

<400> 22

acgttggatg ggaagagacg ttcaggtggt g 31

<210> 23

<211> 35

<212> DNA

<213> Unknown (Unknown)

<400> 23

acgttggatg tatgctatgt cagtgtaaac ctacg 35

<210> 24

<211> 28

<212> DNA

<213> Unknown (Unknown)

<400> 24

acgttggatg ggctaagatg cagtccac 28

<210> 25

<211> 32

<212> DNA

<213> Unknown (Unknown)

<400> 25

acgttggatg ttgcccagca caggataagg ag 32

<210> 26

<211> 27

<212> DNA

<213> Unknown (Unknown)

<400> 26

acgttggatg tcgtgcgtaa ggagtgg 27

<210> 27

<211> 34

<212> DNA

<213> Unknown (Unknown)

<400> 27

acgttggatg ctacttctgg aagtagtgat aagg 34

<210> 28

<211> 26

<212> DNA

<213> Unknown (Unknown)

<400> 28

acgttggatg cttctgttcc cgggaa 26

<210> 29

<211> 40

<212> DNA

<213> Unknown (Unknown)

<400> 29

acgttggatg ggacagctgc ttccactatg gcttcaactc 40

<210> 30

<211> 26

<212> DNA

<213> Unknown (Unknown)

<400> 30

acgttggatg ctctggctgg cgtttt 26

<210> 31

<211> 29

<212> DNA

<213> Unknown (Unknown)

<400> 31

acgttggatg tcaccagggg cgaggctca 29

<210> 32

<211> 28

<212> DNA

<213> Unknown (Unknown)

<400> 32

acgttggatg ttttccaggt ctgacaac 28

<210> 33

<211> 31

<212> DNA

<213> Unknown (Unknown)

<400> 33

acgttggatg agctgagtca ttccactttt c 31

<210> 34

<211> 28

<212> DNA

<213> Unknown (Unknown)

<400> 34

acgttggatg gctctggctg acttcact 28

<210> 35

<211> 34

<212> DNA

<213> Unknown (Unknown)

<400> 35

acgttggatg cttctggatc atcttggcat agag 34

<210> 36

<211> 28

<212> DNA

<213> Unknown (Unknown)

<400> 36

acgttggatg cttcttctct atccccgt 28

<210> 37

<211> 31

<212> DNA

<213> Unknown (Unknown)

<400> 37

acgttggatg gttcacgcaa gagcagagcc t 31

<210> 38

<211> 28

<212> DNA

<213> Unknown (Unknown)

<400> 38

acgttggatg gaggaactag ataagcag 28

<210> 39

<211> 31

<212> DNA

<213> Unknown (Unknown)

<400> 39

acgttggatg gaccagcagg aggcagccct g 31

<210> 40

<211> 27

<212> DNA

<213> Unknown (Unknown)

<400> 40

acgttggatg tggtgcagat gctcaca 27

<210> 41

<211> 33

<212> DNA

<213> Unknown (Unknown)

<400> 41

acgttggatg gttctgtgtt gtccatcagt tca 33

<210> 42

<211> 30

<212> DNA

<213> Unknown (Unknown)

<400> 42

acgttggatg atcccaactc tagaccacac 30

<210> 43

<211> 34

<212> DNA

<213> Unknown (Unknown)

<400> 43

acgttggatg tgttctgtgt tgtccatcag ttca 34

<210> 44

<211> 33

<212> DNA

<213> Unknown (Unknown)

<400> 44

acgttggatg attagagacc aatgctcatc cca 33

<210> 45

<211> 36

<212> DNA

<213> Unknown (Unknown)

<400> 45

acgttggatg tcaaagttct ccgggttagg ccactt 36

<210> 46

<211> 27

<212> DNA

<213> Unknown (Unknown)

<400> 46

acgttggatg aaccagtggt ctgtgaa 27

<210> 47

<211> 31

<212> DNA

<213> Unknown (Unknown)

<400> 47

acgttggatg aagagagcca cgagctccca c 31

<210> 48

<211> 30

<212> DNA

<213> Unknown (Unknown)

<400> 48

acgttggatg tagagttgcc acagctcttc 30

<210> 49

<211> 30

<212> DNA

<213> Unknown (Unknown)

<400> 49

acgttggatg cagttacaac gcctccacgc 30

<210> 50

<211> 27

<212> DNA

<213> Unknown (Unknown)

<400> 50

acgttggatg gagtcaattt atgcagc 27

<210> 51

<211> 37

<212> DNA

<213> Unknown (Unknown)

<400> 51

acgttggatg cgcgttgatg tgaggttcca gggcgcc 37

<210> 52

<211> 27

<212> DNA

<213> Unknown (Unknown)

