CN111500735B - Primer group, probe and kit for direct amplification and detection of high-incidence tumor susceptibility gene polymorphism without taking hands, and method thereof - Google Patents

Primer group, probe and kit for direct amplification and detection of high-incidence tumor susceptibility gene polymorphism without taking hands, and method thereof Download PDF

Info

Publication number
CN111500735B
CN111500735B CN202010477198.8A CN202010477198A CN111500735B CN 111500735 B CN111500735 B CN 111500735B CN 202010477198 A CN202010477198 A CN 202010477198A CN 111500735 B CN111500735 B CN 111500735B
Authority
CN
China
Prior art keywords
dna
artificial sequence
primer
sequence
probe
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202010477198.8A
Other languages
Chinese (zh)
Other versions
CN111500735A (en
Inventor
林文静
戴丽丽
李军
温千钧
陈雅萍
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Aginbury Xiamen Medical Laboratory Co ltd
Original Assignee
Aginbury Xiamen Medical Laboratory Co ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Aginbury Xiamen Medical Laboratory Co ltd filed Critical Aginbury Xiamen Medical Laboratory Co ltd
Priority to CN202010477198.8A priority Critical patent/CN111500735B/en
Publication of CN111500735A publication Critical patent/CN111500735A/en
Application granted granted Critical
Publication of CN111500735B publication Critical patent/CN111500735B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/6858—Allele-specific amplification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers

Abstract

The invention discloses a primer group, a probe, a kit and a method for carrying out hands-free direct amplification and detecting high-incidence tumor susceptibility gene polymorphism. The 5' end of each primer in the primer group contains a joint sequence SEQ ID NO:142 or 143, and when the joint sequence of the upstream primer is SEQ ID NO:142, the joint sequence of the corresponding downstream primer is SEQ ID NO:143; when the linker sequence of the forward primer is SEQ ID NO. 143, the linker sequence of the corresponding reverse primer is SEQ ID NO. 142, followed by the conventional primer design sequence. Can amplify the sequences of 47 sites of 9 tumors simultaneously, does not need to extract and purify nucleic acid of a sample in advance, can shorten the PCR detection time, simplifies the operation steps and obviously reduces the detection cost.

