CN112501305A

CN112501305A - Primer probe combination for quantitative detection of TFPI2 gene methylation and application, kit and method thereof

Info

Publication number: CN112501305A
Application number: CN202011508431.0A
Authority: CN
Inventors: 罗光华; 甘圣春
Original assignee: Jiangsu Mojin Bioengineering Technology Co ltd
Current assignee: Jiangsu Mojin Bioengineering Technology Co ltd
Priority date: 2020-12-18
Filing date: 2020-12-18
Publication date: 2021-03-16
Anticipated expiration: 2040-12-18
Also published as: CN112501305B

Abstract

The invention provides a primer probe combination for quantitative methylation detection of a TFPI2 gene, and application, a kit and a method thereof, belonging to the technical field of genetic engineering, wherein the primer probe combination comprises a primer probe for amplifying a TFPI2 gene and an ACTB gene; the primer probe of the TFPI2 gene comprises T2-F, T2-R and T2-P, and the nucleotide sequence is sequentially shown as SEQ ID No. 1-3; the primer probe of the ACTB gene comprises AB-F, AB-R and AB-P, and the nucleotide sequence is sequentially shown in SEQ ID No. 4-6. The primer probe combination for quantitative detection of TFPI2 gene methylation provided by the invention can realize quantitative detection of TFPI2 gene methylation.

Description

Primer probe combination for quantitative detection of TFPI2 gene methylation and application, kit and method thereof

Technical Field

The invention belongs to the technical field of genetic engineering, and particularly relates to a primer probe combination for quantitative detection of TFPI2 gene methylation, application thereof, a kit and a method.

Background

Colorectal cancer is one of the most common malignant tumors in the world, and according to the report of the national cancer center in 2018, colorectal cancer is the third most common malignant tumor in men and women, and death cases are ranked fourth and third in men and women all over the world. The incidence of colorectal cancer in developed countries is significantly higher than in developing countries, which is related to higher obesity rates, unhealthy eating habits and other factors in developed countries.

The large-scale population screening is an important way for reducing the morbidity and mortality of colorectal cancer, and the traditional colorectal cancer screening has the problems of poor sensitivity, low patient acceptance and the like; the new screening method (such as blood and excrement DNA detection) has the problems of high price, low patient acceptance and the like.

DNA methylation (DNA methylation) is a form of chemical modification of DNA that can alter genetic behavior without altering the DNA sequence. DNA methylation refers to the covalent bonding of a methyl group to the cytosine 5' carbon of a genomic CpG dinucleotide under the action of DNA methyltransferase. Numerous studies have shown that DNA methylation can cause changes in chromatin structure, DNA conformation, DNA stability, and the way DNA interacts with proteins, thereby controlling gene expression. A great deal of research in recent years shows that DNA abnormal methylation is closely related to the occurrence, development and canceration of tumors. The DNA methylation biological effect is used as an early marker of tumorigenesis and development, and the tissue canceration degree at the current stage can be better marked and the tissue canceration risk can be predicted at the histopathological level. However, the detection of methylation in the prior art is limited to qualitative detection, and how to design a primer probe to realize quantitative detection of TFPI2 gene methylation is not provided.

Disclosure of Invention

In view of this, the invention aims to provide a primer probe combination for quantitative detection of TFPI2 gene methylation, and an application, a kit and a method thereof, and the primer probe combination for quantitative detection of TFPI2 gene methylation provided by the invention can realize quantitative detection of TFPI2 gene methylation.

In order to achieve the above purpose, the invention provides the following technical scheme:

the invention provides a primer probe combination for quantitative methylation detection of a TFPI2 gene, which comprises a primer probe for amplifying a TFPI2 gene and an ACTB gene;

the primer probe of the TFPI2 gene comprises T2-F, T2-R and T2-P, the nucleotide sequence of the T2-F is shown as SEQ ID No.1, the nucleotide sequence of the T2-R is shown as SEQ ID No.2, and the nucleotide sequence of the T2-P is shown as SEQ ID No. 3;

the primer probe of the ACTB gene comprises AB-F, AB-R and AB-P, the nucleotide sequence of the AB-F is shown as SEQ ID No.4, the nucleotide sequence of the AB-R is shown as SEQ ID No.5, and the nucleotide sequence of the AB-P is shown as SEQ ID No. 6.