<400> 52

acgttggatg ggctgtgctt tctcgtc 27

<210> 53

<211> 33

<212> DNA

<213> Unknown (Unknown)

<400> 53

acgttggatg gaggtttctg ttactatatg cta 33

<210> 54

<211> 28

<212> DNA

<213> Unknown (Unknown)

<400> 54

acgttggatg aacggctcta accttatc 28

<210> 55

<211> 38

<212> DNA

<213> Unknown (Unknown)

<400> 55

acgttggatg aggtaggtgt ccagctcctg gcactggt 38

<210> 56

<211> 30

<212> DNA

<213> Unknown (Unknown)

<400> 56

acgttggatg accaggaccc tggagtcgat 30

<210> 57

<211> 39

<212> DNA

<213> Unknown (Unknown)

<400> 57

acgttggatg aggtagcttc agaacagctt caaataagg 39

<210> 58

<211> 34

<212> DNA

<213> Unknown (Unknown)

<400> 58

acgttggatg gcttggaaaa taacatctga gggg 34

<210> 59

<211> 26

<212> DNA

<213> Unknown (Unknown)

<400> 59

taggagctgc tggtgcaggg gccacg 26

<210> 60

<211> 20

<212> DNA

<213> Unknown (Unknown)

<400> 60

ccggcttcca agtcttagaa 20

<210> 61

<211> 26

<212> DNA

<213> Unknown (Unknown)

<400> 61

ttggttgtgc tgcacctaac actgca 26

<210> 62

<211> 20

<212> DNA

<213> Unknown (Unknown)

<400> 62

ggtggctgta ggaatctgtc 20

<210> 63

<211> 19

<212> DNA

<213> Unknown (Unknown)

<400> 63

gaagacttca aagacactt 19

<210> 64

<211> 13

<212> DNA

<213> Unknown (Unknown)

<400> 64

gtgtctgcgg gag 13

<210> 65

<211> 26

<212> DNA

<213> Unknown (Unknown)

<400> 65

gaagagaaag acctcccagc gggcaa 26

<210> 66

<211> 24

<212> DNA

<213> Unknown (Unknown)

<400> 66

tgtttcactg taacctccac ctcc 24

<210> 67

<211> 17

<212> DNA

<213> Unknown (Unknown)

<400> 67

actcacagtt ttcactt 17

<210> 68

<211> 22

<212> DNA

<213> Unknown (Unknown)

<400> 68

cactggaggc tgaaccccgt cc 22

<210> 69

<211> 25

<212> DNA

<213> Unknown (Unknown)

<400> 69

tcacacattc tctgtttctg ccatg 25

<210> 70

<211> 23

<212> DNA

<213> Unknown (Unknown)

<400> 70

tacctcccat attggggcct aca 23

<210> 71

<211> 26

<212> DNA

<213> Unknown (Unknown)

<400> 71

agggttggcg tgtgaggcct tacctc 26

<210> 72

<211> 17

<212> DNA

<213> Unknown (Unknown)

<400> 72

accgggaatc tgtacga 17

<210> 73

<211> 24

<212> DNA

<213> Unknown (Unknown)

<400> 73

aagcaggtgg agattctcaa caga 24

<210> 74

<211> 16

<212> DNA

<213> Unknown (Unknown)

<400> 74

cacaccttgt ccttca 16

<210> 75

<211> 15

<212> DNA

<213> Unknown (Unknown)

<400> 75

atggaaagtt ccagc 15

<210> 76

<211> 14

<212> DNA

<213> Unknown (Unknown)

<400> 76

gacgccgcgc tgat 14

<210> 77

<211> 16

<212> DNA

<213> Unknown (Unknown)

<400> 77

ctgagtattg ggaatg 16

<210> 78

<211> 15

<212> DNA

<213> Unknown (Unknown)

<400> 78

tgtagatgag ggaga 15

<210> 79

<211> 20

<212> DNA

<213> Unknown (Unknown)

<400> 79

acagagacaa agcataaaac 20

<210> 80

<211> 23

<212> DNA

<213> Unknown (Unknown)

<400> 80

gggaccaatg ctcatcccaa ctc 23

<210> 81

<211> 21

<212> DNA

<213> Unknown (Unknown)

<400> 81

cttccgggtt aggccacttc a 21

<210> 82

<211> 23

<212> DNA

<213> Unknown (Unknown)

<400> 82

ttgccacagc tcttctactc cac 23

<210> 83

<211> 21

<212> DNA

<213> Unknown (Unknown)

<400> 83

ggcggaagca cacaatgtat t 21

<210> 84

<211> 14

<212> DNA

<213> Unknown (Unknown)