Description

Primer group, probe and kit for direct amplification and detection of high-incidence tumor susceptibility gene polymorphism without taking hands, and method thereof
Technical Field
The invention relates to the field of gene polymorphism, in particular to a primer group, a probe, a kit and a method for carrying out hands-free direct amplification and detecting high-incidence tumor susceptibility gene polymorphism.
Background
According to medical statistics, the occurrence of tumors is not random, and a plurality of cancers such as breast cancer, colorectal cancer, prostate cancer, gastric cancer and the like have remarkable familial aggregation. The activation of protooncogenes and the inactivating mutation of cancer suppressor genes play a central biological role in the canceration process. The major risk factors for human cancer are environmental factors, and genetic polymorphisms of the genes associated therewith determine the susceptibility of an individual to these factors. The intensity of tumor susceptibility increases with the increase of patients with tumors in the family and the decrease of the age of onset, and the intensity of the susceptibility increases the risk of cancer for the family members as the family gene polymorphism is inherited.
The detection of the tumor susceptibility gene provides a basis for formulating more effective and highly targeted tumor prevention and treatment measures. In the cancer multi-family with high risk of cancer, screening the tumor susceptibility gene, detecting the mutant gene carrier, and respectively recommending the mutant gene carrier to change bad living habits, keep away from carcinogenic environment and carcinogen, even perform surgical excision for prevention, tumor prognosis and the like according to the cancer risk of various genotype individuals.
The liver cancer is the third place of the median sequence of all malignant tumors, HBV and HCV infection are main pathogenic factors of the liver cancer, and GLB1, EPB41, STAT4, NBS1, IL12A, KIF B and the like are liver cancer susceptibility genes; the incidence of gastric cancer ranks first in digestive tract cancer, the number of the attack and death is second only in lung cancer, and second in the ranking, XPG, PRKAA1, ZBTB20 and the like are susceptible genes of gastric cancer; lung cancer is the most frequently occurring malignant tumor in the world and is the first cause of death of cancer, and lung cancer susceptibility genes include: CLPTM1L, CD, MTHFR, IL18, etc.; thyroid cancer is the most common endocrine malignancy, and the activity of RET protein related to the initiation of thyroid cancer can be known through the detection of thyroid cancer-related genes, and thyroid cancer susceptibility genes: 9q22.33, 14q13.3, RET, etc.; colorectal cancer becomes one of five cancers, high risk group of colorectal cancer can be screened through colorectal cancer related gene detection, early diagnosis and early treatment are realized through early intervention and prevention, the purpose of improving survival rate is achieved, and colorectal cancer susceptibility genes: ERCC5/XPG, NFKBIA, CCAT2, ADD1, PTPN12, COLCA2, ADIPOR1, etc.; breast cancer, cervical cancer and ovarian cancer are the most common malignant tumors of women, and breast cancer susceptibility genes: BRCA2, ESR1, FEN1, ATM, BRCA1, TOX3, FGFR2, and the like, cervical cancer susceptibility genes: EXOC1, GSDMB, HLA-DPB2, XRCC1, MIR155, CARD8 (2), etc., ovarian cancer susceptibility genes: LTF, COL15A1, ANKRD30A, SRGAP1, ABO/SURF6BRCA2, etc.; prostate cancer is the most common malignancy in men. The risk of the self-suffering from the prostatic cancer can be predicted through detecting prostatic cancer related genes, and the prostatic cancer susceptibility genes are as follows: RAD23B-KLF4, NKX3.1, MSMB, ITGA6, etc.
At present, screening of multi-gene locus detection packages is mainly realized by constructing three methods of panel sequencing, flight mass spectrometry detection or fluorescence PCR detection in the market. The operation steps of sequencing and mass spectrometry are relatively complicated, the cost of detection reagents and equipment is high, and the individual requirements of temporarily increasing or decreasing project sites cannot be met; the conventional method for detecting nucleic acid by fluorescence PCR requires extraction treatment to obtain nucleic acid with higher purity, so that the detection sensitivity is improved, and the repeated detection rate is reduced. However, the nucleic acid extraction process often results in more than 80-90% nucleic acid loss, and the complicated purification steps increase the detection cost and the extraction process takes a long time, and may also result in increased failure of the subsequent fluorescent PCR amplification. Therefore, the sample can be directly used as a template or can be used as the template for fluorescence PCR amplification detection after simple treatment, and has high clinical value.
Disclosure of Invention
The invention aims to provide a primer, a probe and a method for detecting 9 high-tumor susceptibility gene polymorphisms by hands-free direct amplification. The method aims to solve the problems that when the sample is subjected to PCR amplification in the prior art, the sample needs to be subjected to nucleic acid extraction and purification in advance, so that a large amount of nucleic acid is lost, and toxic reagents are used, and can shorten the PCR detection time, simplify the operation steps and obviously reduce the detection cost.
The invention aims to provide 47 loci gene polymorphism for efficiently and rapidly detecting 9 high-incidence tumors of liver cancer, gastric cancer, lung cancer, thyroid cancer, colorectal cancer, breast cancer, cervical cancer, ovarian cancer and prostatic cancer, wherein the loci comprise: rs17401966, rs7574865, rs4678680, rs157224, rs1805794, rs568408, rs13361707, rs9841504, rs873601, rs1801133, rs1946518, rs2890658, rs401681, rs944289, rs965513, rs1799939, rs1800863, rs6983267, rs3802842, rs17655, rs 176696, rs4963, rs 4962 zxft 3562, rs1342387, rs 3545 zxft 3245 32ft 3232, rs 3445 zxft 3425, rs17655, rs 1766, rs 3563, rs 4962, rs 4324 zxft 3524 rs3803662, rs3737559, rs1003623, rs4246215, rs174538, rs2046210, rs15869, rs13117307, rs8067378, rs4282438, rs25487, rs767649, rs7248320, rs1126477, rs1413299, rs1192691, rs11175194, rs 4234 zxft 8654234, rs817826, rs2 zxft 8652, rs10993994, rs12621278, and (3) providing correct gene polymorphism site typing, and performing targeted health management.
Table 1: table of 47 sites corresponding to RS numbers and NCBI numbers
SNP NCBI sequence number SNP NCBI sequence number SNP NCBI sequence number
rs17401966 ss275711116 rs1219648 ss280803138 rs1800863 ss280589136
rs7574865 ss276838709 rs3803662 ss282532652 rs6983267 ss280003853
rs4678680 ss277079025 rs3737559 ss282767661 rs3802842 ss281171561
rs157224 ss275764702 rs1003623 ss1464917 rs17655 ss281863905
rs1805794 ss279907211 rs4246215 ss281034520 rs696 ss281955485
rs568408 ss277424857 rs174538 ss281034519 rs4963 ss277542224
rs13361707 ss278259109 rs2046210 ss279079595 rs3750050 ss279397162
rs9841504 ss277303820 rs15869 ss281664502 rs1342387 ss9829204
rs873601 ss281863906 rs13117307 ss277715863 rs1192691 ss28485974
rs1801133 ss275715273 rs8067378 ss282760355 rs11175194 ss281430557
rs1946518 ss281173095 rs4282438 ss278745744 rs633862 ss10513490
rs2890658 ss280083187 rs25487 ss283219242 rs817826 ss280354468
rs401681 ss278133561 rs767649 ss283505614 rs1512268 ss279735393
rs944289 ss281957192 rs7248320 ss10922948 rs10993994 ss280606327
rs965513 ss11991848 rs1126477 ss277112541 rs12621278 ss276791276
rs1799939 ss38612318 rs1413299 ss280330511 / /
In order to achieve the aim, the invention provides a primer group for amplifying a plurality of genes simultaneously, which is characterized in that the 5' end of each primer in the primer group contains a joint sequence SEQ ID NO:142 or 143, and when the joint sequence of an upstream primer is SEQ ID NO:142, the joint sequence of a corresponding downstream primer is SEQ ID NO:143; when the linker sequence of the forward primer is SEQ ID NO. 143, the linker sequence of the corresponding reverse primer is SEQ ID NO. 142, followed by addition of the conventional primer design sequence.
Further, the plurality of genes is at least 30 genes; preferably 47 genes, preferably 47 tumor genes.
Further, the design sequence of the conventional primer is shown as SEQ ID NO. 1-2;4-5,7-8.
The invention also provides a kit for simultaneously amplifying a plurality of genes, which is characterized by comprising the primer group.
The invention also provides a primer group and a probe for detecting the polymorphism of the high-incidence tumor susceptibility gene by hands-free direct amplification, which are characterized in that the sequence of the primer group is as described above; the sequence of the probe is three arbitrary thioated base sequences plus a conventional probe design sequence.
Furthermore, the sequence of the probe is shown in SEQ ID NO:146,149,152.. 281, 284, and the 5 'and 3' ends of the probe are marked with fluorescent groups.
The invention also provides a kit for detecting the polymorphism of the high-incidence tumor susceptibility gene by hands-free direct amplification, which is characterized by comprising the primer group and the probe.
Further, it contains 10 XPCR reaction solution, dNTP, mg 2+ And Taq DNA polymerase.
The invention also provides a method for exempting from extraction and simultaneously enriching the specific DNA fragments of 47 sites, which is characterized by using the primer group and the probe or the kit.
Further, the method adopts PCR amplification, a pre-amplification reaction system of the PCR amplification,
25 μ l of reaction system: 3 mul of detection sample, 10 XPCR reaction solution, taq DNA polymerase, dNTP with final concentration of 2.5mmol/L and Mg with final concentration of 3.5mmol/L 2+ Oligo Mix with a final concentration of 5umol/L, and the balance of sterile water; the Oligo Mix contains equal amounts of SEQ ID NO:144-145;147-148,150-151.. 282-283;
the pre-amplification reaction procedure of PCR amplification is as follows:
the first step is as follows: 5min at 95 ℃; circulating once;
the second step: 30s at 94 ℃; 30s at 56 ℃; 30s at 72 ℃; circulating for 22 times;
the third step: 10min at 72 ℃; and circulating once.
Further, the detection sample is whole blood, serum, plasma, blood gauze, blood sheet, fingertip blood, oral swab or saliva;
preferably, if the test sample is in a liquid form, the test sample is directly used as the test sample without being processed; and if the sample is a solid sample, placing the freshly collected solid sample in purified water to suspend, and taking the obtained suspension as the detection sample.
The invention also provides a method for detecting the polymorphism of the human high-tumor susceptibility gene by hands-free direct amplification, which is characterized by using the primer group and the probe or the kit.
Further, the method comprises the following steps of detecting and typing the obtained specific DNA fragments enriched with 47 sites by adopting the primer group and the probe or the kit.
Further, the detection and typing step uses fluorescence PCR, the reaction system of the fluorescence PCR,
10 μ L of reaction system: 2 μ L of pre-amplified PCR diluted product, 10 XPCR reaction solution, 0.5U of Taq DNA polymerase, dNTP with final concentration of 2.5mmol/L and Mg with final concentration of 3.5mmol/L 2+ Oligo Mix Z, wherein Oligo Mix Z refers to: an upstream primer with the final concentration of 0.04mmol/L, a downstream primer with the final concentration of 0.4mmol/L and a probe with the final concentration of 0.1 mmol/L;
the procedure of the PCR amplification and dissolution reaction is as follows:
the first step is as follows: circulating for 1 time at 95 ℃ for 5min;
the second step is as follows: 95 ℃ for 10s,60 ℃ for 20s, and 72 ℃ for 25s; circulating for 45 times, and collecting no fluorescence;
the third step: circulating for 1 time at 95 ℃ for 1 min;
the fourth step: fluorescence is collected at 1min at 37 ℃ and 2 ℃ per liter at 37-85 ℃;
the method for judging the typing according to the TM value comprises the following steps:
firstly, the method comprises the following steps: only a single high Tm value dissolution peak indicates that the SNP locus of the target sequence to be detected is completely matched with the designed probe, and the genotype is a wild homozygote;
secondly, the method comprises the following steps: only a single low Tm value dissolution peak indicates that the SNP locus of the target sequence to be detected is not matched with the designed probe, and the genotype is a mutation homozygote;
thirdly, the method comprises the following steps: meanwhile, the high Tm value and the low Tm value dissolve peaks, which shows that the SNP site of the target sequence to be detected is partially matched with the designed probe, and the genotype is a mutant heterozygote.
The purpose of the invention is realized by the following technical scheme:
the invention provides a two-step method for accurately detecting a sample to be detected: firstly, pre-amplifying a target gene DNA fragment to be detected, wherein the aim is to enrich the target gene DNA fragment to be detected; and the second step is to perform fluorescent PCR detection according to the enriched target gene DNA fragment to be detected, and the step can accurately obtain the polymorphism locus typing of the target gene to be detected.
The primer, the probe and the method for detecting the polymorphism of the 9 high-tumor susceptibility genes by hands-free direct amplification are characterized by comprising the following steps of:
1. synthesizing a pair of primer pairs and a probe according to the specific sequence of the target gene to be detected:
the primer pair sequence consists of a section of target gene sequence to be detected and a primer joint, and the primer is used for pre-amplification of the target gene to be detected in the first step and for the second fluorescence PCR detection.
The primer pair sequence is designed according to a primer design rule, the primer sequence comprises a joint, and a detection system is optimized to reach standard sensitivity.
The primer pair can be used for pre-amplifying a target gene DNA fragment to be detected in advance, the aim is to enrich the target gene DNA fragment to be detected, and the primer pair in the process can be used for carrying out one or more or even hundreds of pre-amplification primer pairs.
The probe sequence consists of a section of target gene sequence to be detected, a probe joint (namely a thioated basic group) and two modifying groups, wherein the modifying group region comprises a fluorescent group and a quenching group which are matched;
2. <xnotran> , rs, rs, rs, rs, rs, rs, rs, rs, rs, rs1801133, rs, rs, rs, rs944289, rs965513, rs, rs, rs, rs, rs17655, rs696, rs4963, rs, rs, rs, rs3803662, rs, rs, rs, rs, rs, rs, rs, rs, rs, rs25487, rs, rs, rs, rs, rs, rs, rs, rs, rs, rs, rs 47 DNA . </xnotran>
1) The pre-amplification PCR reaction system designed according to 47 target gene sites to be detected is as follows: 10 XPCR reaction solution, dNTP, mg 2+ Oligo Mix, taq DNA polymerase.
The Oligo Mix contains: forward primer F and reverse primer R for 47 SNP sites.
The primers for the 47 SNP sites are the linker sequence (TGCAGGGTCGCTAAGAAGTCT, SEQ ID NO:142, or TGCAGGGTCGCTAAGAAGTAA, SEQ ID NO: 143) plus a conventional primer design sequence (such as the sequences in Table 2). When the adaptor sequence of the upstream primer is SEQ ID NO. 142, the adaptor sequence of the corresponding downstream primer is SEQ ID NO. 143; when the linker sequence of the upstream primer is SEQ ID NO. 143, the linker sequence of the corresponding downstream primer is SEQ ID NO. 142. That is, in the same pair of upstream and downstream primers, one of the linker sequences is SEQ ID NO:142, and the other must be SEQ ID NO:143. The probe sequence for 47 SNP sites requires three arbitrary thioated bases, plus a conventional probe design sequence (such as the sequences in Table 2). Specifically, the sequences of the forward primer F and the reverse primer R at, for example, 47 SNP sites can be found in Table 3.
TABLE 2 conventional sequences of primers and probes for 47 SNP sites
Figure GDA0003959055700000041
Figure GDA0003959055700000051
Figure GDA0003959055700000061
Figure GDA0003959055700000071
Note: rn at each site represents a conventionally designed sequence of the downstream primer (for example, R1, which is a conventionally designed sequence of the downstream primer at the site of system Z1, rs 17401966), fn represents a conventionally designed sequence of the upstream primer, and Pn represents a conventionally designed sequence of the probe. Care should be taken in designing the conventionally designed sequence of the probe that the probe is not complementary.
TABLE 3 primer Probe sequence Listing of 47 SNP sites
Figure GDA0003959055700000072
Figure GDA0003959055700000081
Figure GDA0003959055700000091
Figure GDA0003959055700000101
Figure GDA0003959055700000111
Note: r at each of the above sites represents a downstream primer, F represents an upstream primer, and P represents a probe. Underlined sequences in the upstream and downstream primers are linker sequences: TGCAGGGTCGCTAAGAAGTCT, SEQ ID NO:142 or TGCAGGGTCGCTAAGAAGTAA, SEQ ID NO:143. The bottom wavy lines in the probe all have three bases, specifically three thio-modified bases added randomly to prevent the probe from being cut by enzyme.
2) The reagent components and the test sample of the present invention are used to perform PCR amplification procedures on a conventional PCR instrument. The detection sample is directly used as a template and is directly added into a PCR reaction system for detection without treatment. The common PCR instrument is simple and convenient to operate, is efficient in time, and can amplify the target gene to be detected. The common PCR instrument can adopt XP gene amplification instrument series products (Hangzhou Bori science and technology limited, china) and the like.
3) The test sample includes, but is not limited to, whole blood, serum, plasma, blood gauze, blood slice, fingertip blood, buccal swab, saliva and other body fluids.
4) The detection sample does not need to be processed if the sample is in a liquid state; if the sample is solid sample such as buccal swab, blood slice, blood gauze, etc., simple treatment can be carried out, for example, placing freshly collected flocked swab in 200 μ l purified water, and suspending with vigorous vortex for at least 15s to obtain sample to be detected.
The amplification procedure was as follows:
the first step is as follows: 5min at 95 ℃; circulate once
The second step is as follows: 30s at 94 ℃; 30s at 56 ℃; 30s at 72 ℃; circulate 22 times
The third step: 10min at 72 ℃; circulate once
Uncapping and diluting the enriched PCR product: and (3) selecting a standard clinical gene amplification laboratory to dilute the PCR product, and taking the PCR product diluted by 40 times as a template to enter the next fluorescent quantitative PCR detection reaction.
3. The invention provides a reagent component for detecting 9 high-tumor susceptibility gene polymorphisms by hands-free direct amplification, which comprises the following components:
1) 47 reaction systems Z designed according to 47 gene loci 1 -Z 47 Respectively containing 10 XPCR reaction solution, dNTP and Mg 2+ 、Oligo Mix Z 1-47 And 47 Oligo Mix Zs in the Taq DNA polymerase respectively consist of a forward primer F, a reverse primer R and a probe P of the site, and the sequences are detailed in a primer probe sequence table 3 of 47 SNP sites.
The fluorescent group labeled at the 5 'and 3' ends of the probe sequence includes but is not limited to ALEXA350, FAM, HEX, TET, JOE, VIC, ROX, texas Red, cy5, cy5.5, TAMRA, etc. The quenching group comprises Dabcyl, BHQ-1, QYS-7 and BHQ-2. The fluorescent group marked at the 5 'end and the 3' end and the corresponding quenching group can generate Fluorescence Resonance Energy Transfer (FRET) when being folded, so that the fluorescence of the fluorescent group is quenched.
2) The PCR product diluted in the previous step is directly used as a template, and is directly added into an optimized PCR reaction system for detection without treatment, so that the experimental operation steps can be reduced, the time can be saved, and the sample pollution possibly caused by uncovering operation can be avoided.
3) By adopting the reagent components and the detection sample, the detection result is analyzed by running a PCR amplification and dissolution program on a fluorescence quantitative PCR instrument, and three gene polymorphisms are distinguished according to a TM value. The fluorescent quantitative PCR instrument may be used in ABI7500 series (Sammerfell technologies, massachusetts, USA), lighterCycler 480 (Roche, basel, switzerland), CFX96 (Burle, calif., USA), MX3005P (Agilent technologies, calif., USA), rotor-Gene Q (QIAGEN, kaije, germany), and the like.
The amplification procedure was as follows:
the first step is as follows: circulating for 1 time at 95 ℃ for 5min;
the second step: 95 ℃ for 10s,60 ℃ for 20s, and 72 ℃ for 25s; circulating for 45 times, and collecting no fluorescence;
the third step: circulating for 1 time at 95 ℃ for 1 min;
the fourth step: fluorescence is collected at 1min at 37 ℃ and 2 ℃ per liter at 37-85 ℃.
The method for judging the typing according to the TM value comprises the following steps:
firstly, the method comprises the following steps: only a single high Tm value dissolution peak indicates that the SNP locus of the target sequence to be detected is completely matched with the designed probe, and the genotype is a wild homozygote;
secondly, the method comprises the following steps: only a single low Tm value dissolution peak indicates that the SNP locus of the target sequence to be detected is not matched with the designed probe, and the genotype is a mutation homozygote;
thirdly, the steps of: meanwhile, the high Tm value and the low Tm value dissolve peaks, which shows that the SNP site of the target sequence to be detected is partially matched with the designed probe, and the genotype is a mutant heterozygote.
According to the above steps, tens of samples such as buccal swabs or peripheral blood are randomly extracted for detection, the genotype of the SNP sites can be obtained, and the detection peak diagrams of several SNP sites are selected as examples, and detailed diagrams shown in FIGS. 1-6 show that the method of the present invention can rapidly and accurately detect the genotype of the sites. The detection accuracy can reach 99.9%, and the method has the advantages of high accuracy, strong flexibility, large flux and short detection period. Then, according to the detection result, interpretation of genetic factors is carried out.
Drawings
FIG. 1 is a graph showing a dissolution peak of the CT pattern at site rs1801133 in the sample of example 2;
FIG. 2 is a graph of the AA-type dissolution peak at site rs1219648 of the sample of example 2;
FIG. 3 is a graph showing the dissolution peaks of the CT pattern at site rs3803662 in the sample of example 2;
FIG. 4 is a graph of the dissolution peak of the AG form at site rs1219648 of the sample of example 4;
FIG. 5 is a graph showing a peak of the TT pattern at site rs3803662 of the samples in example 4;
FIG. 6 is a graph of the dissolution peak at site CT rs1003623 for the sample of example 4;
FIG. 7 is a plot of the sequence at site rs1219648 for the samples of example 1, genotype AA;
FIG. 8 is a plot of the rs3803662 site sequence of the samples of example 1, genotype being CT;
FIG. 9 is a graph of the sequencing of site rs3737559 for the samples of example 1, genotype is GG.
Detailed Description
Reference will now be made in detail to embodiments of the present invention, examples of which are illustrated in the accompanying drawings, wherein like or similar reference numerals refer to the same or similar elements or elements having the same or similar function throughout. The embodiments described below with reference to the drawings are illustrative and intended to be illustrative of the invention and are not to be construed as limiting the invention. Those skilled in the art will recognize that the specific techniques or conditions, not specified in the examples, are according to the techniques or conditions described in the literature of the art or according to the product specification. The reagents or instruments used are not indicated by the manufacturer, and are all conventional products commercially available.
In the examples, both primer synthesis and sequencing were performed by Shanghai.
EXAMPLE 1 hands-free direct amplification of 9 highly tumorigenic genes
The loci of the 9 high-tumor susceptibility genes are as follows: the gene polymorphism of 47 sites involved in 9 high-incidence tumors of liver cancer, stomach cancer, lung cancer, thyroid cancer, colorectal cancer, breast cancer, cervical cancer, ovarian cancer and prostate cancer comprises the following steps: <xnotran> rs, rs, rs, rs, rs, rs, rs, rs, rs, rs1801133, rs, rs, rs, rs944289, rs965513, rs, rs, rs, rs, rs17655, rs696, rs4963, rs, rs, rs, rs3803662, rs, rs, rs, rs, rs, rs, rs, rs, rs, rs25487, rs, rs, rs, rs, rs, rs, rs, rs, rs, rs, rs. </xnotran>
Randomly taking a sample of the oral swab, breaking the oral swab, putting the broken oral swab into an EP tube, adding 200 mul of sterile water, shaking for a few seconds to obtain a sample suspension, and entering a detection stage.
The first step pre-amplification PCR reaction was 25. Mu.l containing 3. Mu.l of sample suspension, 10 XPCR reaction (10 mmol/L Tris-HCl, pH =8.3,5)0mmol/L KCl), 0.5U Taq DNA polymerase, dNTP with final concentration of 2.5mmol/L, mg with final concentration of 3.5mmol/L 2+ 5umol/L Oligo Mix (47 equal amounts of forward primer F and reverse primer R), the balance being sterile water.
The amplification procedure was:
the first step is as follows: 5min at 95 ℃; the cycle was 1 time.
The second step is as follows: 30s at 94 ℃; 30s at 56 ℃; 30s at 72 ℃; the cycle was 22 times.