Preferably, 6-FAM is added at the 5 'end of the T2-P, and BHQ1 is added at the 3' end;

ROX is added to the 5 'end of the AB-P, and BHQ2 is added to the 3' end.

Preferably, the nucleotide sequence of the TFPI2 gene is shown as SEQ ID No.7, and the nucleotide sequence of the ACTB gene is shown as SEQ ID No. 8.

The invention also provides a kit for quantitative detection of TFPI2 gene methylation, which comprises quantitative PCR reaction liquid, Taq enzyme, a positive calibrator, a positive control and a negative control; the quantitative PCR reaction solution contains the primer probe combination of the technical scheme.

Preferably, the quantitative PCR reaction solution comprises, per 22.5 μ L: 10 x 2.5-5 μ L of Buffer, 100 μ M T2-F0.02-0.1 μ L, 100 μ M T2-R0.02-0.1 μ L, 100 μ M AB-F0.02-0.1 μ L, 100 μ M AB-R0.02-0.1 μ L, 100 μ M T2-P0.02-0.1 μ L, 100 μ M AB-P0.02-0.1 μ L, 10mM dNTPs 0.1-1 μ L, Mg²⁺0.5-2. mu.L of 50mM solution of ddH₂O18.25μL。

Preferably, the positive calibrator is 4 solutions containing T2 plasmid, and the concentrations of T2 plasmid in the 4 solutions are 1 × 10⁵copies/μL、1×10⁴copies/μL、1×10³copies/. mu.L and 1X 10²copies/μL。

Preferably, the enzyme activity of the Taq enzyme is 50U/mu L; the positive control is DNA positive to TFPI2 gene methylation, and the negative control is DNA negative to TFPI2 gene methylation.

The invention also provides application of the primer probe combination in the technical scheme in preparation of a reagent for predicting colorectal cancer recurrence risk.

The invention also provides a method for quantitatively detecting the methylation of the TFPI2 gene by using the kit based on the technical scheme, which comprises the following steps:

1) carrying out sulfite conversion on the sample DNA to obtain converted DNA;

2) carrying out fluorescent quantitative PCR reaction on the transformed DNA obtained in the step 1) by using the kit, and taking a positive calibrator as a quantitative calibrator to obtain the copy number of the TFPI2 gene and the copy number of the ACTB gene in a sample; and dividing the copy number of the TFPI2 gene by the copy number of the ACTB gene and multiplying the result by 100 to obtain the methylation rate of the TFPI2 gene in the sample, thereby realizing the quantitative detection of the methylation of the TFPI2 gene.

Preferably, the conditions of the fluorescent quantitative PCR reaction of step 2) include: 10min at 95 ℃; 95 ℃ for 15s, 60 ℃ for 30s, 40 cycles.

The invention provides a primer probe combination for quantitative detection of TFPI2 gene methylation. Specific primers are respectively designed aiming at CpG island and ACTB sequences of a TFPI2 gene, real-time quantitative PCR is carried out by using a probe, T2 plasmid is used as a quantitative calibrator, copy numbers of TFPI2 and ACTB in a sample are obtained, methylation rate of TFPI2 in each sample is obtained by multiplying the copy number of TFPI 2/copy number of ACTB by 100, and quantitative detection of TFPI2 gene methylation is realized.

Drawings

Fig. 1 is a scatter plot of TFPI2 methylation rates (ordinate) versus statistical distribution of different colorectal tissue types (abscissa), at the pathological level, classified into six types of colorectal tissues according to the progression of colorectal cancer development, with tens of samples of TFPI2 methylation rates measured per group to give a group TFPI2 methylation rate; cancer tissue: 32, para-carcinoma tissue: 32, high grade intraepithelial neoplasia: 50, intraepithelial neoplasia of low grade: 52, polyp tissue: 49, normal tissue: 49, total number of samples: 264.