<400> 84

gcagctggct ccgg 14

<210> 85

<211> 22

<212> DNA

<213> Unknown (Unknown)

<400> 85

catgtaccac agcttgctca ca 22

<210> 86

<211> 14

<212> DNA

<213> Unknown (Unknown)

<400> 86

ctctgtctcc agca 14

<210> 87

<211> 28

<212> DNA

<213> Unknown (Unknown)

<400> 87

ttggatgttc ttcaaagata ttgaagaa 28

Claims

1. A kit for detecting the variation of tumor susceptibility related gene loci simultaneously, wherein the tumor susceptibility related gene loci are selected from more than 15, preferably more than 20, and more preferably all 29 mutation loci of the following 25 genes, and the locus screening is related to tumor susceptibility diseases according to evidence levels; the 29 mutation sites are selected from the rs1042522 site of the TP53 gene; locus rs1800566 of NQO1 gene; the rs3813867 site of the CYP2E1 gene; rs1229984 site of ADH1B gene; locus rs1801131 and rs1801133 of MTHFR gene; CYP1A1 gene rs1048943, rs 46903 locus; rs671 site of ALDH2 gene; rs1800629 locus of TNF gene; LTA gene rs909253 site; rs2303428 locus of MSH2 gene; rs25487 site of XRCC1 gene; rs63750447 site of MLH1 gene; rs1051740 locus of EPHX1 gene; rs4680 site of COMT gene; EGF gene rs4444903 locus; the rs731236 and rs1544410 loci of VDR genes; rs1695 site of GSTP1 gene; ESR1 gene rs2234693, rs9340799 site; the rs1056836 locus of CYP1B1 gene; the rs743572 site of CYP17A1 gene; rs11568818 site of MMP7 gene; rs4880 locus of SOD2 gene; rs1801394 locus of MTRR gene; rs80357973 and rs80358557 sites of BRCA1/2 genes; the detection reagent of the 29 mutation sites respectively comprises SEQ ID NO.1 and SEQ ID NO.2, SEQ ID NO.3 and SEQ ID NO.4, SEQ ID NO.5 and SEQ ID NO.6, SEQ ID NO.7 and SEQ ID NO.8, SEQ ID NO.9 and SEQ ID NO.10, SEQ ID NO.11 and SEQ ID NO.12, SEQ ID NO.13 and SEQ ID NO.14, SEQ ID NO.15 and SEQ ID NO.16, SEQ ID NO.17 and SEQ ID NO.18, SEQ ID NO.19 and SEQ ID NO.20, SEQ ID NO.21 and SEQ ID NO.22, SEQ ID NO.23 and SEQ ID NO.24, SEQ ID NO.25 and SEQ ID NO.26, SEQ ID NO.27 and SEQ ID NO.28, SEQ ID NO.29 and SEQ ID NO.30, SEQ ID NO.31 and SEQ ID NO.32, SEQ ID NO.33 and SEQ ID NO.34, SEQ ID NO.35 and SEQ ID NO.35, SEQ ID NO.38 and SEQ ID NO.38, primer pairs shown as SEQ ID NO.41 and SEQ ID NO.42, SEQ ID NO.43 and SEQ ID NO.44, SEQ ID NO.45 and SEQ ID NO.46, SEQ ID NO.47 and SEQ ID NO.48, SEQ ID NO.49 and SEQ ID NO.50, SEQ ID NO.51 and SEQ ID NO.52, SEQ ID NO.53 and SEQ ID NO.54, SEQ ID NO.55 and SEQ ID NO.56, and SEQ ID NO.57 and SEQ ID NO. 58; the kit contains the primer pair which is designed with the site to be detected and has no interference among multi-site primers, and the primer pairs in the kit are packaged in the same way.

2. The kit according to claim 1, wherein the detection reagents for the plurality of mutation sites further comprise single-base nucleic acid primers which are designed with the site to be detected and do not interfere with multiple sites, and the single-base nucleic acid primers are respectively shown as SEQ ID No. 59-SEQ ID No. 87.

3. The kit of claim 1, further comprising PCR amplification reagents comprising 10 XPCR Buffer with 20mM, 25mM MgCl₂25mM dNTP Mix, 0.5. mu.M Primer Mix and 5U/. mu.l PCR Enzyme.

4. The kit of claim 1, further comprising an SAP enzymatic digestion treatment reagent comprising an SAP Buffer and an SAP Enzyme.

5. The kit of claim 1, further comprising a single base extension reaction reagent comprising iPLEX Buffer, iPLEX Termination Mix, extended Primer Mix, and iPLEX Enzyme.

6. Use of the kit of any one of claims 1 to 5 for simultaneously detecting multiple SNP sites associated with tumor susceptibility.