The third step: 10min at 72 ℃; the cycle is 1 time.
After the PCR is amplified by a common PCR instrument, a PCR amplification product is obtained.
Example 2 detection of polymorphisms of highly tumor-associated susceptibility genes by hands-free direct amplification
The PCR product (obtained in example 1) diluted 40 times was used as a template for the next fluorescent quantitative PCR detection reaction.
Second step configuration Z 1 -Z 47 The total of 47 reaction systems are as follows:
mu.L of the Z reaction system contained 2. Mu.L of the diluted PCR product from the previous step, 10 XPCR reaction (10 mmol/L Tris-HCl, pH =8.3, 50mmol/L KCl), 0.5U Taq DNA polymerase, 2.5mmol/L dNTP,3.5mmol/L Mg 2+ ，Oligo Mix Z N (0.04mmol/L Z N -F,0.4mmol/L Z N -R,0.1mmol/L Z N -P), sterile water.
The procedure for the PCR amplification reaction was:
the first step is as follows: circulating for 1 time at 95 ℃ for 5min;
the second step is as follows: 95 ℃ for 10s,60 ℃ for 20s, and 72 ℃ for 25s; circulating for 45 times, and collecting no fluorescence;
the third step: circulating for 1 time at 95 ℃ for 1 min;
the fourth step: fluorescence is collected at 1min at 37 ℃ and 2 ℃ per liter at 37-85 ℃.
47 reaction systems directly carry out amplification reaction by hands-free extraction without treatment, and can be completely and accurately typed according to the judgment standard of TM value typing. The criteria for determining the type of TM are shown in Table 4 below.
Table 4: TM value typing judgment standard table
Figure GDA0003959055700000131
Figure GDA0003959055700000141
Figure GDA0003959055700000151
Figure GDA0003959055700000161
Figure GDA0003959055700000171
Note: because of the influence of sample quality and genotyping, the melting curve peak formed in each channel by each genotype has a tiny fluctuation range, and in order to accurately judge the result, the experiment sets up the corresponding Tm values and the variation ranges of the melting peaks of different genotypes of 47 SNP sites.
Table 5: table of results of TM value typing of examples
Figure GDA0003959055700000172
Figure GDA0003959055700000181
This example adopts
Figure GDA0003959055700000182
The 480-II PCR instrument is used for amplification and dissolution,
Figure GDA0003959055700000183
480 the software was used for genotyping, the results of this example are detailed in Table 5.
The detection peak maps of several SNP sites are selected as examples and are shown in detail in figures 1-3, wherein: FIG. 1: rs1801133-CT; FIG. 2: rs1219648-AA; FIG. 3: rs3803662-CT.
Therefore, the results show that the method for directly amplifying the oral swab sample to be detected without extraction directly as the template is feasible, simple, efficient, time-saving and low-cost, and is beneficial to large-scale popularization. The detection can be carried out efficiently, and the time is saved.
Example 3: extraction-free direct amplification detection of 9 high-tumor susceptibility genes
Randomly drawing a whole blood sample, reversing the blood collection tube, mixing uniformly, and sucking 200ul of blood sample into a centrifuge tube of 1.5ml to be used as a spare sample.
The first step of pre-amplification PCR reaction system is 25 μ L, and contains 3 μ L whole blood sample, 10 XPCR reaction solution (10 mmol/L Tris-HCl, pH =8.3, 50mmol/L KCl), 0.5U Taq DNA polymerase, dNTP with final concentration of 2.5mmol/L, mg with final concentration of 3.5mmol/L 2+ 5umol/L Oligo Mix (47 equal amounts of forward primer F and reverse primer R), the balance being sterile water.
The amplification procedure was:
the first step is as follows: 5min at 95 ℃; the cycle was 1 time.
The second step: 30s at 94 ℃; 30s at 56 ℃; 30s at 72 ℃; the cycle was 22 times.
The third step: 10min at 72 ℃; the cycle was 1 time.
After the PCR is amplified by a common PCR instrument, a PCR amplification product is obtained.
Example 4 hands-free direct amplification assay 9 high tumor susceptibility Gene assay Whole blood test specimens
A standard clinical gene amplification laboratory is selected to dilute the PCR product, and the PCR product (obtained in example 3) diluted by 40 times is used as a template to enter the next fluorescent quantitative PCR detection reaction.
Second step configuration Z 1 -Z 47 The total of 47 reaction systems are as follows:
10 μ L ofThe Z reaction system contains 2 μ L of the diluted PCR product pre-amplified in the previous step, 10 XPCR reaction solution (10 mmol/L Tris-HCl, pH =8.3, 50mmol/L KCl), 0.5U Taq DNA polymerase, 2.5mmol/L dNTP,3.5mmol/L Mg 2+ ，Oligo Mix Z N (0.04mmol/L Z N -F,0.4mmol/L Z N -R,0.1mmol/L Z N -P), sterile water.
The procedure for the PCR amplification reaction was:
the first step is as follows: circulating for 1 time at 95 ℃ for 5min;
the second step is as follows: 95 ℃ for 10s,60 ℃ for 20s, and 72 ℃ for 25s; circulating for 45 times, and collecting no fluorescence;
the third step: circulating for 1 time at 95 ℃ for 1 min;
the fourth step: fluorescence is collected at 1min at 37 ℃ and 2 ℃ per liter at 37-85 ℃.
47 reaction systems directly carry out amplification reaction by hands-free extraction without treatment, and can be completely and accurately typed according to the judgment standard of TM value typing. The criteria for determining the type of TM are shown in Table 2.
This example adopts
Figure GDA0003959055700000184
The 480-II PCR instrument is used for amplification and dissolution,
Figure GDA0003959055700000185
480 the software was used for genotyping, the results of this example are detailed in Table 5.
The detection peak maps of several SNP sites are selected as examples and are shown in detail in FIGS. 4-6, wherein: FIG. 4: rs1219648-AG; FIG. 5: rs3803662-TT; FIG. 6: rs1003623-CT.
Therefore, the results show that the method for directly amplifying the whole blood sample to be detected without extraction directly as the template is feasible, simple, efficient, time-saving and low-cost, and is beneficial to large-scale popularization. The detection can be carried out efficiently, and the time is saved.
Example 5 accuracy test
In this example, the samples of examples 1 and 3 were extracted for DNA extraction, 47 sites were amplified with the corresponding primers, and the amplified products were sent to Shanghai Biotechnology Ltd for Sanger sequencing. Comparative example 2 consistency of the test results with the sequencing results. The comparative results for the example 1 sample are specifically shown in table 6 below.
TABLE 6 example 1 comparison of sample detection results with sequencing results
Figure GDA0003959055700000191
Figure GDA0003959055700000201
As can be seen from Table 6, the detection results of the sample of example 1 are completely consistent with the sequencing results.
Sequencing charts of several SNP sites were selected as examples, and are shown in detail in FIGS. 7-9, in which: FIG. 7: rs1219648-AA; FIG. 8: rs3803662-CT; FIG. 9: rs3737559-GG.
The detection results of the sample in example 3 are also completely consistent with the sequencing results.
It can be seen that, in this embodiment, the direct amplification detection method without taking sample provided by the present invention can efficiently detect SNP sites of a plurality of samples, and obtain accurate and reliable results. Compared with the Sanger sequencing method, the method greatly improves the sequencing flux, can effectively detect the SNP sites of a plurality of samples at the same time, reduces the steps of processing intermediate samples, improves the experimental efficiency and has lower detection cost.
Although embodiments of the present invention have been shown and described above, it will be understood that the above embodiments are exemplary and not to be construed as limiting the present invention, and that those skilled in the art may make variations, modifications, substitutions and alterations within the scope of the present invention without departing from the spirit and scope of the present invention.
SEQUENCE LISTING
<110> Aigenic Borui (Xiamen) medical laboratory Co., ltd
<120> primer group, probe and reagent for direct amplification and detection of high-incidence tumor susceptibility gene polymorphism without taking hands
Cartridge and method thereof
<130> AJYB-20002-CNI
<160> 284
<170> PatentIn version 3.5
<210> 1
<211> 21
<212> DNA
<213> Artificial sequence
<400> 1
cacagggttt tctgcaattg a 21
<210> 2
<211> 20
<212> DNA
<213> Artificial sequence
<400> 2
catagtgcct ctatgagtcc 20
<210> 3
<211> 20
<212> DNA
<213> Artificial sequence
<400> 3
ctctatgagt ccgtattgag 20
<210> 4
<211> 25
<212> DNA
<213> Artificial sequence
<400> 4
tgagtgtgta tgcagtaaaa gtatg 25
<210> 5
<211> 20
<212> DNA
<213> Artificial sequence
<400> 5
aatcccctga aattccactg 20
<210> 6
<211> 25
<212> DNA
<213> Artificial sequence
<400> 6
ataaccacta ttcacatttt ggtca 25
<210> 7
<211> 18
<212> DNA
<213> Artificial sequence
<400> 7
tattctgcct tgggtttg 18
<210> 8
<211> 18
<212> DNA
<213> Artificial sequence
<400> 8
agagggattc atgggact 18
<210> 9
<211> 19
<212> DNA
<213> Artificial sequence
<400> 9
tcccttttct gcaatggat 19
<210> 10
<211> 22
<212> DNA
<213> Artificial sequence
<400> 10
gctgctttga tagaccccag ag 22
<210> 11
<211> 20
<212> DNA
<213> Artificial sequence
<400> 11
gacaggcgat ccaggtgagt 20
<210> 12
<211> 21
<212> DNA
<213> Artificial sequence
<400> 12
agcagtacca cgtgtcaaat t 21
<210> 13
<211> 21
<212> DNA
<213> Artificial sequence
<400> 13
atgtgcactc atttgtggac g 21
<210> 14
<211> 20
<212> DNA
<213> Artificial sequence
<400> 14
acctttcaat ttgtggaggc 20
<210> 15
<211> 21
<212> DNA
<213> Artificial sequence
<400> 15
ctgcttcttg gactgaactg c 21
<210> 16
<211> 25
<212> DNA
<213> Artificial sequence
<400> 16
tgaaaaacac cttcaggatg gatat 25
<210> 17
<211> 24
<212> DNA
<213> Artificial sequence
<400> 17
tgaggaaact ttgataggat gtgg 24
<210> 18
<211> 21
<212> DNA
<213> Artificial sequence
<400> 18
acatccacat gatacctctg a 21
<210> 19
<211> 23
<212> DNA
<213> Artificial sequence
<400> 19
tctgaggaca gatgaaggat aag 23
<210> 20
<211> 22
<212> DNA
<213> Artificial sequence
<400> 20
agacacctaa ccatttcatt cc 22
<210> 21
<211> 17
<212> DNA
<213> Artificial sequence
<400> 21
agccaccatc agcttaa 17
<210> 22
<211> 25
<212> DNA
<213> Artificial sequence
<400> 22
agaacagtag aatctcactg ttaag 25
<210> 23
<211> 24
<212> DNA
<213> Artificial sequence
<400> 23
ggtgtatgat tctcagttga tctt 24
<210> 24
<211> 22
<212> DNA
<213> Artificial sequence
<400> 24
tttaccagta atcctttcaa ct 22
<210> 25
<211> 20
<212> DNA
<213> Artificial sequence
<400> 25
actaagacgt gcgaggggaa 20
<210> 26
<211> 20
<212> DNA
<213> Artificial sequence
<400> 26
tttgttttta ggaaccacac 20
<210> 27
<211> 25
<212> DNA
<213> Artificial sequence
<400> 27
caaagaccgt gccaccagtt aattt 25
<210> 28
<211> 21
<212> DNA
<213> Artificial sequence
<400> 28
aagcggaaga atgtgtcagc c 21
<210> 29
<211> 23
<212> DNA
<213> Artificial sequence
<400> 29
ctgacctgaa gcacttgaag gag 23
<210> 30
<211> 18
<212> DNA
<213> Artificial sequence
<400> 30
tctgcgggag ccgatttc 18
<210> 31
<211> 20
<212> DNA
<213> Artificial sequence
<400> 31
tatcagatgc aagccacacg 20
<210> 32
<211> 20
<212> DNA
<213> Artificial sequence
<400> 32
ccctctcccc aagcttactt 20
<210> 33
<211> 26
<212> DNA
<213> Artificial sequence
<400> 33
tgtaaaaatt attacataaa attcta 26
<210> 34
<211> 20
<212> DNA
<213> Artificial sequence
<400> 34
taatacattt cttgtgaggc 20
<210> 35
<211> 22
<212> DNA
<213> Artificial sequence
<400> 35
agaattgctt gaacctggga gg 22
<210> 36
<211> 19
<212> DNA
<213> Artificial sequence
<400> 36
aatcaaggcc gccatttaa 19
<210> 37
<211> 25
<212> DNA
<213> Artificial sequence
<400> 37
ttgataaact taccagccag aaagc 25
<210> 38
<211> 22
<212> DNA
<213> Artificial sequence
<400> 38
gcatagtggg cagaaaacaa gg 22
<210> 39
<211> 26
<212> DNA
<213> Artificial sequence
<400> 39
acttcagagt ccatcatggt gtgaag 26
<210> 40
<211> 28
<212> DNA
<213> Artificial sequence
<400> 40
ctataattag cctgtgaatg gacattag 28
<210> 41
<211> 26
<212> DNA
<213> Artificial sequence
<400> 41
ggagaaccaa caggattctg actaat 26
<210> 42
<211> 31
<212> DNA
<213> Artificial sequence
<400> 42
agatagtcat tgcagatttg taatagctgg g 31
<210> 43
<211> 23
<212> DNA
<213> Artificial sequence
<400> 43
aattacccag gctcaggtta tgt 23
<210> 44
<211> 22
<212> DNA
<213> Artificial sequence
<400> 44
gaggtagcag gcagagaatg ta 22
<210> 45
<211> 20
<212> DNA
<213> Artificial sequence
<400> 45
gaacagatca aaggagtaaa 20
<210> 46
<211> 18
<212> DNA
<213> Artificial sequence
<400> 46
tccacggaga cctggttc 18
<210> 47
<211> 19
<212> DNA
<213> Artificial sequence
<400> 47
cttcatcgtc tcggtgctg 19
<210> 48
<211> 16
<212> DNA
<213> Artificial sequence
<400> 48
tcctcttccg gtgccc 16
<210> 49
<211> 19
<212> DNA
<213> Artificial sequence
<400> 49
tggggtgagg gctataaaa 19
<210> 50
<211> 18
<212> DNA
<213> Artificial sequence
<400> 50
cggcttgtcc cgagatgt 18
<210> 51
<211> 21
<212> DNA
<213> Artificial sequence
<400> 51
gaggattcgt acgtgaagag g 21
<210> 52
<211> 22
<212> DNA
<213> Artificial sequence
<400> 52
ctcctcctac cactaagagg tg 22
<210> 53
<211> 20
<212> DNA
<213> Artificial sequence
<400> 53
gagaaagcag ctttccagct 20
<210> 54
<211> 22
<212> DNA
<213> Artificial sequence
<400> 54
ttttctcagt gcctttcatc tg 22
<210> 55
<211> 21
<212> DNA
<213> Artificial sequence
<400> 55