Detailed Description

The invention provides a primer probe combination for quantitative methylation detection of a TFPI2 gene, which comprises a primer probe for amplifying a TFPI2 gene and an ACTB gene; the primer probe of the TFPI2 gene comprises T2-F, T2-R and T2-P, the nucleotide sequence of the T2-F is shown as SEQ ID No.1, the nucleotide sequence of the T2-R is shown as SEQ ID No.2, and the nucleotide sequence of the T2-P is shown as SEQ ID No. 3; the primer probe of the ACTB gene comprises AB-F, AB-R and AB-P, the nucleotide sequence of the AB-F is shown as SEQ ID No.4, the nucleotide sequence of the AB-R is shown as SEQ ID No.5, and the nucleotide sequence of the AB-P is shown as SEQ ID No. 6.

The invention designs specific primers aiming at CpG island and ACTB sequence of TFPI2 gene respectively. In the invention, the accession number of the TFPI2 gene is NG _032914, and the accession number of the ACTB gene is NG _ 007992. In the invention, the CpG island of the TFPI2 gene is positioned in a promoter region and is a key region for regulating gene transcription, the C methylation of a specific site in the CpG island has great influence on the expression activity of the gene, the methylation condition of the specific site can be detected by designing a specific primer probe sequence, and positive shows that the canceration risk is high and the negative canceration risk is low.

ACTB is a housekeeping gene commonly used in cells, and a detection primer probe sequence is designed at the junction of an exon and an intron of the gene, so that the cell number can be specifically calibrated, and the detection primer probe sequence is necessary for accurate methylation quantification.

In the invention, the nucleotide sequence of T2-F is shown as SEQ ID No.1, and specifically comprises the following steps:

GATCGTAGTGTAAGACGTTC；

the nucleotide sequence of the T2-R is shown as SEQ ID No.2, and specifically comprises the following steps:

ATAACGAACACACGATCCG；

the nucleotide sequence of the T2-P is shown as SEQ ID No.3, and specifically comprises the following steps:

AAAGAGCGTATGGCGAGATG, it is preferable to add 6-FAM to the 5 'end of T2-P and BHQ1 to the 3' end.

In the invention, the nucleotide sequence of the AB-F is shown as SEQ ID No.4, and specifically comprises the following steps:

TTATTGTGGGGTGTTTTAGGTATTAG；

the nucleotide sequence of the AB-R is shown as SEQ ID No.5, and specifically comprises the following steps:

AAACACCCTTACCTCCCACC；

the nucleotide sequence of the AB-P is shown as SEQ ID No.6, and specifically comprises the following steps:

agttggttgggtggggtagttttggg, it is preferable to add ROX at the 5 'end of AB-P and BHQ2 at the 3' end.

The invention also provides a kit for quantitative detection of TFPI2 gene methylation, which comprises quantitative PCR reaction liquid, Taq enzyme, a positive calibrator, a positive control and a negative control; the quantitative PCR reaction solution contains the primer probe in the technical scheme.

In the present invention, the quantitative PCR reaction solution preferably contains, per 22.5. mu.L: 10 x 2.5-5 μ L of Buffer, 100 μ M T2-F0.02-0.1 μ L, 100 μ M T2-R0.02-0.1 μ L, 100 μ M AB-F0.02-0.1 μ L, 100 μ M AB-R0.02-0.1 μ L, 100 μ M T2-P0.02-0.1 μ L, 100 μ M AB-P0.02-0.1 μ L, 10mM dNTPs 0.1-1 μ L, Mg²⁺0.5-2. mu.L of 50mM solution of ddH₂O18.25. mu.L. The source of the reagent is not particularly limited in the present invention, and a conventional commercially available product may be used. The amount of the quantitative PCR reaction solution placed in the kit is not particularly limited, and the amount of the reaction solution placed in the conventional kit can be adopted.

In the present invention, the positive calibrator is preferably 4 solutions containing T2 plasmid, and the concentrations of T2 plasmid in the 4 solutions are 1 × 10⁵copies/μL、1×10⁴copies/μL、1×10³copies/. mu.L and 1X 10²copies/. mu.L. The invention uses T2 plasmid as quantitative calibrator. The amount of the positive calibrator in the kit is not particularly limited, and the positive calibrator can be placed in the kit by a conventional method.

In the invention, the nucleotide sequence of the T2 plasmid is shown as SEQ ID No.7, and specifically comprises the following steps: wherein, the bold part is a TFPI2 amplification fragment, and the italic part is an ACTB amplification fragment.

In the invention, the enzyme activity of the Taq enzyme is preferably 50U/. mu.L, the amount of the Taq enzyme placed in the kit is not particularly limited, and the amount of the enzyme placed in the kit can be determined by adopting the conventional method.

In the present invention, the positive control is preferably DNA positive for methylation of TFPI2 gene, and the negative control is preferably DNA negative for methylation of TFPI2 gene. In the invention, the positive control is DNA extracted from a tumor cell strain with positive TFPI2 gene methylation, and the negative control is DNA extracted from a cell strain with negative TFPI2 gene methylation. The specific nucleotide sequence is as follows:

TFPI2 gene methylation positive control (SEQ ID No. 8):

GTTCGTTGGGTAAGGCGTTCGAGAAAGCGTTTGGCGGGAGGAGGTGCGCGGTTTTTTGTTTTAGGCGGTTCGGGTGTTCGTTTT；

TFPI2 gene methylation negative control (SEQ ID No. 9):

GTTTGTTGGGTAAGGTGTTTGAGAAAGTGTTTGGTGGGAGGAGGTGTGTGGTTTTTTGTTTTAGGTGGTTTGGGTGTTTGTTTT。

1) carrying out sulfite conversion on the sample DNA to obtain converted DNA;

In the present invention, the sample is preferably colorectal cancer tissue. The method for extracting DNA of colorectal cancer is not particularly limited, and the method for extracting DNA in tissues can be adopted. The method of the present invention for transforming a sample DNA with sulfite is not particularly limited, and is preferably performed according to the instructions in the Qiagen59104EpiTect bisufite Kit. In the present invention, the principle of sulfite conversion is: methylated C is not converted in a sulfite environment, unmethylated C is converted into T in the sulfite environment, and after the sulfite conversion, a PCR fluorescent probe method is used to distinguish whether C at a specific site is converted into T, so that whether the C at the site is methylated or not is judged.

In the present invention, the conditions of the fluorescent quantitative PCR reaction preferably include: 10min at 95 ℃; 95 ℃ for 15s, 60 ℃ for 30s, 40 cycles. In the present invention, the system of the fluorescent quantitative PCR reaction is shown in table 1:

TABLE 1 fluorescent quantitative PCR reaction System

Composition (I)	Volume of
		10×Buffer	2.5μL
T2-F(10μM)	0.4μL
		T2-R(10μM)	0.4μL
AB-F(10μM)	0.4μL
		AB-R(10μM)	0.4μL
T2-P(10μM)	0.6μL
		AB-P(10μM)	0.3μL
dNTPs(10mM)	0.5μL
		Mg²⁺(50mM)	1μL
Water (W)	16μL
		Taq enzyme (5U/. mu.L)	0.5μL
DNA after transformation (DNA concentration 10 ng/. mu.L)	2μL
		Total volume	25μL

The fluorescent quantitative PCR is preferably carried out by using an ABI7500 PCR instrument. And taking the positive calibrator as a quantitative calibrator to obtain the copy number of the TFPI2 gene and the copy number of the ACTB gene in the sample. In the invention, four calibrators synchronously carry out PCR reaction and calibrate corresponding concentrations (TFPI2 and ACTB copy number) when detecting a sample, the sample concentrations (TFPI2 and ACTB copy number) are calculated by self-contained software analysis of a PCR instrument according to the relation between the Ct value and the concentration (TFPI2 and ACTB copy number) of the calibrators, and the methylation rate is calculated by the formula: the methylation rate of each sample was calculated as TFPI2 copy number/ACTB copy number × 100 (so this methylation rate can be understood as the number of TFPI2 methylation positive cells out of 100 cells).

The technical solutions provided by the present invention are described in detail below with reference to examples, but they should not be construed as limiting the scope of the present invention.