gggaggatgt tccacacaga t 21
<210> 56
<211> 22
<212> DNA
<213> Artificial sequence
<400> 56
ccccatgggt gaaagtaaag ta 22
<210> 57
<211> 20
<212> DNA
<213> Artificial sequence
<400> 57
agaaaatctc tcccagaaat 20
<210> 58
<211> 22
<212> DNA
<213> Artificial sequence
<400> 58
ggatttttgg gggagacctg cc 22
<210> 59
<211> 22
<212> DNA
<213> Artificial sequence
<400> 59
gttctgcgaa tctgaagcac tg 22
<210> 60
<211> 20
<212> DNA
<213> Artificial sequence
<400> 60
cagcatgttc acttgaagat 20
<210> 61
<211> 24
<212> DNA
<213> Artificial sequence
<400> 61
caaaatgagg gctgatccta ccac 24
<210> 62
<211> 20
<212> DNA
<213> Artificial sequence
<400> 62
ccagcgtctg acgttatgag 20
<210> 63
<211> 20
<212> DNA
<213> Artificial sequence
<400> 63
gcctggccca aaacgtctta 20
<210> 64
<211> 20
<212> DNA
<213> Artificial sequence
<400> 64
tcaccttctg gagtggccgt 20
<210> 65
<211> 22
<212> DNA
<213> Artificial sequence
<400> 65
cagaccgtga gctggaggag ta 22
<210> 66
<211> 22
<212> DNA
<213> Artificial sequence
<400> 66
aagggctgtg aaggtgagtg ct 22
<210> 67
<211> 22
<212> DNA
<213> Artificial sequence
<400> 67
aggggtgttc tgaagagtgg tg 22
<210> 68
<211> 25
<212> DNA
<213> Artificial sequence
<400> 68
gccataccca tacctgattt atctg 25
<210> 69
<211> 20
<212> DNA
<213> Artificial sequence
<400> 69
acaccaagtc ctgcaacaca 20
<210> 70
<211> 22
<212> DNA
<213> Artificial sequence
<400> 70
cctgtagagg ggccatgaag ta 22
<210> 71
<211> 24
<212> DNA
<213> Artificial sequence
<400> 71
cctgatgatt agtgatgttg cctg 24
<210> 72
<211> 20
<212> DNA
<213> Artificial sequence
<400> 72
catcaaccgt caaagtgtac 20
<210> 73
<211> 22
<212> DNA
<213> Artificial sequence
<400> 73
actgaaaatc taaagcacgc ct 22
<210> 74
<211> 23
<212> DNA
<213> Artificial sequence
<400> 74
agtatgaatc attgggacaa gcc 23
<210> 75
<211> 26
<212> DNA
<213> Artificial sequence
<400> 75
ccatccttga agagcgtgtg tcaagt 26
<210> 76
<211> 20
<212> DNA
<213> Artificial sequence
<400> 76
gggggtcagt ccacagtttt 20
<210> 77
<211> 27
<212> DNA
<213> Artificial sequence
<400> 77
ctgcctaatg attttctctc cttaatg 27
<210> 78
<211> 25
<212> DNA
<213> Artificial sequence
<400> 78
tctatagctg tcccttagcg aagaa 25
<210> 79
<211> 20
<212> DNA
<213> Artificial sequence
<400> 79
ttgtgagcag ggacaagaac 20
<210> 80
<211> 24
<212> DNA
<213> Artificial sequence
<400> 80
cacatcagaa aaaggtgtgt attg 24
<210> 81
<211> 20
<212> DNA
<213> Artificial sequence
<400> 81
cagcacatga gtaattatgg 20
<210> 82
<211> 25
<212> DNA
<213> Artificial sequence
<400> 82
ccaaacaata cataacactt atgat 25
<210> 83
<211> 21
<212> DNA
<213> Artificial sequence
<400> 83
tgccagttaa cattctacca g 21
<210> 84
<211> 20
<212> DNA
<213> Artificial sequence
<400> 84
agacttgttc ggtgtttctt 20
<210> 85
<211> 27
<212> DNA
<213> Artificial sequence
<400> 85
atagcaacaa gttttggaga agagaga 27
<210> 86
<211> 23
<212> DNA
<213> Artificial sequence
<400> 86
actccagggg ctccagcttt ctg 23
<210> 87
<211> 20
<212> DNA
<213> Artificial sequence
<400> 87
catcttttgt ctcccccttt 20
<210> 88
<211> 20
<212> DNA
<213> Artificial sequence
<400> 88
ccctcaacgc tctcaccatt 20
<210> 89
<211> 21
<212> DNA
<213> Artificial sequence
<400> 89
tctacacccg aaatcgcagg a 21
<210> 90
<211> 21
<212> DNA
<213> Artificial sequence
<400> 90
ctgctcctgc cgacgtgttc t 21
<210> 91
<211> 20
<212> DNA
<213> Artificial sequence
<400> 91
atcattttcc tcacacatac 20
<210> 92
<211> 22
<212> DNA
<213> Artificial sequence
<400> 92
cgaaaccaac ttagtgggtc aa 22
<210> 93
<211> 22
<212> DNA
<213> Artificial sequence
<400> 93
aggtagatgc gtatgtgact gt 22
<210> 94
<211> 25
<212> DNA
<213> Artificial sequence
<400> 94
ccgatacaca aacgctgagg taaat 25
<210> 95
<211> 20
<212> DNA
<213> Artificial sequence
<400> 95
gacgcttaac ctttccagtt 20
<210> 96
<211> 22
<212> DNA
<213> Artificial sequence
<400> 96
gcacaatgag caaagaaatt ag 22
<210> 97
<211> 26
<212> DNA
<213> Artificial sequence
<400> 97
gttccaattt tagtatatgt gctgct 26
<210> 98
<211> 27
<212> DNA
<213> Artificial sequence
<400> 98
aagtgttaag atcacatatc ttctatt 27
<210> 99
<211> 21
<212> DNA
<213> Artificial sequence
<400> 99
ttatttgtga caattgagtg c 21
<210> 100
<211> 20
<212> DNA
<213> Artificial sequence
<400> 100
gctacagtga gacccagaat 20
<210> 101
<211> 21
<212> DNA
<213> Artificial sequence
<400> 101
tcagtccctc agaaagaaga g 21
<210> 102
<211> 21
<212> DNA
<213> Artificial sequence
<400> 102
gtaacgttat aaatggggaa a 21
<210> 103
<211> 21
<212> DNA
<213> Artificial sequence
<400> 103
gaggcctgag tttggaatat c 21
<210> 104
<211> 21
<212> DNA
<213> Artificial sequence
<400> 104
acctctccaa atcctgaaga g 21
<210> 105
<211> 21
<212> DNA
<213> Artificial sequence
<400> 105
ccatactcca agtaaatttg g 21
<210> 106
<211> 21
<212> DNA
<213> Artificial sequence
<400> 106
gccgcatcgt gcgtaaggag t 21
<210> 107
<211> 24
<212> DNA
<213> Artificial sequence
<400> 107
ggcattgccc agcacaggat aagg 24
<210> 108
<211> 24
<212> DNA
<213> Artificial sequence
<400> 108
aggccttacc tccgggaggg cagc 24
<210> 109
<211> 20
<212> DNA
<213> Artificial sequence
<400> 109
aattgcctga ttagagcact 20
<210> 110
<211> 20
<212> DNA
<213> Artificial sequence
<400> 110
caaaagggga cctgtgtgac 20
<210> 111
<211> 20
<212> DNA
<213> Artificial sequence
<400> 111
aacactgtca cttttctgag 20
<210> 112
<211> 24
<212> DNA
<213> Artificial sequence
<400> 112
gtcaatattt ctcttaacgt cctc 24
<210> 113
<211> 23
<212> DNA
<213> Artificial sequence
<400> 113
agaataagaa acggtcacag cct 23
<210> 114
<211> 19
<212> DNA
<213> Artificial sequence
<400> 114
agatcctcga ttcgatctt 19
<210> 115
<211> 20
<212> DNA
<213> Artificial sequence
<400> 115
tgggggagtc tctctttatg 20
<210> 116
<211> 20
<212> DNA
<213> Artificial sequence
<400> 116
cctcagtcag tggttgaatc 20
<210> 117
<211> 21
<212> DNA
<213> Artificial sequence
<400> 117
tgttcagtgg tgcaccgtat c 21
<210> 118
<211> 20
<212> DNA
<213> Artificial sequence
<400> 118
gggagaaagc cctggctaag 20
<210> 119
<211> 19
<212> DNA
<213> Artificial sequence
<400> 119
ggtcgagcac tctcgtctt 19
<210> 120
<211> 20
<212> DNA
<213> Artificial sequence
<400> 120
acgggtcacg atggtgtcag 20
<210> 121
<211> 23
<212> DNA
<213> Artificial sequence
<400> 121
gtgtgtatga gtgtgtatta gag 23
<210> 122
<211> 20
<212> DNA
<213> Artificial sequence
<400> 122
cccatcctat cccagatcag 20
<210> 123
<211> 21
<212> DNA
<213> Artificial sequence
<400> 123
ttcctataca tttctccctt t 21
<210> 124
<211> 25
<212> DNA
<213> Artificial sequence
<400> 124
agcatttaaa ttggctaact taagg 25
<210> 125
<211> 21
<212> DNA
<213> Artificial sequence
<400> 125
gtgctaggaa ttctggtgga g 21
<210> 126
<211> 20
<212> DNA
<213> Artificial sequence
<400> 126
tttgtaacga gttaccaggt 20
<210> 127
<211> 20
<212> DNA
<213> Artificial sequence
<400> 127
gggttacctg cttcctgtct 20
<210> 128
<211> 21
<212> DNA
<213> Artificial sequence
<400> 128
gggcctaaac ctttccaaga g 21
<210> 129
<211> 22
<212> DNA
<213> Artificial sequence
<400> 129
agcatttgca ctccgatcca at 22
<210> 130
<211> 24
<212> DNA
<213> Artificial sequence
<400> 130
gaactgtttc ataccaccgt tgag 24
<210> 131
<211> 20
<212> DNA
<213> Artificial sequence
<400> 131
aagggacagc ctgatgctac 20
<210> 132
<211> 25
<212> DNA
<213> Artificial sequence
<400> 132
aggccctagt aaacgattgt gcatc 25
<210> 133
<211> 25
<212> DNA
<213> Artificial sequence
<400> 133
gctcaaactt ttatactgga gaggg 25
<210> 134
<211> 25
<212> DNA
<213> Artificial sequence
<400> 134
ctcaatgtgt tctcaccttg ttatc 25
<210> 135
<211> 23
<212> DNA
<213> Artificial sequence
<400> 135
attcccaatg acgtcgaatg cgt 23
<210> 136
<211> 27
<212> DNA
<213> Artificial sequence
<400> 136
atagcaacaa gttttggaga agagaga 27
<210> 137
<211> 23
<212> DNA
<213> Artificial sequence
<400> 137
actccagggg ctccagcttt ctg 23
<210> 138
<211> 20
<212> DNA
<213> Artificial sequence
<400> 138
catcttttgt ctcccccttt 20
<210> 139
<211> 20
<212> DNA
<213> Artificial sequence
<400> 139
acaggattgc ctggagacaa 20
<210> 140
<211> 23
<212> DNA
<213> Artificial sequence
<400> 140
tcagctgacc aagcaattca tac 23
<210> 141
<211> 21
<212> DNA
<213> Artificial sequence
<400> 141
agagccacaa caaaacactg t 21
<210> 142
<211> 21
<212> DNA
<213> Artificial sequence
<400> 142
tgcagggtcg ctaagaagtc t 21
<210> 143
<211> 21
<212> DNA
<213> Artificial sequence
<400> 143
tgcagggtcg ctaagaagta a 21
<210> 144
<211> 42
<212> DNA
<213> Artificial sequence
<400> 144
tgcagggtcg ctaagaagta acacagggtt ttctgcaatt ga 42
<210> 145
<211> 41
<212> DNA
<213> Artificial sequence
<400> 145
tgcagggtcg ctaagaagtc tcatagtgcc tctatgagtc c 41
<210> 146
<211> 23
<212> DNA
<213> Artificial sequence
<220>
<221> modified_base
<222> (1)..(3)
<223> thio modification
<400> 146
cgtctctatg agtccgtatt gag 23
<210> 147
<211> 46
<212> DNA
<213> Artificial sequence
<400> 147
tgcagggtcg ctaagaagtc ttgagtgtgt atgcagtaaa agtatg 46
<210> 148
<211> 41
<212> DNA
<213> Artificial sequence
<400> 148
tgcagggtcg ctaagaagta aaatcccctg aaattccact g 41
<210> 149
<211> 28
<212> DNA
<213> Artificial sequence
<220>
<221> modified_base
<222> (1)..(2)
<223> thio modification
<400> 149
actataacca ctattcacat tttggtca 28
<210> 150
<211> 39
<212> DNA
<213> Artificial sequence
<400> 150
tgcagggtcg ctaagaagta atattctgcc ttgggtttg 39
<210> 151
<211> 39
<212> DNA
<213> Artificial sequence
<400> 151
tgcagggtcg ctaagaagtc tagagggatt catgggact 39
<210> 152
<211> 22
<212> DNA
<213> Artificial sequence
<220>
<221> modified_base
<222> (1)..(3)
<223> thio modification
<400> 152
ttctcccttt tctgcaatgg at 22
<210> 153
<211> 43
<212> DNA
<213> Artificial sequence
<400> 153
tgcagggtcg ctaagaagtc tgctgctttg atagacccca gag 43
<210> 154
<211> 41
<212> DNA
<213> Artificial sequence
<400> 154
tgcagggtcg ctaagaagta agacaggcga tccaggtgag t 41
<210> 155
<211> 24
<212> DNA
<213> Artificial sequence
<220>
<221> modified_base
<222> (1)..(3)
<223> thio modification
<400> 155
gttagcagta ccacgtgtca aatt 24
<210> 156
<211> 42
<212> DNA
<213> Artificial sequence
<400> 156
tgcagggtcg ctaagaagta aatgtgcact catttgtgga cg 42
<210> 157
<211> 41
<212> DNA
<213> Artificial sequence
<400> 157
tgcagggtcg ctaagaagtc tacctttcaa tttgtggagg c 41
<210> 158
<211> 24
<212> DNA
<213> Artificial sequence
<220>
<221> modified_base
<222> (1)..(3)
<223> thio modification
<400> 158
ggtctgcttc ttggactgaa ctgc 24
<210> 159
<211> 46
<212> DNA
<213> Artificial sequence
<400> 159
tgcagggtcg ctaagaagta atgaaaaaca ccttcaggat ggatat 46
<210> 160
<211> 45
<212> DNA
<213> Artificial sequence
<400> 160
tgcagggtcg ctaagaagtc ttgaggaaac tttgatagga tgtgg 45
<210> 161
<211> 24
<212> DNA
<213> Artificial sequence
<220>
<221> modified_base
<222> (1)..(3)
<223> thio modification
<400> 161
cccacatcca catgatacct ctga 24
<210> 162
<211> 44
<212> DNA
<213> Artificial sequence
<400> 162
tgcagggtcg ctaagaagta atctgaggac agatgaagga taag 44
<210> 163
<211> 43
<212> DNA
<213> Artificial sequence
<400> 163
tgcagggtcg ctaagaagtc tagacaccta accatttcat tcc 43
<210> 164
<211> 20
<212> DNA
<213> Artificial sequence
<220>
<221> modified_base
<222> (1)..(3)
<223> thio modification
<400> 164
cctagccacc atcagcttaa 20
<210> 165
<211> 46
<212> DNA
<213> Artificial sequence
<400> 165
tgcagggtcg ctaagaagta aagaacagta gaatctcact gttaag 46
<210> 166
<211> 45
<212> DNA
<213> Artificial sequence
<400> 166
tgcagggtcg ctaagaagtc tggtgtatga ttctcagttg atctt 45
<210> 167
<211> 25
<212> DNA
<213> Artificial sequence
<220>
<221> modified_base
<222> (1)..(3)
<223> thio modification
<400> 167
ccgtttacca gtaatccttt caact 25
<210> 168
<211> 41
<212> DNA
<213> Artificial sequence
<400> 168
tgcagggtcg ctaagaagtc tactaagacg tgcgagggga a 41
<210> 169
<211> 41
<212> DNA
<213> Artificial sequence
<400> 169
tgcagggtcg ctaagaagta atttgttttt aggaaccaca c 41
<210> 170
<211> 28
<212> DNA
<213> Artificial sequence
<220>
<221> modified_base
<222> (1)..(3)
<223> thio modification
<400> 170
actcaaagac cgtgccacca gttaattt 28
<210> 171
<211> 42
<212> DNA
<213> Artificial sequence
<400> 171
tgcagggtcg ctaagaagta aaagcggaag aatgtgtcag cc 42
<210> 172
<211> 44
<212> DNA
<213> Artificial sequence
<400> 172
tgcagggtcg ctaagaagtc tctgacctga agcacttgaa ggag 44
<210> 173
<211> 21
<212> DNA
<213> Artificial sequence
<220>
<221> modified_base
<222> (1)..(3)
<223> thio modification
<400> 173
gtgtctgcgg gagccgattt c 21
<210> 174
<211> 41
<212> DNA
<213> Artificial sequence
<400> 174
tgcagggtcg ctaagaagtc ttatcagatg caagccacac g 41
<210> 175
<211> 41
<212> DNA
<213> Artificial sequence
<400> 175
tgcagggtcg ctaagaagta accctctccc caagcttact t 41
<210> 176
<211> 29
<212> DNA
<213> Artificial sequence
<220>
<221> modified_base
<222> (1)..(3)
<223> thio modification
<400> 176
ctctgtaaaa attattacat aaaattcta 29
<210> 177
<211> 41
<212> DNA
<213> Artificial sequence
<400> 177
tgcagggtcg ctaagaagta ataatacatt tcttgtgagg c 41
<210> 178
<211> 43
<212> DNA
<213> Artificial sequence
<400> 178
tgcagggtcg ctaagaagtc tagaattgct tgaacctggg agg 43
<210> 179
<211> 22
<212> DNA
<213> Artificial sequence
<220>
<221> modified_base
<222> (1)..(3)
<223> thio modification
<400> 179
cataatcaag gccgccattt aa 22
<210> 180
<211> 46
<212> DNA
<213> Artificial sequence
<400> 180
tgcagggtcg ctaagaagta attgataaac ttaccagcca gaaagc 46
<210> 181
<211> 43
<212> DNA
<213> Artificial sequence
<400> 181
tgcagggtcg ctaagaagtc tgcatagtgg gcagaaaaca agg 43
<210> 182
<211> 29
<212> DNA
<213> Artificial sequence
<220>
<221> modified_base
<222> (1)..(3)
<223> thio modification
<400> 182
cacacttcag agtccatcat ggtgtgaag 29
<210> 183
<211> 49
<212> DNA
<213> Artificial sequence
<400> 183