Reagent and instrument sources: the Qiagen EpiTect bisufite Kit (48) Kit was purchased from Shanghai Youning vitamin science and technology, Inc.; the Omega FFPE DNA Kit D3399 paraffin-embedded tissue DNA extraction Kit is purchased from Nanjing Youlbo Biotech limited; primer probe is synthesized by Competition Biotechnology engineering (Shanghai) Ltd; taq enzyme was purchased from Bioline (Meridian Life Science, Inc.); dNTPs were purchased from Novozan Biotechnology, Inc.; the calibrator (T2 plasmid) was synthesized by Kinsley Biotechnology Ltd; the positive control is whole genome DNA extracted from the HT-29 cell strain; the negative control is whole genome DNA extracted from 293T cell line.

Example 1

Firstly, preparing TFPI2 methylation positive and negative control products by using an HT-29 cell strain and a 293T cell strain; a plasmid (T2) containing the TFPI2 and ACTB gene fragments was synthesized and diluted to 1X 10⁵copies/mL、1×10⁴copies/mL、1×10³copies/mL、1×10²copies/mL4 concentration gradients were used for quantification. Taking six paraffin section samples of colorectal cancer tissues and corresponding paracarcinoma tissues as examples, the TFPI2 gene methylation is quantitatively detected.

Paraffin tissue DNA extraction

1. Taking 3-8 paraffin slice samples with the size of 10-20 mu m to a 1.5mL centrifuge tube, adding 1mL dimethylbenzene, and violently swirling for 10s for uniform mixing. Centrifuge at 10,000g for 2min and carefully aspirate the supernatant (do not aspirate into the slice).

3. Add 1mL of absolute ethanol and mix by vortexing.

4.10,000 g for 2min, carefully aspirate the supernatant (do not aspirate the slices); uncovering the cover at 37 ℃ and air drying for 5min until the ethanol is completely volatilized (if wax blocks are not completely removed, dewaxing can be repeated).

5. Add 200. mu.L of BufferFTL and 20. mu.l of OB protease and vortex and mix.

Water bath is carried out for 3h at the temperature of 6.55 ℃ or until the tissue is digested, and the mixture is uniformly mixed once every 20-30 min. If desired, the mixture may be digested overnight.

Water bath at 7.90 deg.c for 60 min.

8. Standing at room temperature for 5 min.

9. Add 220. mu.L of Bufferbl and vortex to mix.

10. Add 250. mu.L of absolute ethanol and mix by vortexing at high speed for 15 s.

11. The mixture was transferred to a Hibind DNA column with a collection tube, centrifuged at 10,000g for 1min at room temperature, and the filtrate was discarded.

12. The column was mounted on a collection tube, 500. mu.L of HB Buffer was added, and 10,000g was centrifuged at room temperature for 1min, and the filtrate was discarded.

13. The column was mounted in a fresh collection tube, 500. mu.L of DNA Wash Buffer was added, and centrifugation was carried out at 10,000g for 1min at room temperature.

14. The filtrate was discarded and step 13 was repeated once. After discarding the filtrate, the column was replaced with a new collection tube and centrifuged at 10,000g for 3 min.

15. The column was mounted on a clean 1.5mL centrifuge tube, 80. mu.L of 70 ℃ preheated Elution Buffer was added to the column matrix, and after standing at room temperature for 3min, 10,000g of the column was centrifuged at room temperature for 1min to elute DNA, and the eluate containing DNA was retained.

(II) determination of DNA concentration

The DNA concentration was measured using a Shanghai chromatography visible light photometer UV-5500PC and the DNA was diluted to 100 ng/. mu.L.

(III) sulfite conversion

Transformation was performed according to the Qiagen59104EpiTect bisufite Kit, with the following specific steps:

1. preparing a conversion reaction system:

TABLE 2 conversion reaction System

2. After preparation, the mixture is mixed evenly and placed on a PCR instrument, and the following PCR programs are set:

TABLE 3 PCR procedure

Step (ii) of	Time	Temperature of
			A	5min	95℃
B	25min	60℃
			C	5min	95℃
D	85min	60℃
			E	5min	95℃
F	175min	60℃
			G	1min	30℃

3. And (5) running a transformation program, and recovering the DNA after transformation after the transformation is finished.

4. The DNA that was transformed was aspirated into a new 1.5ml centrifuge tube.

5. Add 310. mu.L of buffer BL containing 10. mu.L/ml carrier RNA and mix well with shaking for 5 s.

6. Adding 250 mu L of absolute ethyl alcohol, shaking and mixing uniformly for 5 s.

7. The mixed solution obtained in step 6 was added to EpiTect spin column and centrifuged at 10,000g for 1 min.

8. The filtrate was discarded, 500. mu.L of BufferBW was added to the recovery column, and 10,000g was centrifuged for 1 min.

9. The filtrate was discarded, 500. mu.L of Buffer BD was added to the recovery column, and the mixture was allowed to stand at room temperature for 15min and centrifuged at 10,000g for 1 min.

10. The filtrate was discarded, 500. mu.L of BufferBW was added to the recovery column, and 10,000g was centrifuged for 1 min.

11. Step 10 is repeated once.

12. The recovery column was placed in a new 1.5mL centrifuge tube and allowed to stand at room temperature for 5 min.

13. Add 50. mu.L Buffer EB (preheated at 56 ℃) to the adsorption column and let stand at room temperature for 5 min.

14.10,000 g, and the eluted DNA after transformation is stored for further use.

Six colorectal cancer tissues and corresponding paracarcinoma tissues are selected for methylation quantitative analysis.

Transforming DNA is extracted according to the above process, and a PCR reaction system is prepared according to the following components:

TABLE 1 PCR reaction System

Composition (I)	Volume of
		10×Buffer	2.5μL
T2-F(10μM)	0.4μL
		T2-R(10μM)	0.4μL
AB-F(10μM)	0.4μL
		AB-R(10μM)	0.4μL
T2-P(10μM)	0.6μL
		AB-P(10μM)	0.3μL
dNTPs(10mM)	0.5μL
		Mg²⁺(50mM)	1μL
Water (W)	16μL
		Taq enzyme (5U/. mu.L)	0.5μL
After transformationDNA(10ng/μL)	2μL
		Total volume	25μL

The ABI7500 PCR instrument was set up with the following program for the fluorescent PCR reaction:

TABLE 4 procedure for fluorescent PCR reaction

And (4) analyzing results:

the results of quantitative methylation detection of six colorectal cancer tissues and corresponding paraneoplastic tissues are shown in Table 5, wherein 13-1 to 18-1 are cancer tissues of six different patients and the corresponding paraneoplastic tissues:

1. the quantitative calibrator for the 4 concentrations described above was set to S in the ABI7500 PCR instrument software sample set and the corresponding concentrations were indicated.

2. Adjust baseline, threshold line.

3. Judging a standard curve: check for the accuracy of the Curve in Standard Curve, R²Is more than or equal to 0.98, is qualified.

4. Sample copy number calculation: after the standard curve is checked well, the Export menu bar is clicked to generate the copy number of the sample TFPI2 and ACTB.

5. Calculate the methylation rate for each sample in the generated Excel table: two fluorescence channels, FAM (TFPI2) and rox (actb), were assigned to each sample. The formula for the methylation rate is: and calculating methylation rates of 13-1 to 18-1 and 13-3 to 18-3 according to the formula of the copy number of TFPI 2/copy number of ACTB × 100.

TABLE 5 results of quantitative detection of methylation of six colorectal cancer tissues and corresponding paracarcinoma tissues

Cancer tissue	Methylation rate	Tissue adjacent to the cancer	Methylation rate
				13-1	26.00	13-3	1.99
14-1	14.01	14-3	0.60
				15-1	7.01	15-3	0.48
16-1	31.99	16-3	0.51
				17-1	10.11	17-3	0.00
18-1	11.41	18-3	2.90

As can be seen in table 5, colorectal cancer tissue is highly methylated and there may be a small amount of methylation in the paraneoplastic tissue.

FIG. 1 is a statistical analysis of samples taken at different stages of colorectal cancer development using the primer probe combinations and methods described above, initially setting a TFPI2 methylation rate greater than 5 as high risk (easy recurrence, residual cancer cells, etc.).

The detection limit experiment is detected according to the following steps:

1.500ng of DNA from methylation positive cells was transformed, the recovery volume was 50. mu.l, and the concentration of DNA after transformation was about 10 ng/. mu.l.

2.500ng of DNA from methylation-negative cells was transformed, the recovery volume was 50. mu.l, and the concentration of DNA after transformation was about 10 ng/. mu.l.