tgcagggtcg ctaagaagta actataatta gcctgtgaat ggacattag 49
<210> 184
<211> 47
<212> DNA
<213> Artificial sequence
<400> 184
tgcagggtcg ctaagaagtc tggagaacca acaggattct gactaat 47
<210> 185
<211> 34
<212> DNA
<213> Artificial sequence
<220>
<221> modified_base
<222> (1)..(3)
<223> thio modification
<400> 185
gaaagatagt cattgcagat ttgtaatagc tggg 34
<210> 186
<211> 44
<212> DNA
<213> Artificial sequence
<400> 186
tgcagggtcg ctaagaagta aaattaccca ggctcaggtt atgt 44
<210> 187
<211> 43
<212> DNA
<213> Artificial sequence
<400> 187
tgcagggtcg ctaagaagtc tgaggtagca ggcagagaat gta 43
<210> 188
<211> 23
<212> DNA
<213> Artificial sequence
<220>
<221> modified_base
<222> (1)..(3)
<223> thio modification
<400> 188
cacgaacaga tcaaaggagt aaa 23
<210> 189
<211> 39
<212> DNA
<213> Artificial sequence
<400> 189
tgcagggtcg ctaagaagta atccacggag acctggttc 39
<210> 190
<211> 40
<212> DNA
<213> Artificial sequence
<400> 190
tgcagggtcg ctaagaagtc tcttcatcgt ctcggtgctg 40
<210> 191
<211> 19
<212> DNA
<213> Artificial sequence
<220>
<221> modified_base
<222> (1)..(3)
<223> thio modification
<400> 191
caatcctctt ccggtgccc 19
<210> 192
<211> 40
<212> DNA
<213> Artificial sequence
<400> 192
tgcagggtcg ctaagaagta atggggtgag ggctataaaa 40
<210> 193
<211> 39
<212> DNA
<213> Artificial sequence
<400> 193
tgcagggtcg ctaagaagtc tcggcttgtc ccgagatgt 39
<210> 194
<211> 24
<212> DNA
<213> Artificial sequence
<220>
<221> modified_base
<222> (1)..(3)
<223> thio modification
<400> 194
tccgaggatt cgtacgtgaa gagg 24
<210> 195
<211> 43
<212> DNA
<213> Artificial sequence
<400> 195
tgcagggtcg ctaagaagtc tctcctccta ccactaagag gtg 43
<210> 196
<211> 41
<212> DNA
<213> Artificial sequence
<400> 196
tgcagggtcg ctaagaagta agagaaagca gctttccagc t 41
<210> 197
<211> 25
<212> DNA
<213> Artificial sequence
<220>
<221> modified_base
<222> (1)..(3)
<223> thio modification
<400> 197
cgcttttctc agtgcctttc atctg 25
<210> 198
<211> 42
<212> DNA
<213> Artificial sequence
<400> 198
tgcagggtcg ctaagaagta agggaggatg ttccacacag at 42
<210> 199
<211> 43
<212> DNA
<213> Artificial sequence
<400> 199
tgcagggtcg ctaagaagtc tccccatggg tgaaagtaaa gta 43
<210> 200
<211> 23
<212> DNA
<213> Artificial sequence
<220>
<221> modified_base
<222> (1)..(3)
<223> thio modification
<400> 200
cgcagaaaat ctctcccaga aat 23
<210> 201
<211> 43
<212> DNA
<213> Artificial sequence
<400> 201
tgcagggtcg ctaagaagta aggatttttg ggggagacct gcc 43
<210> 202
<211> 43
<212> DNA
<213> Artificial sequence
<400> 202
tgcagggtcg ctaagaagtc tgttctgcga atctgaagca ctg 43
<210> 203
<211> 23
<212> DNA
<213> Artificial sequence
<220>
<221> modified_base
<222> (1)..(3)
<223> thio modification
<400> 203
gttcagcatg ttcacttgaa gat 23
<210> 204
<211> 45
<212> DNA
<213> Artificial sequence
<400> 204
tgcagggtcg ctaagaagta acaaaatgag ggctgatcct accac 45
<210> 205
<211> 41
<212> DNA
<213> Artificial sequence
<400> 205
tgcagggtcg ctaagaagtc tccagcgtct gacgttatga g 41
<210> 206
<211> 23
<212> DNA
<213> Artificial sequence
<220>
<221> modified_base
<222> (1)..(3)
<223> thio modification
<400> 206
cccgcctggc ccaaaacgtc tta 23
<210> 207
<211> 41
<212> DNA
<213> Artificial sequence
<400> 207
tgcagggtcg ctaagaagta atcaccttct ggagtggccg t 41
<210> 208
<211> 43
<212> DNA
<213> Artificial sequence
<400> 208
tgcagggtcg ctaagaagtc tcagaccgtg agctggagga gta 43
<210> 209
<211> 25
<212> DNA
<213> Artificial sequence
<220>
<221> modified_base
<222> (1)..(3)
<223> thio modification
<400> 209
actaagggct gtgaaggtga gtgct 25
<210> 210
<211> 43
<212> DNA
<213> Artificial sequence
<400> 210
tgcagggtcg ctaagaagta aaggggtgtt ctgaagagtg gtg 43
<210> 211
<211> 46
<212> DNA
<213> Artificial sequence
<400> 211
tgcagggtcg ctaagaagtc tgccataccc atacctgatt tatctg 46
<210> 212
<211> 23
<212> DNA
<213> Artificial sequence
<220>
<221> modified_base
<222> (1)..(3)
<223> thio modification
<400> 212
ccaacaccaa gtcctgcaac aca 23
<210> 213
<211> 43
<212> DNA
<213> Artificial sequence
<400> 213
tgcagggtcg ctaagaagta acctgtagag gggccatgaa gta 43
<210> 214
<211> 45
<212> DNA
<213> Artificial sequence
<400> 214
tgcagggtcg ctaagaagtc tcctgatgat tagtgatgtt gcctg 45
<210> 215
<211> 23
<212> DNA
<213> Artificial sequence
<220>
<221> modified_base
<222> (1)..(3)
<223> thio modification
<400> 215
ccccatcaac cgtcaaagtg tac 23
<210> 216
<211> 43
<212> DNA
<213> Artificial sequence
<400> 216
tgcagggtcg ctaagaagtc tactgaaaat ctaaagcacg cct 43
<210> 217
<211> 44
<212> DNA
<213> Artificial sequence
<400> 217
tgcagggtcg ctaagaagta aagtatgaat cattgggaca agcc 44
<210> 218
<211> 29
<212> DNA
<213> Artificial sequence
<220>
<221> modified_base
<222> (1)..(3)
<223> thio modification
<400> 218
actccatcct tgaagagcgt gtgtcaagt 29
<210> 219
<211> 41
<212> DNA
<213> Artificial sequence
<400> 219
tgcagggtcg ctaagaagta agggggtcag tccacagttt t 41
<210> 220
<211> 48
<212> DNA
<213> Artificial sequence
<400> 220
tgcagggtcg ctaagaagtc tctgcctaat gattttctct ccttaatg 48
<210> 221
<211> 28
<212> DNA
<213> Artificial sequence
<220>
<221> modified_base
<222> (1)..(3)
<223> thio modification
<400> 221
cattctatag ctgtccctta gcgaagaa 28
<210> 222
<211> 41
<212> DNA
<213> Artificial sequence
<400> 222
tgcagggtcg ctaagaagta attgtgagca gggacaagaa c 41
<210> 223
<211> 45
<212> DNA
<213> Artificial sequence
<400> 223
tgcagggtcg ctaagaagtc tcacatcaga aaaaggtgtg tattg 45
<210> 224
<211> 23
<212> DNA
<213> Artificial sequence
<220>
<221> modified_base
<222> (1)..(3)
<223> thio modification
<400> 224
ttccagcaca tgagtaatta tgg 23
<210> 225
<211> 46
<212> DNA
<213> Artificial sequence
<400> 225
tgcagggtcg ctaagaagta accaaacaat acataacact tatgat 46
<210> 226
<211> 42
<212> DNA
<213> Artificial sequence
<400> 226
tgcagggtcg ctaagaagtc ttgccagtta acattctacc ag 42
<210> 227
<211> 23
<212> DNA
<213> Artificial sequence
<220>
<221> modified_base
<222> (1)..(3)
<223> thio modification
<400> 227
cccagacttg ttcggtgttt ctt 23
<210> 228
<211> 48
<212> DNA
<213> Artificial sequence
<400> 228
tgcagggtcg ctaagaagta aatagcaaca agttttggag aagagaga 48
<210> 229
<211> 44
<212> DNA
<213> Artificial sequence
<400> 229
tgcagggtcg ctaagaagtc tactccaggg gctccagctt tctg 44
<210> 230
<211> 23
<212> DNA
<213> Artificial sequence
<220>
<221> modified_base
<222> (1)..(3)
<223> thio modification
<400> 230
acacatcttt tgtctccccc ttt 23
<210> 231
<211> 41
<212> DNA
<213> Artificial sequence
<400> 231
tgcagggtcg ctaagaagta accctcaacg ctctcaccat t 41
<210> 232
<211> 42
<212> DNA
<213> Artificial sequence
<400> 232
tgcagggtcg ctaagaagtc ttctacaccc gaaatcgcag ga 42
<210> 233
<211> 24
<212> DNA
<213> Artificial sequence
<220>
<221> modified_base
<222> (1)..(3)
<223> thio modification
<400> 233
aatctgctcc tgccgacgtg ttct 24
<210> 234
<211> 41
<212> DNA
<213> Artificial sequence
<400> 234
tgcagggtcg ctaagaagta aatcattttc ctcacacata c 41
<210> 235
<211> 43
<212> DNA
<213> Artificial sequence
<400> 235
tgcagggtcg ctaagaagtc tcgaaaccaa cttagtgggt caa 43
<210> 236
<211> 25
<212> DNA
<213> Artificial sequence
<220>
<221> modified_base
<222> (1)..(3)
<223> thio modification
<400> 236
ctaaggtaga tgcgtatgtg actgt 25
<210> 237
<211> 46
<212> DNA
<213> Artificial sequence
<400> 237
tgcagggtcg ctaagaagta accgatacac aaacgctgag gtaaat 46
<210> 238
<211> 41
<212> DNA
<213> Artificial sequence
<400> 238
tgcagggtcg ctaagaagtc tgacgcttaa cctttccagt t 41
<210> 239
<211> 25
<212> DNA
<213> Artificial sequence
<220>
<221> modified_base
<222> (1)..(3)
<223> thio modification
<400> 239
accgcacaat gagcaaagaa attag 25
<210> 240
<211> 47
<212> DNA
<213> Artificial sequence
<400> 240
tgcagggtcg ctaagaagta agttccaatt ttagtatatg tgctgct 47
<210> 241
<211> 48
<212> DNA
<213> Artificial sequence
<400> 241
tgcagggtcg ctaagaagtc taagtgttaa gatcacatat cttctatt 48
<210> 242
<211> 24
<212> DNA
<213> Artificial sequence
<220>
<221> modified_base
<222> (1)..(3)
<223> thio modification
<400> 242
actttatttg tgacaattga gtgc 24
<210> 243
<211> 41
<212> DNA
<213> Artificial sequence
<400> 243
tgcagggtcg ctaagaagta agctacagtg agacccagaa t 41
<210> 244
<211> 42
<212> DNA
<213> Artificial sequence
<400> 244
tgcagggtcg ctaagaagtc ttcagtccct cagaaagaag ag 42
<210> 245
<211> 24
<212> DNA
<213> Artificial sequence
<220>
<221> modified_base
<222> (1)..(3)
<223> thio modification
<400> 245
ccggtaacgt tataaatggg gaaa 24
<210> 246
<211> 42
<212> DNA
<213> Artificial sequence
<400> 246
tgcagggtcg ctaagaagta agaggcctga gtttggaata tc 42
<210> 247
<211> 42
<212> DNA
<213> Artificial sequence
<400> 247
tgcagggtcg ctaagaagtc tacctctcca aatcctgaag ag 42
<210> 248
<211> 24
<212> DNA
<213> Artificial sequence
<220>
<221> modified_base
<222> (1)..(3)
<223> thio modification
<400> 248
cgcccatact ccaagtaaat ttgg 24
<210> 249
<211> 42
<212> DNA
<213> Artificial sequence
<400> 249
tgcagggtcg ctaagaagtc tgccgcatcg tgcgtaagga gt 42
<210> 250
<211> 45
<212> DNA
<213> Artificial sequence
<400> 250
tgcagggtcg ctaagaagta aggcattgcc cagcacagga taagg 45
<210> 251
<211> 27
<212> DNA
<213> Artificial sequence
<220>
<221> modified_base
<222> (1)..(3)
<223> thio modification
<400> 251
aataggcctt acctccggga gggcagc 27
<210> 252
<211> 41
<212> DNA
<213> Artificial sequence
<400> 252
tgcagggtcg ctaagaagta aaattgcctg attagagcac t 41
<210> 253
<211> 41
<212> DNA
<213> Artificial sequence
<400> 253
tgcagggtcg ctaagaagtc tcaaaagggg acctgtgtga c 41
<210> 254
<211> 23
<212> DNA
<213> Artificial sequence
<220>
<221> modified_base
<222> (1)..(3)
<223> thio modification
<400> 254
cccaacactg tcacttttct gag 23
<210> 255
<211> 45
<212> DNA
<213> Artificial sequence
<400> 255
tgcagggtcg ctaagaagta agtcaatatt tctcttaacg tcctc 45
<210> 256
<211> 44
<212> DNA
<213> Artificial sequence
<400> 256
tgcagggtcg ctaagaagtc tagaataaga aacggtcaca gcct 44
<210> 257
<211> 22
<212> DNA
<213> Artificial sequence
<220>
<221> modified_base
<222> (1)..(3)
<223> thio modification
<400> 257
aggagatcct cgattcgatc tt 22
<210> 258
<211> 41
<212> DNA
<213> Artificial sequence
<400> 258
tgcagggtcg ctaagaagta atgggggagt ctctctttat g 41
<210> 259
<211> 41
<212> DNA
<213> Artificial sequence
<400> 259
tgcagggtcg ctaagaagtc tcctcagtca gtggttgaat c 41
<210> 260
<211> 24
<212> DNA
<213> Artificial sequence
<220>
<221> modified_base
<222> (1)..(3)
<223> thio modification
<400> 260
tcttgttcag tggtgcaccg tatc 24
<210> 261
<211> 41
<212> DNA
<213> Artificial sequence
<400> 261
tgcagggtcg ctaagaagta agggagaaag ccctggctaa g 41
<210> 262
<211> 40
<212> DNA
<213> Artificial sequence
<400> 262
tgcagggtcg ctaagaagtc tggtcgagca ctctcgtctt 40
<210> 263
<211> 23
<212> DNA
<213> Artificial sequence
<220>
<221> modified_base
<222> (1)..(3)
<223> thio modification
<400> 263
cttacgggtc acgatggtgt cag 23
<210> 264
<211> 44
<212> DNA
<213> Artificial sequence
<400> 264
tgcagggtcg ctaagaagta agtgtgtatg agtgtgtatt agag 44
<210> 265
<211> 41
<212> DNA
<213> Artificial sequence
<400> 265
tgcagggtcg ctaagaagtc tcccatccta tcccagatca g 41
<210> 266
<211> 24
<212> DNA
<213> Artificial sequence
<220>
<221> modified_base
<222> (1)..(3)
<223> thio modification
<400> 266
cccttcctat acatttctcc cttt 24
<210> 267
<211> 46
<212> DNA
<213> Artificial sequence
<400> 267
tgcagggtcg ctaagaagta aagcatttaa attggctaac ttaagg 46
<210> 268
<211> 42
<212> DNA
<213> Artificial sequence
<400> 268
tgcagggtcg ctaagaagtc tgtgctagga attctggtgg ag 42
<210> 269
<211> 23
<212> DNA
<213> Artificial sequence
<220>
<221> modified_base
<222> (1)..(3)
<223> thio modification
<400> 269
ttctttgtaa cgagttacca ggt 23
<210> 270
<211> 41
<212> DNA
<213> Artificial sequence
<400> 270
tgcagggtcg ctaagaagta agggttacct gcttcctgtc t 41
<210> 271
<211> 42
<212> DNA
<213> Artificial sequence
<400> 271
tgcagggtcg ctaagaagtc tgggcctaaa cctttccaag ag 42
<210> 272
<211> 25
<212> DNA
<213> Artificial sequence
<220>
<221> modified_base
<222> (1)..(3)
<223> thio modification
<400> 272
cttagcattt gcactccgat ccaat 25
<210> 273
<211> 45
<212> DNA
<213> Artificial sequence
<400> 273
tgcagggtcg ctaagaagta agaactgttt cataccaccg ttgag 45
<210> 274
<211> 41
<212> DNA
<213> Artificial sequence
<400> 274
tgcagggtcg ctaagaagtc taagggacag cctgatgcta c 41
<210> 275
<211> 28
<212> DNA
<213> Artificial sequence
<220>
<221> modified_base
<222> (1)..(3)
<223> thio modification
<400> 275
attaggccct agtaaacgat tgtgcatc 28
<210> 276
<211> 46
<212> DNA
<213> Artificial sequence
<400> 276
tgcagggtcg ctaagaagta agctcaaact tttatactgg agaggg 46
<210> 277
<211> 46
<212> DNA
<213> Artificial sequence
<400> 277
tgcagggtcg ctaagaagtc tctcaatgtg ttctcacctt gttatc 46
<210> 278
<211> 26
<212> DNA
<213> Artificial sequence
<220>
<221> modified_base
<222> (1)..(3)
<223> thio modification
<400> 278
cccattccca atgacgtcga atgcgt 26
<210> 279
<211> 48
<212> DNA
<213> Artificial sequence
<400> 279
tgcagggtcg ctaagaagta aatagcaaca agttttggag aagagaga 48
<210> 280
<211> 44
<212> DNA
<213> Artificial sequence
<400> 280
tgcagggtcg ctaagaagtc tactccaggg gctccagctt tctg 44
<210> 281
<211> 23
<212> DNA
<213> Artificial sequence
<220>
<221> modified_base
<222> (1)..(3)
<223> thio modification
<400> 281
acacatcttt tgtctccccc ttt 23
<210> 282
<211> 41
<212> DNA
<213> Artificial sequence
<400> 282
tgcagggtcg ctaagaagtc tacaggattg cctggagaca a 41
<210> 283
<211> 44
<212> DNA
<213> Artificial sequence
<400> 283
tgcagggtcg ctaagaagta atcagctgac caagcaattc atac 44
<210> 284
<211> 24
<212> DNA
<213> Artificial sequence
<220>
<221> modified_base
<222> (1)..(3)
<223> thio modification
<400> 284
cgcagagcca caacaaaaca ctgt 24