3. And (4) accurately quantifying the ACTB of the transformed positive and negative DNA by using a standard curve, and adjusting the copy number of the ACTB to the same level.

4. According to methylation positive DNA: methylation negative DNA 1% methylated DNA was prepared in a ratio of 1: 99.

The PCR is repeatedly detected for 25 times by taking 1% methylated DNA as a template, and the detection frequency of TFPI2 is not less than 23 times.

The results were: the lowest detection limit was 1% methylation (10 ng/. mu.l).

The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.

Sequence listing

<110> Jiangsu Mugil bioengineering technology GmbH

<120> primer probe combination for quantitative detection of TFPI2 gene methylation and application, kit and method thereof

<160> 9

<170> SIPOSequenceListing 1.0

<210> 1

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

gatcgtagtg taagacgttc 20

<210> 2

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

ataacgaaca cacgatccg 19

<210> 3

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

aaagagcgta tggcgagatg 20

<210> 4

<211> 26

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

ttattgtggg gtgttttagg tattag 26

<210> 5

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

aaacaccctt acctcccacc 20

<210> 6

<211> 26

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

agttggttgg gtggggtagt tttggg 26

<210> 7

<211> 2251

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

gttcgttggg taaggcgttc gagaaagcgt ttggcgggag gaggtgcgcg gttttttgtt 60

ttaggcggtt cgggtgttcg ttttctaaac cctaaaccct aaaccctaaa ccctaaaccc 120

taaaccctaa accctaaacc ctaaccctaa accctaaccc taaaccctaa accctaaacc 180

ctaaacccta aaccctaaac agctgacagt acgatagatc cacgcgagag gaaccggaga 240

gacaacggga tccaggcgcc agcgacggat ccgggcgaga ggggagtgga gatcatggat 300

ccgtgcggga ggggaagaag tcgccgaatc cgaccctccc atcgccatcg acagtaggtc 360

tgcgcgagag gggcaccggc gctggctctg agcgagatgc aacgccggcc ggcttggaga 420

gtaactcaag agagacagaa tggaagatag agaacaagag agtgagagga taaggatata 480

gaccagacca cacaattttc tcttcttttt aactttgtat taagatcttt tatggaacat 540

cttttattgt tgatatcaaa ataactgaaa cttatacttt aatatttttt gagacaaaaa 600

gtaacaatcg taaaaaaaag ttccacgaga gttaccccac cacccatgtc tcgagccgac 660

cagatctgcc gcccacgacc cgagtcatcg ttggatccac cacccacaac ccgcgaccga 720

gctacgcctc ctgtggattg atgccactgc cctgagcttc actgccggta ctgtcgctcg 780

cgacccgagc tccgccgctg gtaccgtcgc ccacaactca agctgtgttg ccactagaga 840

aaaaggaggc gagagcgagg gcaaaacgag gcaaggcgtg gcgtgacatg gtgtgactgg 900

ttggtcaatt agccgacaat ggatccaccg cccatgaacc gagccaccgt tggatccgcc 960

acccgcagat tcggctgtcc cctctccctc aacttattct tcctctcttg attcaacggg 1020

aggagtggca actgacggca acagagctcg cctcatgggc gatggaacca gcggcgaagc 1080

tcggaggagg aagcgagcgt tttcgagttt cgagttcgag ttttcgagtt tgagtcgtaa 1140

tcgttgcggt attttgtttc ggattcgtgg cggaggggtt gagccacatg aggcgatggc 1200

gacaatgagg cgagacatgg cgtggctggc tgttacattt tgttttgatg aaaagcataa 1260

ccatgcggat gatattttta ttatagacta gagatgatta ttgaatagac atgctcttaa 1320

ccatttttaa ctctaattcc acctacacta tgaatattag aaaaaaaata caatgtatac 1380

tcttaagaag tttgcgctat catagccatc atactcatta aaacattttt cttcacatgt 1440

tgcaacgcat gggcattttg ctagttagag aataaaaata aatttgtagg taaaactttt 1500

atatatgtgt tctcggtgac ttaaaagcca atgcttaaaa ataaactacg ttaaaaatat 1560

cttaaaatca atattaaaat taagtttgaa aatttaaatt ttggcttttt ctttgactga 1620