Claims (15)

1. A primer group for simultaneously amplifying a plurality of genes is characterized in that the 5' end of each primer in the primer group contains a joint sequence SEQ ID NO:142 or 143, and when the joint sequence of an upstream primer is SEQ ID NO:142, the joint sequence of a corresponding downstream primer is SEQ ID NO:143; when the joint sequence of the upstream primer is SEQ ID NO. 143, the joint sequence of the corresponding downstream primer is SEQ ID NO. 142, and then a conventional primer design sequence is added;
<xnotran> 30 , rs, rs, rs, rs, rs, rs, rs, rs, rs, rs1801133, rs, rs, rs, rs944289, rs965513, rs, rs, rs, rs, rs17655, rs696, rs4963, rs, rs, rs, rs3803662, rs, rs, rs, rs, rs, rs, rs, rs, rs, rs25487, rs, rs, rs, rs, rs, rs, rs, rs, rs, rs, rs. </xnotran>
2. The primer set for simultaneous amplification of multiple genes according to claim 1, wherein the multiple genes are 47 genes.
3. The primer set for simultaneous amplification of multiple genes according to claim 1, wherein the multiple genes are 47 tumor genes.
4. The primer set for simultaneously amplifying a plurality of genes as claimed in claim 1, wherein the conventional primer design sequence is as shown in SEQ ID NO 1-2;4-5,7-8.
5. A kit for simultaneously amplifying a plurality of genes, comprising the primer set according to any one of claims 1 to 4.
6. A primer group and a probe for detecting multiple gene polymorphisms by direct amplification without taking out, wherein the sequences of the primer group are as in claim 1 or 2; the sequence of the probe is the sum of three arbitrary thioated base sequences and a conventional probe design sequence; the sequence of the probe is shown in SEQ ID NO:146,149,152.
7. A kit for detecting a plurality of gene polymorphisms by amplifying them directly without picking up a probe, comprising the primer set according to claim 4 and a probe.
8. The kit of claim 7, further comprising 10 XPCR reaction solution, dNTP, mg 2+ And Taq DNA polymerase.
9. A method for non-diagnostic purpose of exempting from extraction and simultaneously enriching multiple site specific DNA fragments, which is characterized by using the primer set of any one of claims 1-4 or the kit of claim 5.
10. The method of claim 9, wherein the method employs PCR amplification, and the pre-amplification reaction system of PCR amplification is,
25 μ l of reaction system: 3 mul of detection sample, 10 XPCR reaction solution, taq DNA polymerase, dNTP with final concentration of 2.5mmol/L and Mg with final concentration of 3.5mmol/L 2+ Oligo Mix with final concentration of 5umol/L, and the balance of sterile water; the Oligo Mix contains equal amounts of SEQ ID NO:144-145;147-148,150-151.. 282-283;
the pre-amplification reaction procedure of PCR amplification is as follows:
the first step is as follows: 5min at 95 ℃; circulating once;
the second step is as follows: 30s at 94 ℃; 30s at 56 ℃; 30s at 72 ℃; circulating for 22 times;
the third step: 10min at 72 ℃; and circulating once.
11. The method of claim 10, wherein the test sample is whole blood, serum, plasma, blood gauze, blood sheet, fingertip blood, buccal swab, or saliva.
12. The method of claim 11, wherein the test sample is directly used as the test sample without treatment if the test sample is in a liquid state; and if the sample is a solid sample, placing the freshly collected solid sample in purified water to suspend, and taking the obtained suspension as the detection sample.
13. Use of a method for detecting multiple gene polymorphisms by hands-free direct amplification for the preparation of a kit for detecting 9 tumor gene polymorphisms, characterized in that the primer set and the probe according to claim 6, or the kit according to claim 7 or 8 are used.
14. The use according to claim 13, which comprises the step of detecting and typing the multiple site-enriched specific DNA fragments obtained in claim 9 using the primer set and probe according to claim 6 or the kit according to claim 7 or 8.
15. The use of claim 14, wherein said detecting and typing step uses fluorescence PCR, wherein the reaction system of fluorescence PCR is 10 μ L, and comprises 2 μ L of pre-amplified PCR diluted product, 10 XPCR reaction solution, 0.5U Taq DNA polymerase, dNTP with final concentration of 2.5mmol/L, and Mg with final concentration of 3.5mmol/L 2+ Oligo Mix Z, wherein Oligo Mix Z refers to: an upstream primer with a final concentration of 0.04mmol/L, a downstream primer with a final concentration of 0.4mmol/L and a probe with a final concentration of 0.1 mmol/L;
the procedure of the PCR amplification and dissolution reaction is as follows:
the first step is as follows: circulating for 1 time at 95 ℃ for 5min;
the second step is as follows: 95 ℃ for 10s,60 ℃ for 20s, and 72 ℃ for 25s; circulating for 45 times, and collecting no fluorescence;
the third step: circulating for 1 time at 95 ℃ for 1 min;
fourth step of the method comprises the following steps: fluorescence is collected at 1min at 37 ℃ and 2 ℃ per liter at 37-85 ℃;
the method for determining the type according to the TM value is as follows:
firstly: only a single high Tm value dissolution peak indicates that the SNP locus of the target sequence to be detected is completely matched with the designed probe, and the genotype is a wild homozygote;
secondly, the method comprises the following steps: only a single low Tm value dissolution peak indicates that the SNP locus of the target sequence to be detected is not matched with the designed probe, and the genotype is a mutation homozygote;
thirdly, the method comprises the following steps: meanwhile, the high Tm value and the low Tm value dissolve peaks, which shows that the SNP site of the target sequence to be detected is partially matched with the designed probe, and the genotype is a mutant heterozygote.
CN202010477198.8A 2020-05-29 2020-05-29 Primer group, probe and kit for direct amplification and detection of high-incidence tumor susceptibility gene polymorphism without taking hands, and method thereof Active CN111500735B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202010477198.8A CN111500735B (en) 2020-05-29 2020-05-29 Primer group, probe and kit for direct amplification and detection of high-incidence tumor susceptibility gene polymorphism without taking hands, and method thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202010477198.8A CN111500735B (en) 2020-05-29 2020-05-29 Primer group, probe and kit for direct amplification and detection of high-incidence tumor susceptibility gene polymorphism without taking hands, and method thereof