ataggccatc tgatggaagc tgaataagcc atccgatggg agctgtgaca gtgatgaaaa 1680

ggagagcagt aagagagcag taagagcatc ccagcagctc ctctatctag gcatccatcc 1740

gatatttgga gtatggagga gaaaaacagt gctccagcag agtctccatc acatgcttca 1800

tttttggagg tcctccaaat ctagcccttc ccaagccaaa tatggaggtt ctctctcctc 1860

actccatcct caactaccca cttcccaaga ttttttttga gtggtgaaag gtgagaggaa 1920

taggagtaaa aatgtgtggt agttgaaaaa tattactaaa atataggatg ttggtatatg 1980

taggatgtaa tatgaatgat ctgttggagt gaaaagttat atagagtgga aatcttttta 2040

aatggccatc caaatgagag tatgaaattt agatgagctg gtggggatgc tctaagagaa 2100

cgagagaagc acagagcaga taaaccacac ccacaggcac caccgtcctt gttggtaatg 2160

aagaagactt attgtggggt gttttaggta ttaggtaggg gagttggttg ggtggggtag 2220

ttttgggagt gggtgggagg taagggtgtt t 2251

<210> 8

<211> 84

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

gttcgttggg taaggcgttc gagaaagcgt ttggcgggag gaggtgcgcg gttttttgtt 60

ttaggcggtt cgggtgttcg tttt 84

<210> 9

<211> 84

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

gtttgttggg taaggtgttt gagaaagtgt ttggtgggag gaggtgtgtg gttttttgtt 60

ttaggtggtt tgggtgtttg tttt 84

Claims

1. A primer probe combination for quantitative detection of TFPI2 gene methylation is characterized by comprising a primer probe for amplifying a TFPI2 gene and an ACTB gene;

2. The primer probe combination of claim 1, wherein 6-FAM is added to the 5 'end of T2-P, and BHQ1 is added to the 3' end;

ROX is added to the 5 'end of the AB-P, and BHQ2 is added to the 3' end.

3. The primer probe combination of claim 1, wherein the nucleotide sequence of the TFPI2 gene is shown as SEQ ID No.7, and the nucleotide sequence of the ACTB gene is shown as SEQ ID No. 8.

4. A kit for quantitative detection of TFPI2 gene methylation is characterized by comprising quantitative PCR reaction liquid, Taq enzyme, a positive calibrator, a positive control and a negative control; the quantitative PCR reaction solution contains the primer probe combination according to any one of claims 1 to 3.

5. The kit according to claim 4, wherein the quantitative PCR reaction solution comprises: 10 x 2.5-5 μ L of Buffer, 100 μ M T2-F0.02-0.1 μ L, 100 μ M T2-R0.02-0.1 μ L, 100 μ M AB-F0.02-0.1 μ L, 100 μ M AB-R0.02-0.1 μ L, 100 μ M T2-P0.02-0.1 μ L, 100 μ M AB-P0.02-0.1 μ L, 10mM dNTPs 0.1-1 μ L, Mg²⁺0.5-2. mu.L of 50mM solution of ddH₂O18.25μL。

6. The kit of claim 4, wherein the positive calibrator is 4 solutions containing T2 plasmid, and the concentrations of T2 plasmid in the 4 solutions are 1X 10⁵copies/μL、1×10⁴copies/μL、1×10³copies/. mu.L and 1X 10²copies/μL。

7. The kit according to claim 4, wherein the enzyme activity of Taq enzyme is 50U/. mu.L; the positive control is DNA positive to TFPI2 gene methylation, and the negative control is DNA negative to TFPI2 gene methylation.

8. Use of a primer probe combination according to any one of claims 1 to 3 for the preparation of a reagent for predicting the risk of colorectal cancer recurrence.

9. A method for quantitatively detecting methylation of TFPI2 gene based on the kit of any one of claims 4 to 7 for non-diagnostic purposes, which is characterized by comprising the following steps:

1) carrying out sulfite conversion on the sample DNA to obtain converted DNA;

10. The method of claim 9, wherein the conditions of the step 2) fluorescent quantitative PCR reaction comprise: 10min at 95 ℃; 95 ℃ for 15s, 60 ℃ for 30s, 40 cycles.