Publications (2)

Publication Number Publication Date
CN111500735A CN111500735A (en) 2020-08-07
CN111500735B true CN111500735B (en) 2023-02-10

Family

ID=71870450

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202010477198.8A Active CN111500735B (en) 2020-05-29 2020-05-29 Primer group, probe and kit for direct amplification and detection of high-incidence tumor susceptibility gene polymorphism without taking hands, and method thereof

Country Status (1)

Country Link
CN (1) CN111500735B (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113416782A (en) * 2021-06-11 2021-09-21 中国科学院北京基因组研究所(国家生物信息中心) Tumor-related SNP site primer composition and application

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104232774A (en) * 2014-09-17 2014-12-24 湖北维达健基因技术有限公司 Primers for detecting breast cancer susceptibility gene SNP (single nucleotide polymorphism), fluorescent probes and applications
CN108774639A (en) * 2018-05-31 2018-11-09 澳門帝傑數碼基因有限公司 A kind of fluorescent probe PCR of stereospecfic polymerization
CN108977548A (en) * 2018-08-24 2018-12-11 北京青航基因科技有限公司 SNP site combination and the application in the product of preparation detection tumor susceptibility gene
CN110628912A (en) * 2019-11-06 2019-12-31 上海韦翰斯生物医药科技有限公司 Primer and method for detecting polymorphism

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
FI20040227A (en) * 2004-02-13 2005-08-14 Jurilab Ltd Oy Procedure for detecting the risk of cancer, coronary heart disease and cerebral palsy

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104232774A (en) * 2014-09-17 2014-12-24 湖北维达健基因技术有限公司 Primers for detecting breast cancer susceptibility gene SNP (single nucleotide polymorphism), fluorescent probes and applications
CN108774639A (en) * 2018-05-31 2018-11-09 澳門帝傑數碼基因有限公司 A kind of fluorescent probe PCR of stereospecfic polymerization
CN108977548A (en) * 2018-08-24 2018-12-11 北京青航基因科技有限公司 SNP site combination and the application in the product of preparation detection tumor susceptibility gene
CN110628912A (en) * 2019-11-06 2019-12-31 上海韦翰斯生物医药科技有限公司 Primer and method for detecting polymorphism

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
高分辨率曲线法检测骨髓增殖肿瘤患者JAK2V617F基因突变;陈海华，等;《中国实验血液学杂志》;20140220;第22卷(第01期);112-116 *

Also Published As

Publication number Publication date
CN111500735A (en) 2020-08-07

Similar Documents

Publication Publication Date Title
CN107419018B (en) Method and kit for detecting gene mutation based on Blocker primer and ARMS primer
CN110527710B (en) Primer, probe and kit for detecting NTRK gene fusion mutation
CN108998505B (en) Gene polymorphism site detection technology and kit thereof
CN113913533B (en) SNP molecular marker related to grass carp characters and application thereof
CN107723354B (en) Multiplex PCR (polymerase chain reaction) primer, kit and method for detecting non-small cell lung cancer oncogene mutation based on high-throughput sequencing
CN109468377A (en) For the primer sets of antipsychotics related gene polymorphism site primer, kit and method
Orrego et al. Determination of familial relationships
CN112662760A (en) Cancer gene methylation detection system and cancer in-vitro detection method implemented in cancer gene methylation detection system
US20130096010A1 (en) HtSNPs FOR DETERMINING A GENOTYPE OF CYTOCHROME P450 1A2, 2A6 AND 2D6, PXR AND UDP-GLUCURONOSYLTRANSFERASE 1A GENE AND MULTIPLEX GENOTYPING METHODS USING THEREOF
CN113151440A (en) Kit for predicting aspirin curative effect and adverse reaction, detection method and application thereof
CN111500735B (en) Primer group, probe and kit for direct amplification and detection of high-incidence tumor susceptibility gene polymorphism without taking hands, and method thereof
CN110592217A (en) Kit for detecting KRAS gene mutation in free DNA of peripheral blood and application thereof
CN115058543A (en) Primer group and kit for identifying Delta variant strain and Omicron variant strain
CN112662762A (en) Probe composition for detecting 5 tumors of digestive tract
WO2008032921A1 (en) Htsnps for determining a genotype of cytochrome p450 1a2, 2a6 and 2d6, pxr and udp-glucuronosyltransferase 1a gene and multiplex genotyping methods using thereof
CN105177118B (en) Detect the primer and probe system and kit of Human epidermal growth factor receptor gene mutation
CN107338287B (en) Kit and method for detecting sheep BMPR-IB gene A746G mutation by Taqman-MGB probe
CN108531598B (en) ROS1 gene fusion detection primer, method and kit
CN112662763A (en) Probe composition for detecting common amphoteric cancers
CN107177688B (en) Kit for detecting deafness susceptibility gene mutation and application thereof
CN103131782B (en) Kit for detecting early stage non-small-cell lung cancer multi-site association genes
CN108660252B (en) Human immunodeficiency virus drug resistance analysis method based on pyrosequencing
CN112143815B (en) Nucleic acid composition, kit and detection method for detecting fusion mutation of human FGFR2 gene
WO2020138435A1 (en) Auxiliary diagnostic method for intraocular malignant lymphoma
CN113981072A (en) Primers, probes, kit and method for detecting HLA-A29 gene

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant