CN109486955A - It is a kind of for excrement Detection progress phase adenoma, the kit of colorectal cancer related gene methylation sites - Google Patents

It is a kind of for excrement Detection progress phase adenoma, the kit of colorectal cancer related gene methylation sites Download PDF

Info

Publication number
CN109486955A
CN109486955A CN201811636672.6A CN201811636672A CN109486955A CN 109486955 A CN109486955 A CN 109486955A CN 201811636672 A CN201811636672 A CN 201811636672A CN 109486955 A CN109486955 A CN 109486955A
Authority
CN
China
Prior art keywords
buffer
artificial sequence
dna
colorectal cancer
centrifuged
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201811636672.6A
Other languages
Chinese (zh)
Other versions
CN109486955B (en
Inventor
李有彩
林喜建
宋庆涛
郑立谋
吕唯
张慧英
秦秋平
廖乃淞
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Hangzhou Avic Biotechnology Co.,Ltd.
Original Assignee
Amoy Diagnostics Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Amoy Diagnostics Co Ltd filed Critical Amoy Diagnostics Co Ltd
Priority to CN201811636672.6A priority Critical patent/CN109486955B/en
Publication of CN109486955A publication Critical patent/CN109486955A/en
Application granted granted Critical
Publication of CN109486955B publication Critical patent/CN109486955B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/154—Methylation markers

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Pathology (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Physics & Mathematics (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Hospice & Palliative Care (AREA)
  • Biophysics (AREA)
  • Oncology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses a kind of for progressive stage adenoma, the excrement detection kit of colorectal cancer related gene multidigit point DNA methylation assay, it includes following primer and probe: SEQ ID NO:1-SEQ ID NO:131, further includes the composition for largely extracting and converting faeces DNA.Kit of the invention can be used noninvasive excrement detection intestinal cancer methylation related gene, the early screening of large intestine progressive stage adenoma, colorectal cancer patients carried out in a manner of polygene combined detection etc..It is accurate that the multiple groups of kit of the present invention close joint detection results, single group closes single tube detection, single group closes repeating pipe detection, more combinatorial association DNA methylation assay progressive stage adenoma susceptibility 62-90%, colorectal cancer susceptibility 78-100%, specific 82-100%, and overall testing cost is low compared to sigmoidoscopy expense, it can be used for carrying out the multipurposes such as colorectal cancer early screening before clinical tradition checks, avoid part subject by the detection means of the pain such as sigmoidoscope.

Description

One kind is for excrement Detection progress phase adenoma, colorectal cancer related gene methylation position The kit of point
Technical field
The invention belongs to field of medical technology, it is related to detecting the methyl of large intestine progressive stage adenoma, colorectal cancer early screening Change the kit of multidigit point joint-detection.
Background technique
In China, colorectal cancer incidence rate and the death rate are the 5th in malignant tumour, and colorectal cancer incidence rate is in Rising stage, the annual new hair colorectal cancer patients of China surpass 400,000 person-times, and annual about 200,000 people die of colorectal cancer, domestic annual Disease incidence speedup is 4.2%, higher than the 2% of world level.Colorectal cancer is early found, early treatment is to patient's prognosis, recurrence, existence Have a vital effect, I-II 5 years OS of A phase treatment of colorectal cancer 90% or more, with cancer 5 years OS of progress gradually Decline, advanced colorectal cancer treat 5 years OS and only have 13%.Colorectal cancer early symptom is unobvious, and cancer early screening realizes phase To weakness, a large amount of colorectal cancer patients exist when not feeling like oneself in view of carrying out relatively painful when sigmoidoscope etc. checks It waives the inspection, the compliance of sigmoidoscopy is poor, and most of patient has been middle and advanced stage when being diagnosed as colorectal cancer, wrong Golden hour has been spent, conditions of patients is caused further to deteriorate, has also increased patient home's successive treatment expense.
Currently, the means of hospital's conventional detection colorectal cancer are mainly sigmoidoscopy, fecal occult blood immunochemistry The means such as detection, fecal occult blood joint faeces DNA detection.And there is also numerous methylation detection kits on the market, can be used for Scientific research.
Sigmoidoscopy can be by enteron aisle microscopy intuitively with 95% or more susceptibility as goldstandard Observe the lesions such as colorectal cancer, adenoma, polyp.The inspection fee for carrying out sigmoidoscope detection is relatively high, and patient needs Time reservation sigmoidoscopy a few days ago and control 3 days or more diet are mentioned, is taken on the day before inspection and largely urges purgative prescription 3 diarrhea more than hour is carried out, needing to be passed through large quantity of air during the inspection process expands enteron aisle in order to detect, checking process In be accompanied by sense of dragging part subject and be difficult to be resistant to and need to use anesthesia means.Secondly have in detection process to testing staff Otherwise high requirement will appear the risks such as bowel perforation, missing inspection.In addition, it has missed detection risk, and proximal end for distal gut The cancers potential risk such as colon and possible missing inspection part polyp, leads to problems such as the different detection results for suffering from cancer position inconsistent. Although sigmoidoscopy is as goldstandard, its inspection requirements is high, and costly, patient's checking process is cumbersome and painful, The disadvantages of missing inspection and inconsistent testing result, is also particularly evident.
The detection of fecal occult blood immunochemistry can determine patient with the presence or absence of just hidden according to the hemoglobin content in patient's excrement Blood, with 73% colorectal cancer sensibility, there is about 30% vacation sun in this technology.This technology disturbing factor is numerous, and diet is practised Used, materials position, oral cavity bleed etc. and can directly affect final detection result.In addition, the commercially available difference of this kit is obvious, it is different The spread in performance of kit is uneven, causes testing result difference huge.
Presently commercially available fecal occult blood joint faeces DNA is detected as U.S. FDA and produces in " Cologuard " of approval in 2014 Product targetedly detect stool occult blood, Kras mutation, NDRG4/BMP3 gene methylation state, with 92.3% Colon and rectum Cancer sensibility but specificity only 86.6%.This technology also has the shortcomings that corresponding to cause to be difficult to largely to use.1. this kit is Import reagent, in terms of relative difficulty.2. this kit is directed to American population, susceptibility when detecting in Chinese population It reduces.3. this kit specificity is relatively low, a large amount of " false sun " will be generated, subject's fear mood is caused.
Methylation detection kit existing market is relative complex.Some detects 9 gene methylation of Septin using blood plasma, But sensibility about 70%, it is difficult to meet clinical requirement.Some uses high-flux sequence, detects 1000-3000 methylation sites, Susceptibility with the sigmoidoscope that can match in excellence or beauty, but kit cost is high, is unsatisfactory for the condition of a large amount of screenings.Some detections The single methylation sites of term single gene, but the problems such as sample source of people DNA concentration is relatively low, degradation is serious can not be effectively solved, Cause kit susceptibility is unstable can not form sound detection architecture.Some is low using detection means, expenses such as MS-PCR It is honest and clean, but detection method poor sensitivity, it is only applicable to the use such as institute's scientific research.
Investigation shows that most patients refuse to carry out sigmoidoscopy and the means of non-invasive screening is selected to tie Carcinoma of the rectum detection, and excrement detection of nucleic acids colorectal cancer has advantageous advantage, every gram of normal human faecal mass in non-invasive screening There are ten thousand Colonic exfoliative cells of 75-120 in sample, and the cell that adenoma, colorectal cancer patients fall off will be more.What is fallen off is normal Cell and cancer cell toward distal migration and are discharged with excreta, and during which partial exfoliation cell is ruptured during migration, released It releases DNA and degrades.
Presently commercially available fecal sample DNA methylation assay colorectal cancer kit still has more disadvantage.Detection sensitivity, spy The opposite sex is difficult to meet substitution or the function close to substitution sigmoidoscopy；Preservation, extraction and the sulfurous acid of fecal sample There are technological difficulties for hydrogen salt conversion；The detection content confusion of detection kit is without explicitly studying gene information etc.；Reagent Box testing cost remains high, and clinical value is lowered.
Summary of the invention
The main object of the present invention is to provide a kind of for progressive stage adenoma, colorectal cancer related gene multidigit point first The excrement detection kit of baseization detection, which includes the composition for largely extracting and converting faeces DNA, Yi Jiyong In Detection progress phase adenoma, the primer and probe composition of colorectal cancer related gene multidigit point DNA methylation assay, wherein described A large amount of extractions and the compositions for converting faeces DNA include: by volume
1)5-35mL Buffer SPB；
2) 50~1000 μ L Buffer SLS；
3)1-2mL Buffer SDL；
4)100-800μL Buffer DTE；
5)100-800μL Buffer BCB；
6)10-300μL Buffer DPB；
7)20-800μL Buffer DBB；
8) 500~750 μ L Buffer BDD；
9) 500~750 μ L Buffer DW1；
10) 500~750 μ L Buffer DW2；
11) 30~200 μ L Buffer DTE.
Preferably, the Buffer SPB includes 10~500mM EDTA, 10~500mM Tris, 50~500mM NaCl, 10~70% dehydrated alcohols；The Buffer SLS include 10~500mM EDTA, 10~500mM Tris, 10~ 20%SDS.
Preferably, the Buffer SDL includes 10~500mM EDTA, 10~500mM Tris, 0.5~5%PVP10 With 0.5~3.5M sodium acetate；The Buffer DTE includes 10~20mM Tris, the EDTA of 5~10mM.
Preferably, the Buffer BCB includes 10~500mM EDTA, 10~500mM Tris and 0.5~5M sulfurous acid Salt；The Buffer DPB includes 10~500mM EDTA, 10~500mM Tris, 20~1000mM hydroquinone.
Preferably, the Buffer DBB includes the different sulphur cyanogen of 10~500mM EDTA, 10~500mM Tris and 3~5.5M Sour guanidine；The Buffer BDD includes 20~400mM Tris, 20~500mM EDTA, 20~500mM NaOH, 60~100% Ethyl alcohol.
Preferably, the Buffer DW1 includes 150~400mM Tris, 40~100mM EDTA, 2~5M isothiocyanic acid Guanidine, 40~70% ethyl alcohol；The Buffer DW2 includes 300~700mM Tris, 0.8~1.2M NaCl, 70~90% second Alcohol；The Buffer DTE includes 10~20mM Tris, 5~10mM EDTA.
Preferably, the primer and probe composition includes: SEQ ID NO:1-SEQ ID NO:131.
Preferably, the primer and probe composition includes at least one of combination of table 2 or the inspection of more combinatorial associations It surveys, wherein ACTB gene is house-keeping gene:
Table 2 progressive stage adenoma, colorectal cancer detection primer probe single group information
It is further preferred that the primer and probe composition includes each combination individually detection, various combination connection Detection is closed to repeat to detect with single group conjunction.
Further, wherein ACTB gene for the extracting concentration in Quality Control extraction, conversion process and evaluates sample " yin-yang The judgment basis of property " result.
Further, the ACTB gene selects the conservative region of correlation ACTB gene, and can distinguish conversion front and back sequence Column difference.
In the present invention, the methylation related gene is tetra- genes of MAL/SDC2/TFPI2/Vimentin.
The present invention uses Colon and rectum for the promoter methylation region of tetra- genes of MAL/SDC2/TFPI2/Vimentin Cancerous tissue sample, progressive stage adenoma tissue samples, cancer beside organism's sample pass through nucleic acid extraction and bisulfite conversion, by sulfurous Sour hydrogen salt converted product ssDNA is expanded using sequencing primer, and sequencing primer amplified fragments are carried out Sanger sequencing, are determined Methylation hot spot region in each gene promoter methylation region.
For Sanger sequencing result, the first of tetra- genes of MAL/SDC2/TFPI2/Vimentin in tissue samples is determined Site in the site base hot spot CpG with hypersensitivity and specificity.
For determining tetra- gene methylation hot spot regions MAL/SDC2/TFPI2/Vimentin, design primer probe, It is tested for fluorescent PCR.
The invention avoids the inefficiency such as Magnetic bead hybridization capture, the purpose template enrichment procedures of somewhat expensive, use excrement Just the method for sample extraction progress synchronous with conversion, obtains the template DNA of higher concentration, improves pattern detection sensibility, inspection The stability of survey method.
The present invention in use, include it is a large amount of extract conversion faeces DNA step, specifically include following fecal sample and receive Collection, cracking, precipitating, bisulfite conversion, nucleic acid purification and recycling:
1. taking 5~35mL sample protection liquid SPB into centrifuge tube, then take 1~5g fresh excreta sample into pipe, sufficiently shakes Swing mixing；
2. 50~1000 μ L 20%SDS are first added, it is mixed by inversion, 50~500 μ L Proteinase Ks is added, after being mixed by inversion Set 70 DEG C of 5~30min of water-bath of thermostat water bath；
3. centrifuge tube is gone to room-temperature water bath 3min, 10000g is centrifuged 1min；
4. take 2~6mL supernatant in new centrifuge tube, 1~2mL liquid SDL that disinthibites is added and turns upside down mixing, 10000g It is centrifuged 2min；
5. take whole supernatants in new centrifuge tube, then plus 2~5mL organic solvent, mixing of turning upside down, 12000g is pre-chilled It is centrifuged 10min, abandons supernatant；
6. 100~800 μ L eluent DTE are added toward centrifuge tube, it is vortexed to mix to precipitating and scatters；
7. 12000g is centrifuged 2min, the whole liquid of absorption to centrifuge tube, then adds 100~800 μ L conversion fluids toward centrifuge tube BCB；
8. again toward centrifuge tube be added 10~300 μ L nuclease protection liquid DPB, after mixing wink from；
It is converted 9. centrifuge tube is placed in amplification instrument；
10. after completing conversion, 200~800 μ L combination liquid DBB and 300~700 μ L dehydrated alcohols are added, sufficiently oscillation is mixed It is even；
11. mixing liquid is added in purification column, 12000g is centrifuged 30s, removes liquid in collecting pipe；
12. residue is transferred in purification column, 12000g is centrifuged 30s, removes liquid in collecting pipe；
13. 500~750 μ L cleaning solution BDD are added in purification column, it is stored at room temperature 5~20min, 12000g is centrifuged 30s, Remove liquid in collecting pipe；
14. 500~750 μ L cleaning solution DW1 are added in purification column, 12000g is centrifuged 30s, removes liquid in collecting pipe；
15. 500~750 μ L cleaning solution DW2 are added in purification column, 12000g is centrifuged 30s, removes liquid in collecting pipe；
16. using new collecting pipe instead, 12000g is centrifuged 2min；
17. abandoning collecting pipe, purification column is placed in new centrifuge tube；
18. 30~200 μ L eluent DTE are carefully added dropwise on purification column film, 60 DEG C of 1~5min of incubation；
19. 12000g is centrifuged 2min, the human feces DNA after being converted.
The ssDNA recycled after purification is used into tetra- bases of colorectal cancer related gene MAL/SDC2/TFPI2/Vimentin Multiple CpG methylation sites of cause carry out joint-detection.
The present invention using preferred primer combination of probe for colorectal cancer fecal sample, progressive stage adenoma fecal sample, Healthy People fecal sample is detected, and determines the primer combination of probe detection performance of more methylation sites joint-detections.
A large amount of extractions and conversion faeces DNA composition in kit of the present invention, source of people fecal sample can be cracked, It is used for bisulfite conversion after precipitating, the ssDNA purified after conversion is directly used in more combinatorial association DNA methylation assays, Solves human source gene group content in fecal sample is relatively low, degrades in excrement the genome yield after bisulfite conversion The problem of too low, extraction obtains the higher cost of ssDNA with bisulfite conversion.
The primer and probe of kit of the present invention uses tetra- gene promoter first of SDC2/MAL/TFPI2/Vimentin The means of base joint-detection solve and detect that unstable, susceptibility is insufficient, specific in current DNA methylation assay colorectal cancer The problems such as insufficient.
1. kit of the present invention detects the fecal sample used, converted after extractable, easy to operate, quick, the sample of recycling This concentration is higher.
2. kit detection colorectal cancer of the present invention, progressive stage adenoma are low-cost.
3. kit of the present invention has very high sensitive and specificity to colorectal cancer, progressive stage adenoma.
4. kit of the present invention uses the different primers probe combinations of four genes, select various combination that can have different quick Sensitivity and specificity.
5. kit of the present invention uses the different primers probe combinations of four genes, early screening, auxiliary diagnosis can be met Etc. different demands.
Attached drawing and explanation
Fig. 1 is different sample Sanger sequencing results.
Fig. 2 is that different primers probe uses cell line sample investigation results of property.
Fig. 3 is portion of stool pattern detection result.
Specific embodiment
A specific embodiment of the invention is further illustrated by following specific embodiments
Embodiment 1
The present invention using nucleic acid extraction kit (Xiamen Ai De biological medicine Science and Technology Co., Ltd. product, article No.: ADx-FF01 c1806264) Colorectal Carcinoma sample, progressive stage adenoma tissue samples, cancer beside organism's sample progress DNA are mentioned It takes.Extraction step is as follows:
1. scraping 1~5 FFPE sample according to the size of FFPE biopsy tissues area into 1.5mL centrifuge tube, being added 1mL dimethylbenzene, oscillation mix 10s；
2. 13000 × g of room temperature is centrifuged 2min, carefully supernatant (not being drawn onto precipitating) is removed；
3. 1mL dehydrated alcohol is added, oscillation mixes 10s, and 13000 × g is centrifuged 2min at room temperature, carefully removes supernatant (not It is drawn onto precipitating)；
4. room temperature, which uncaps to place to uncap at 10min or 37 DEG C, places 5min, ethyl alcohol is made sufficiently to volatilize.
5. 180 μ L Buffer DTL and 20 μ L Proteinase K Solution are added, oscillation is mixed, 56 DEG C of digestion 1h can digest overnight if sample size is more；
6. 10 μ L Buffer DES are added, it is put into temperature after mixing and has risen in 90 DEG C of constent temperature heater, is incubated for 1h；
7. hand held centrifuge is centrifuged 5~10s.If it is desired, 2 μ L 100mg/mL RNase A can be added, it is placed at room temperature for 5min is to remove RNA；
8. 200 μ L Buffer DTB and 200 μ L dehydrated alcohols are added, oscillation mix after with hand held centrifuge centrifugation 5~ 10s；
9. whole liquid are transferred in DNA adsorption column, 10000 × g is centrifuged 1min, outwells the liquid in collecting pipe；
10. 600 μ L Buffer DW1,10000 × g centrifugation 1min are added into DNA adsorption column, outwell in collecting pipe Liquid；
11. 600 μ L Buffer DW2,10000 × g are added into DNA adsorption column is centrifuged 1min, collecting pipe is abandoned；
12. using new collecting pipe instead, 13000 × g is centrifuged 3min, abandons collecting pipe；
13. adsorption column is carefully transferred in clean 1.5mL centrifuge tube；30~100 μ L are added dropwise toward DNA absorption center membrane Buffer DTE (does not encounter DNA adsorbed film), is stored at room temperature 1~5min, and 13000 × g is centrifuged 1min, collects sample DNA and protects It deposits.
The tissue DNA sample extracted using EpiTect Fast DNA Bisulfite Kit (QIAGEN Products, Article No.: 59826) carrying out bisulfite conversion, and conversion operation is as follows:
1. the tissue samples DNA extracted is diluted to 50ng/uL；
2. by diluted sample DNA 20uL, Bisulfite Solution 85uL, DNA Protect Buffer 35uL carries out being mixed in 200uL centrifuge tube, and the concussion of hand held centrifuge mixes brief centrifugation after 15s；
Program is run 3. being placed on regular-PCR instrument: 95 DEG C of 5min, 60 DEG C of 20min, 95 DEG C of 5min, 60 DEG C of 20min, 20 DEG C save.
4. above-mentioned conversion fluid is transferred in clean 1.5mL centrifuge tube, it is anhydrous that 310uL Buffer BL, 250uL is added Ethyl alcohol, the concussion of hand held centrifuge mix brief centrifugation after 15s；
5. all of the above liquid is transferred in adsorption column, 13000g is centrifuged 1min, outwells the liquid in collecting pipe；
6. 500uL Buffer BW is added in adsorption column, 13000g is centrifuged 1min, outwells the liquid in collecting pipe；
7. 500uL Buffer BD is added in adsorption column, it is stored at room temperature 15min, 13000g is centrifuged 1min, outwells collection Liquid in pipe；
8. 500uL Buffer BW is added in adsorption column, 13000g is centrifuged 1min, outwells the liquid in collecting pipe；
9. being repeated once step 8；
10. 250uL dehydrated alcohol is added in adsorption column, 13000g is centrifuged 1min；
11. using new collecting pipe instead, sky gets rid of 13000g centrifugation 2min；
12. using 1.5mL centrifuge tube instead, 15uL Buffer EB is added dropwise toward adsorption column center membrane, is placed at room temperature for 1min, 15000g is centrifuged 1min；
13. collecting converted product ssDNA and saving.
Sequencing primer, each gene design 4-8 group sequencing primer combination are designed for the promoter CpG site of four genes The island CpG is covered, wherein the island CpG position may cover the regions such as promoter region, exon, introne.
Sequencing primer is expanded using PCR reaction system, amplified production is subjected to Sanger sequencing, sequencing result is analyzed, looks into Look for methylation hot spot site.Concrete operation step is as follows.
Colorectal Carcinoma sample, progressive stage adenoma tissue samples, cancer beside organism's sample information are as shown in Table 3-5:
3 Colorectal Carcinoma sample information of table
Table 4 progressive stage adenoma tissue sample info
5 cancer beside organism's sample information of table
Bisulfite conversion product ssDNA is expanded using following PCR reaction system:
Organize nucleic acid ssDNA:20-80ng
5 × PCR Buffer:5-10uL
MgCL2:1-8mmol
DNTP:0.1-0.8mmol
Taq archaeal dna polymerase: 1-5U
Upstream sequencing primer: 0.1-0.8umol
Upstream sequencing primer: 0.1-0.8umol
Moisturizing is to total system: 25-50uL
Regular-PCR instrument expands tissue samples, and it is as follows to detect each gene methylation program:
First stage: 95 DEG C of 5min
Second stage: 95 DEG C of 30s, 55 DEG C of 30s, 72 DEG C of 30s, 40 circulations
Sequencing primer amplified production is subjected to Sanger sequencing, summarizes sequencing result, finds the hot spot that methylates in four genes Region, and methylation level is relatively low in cancer beside organism, sequencing result is as follows, wherein "MThe position C " is to suggest carrying out Detect colorectal cancer methylation sites:
When analysis of methylation Sanger sequencing result, according to " C " base in the site CpG in sequencing result peak figure and " T " The presence or absence of base determines whether to methylate, and determines methylation ratio according to " C " base accounting low with the peak height of " T " base Just.Each methylation sites susceptibility is carried out there are situation with " C " in the macroscopic site CpG and specificity counts, Determine the discrimination of each site methylation and different type sample.
Wherein Colorectal Carcinoma susceptibility 74% in MAL gene order, progressive stage adenoma tissue susceptibility 86%, by cancer Tissue specificity 92%, "MC " methylation hot spot site is as follows:
MCGTTMCGTAGMCGGGGTTTMCGAAGAGGTTTAGGGMCGGTGTTMCGMCGGMCGTTMCGGGTMCGGGTTTTTM CGGGGMCGTGGGGMCGGGGGGMCGGGGTTGGGMCGGMCGGTMCGGGGTTTTTTTTTTTTTTGTTTMCGGGTTTTTTTGT TTTTAATTMCGMCGMCGMCGGGGGMCGTTTAGGTTATTGGGTTTMCGMCGGAGTTAGMCGAGAGGTTTGMCGMCGGAGTT TGAGMCGGMCGTTMCGTTTMCGTTTTAAGGTMCGAMCGTTAGTAMCGTMCGTTATGGTTTTMCGTAGMCGGMCGAMCGGGG GGTAGTATTTTGTTTAGTGG
Wherein Colorectal Carcinoma susceptibility 84%, progressive stage adenoma tissue susceptibility 84%, cancer in SDC2 gene order Other tissue specificity 98%, "MC " methylation hot spot site is as follows:
TAGGAGTTTTGGTTTGTMCGGTGAGTAGAGTMCGGMCGTAGTTATAGMCGMCGGAGTMCGMCGGMCGTTTAT TGGTTTTMCGGAGTTGTTAATMCGGMCGTGTAATTTTGTAGGAATTTTTTTCGGGTTTATTTGGGAGTTATATTGTCG TTTTTTTTTTTTAGTCGTTTAGGGGAGTTCGGAGAAGTAGGTTTAGGAGGGAGGGAGTTAGAGGAAAAGAAGAGGAG GAGAAGGAGGAGGATTCGGGGAGGGAGGCGCGGCGCGGGAGGAGGAGGGGCGTAGTCGCGGAGTTAGTGGTTTCGTT TGGACGCGTTGTTTTTTAGATATTTTMCGGAGTTTTAGTMCGMCGMCGGATMCGMCGMCGTTTTMCGTMCGTTTTGTTTT TAAATTTTTGTMCGTAGTTTTTTTTTAAGTTAGMCGAATTTATTTTTTAAAATTAGAAATTGAATTTMCGGTAMCGGG AAAGGAGTTMCGMCGGAGGAGTAAAATTATAGTAGAGTAAGAAGAGTTTTAGAGAGTAGTTTTTTCGGAGTATTAATT TCGTGTCGGGAGTGTAGAAATTAATAAGTGAGAGGGMCGTMCGMCGTTTTMCGGGGMCGTAGTTGMCGGGMCGGMCGGGA GTAGGMCGTAGGAGGAGGAAGMCGAGMCGTTTTMCGAGTTTMCGAGTTMCGAGTTTTMCGAGTTTGAGTMCGTAATMCGT TGMCGGTATTTTGTTTMCGGATTMCGTGTGMCGMCGGGTTGMCGTMCGAGMCGTTGGGTAGGAGGTTTMCGTTTTGTTTT GGTTGTAAGTAGMCGGTTGGGAGTAGTMCGGTTTTTGGGGAATATGMCGGMCGMCGMCGTGGATTTTGTTTATTTTGGG TTTGGTGGTTTGMCGTGTMCGGMCGGAGTMCGGTGAGTGGGTTAGGMCGGAGGATGMCGMCGMCGTT
Wherein Colorectal Carcinoma susceptibility 90%, progressive stage adenoma tissue susceptibility 96%, cancer in TFPI2 gene order Other tissue specificity 100%, "MC " methylation hot spot site is as follows:
MCGMCGGGGGMCGGMCGGGGTGATAGTTTTMCGTGTATGAATTAGTTATTTTTTAGGTTTMCGTTTMCGGMC GGGGGTMCGGTMCGGAMCGTTMCGTTTMCGTATAAAGMCGGGTATTMCGGGTMCGTTTGGAGTAGAAAGTMCGMCGTATT TTTTTTMCGTTAGGMCGTTTTTTMCGGAMCGTTTTGTTTAGMCGGGTMCGTTMCGATTTTTTGTATTATGGATTTMCGTTMCGTTTTTTGGGGTTGT
Wherein Colorectal Carcinoma susceptibility 86%, progressive stage adenoma tissue susceptibility in Vimentin gene order 80%, cancer beside organism's specificity 96%, "MC " methylation hot spot site is as follows:
GTTGGGATGGTAGTGGGAGGGGATTTTTTTTTTTAAMCGGGGTTATAAAAATAGMCGTTTTMCGGMCGGG GTTTAGTTTTTTGTTATTTTMCGTTTMCGAGGTTTTMCGMCGTTAGAGAMCGTAGTMCGMCGTTTTTATTATTTATATT TATMCGMCGTTTTMCGTTMCGTTTTTTTTTMCGGGAGTTAGTTMCGMCGTTATMCGTMCGTMCGTTTAGGTTATMCGTTAT TTTTMCGTAGTTATGTTTATTAGGTTMCGTGTTTTMCGTTTTTTTATMCGTAGGATGTTMCGGMCGGTTMCGGGTATMCGMCGAGTMCGGTMCGAGTTTTAGTMCGGAGTTAMCGTGATTAMCGTTTATTMCGTATTTATAGTTTGGGTAGMCGMCGTTGMCGTTTTAGTATTAGT
Embodiment 2
For tetra- gene promoter methylation region design primer probes of MAL/SDC2/TFPI2/Vimentin, primer Probe location is for methylation hot spot region key design, the design primer probe sequence SEQ ID described in embodiment 1 NO.1-131 is as shown in table 6:
6 primed probe information of table
Use nucleic acid extraction kit (Xiamen Ai De biological medicine Science and Technology Co., Ltd. product, article No.: ADx-TI01 C1814560 DNA extraction) is carried out to colorectal cancer cell system HCT15/HCT116, extracts DNA shown in steps are as follows:
1. taking 20-60mg cell line sample that 1mL physiological saline is added, concussion is mixed, and 1200g is centrifuged 2min, careful to remove Supernatant；
2. 180uL Buffer DTL is added, 20uL Proteinase K Solution is added, concussion mixes, and 56 DEG C disappear Change to limpider lysate is obtained, can digest overnight；
3. taking out sample cell, 5-10s is centrifuged with hand held centrifuge；
4. 200uL Buffer DTB and 200uL dehydrated alcohol is added, concussion uses hand held centrifuge to be centrifuged 5- after mixing 10s。
5. whole liquid are transferred in DNA adsorption column, 8000g is centrifuged 1min, outwells the liquid in collecting pipe；
6. 600uL Buffer DW1 is added into DNA adsorption column, 8000g is centrifuged 1min, outwells the liquid in collecting pipe；
7. 600uL Buffer DW2 is added into DNA adsorption column, 8000g is centrifuged 1min, outwells the liquid in collecting pipe；
8. using new collecting pipe instead, 12000g is centrifuged 3min, abandons collecting pipe；
9. adsorption column is carefully transferred in clean 1.5mL centrifuge tube, 100uL is added dropwise toward DNA adsorption column center membrane Buffer DTE is stored at room temperature 1-5min, and 12000g is centrifuged 1min, collects sample DNA and saves.
The cell line dna sample extracted is used into EpiTect Fast DNA Bisulfite Kit (QIAGEN company Product, article No.: 59826) carrying out bisulfite conversion, and bisulfite conversion is shown in steps are as follows:
1. the tissue samples DNA extracted is diluted to 50ng/uL；
2. by diluted sample DNA 20uL, Bisulfite Solution 85uL, DNA Protect Buffer 35uL carries out being mixed in 200uL centrifuge tube, and the concussion of hand held centrifuge mixes brief centrifugation after 15s；
Program is run 3. being placed on regular-PCR instrument: 95 DEG C of 5min, 60 DEG C of 20min, 95 DEG C of 5min, 60 DEG C of 20min, 20 DEG C save.
4. above-mentioned conversion fluid is transferred in clean 1.5mL centrifuge tube, it is anhydrous that 310uL Buffer BL, 250uL is added Ethyl alcohol, the concussion of hand held centrifuge mix brief centrifugation after 15s；
5. all of the above liquid is transferred in adsorption column, 13000g is centrifuged 1min, outwells the liquid in collecting pipe；
6. 500uL Buffer BW is added in adsorption column, 13000g is centrifuged 1min, outwells the liquid in collecting pipe；
7. 500uL Buffer BD is added in adsorption column, it is stored at room temperature 15min, 13000g is centrifuged 1min, outwells collection Liquid in pipe；
8. 500uL Buffer BW is added in adsorption column, 13000g is centrifuged 1min, outwells the liquid in collecting pipe；
9. being repeated once step 8；
10. 250uL dehydrated alcohol is added in adsorption column, 13000g is centrifuged 1min；
11. using new collecting pipe instead, sky gets rid of 13000g centrifugation 2min；
12. using 1.5mL centrifuge tube instead, 15uL Buffer EB is added dropwise toward adsorption column center membrane, is placed at room temperature for 1min, 15000g is centrifuged 1min；
13. collecting converted product ssDNA and saving.
SsDNA after conversion detects different primers probe amplification performance using PCR reaction system, determines each combination thin Amplification efficiency in born of the same parents system sample, PCR amplification system are as follows:
Cell line nucleic acid ssDNA:20-80ng
5 × PCR Buffer:5-10uL
MgCL2:1-8mmol
DNTP:0.1-0.8mmol
Taq archaeal dna polymerase: 1-5U
Upstream amplification primer: 0.1-0.8umol
Upstream amplification primer: 0.1-0.8umol
PCR detection probe: 0.1-0.8umol
Moisturizing is to total system: 25-50uL
Fluorescent PCR instrument amplifying cells system sample, it is as follows to detect each gene primer probe capability process:
First stage: 95 DEG C of 5min
Second stage: 95 DEG C of 30s, 65 DEG C of 30s, 72 DEG C of 30s, 15 circulations
Phase III: 95 DEG C of 30s, 60 DEG C of 30s, 72 DEG C of 30s, 30 circulations, 60 DEG C of whens, collect fluorescence signal
In experimental result, following primed probe has excellent amplification efficiency using cell line sample, can normally expand Primed probe has good " S " type amplification curve, and amplification purpose section that can be specific, and amplification curve diagram is shaped like Fig. 2 institute Show, more excellent primer probe sequence is as shown in table 7:
The excellent primed probe information of 7 amplification efficiency of table
Embodiment 3
Relatively directly using QIAamp Fast DNA Stool Mini Kit, (article No.: 51604) QIAGEN product is extracted After fecal sample DNA, EpiTect Fast DNA Bisulfite Kit (QIAGEN Products, article No.: 59826) are reused Bisulfite conversion is carried out, completes extraction, bisulfite conversion, washing purifying and recycling during the extraction process with the present invention Two kinds of sample process modes.Concentration of specimens is detected using Quantus, detects different sample extractions and Asia using PCR reaction system Sample yield after disulfate conversion.Compare respective advantage and disadvantage, concrete operation step is as follows.
Bisulfite conversion method is carried out again after first extracting faeces DNA: first using QIAamp Fast DNA Stool Mini Kit (QIAGEN product, article No.: 51604) extracting fecal sample DNA, and extraction operation is as follows:
1. taking 1g fecal sample in 10mL InhibitEx Buffer in 15mL indigo plant lid centrifuge tube, concussion instrument concussion 1min；
2. taking 2mL suspension into 5mL centrifuge tube, centrifuge 12000rpm 1min；
3. taking supernatant to be divided into two 2.0mL EP pipes, respectively 600uL；
4. two 600uL centrifuged supernatants are separately added into 25uL Proteinase K, addition 600uL Buffer AL concussion mixes Even, brief centrifugation；
5. 56 DEG C of cracking 10min, pyrolysis product is transferred in 2mL centrifuge tube；
6. 600uL dehydrated alcohol is added into pyrolysis product, concussion mixing, brief centrifugation；
7. taking above two products same centrifugal column excessively, each 700uL, 13000rpm 1min；
8. using 500uL Buffer AW1,13000rpm 1min.Use new collecting pipe instead；
9. using 500uL Buffer AW2,13000rpm 3min.Use new collecting pipe instead；
10. sky gets rid of 13000rpm 3min.Collecting pipe is replaced using EP pipe；
11. using 50uL purified water eluted product, 13000rpm 1min after 5min is stood；
Product is extracted 12. collecting, is saved, for use.
Reusing EpiTect Fast DNA Bisulfite Kit, (article No.: 59826) QIAGEN Products carry out sub- Disulfate conversion, the sample ssDNA after obtaining final bisulfite conversion, operating procedure are as follows:
1. the tissue samples DNA extracted is diluted to 50ng/uL；
2. by diluted sample DNA 20uL, Bisulfite Solution 85uL, DNA Protect Buffer 35uL carries out being mixed in 200uL centrifuge tube, and the concussion of hand held centrifuge mixes brief centrifugation after 15s；
Program is run 3. being placed on regular-PCR instrument: 95 DEG C of 5min, 60 DEG C of 20min, 95 DEG C of 5min, 60 DEG C of 20min, 20 DEG C save.
4. above-mentioned conversion fluid is transferred in clean 1.5mL centrifuge tube, it is anhydrous that 310uL Buffer BL, 250uL is added Ethyl alcohol, the concussion of hand held centrifuge mix brief centrifugation after 15s；
5. all of the above liquid is transferred in adsorption column, 13000g is centrifuged 1min, outwells the liquid in collecting pipe；
6. 500uL Buffer BW is added in adsorption column, 13000g is centrifuged 1min, outwells the liquid in collecting pipe；
7. 500uL Buffer BD is added in adsorption column, it is stored at room temperature 15min, 13000g is centrifuged 1min, outwells collection Liquid in pipe；
8. 500uL Buffer BW is added in adsorption column, 13000g is centrifuged 1min, outwells the liquid in collecting pipe；
9. being repeated once step 8；
10. 250uL dehydrated alcohol is added in adsorption column, 13000g is centrifuged 1min；
11. using new collecting pipe instead, sky gets rid of 13000g centrifugation 2min；
12. using 1.5mL centrifuge tube instead, 15uL Buffer EB is added dropwise toward adsorption column center membrane, is placed at room temperature for 1min, 15000g is centrifuged 1min；
13. collecting converted product ssDNA and saving.
The bisulfite conversion product ssDNA of collection is dense using the ssDNA detection kit progress nucleic acid of Quantus Degree is quantitative, measures production concentration Cq value using fluorescent PCR instrument.
Carry out fecal sample cracking precipitating DNA after directly carry out bisulfite conversion method: disposably from fecal sample into The DNA that row protection, cracking, precipitating obtain is directly used in bisulfite conversion, and then the ssDNA after being converted.Carry out sample The Quality Control of this DNA concentration.The extraction for carrying out fecal sample using following steps is synchronous with bisulfite conversion to be carried out:
1. taking 6mL Buffer SPB (50mM EDTA, 50mM Tris, 100mM NaCl, 30% dehydrated alcohol) to centrifugation Guan Zhong, then take 1g fecal sample into pipe, sufficiently oscillation mixes；
2. 500 μ L Buffer SLS (50mM EDTA, 50mM Tris, 20%SDS) are first added, it is mixed by inversion, adds 50 μ L Proteinase Ks are mixed by inversion 70 DEG C of water-bath 10min of postposition thermostat water bath；
3. centrifuge tube is gone to room-temperature water bath 3min, 10000g is centrifuged 1min；
4. taking 5mL supernatant in new centrifuge tube, 1mL Buffer SDL (50mM EDTA, 50mM Tris, 2% is added PVP10 and 1M sodium acetate) mixing of turning upside down, 10000g centrifugation 2min；
5. take whole supernatants in new centrifuge tube, then plus 3mL isopropanol, mixing of turning upside down, 12000g centrifugation 10min abandons supernatant；
6. 250 μ L Buffer DTE (20mM Tris, 10mM EDTA) is added toward centrifuge tube, being vortexed to mix to precipitating dissipates It opens；
7.12000g is centrifuged 2min, the whole liquid of absorption to centrifuge tube, then adds 500 μ L Buffer BCB toward centrifuge tube；
8. 50 μ L Buffer DPB (50mM EDTA, 50mM Tris, 100mM hydroquinone) are added toward centrifuge tube again, mix It is even after wink from；
It is converted 9. centrifuge tube is placed in amplification instrument；
10. after completing conversion, 600 μ L Buffer DBB (50mM EDTA, 50mM Tris and 4.5M isothiocyanic acids are added Guanidine) and 600 μ L dehydrated alcohols, sufficiently oscillation mixing；
11. mixing liquid is added in purification column, 12000g is centrifuged 30s, removes liquid in collecting pipe；
12. remaining liq is fully transferred in purification column, 12000g is centrifuged 30s, removes liquid in collecting pipe；
13. 700 μ L Buffer BDD (50mM Tris, 50mM EDTA, 50mM NaOH, 90% ethyl alcohol) Yu Chunhua is added In column, it is stored at room temperature 15min, 12000g is centrifuged 30s, removes liquid in collecting pipe；
14. be added 700 μ L Buffer DW1 (50mM Tris, 50mM EDTA, 2M guanidinium isothiocyanate, 50% ethyl alcohol) in In purification column, 12000g is centrifuged 30s, removes liquid in collecting pipe；
15. 700 μ L Buffer DW2 (50mM Tris, 0.8M NaCl, 80% ethyl alcohol) is added in purification column, 12000g is centrifuged 30s, removes liquid in collecting pipe；
16. using new collecting pipe instead, 12000g is centrifuged 2min；
17. abandoning collecting pipe, purification column is placed in new centrifuge tube；
18. 50 μ L Buffer DTE (20mM Tris, 10mM EDTA) is added dropwise on purification column film, 60 DEG C of incubation 2min；
19. 12000g is centrifuged 2min, the human feces DNA after being converted.
The bisulfite conversion product ssDNA of collection is dense using the ssDNA detection kit progress nucleic acid of Quantus Degree is quantitative, measures production concentration Cq value using fluorescent PCR instrument.
Compare two kinds obtain bisulfite conversions after product ssDNA Quality Control data it is as shown in table 8:
Table 8 is different to obtain product methods experiment result
Compare two kinds obtain bisulfite conversions after ssDNA method as a result, wherein using Quantus ssDNA examine Test agent box carries out sample and recycles concentration Quality Control, in which: first extracts the method that DNA carries out bisulfite conversion again and obtains 10 Sample final concentration mean value 30.4ng/uL, qPCR detect Cq mean value 19.54；Carry out fecal sample cracking, precipitating DNA after directly into Row bisulfite conversion method obtains 10 sample final concentration mean values 76.5ng/uL, qPCR and detects Cq mean value 16.67.Use Directly carrying out bisulfite conversion method after fecal sample cracking, precipitating DNA can get a greater amount of DNA total amounts, compared to tradition The method of ssDNA after being converted have many advantages, such as it is easy, quick, efficient, and compare Streptavidin MagneSphere hybrid capture Extraction expense can be reduced to 1/5 hereinafter, even 1/10 or less by method.It can reduce subject's financial burden, to by fecal sample It detects colorectal cancer methylating reagent box and provides economic support for early sieve.
Embodiment 4
Colorectal cancer fecal sample, large intestine progressive stage adenoma fecal sample, Healthy People fecal sample are cracked, precipitated Bisulfite conversion method is directly carried out after DNA, and ssDNA after the bisulfite conversion of acquisition is subjected to fluorescent PCR detection, behaviour Make shown in steps are as follows:
1. 5~35mL sample is taken to protect liquid SPB (10~500mM EDTA, 10~500mM Tris, 50~500mM NaCl, 10~70% dehydrated alcohols) into centrifuge tube, then take 1~5g fresh excreta sample into the pipe of protection liquid, sufficiently vibrate It mixes；
2. 50~1000 μ L 20%SDS are first added, it is mixed by inversion, 50~500 μ L Proteinase Ks is added, after being mixed by inversion Set 70 DEG C of 5~30min of water-bath of thermostat water bath；
3. centrifuge tube is gone to room-temperature water bath 3min equilibrium at room temperature, 10000g is centrifuged 1min；
4. take 2~6mL supernatant in new centrifuge tube, 1~2mL is added and disinthibites liquid SDL (10~500mM EDTA, 10 ~500mM Tris, 0.5~5%PVP10 and 0.5~3.5M sodium acetate) mixing of turning upside down, 10000g centrifugation 2min；
5. take whole supernatants in new centrifuge tube, then plus 2~5mL pre-cooling organic solvent (isopropanol or ethyl alcohol), up and down It is mixed by inversion, 12000g is centrifuged 10min, abandons supernatant；
6. 100~800 μ L eluent DTE (10~20mM Tris, 5~10mM EDTA) is added toward centrifuge tube, it is vortexed mixed It is even to scatter to precipitating；
7. 12000g is centrifuged 2min, the whole liquid of absorption to centrifuge tube, then adds 100~800 μ L conversion fluids toward centrifuge tube BCB (10~500mM EDTA, 10~500mM Tris and 0.5~5M sulphite, at least containing sodium sulfite, sodium hydrogensulfite, One of magnesium bisulfite, sodium pyrosulfite and ammonium bisulfite, pH value of solution 4.0~7.0)；
8. again toward centrifuge tube be added 10~300 μ L nuclease protection liquid DPB (10~500mM EDTA, 10~500mM Tris, 20~1000mM hydroquinone), after mixing wink from；
It is converted 9. centrifuge tube is placed in amplification instrument；
10. complete conversion after, be added 200~800 μ L combination liquid DBB (10~500mM EDTA, 10~500mM Tris and 3~5.5M guanidinium isothiocyanate) and 300~700 μ L dehydrated alcohols, sufficiently oscillation mixing；
11. mixing liquid is added in purification column, 12000g is centrifuged 30s, removes liquid in collecting pipe；
12. residue is transferred in purification column, 12000g is centrifuged 30s, removes liquid in collecting pipe；
13. 500~750 μ L cleaning solution BDD (20~400mM Tris, 20~500mM EDTA, 20~500mM are added NaOH, 60~100% ethyl alcohol) in purification column, it is stored at room temperature 5~20min, 12000g is centrifuged 30s, removes liquid in collecting pipe Body；
14. 500~750 μ L cleaning solution DW1 (the different sulphur cyanogen of 150~400mM Tris, 40~100mM EDTA, 2~5M are added Sour guanidine, 40~70% ethyl alcohol) in purification column, 12000g is centrifuged 30s, removes liquid in collecting pipe；
15. 500~750 μ L cleaning solution DW2 (300~700mM Tris, 0.8~1.2M NaCl, 70~90% second are added Alcohol) in purification column, 12000g is centrifuged 30s, removes liquid in collecting pipe；
16. using new collecting pipe instead, 12000g is centrifuged 2min；
17. abandoning collecting pipe, purification column is placed in new centrifuge tube；
18. 30~200 μ L eluent DTE (10~20mM Tris, 5~10mM EDTA) is carefully added dropwise in purification column film On, 60 DEG C of 1~5min of incubation；
19. 12000g is centrifuged 2min, the human feces DNA after being converted.
The primer combination of probe selected in embodiment 2 is detected using fluorescent PCR method, wherein sample information such as table 9-11 institute Show:
9 colorectal cancer fecal sample information of table
Table 10 progressive stage adenoma fecal sample information
11 intestinal cancer specificity crowd's fecal sample information of table
The above colorectal cancer fecal sample, progressive stage adenoma fecal sample, intestinal cancer specific human are detected using fluorescent PCR method Group's group's fecal sample, PCR reaction system are as follows:
Colorectal cancer, progressive stage adenoma, intestinal cancer specificity crowd's group's fecal sample ssDNA:20-80ng
5 × PCR Buffer:5-10uL
MgCL2:1-8mmol
DNTP:0.1-0.8mmol
Taq archaeal dna polymerase: 1-5U
Upstream amplification primer: 0.1-0.8umol
Upstream amplification primer: 0.1-0.8umol
PCR detection probe: 0.1-0.8umol
Moisturizing is to total system: 25-50uL
Fluorescent PCR instrument amplifying cells system sample, it is as follows to detect each gene primer probe capability process:
First stage: 95 DEG C of 5min
Second stage: 95 DEG C of 30s, 65 DEG C of 30s, 72 DEG C of 30s, 15 circulations
Phase III: 95 DEG C of 30s, 60 DEG C of 30s, 72 DEG C of 30s, 30 circulations.Fluorescence signal is collected at 60 DEG C.
Using the primer combination of probe filtered out carry out detection colorectal cancer fecal sample, progressive stage adenoma fecal sample, Intestinal cancer specificity crowd's group's fecal sample carries out fluorescent PCR detection after extracting conversion, by every group of purpose methylation related gene inspection It surveys combination Cq value and subtracts the ACTB genetic test Cq value of the sample to obtain the Δ Cq value of various combination, with the cut- of different Δ Cq Off value determine the detection performance of different genes, and testing result is as shown in Figure 3.Following list combine detection knot in testing result Fruit is more excellent, and testing result is as Table 12-13:
12 single group of table closes primed probe single tube and detects fecal sample performance information
13 single group of table closes primed probe and repeats 2 pipes detection fecal sample performance information
4 assortment of genes colorectal cancer fecal samples, progressive stage adenoma fecal sample, intestinal cancer specificity crowd's excrement sample This, when closing joint-detection using multiple groups, testing result is as shown in table 14-16:
14 liang of combination primed probes of table detect fecal sample performance
Table 15 3 combines primed probe and detects fecal sample performance
Table 16 4 combines primed probe and detects fecal sample performance
There is detection sensitivity when combining much higher, but specificity has decline to show simultaneously.
Sequence table
<110>Xiamen Ai De biological medicine Science and Technology Co., Ltd.
<120>a kind of for excrement Detection progress phase adenoma, the kit of colorectal cancer related gene methylation sites
<160> 131
<170> SIPOSequenceListing 1.0
<210> 1
<211> 22
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 1
cgtttaggtt attgggtttc gc 22
<210> 2
<211> 19
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 2
ttaggttatt gggtttcgc 19
<210> 3
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 3
cgggggcgtt taggttattg 20
<210> 4
<211> 19
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 4
cgagaggttt gcgcggagt 19
<210> 5
<211> 19
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 5
gagttagcga gaggtttgc 19
<210> 7
<211> 19
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 7
tgggtttcgc ggagttagc 19
<210> 8
<211> 24
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 8
cgttcgtttc gttttaaggt cgac 24
<210> 9
<211> 22
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 9
gcgttcgttt cgttttaagg tc 22
<210> 10
<211> 21
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 10
cgttcgtttc gttttaaggt c 21
<210> 11
<211> 14
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 11
cgagaggttt gcgc 14
<210> 12
<211> 14
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 12
cgaaacgaac gccg 14
<210> 13
<211> 16
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 13
cgtcgttatg gttttc 16
<210> 14
<211> 17
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 14
gaacgccgct caaactc 17
<210> 15
<211> 21
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 15
cttaaaacga aacgaacgcc g 21
<210> 16
<211> 22
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 16
acgtcgacct taaaacgaaa cg 22
<210> 17
<211> 21
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 17
cataacgacg tactaacgtc g 21
<210> 18
<211> 25
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 18
aaaccataac gacgtactaa cgtcg 25
<210> 19
<211> 24
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 19
gaaaaccata acgacgtact aacg 24
<210> 20
<211> 17
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 20
actacccccc gtcgccg 17
<210> 21
<211> 21
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 21
acaaaatact accccccgtc g 21
<210> 22
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 22
accactaaac aaaatactac 20
<210> 23
<211> 19
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 23
gtcggtgagt agagtcggc 19
<210> 24
<211> 18
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 24
tcggtgagta gagtcggc 18
<210> 25
<211> 23
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 25
cgcgttgttt tttagatatt ttc 23
<210> 26
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 26
cgcgttgttt tttagatatt 20
<210> 27
<211> 16
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 27
gtcgcgtttt cggggc 16
<210> 28
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 28
tgagagggcg tcgcgttttc 20
<210> 29
<211> 21
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 29
attaataagt gagagggcgt c 21
<210> 30
<211> 19
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 30
gtaggaggag gaagcgagc 19
<210> 31
<211> 23
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 31
cgagtttgag tcgtaatcgt tgc 23
<210> 32
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 32
gtttgagtcg taatcgttgc 20
<210> 33
<211> 23
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 33
cgagtttgag tcgtaatcgt tgc 23
<210> 34
<211> 26
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 34
cgtggatttt gtttattttg ggtttg 26
<210> 35
<211> 22
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 35
cgcgtggatt ttgtttattt tg 22
<210> 36
<211> 22
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 36
cgttgttcgt tggcgttatt tc 22
<210> 37
<211> 21
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 37
agaaaagcgt tgttcgttgg c 21
<210> 38
<211> 13
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 38
cgcgactccg cgc 13
<210> 39
<211> 13
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 39
tccgcgcgac taa 13
<210> 40
<211> 13
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 40
ctcccgccgc ccg 13
<210> 41
<211> 16
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 41
cgaaaactcg aactcg 16
<210> 42
<211> 15
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 42
cggattcgtg tgcgc 15
<210> 43
<211> 13
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 43
tgcgtgtcgg cgg 13
<210> 44
<211> 13
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 44
ttcccgcgaa ccg 13
<210> 45
<211> 23
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 45
acaactccga aaaccaataa acg 23
<210> 46
<211> 18
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 46
cgccgattaa caactccg 18
<210> 47
<211> 21
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 47
acaaaacgac gaaaacgcgc g 21
<210> 48
<211> 25
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 48
atttaaaaac aaaacgacga aaacg 25
<210> 49
<211> 19
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 49
acgctcgctt cctcctcct 19
<210> 50
<211> 19
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 50
cgaaactcga aaacgctcg 19
<210> 51
<211> 22
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 51
acaaaatacc gcaacgatta cg 22
<210> 52
<211> 25
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 52
gaaacaaaat accgcaacga ttacg 25
<210> 53
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 53
acgaaacctc ctacccaacg 20
<210> 54
<211> 19
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 54
tcctacccaa cgctcgacg 19
<210> 55
<211> 23
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 55
ctacttacaa ccaaaacaaa acg 23
<210> 56
<211> 19
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 56
tcctccgcct aacccactc 19
<210> 57
<211> 25
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 57
cgactaaacc aaaccgcaat tctcg 25
<210> 58
<211> 22
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 58
cctctacgac taaaccaaac cg 22
<210> 59
<211> 16
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 59
cgtttcggcg ggggtc 16
<210> 60
<211> 16
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 60
gtttcggtgg gggtcg 16
<210> 61
<211> 22
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 61
attttttagg tttcgtttcg gc 22
<210> 62
<211> 19
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 62
agttattttt taggtttcg 19
<210> 63
<211> 21
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 63
ttatttttta ggtttcgttt c 21
<210> 64
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 64
acgttcgttt cgtataaagc 20
<210> 65
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 65
gtcggtcgga cgttcgtttc 20
<210> 66
<211> 19
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 66
cggtcggatg ttcgtttcg 19
<210> 67
<211> 22
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 67
gggtcggtcg gatgtttgtt tc 22
<210> 68
<211> 17
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 68
gggggtcggt cggacgt 17
<210> 69
<211> 22
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 69
gggtattcgg gtcgtttgga gt 22
<210> 70
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 70
cgggtatttg ggtcgtttgg 20
<210> 71
<211> 24
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 71
tcgtataaag cgggtattcg ggtc 24
<210> 72
<211> 18
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 72
agcgggtatt tgggtcgt 18
<210> 73
<211> 23
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 73
cgtataaagt gggtattcgg gtc 23
<210> 74
<211> 22
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 74
agtgggtatt tgggtcgttt gg 22
<210> 75
<211> 19
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 75
cgttcgtttc gtataaagc 19
<210> 76
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 76
tggttcgttg cgtttttttc 20
<210> 77
<211> 21
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 77
cggggtttta tggttcgttg c 21
<210> 79
<211> 23
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 79
tcgattttgt tgtttttttt gac 23
<210> 81
<211> 27
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 81
tgtttaggag ttaataggta tttggtc 27
<210> 82
<211> 22
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 82
tcgttttttt taggtttttg tc 22
<210> 83
<211> 15
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 83
cggacgttcg tttcg 15
<210> 84
<211> 14
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 84
ctccaaacga cccg 14
<210> 85
<211> 16
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 85
cgcgtatttt ttttcg 16
<210> 86
<211> 16
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 86
cttctctccc caaccg 16
<210> 87
<211> 15
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 87
aggttgtatt gggcg 15
<210> 88
<211> 14
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 88
cggagagggc gtag 14
<210> 89
<211> 15
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 89
tcccccctac caacg 15
<210> 90
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 90
ccaaacgacc cgaatacccg 20
<210> 91
<211> 21
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 91
cgcgactttc tactccaaac g 21
<210> 92
<211> 17
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 92
tctactccaa acgaccc 17
<210> 93
<211> 22
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 93
acgcctaacg aaaaaaaata cg 22
<210> 94
<211> 28
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 94
gaaaaaacgc ctaacgaaaa aaaatacg 28
<210> 95
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 95
acaaaacgtc cgaaaaaacg 20
<210> 96
<211> 24
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 96
ctaaacaaaa cgtccgaaaa aacg 24
<210> 97
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 97
cccgctaaac aaaacgtccg 20
<210> 98
<211> 22
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 98
gacccactaa acaaaacgtc cg 22
<210> 99
<211> 19
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 99
accaacaaat atctaaccg 19
<210> 100
<211> 24
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 100
acgaccaaat acctattaac tcct 24
<210> 101
<211> 27
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 101
cgattaaaaa aaaaaactcc taaaacg 27
<210> 102
<211> 24
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 102
acgcctacac gaaaccccat aacc 24
<210> 103
<211> 25
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 103
acgaaactta aaaaacgcct acacg 25
<210> 104
<211> 22
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 104
aaattctatc cccttccgaa cg 22
<210> 105
<211> 24
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 105
ccttccgaac gaaaaaacct ctac 24
<210> 106
<211> 22
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 106
ggaggggatt ttttttttta ac 22
<210> 107
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 107
gatggtagtg ggaggggatt 20
<210> 108
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 108
ttgggatggt agtgggaggg 20
<210> 109
<211> 30
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 109
gtttttatta tttatattta tcgcgttttc 30
<210> 110
<211> 27
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 110
cgcgttttta ttatttatat ttatcgc 27
<210> 111
<211> 21
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 111
tcgcgttaga gacgtagtcg c 21
<210> 112
<211> 17
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 112
aggatgttcg gcggttc 17
<210> 113
<211> 19
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 113
ttatcgtagg atgttcggc 19
<210> 114
<211> 25
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 114
aggttcgtgt tttcgttttt ttatc 25
<210> 115
<211> 26
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 115
agtattagtc gtagttttta cgtttc 26
<210> 116
<211> 27
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 116
cgttttagta ttagtcgtag tttttac 27
<210> 117
<211> 24
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 117
gcgcgttgcg ttttagtatt agtc 24
<210> 118
<211> 13
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 118
cgccgaaaac gct 13
<210> 119
<211> 15
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 119
cgggagttag ttcgc 15
<210> 120
<211> 13
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 120
cgcgagtcgg tcg 13
<210> 121
<211> 15
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 121
catacacgcc gcccg 15
<210> 122
<211> 24
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 122
cgaaaacctc gaaacgaaaa taac 24
<210> 123
<211> 25
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 123
tctctaacgc gaaaacctcg aaacg 25
<210> 125
<211> 19
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 125
ctctaacgcg aaaacctcg 19
<210> 126
<211> 21
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 126
acgataacct aaacgacgac g 21
<210> 127
<211> 26
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 127
cgaaaaataa cgataaccta aacgac 26
<210> 128
<211> 26
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 128
cgaataaacg taatcacgta actccg 26
<210> 129
<211> 27
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 129
acgaataaac gtaatcacgt aactccg 27
<210> 130
<211> 19
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 130
acgaataaac gtaatcacg 19
<210> 131
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 131
gcgcacaaca aaaaaacgcg 20
<210> 132
<211> 22
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 132
cgcaggcgca caacaaaaaa ac 22
<210> 133
<211> 26
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 133
tgaggttaag tgtgattttg tggtgt 26
<210> 134
<211> 15
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 134
acccccaacc caacc 15
<210> 135
<211> 25
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 135
cctcctacaa aattcaccct ctact 25

Claims (10)

1. it is used for progressive stage adenoma, the excrement detection kit of colorectal cancer related gene multidigit point DNA methylation assay, including with In a large amount of compositions extracted and convert faeces DNA, and it is used for Detection progress phase adenoma, colorectal cancer related gene multidigit point The primer and probe composition of DNA methylation assay, wherein a large amount of extractions and the composition for converting faeces DNA wrap by volume It includes:
1)5-35mL Buffer SPB；
2) 50~1000 μ L Buffer SLS；
3)1-2mL Buffer SDL；
4)100-800μL Buffer DTE；
5)100-800μL Buffer BCB；
6)10-300μL Buffer DPB；
7)20-800μL Buffer DBB；
8) 500~750 μ L Buffer BDD；
9) 500~750 μ L Buffer DW1；
10) 500~750 μ L Buffer DW2；
11) 30~200 μ L Buffer DTE.
2. according to claim 1 a kind of for progressive stage adenoma, colorectal cancer related gene multidigit point DNA methylation assay Excrement detection kit, it is characterised in that:
The Buffer SPB includes 10~500mM EDTA, 10~500mM Tris, 50~500mM NaCl, 10~70% nothings Water-ethanol；
The Buffer SLS includes 10~500mM EDTA, 10~500mM Tris, 10~20%SDS；
The Buffer SDL includes 10~500mM EDTA, 10~500mM Tris, 0.5~5%PVP10 and 0.5~3.5M Sodium acetate；
The Buffer DTE includes 10~20mM Tris, the EDTA of 5~10mM.
3. according to claim 1 a kind of for progressive stage adenoma, colorectal cancer related gene multidigit point DNA methylation assay Excrement detection kit, it is characterised in that:
The Buffer BCB includes 10~500mM EDTA, 10~500mM Tris and 0.5~5M sulphite；
The Buffer DPB includes 10~500mM EDTA, 10~500mM Tris, 20~1000mM hydroquinone；
The Buffer DBB includes 10~500mM EDTA, 10~500mM Tris and 3~5.5M guanidinium isothiocyanate；
The Buffer BDD includes 20~400mM Tris, 20~500mM EDTA, 20~500mM NaOH, 60~100% Ethyl alcohol.
4. according to claim 1 a kind of for progressive stage adenoma, colorectal cancer related gene multidigit point DNA methylation assay Excrement detection kit, it is characterised in that:
The Buffer DW1 include 150~400mM Tris, 40~100mM EDTA, 2~5M guanidinium isothiocyanate, 40~70% Ethyl alcohol；
The Buffer DW2 includes 300~700mM Tris, 0.8~1.2M NaCl, 70~90% ethyl alcohol；
The Buffer DTE includes 10~20mM Tris, 5~10mM EDTA.
5. a kind of application method of excrement detection kit according to any one of claims 1 to 4, includes largely extracting Faeces DNA step is converted, the step includes:
1) it takes 5~35mL Buffer SPB into centrifuge tube, then takes 1~5g fecal sample into pipe, sufficiently oscillation mixes；
2) 50~1000 μ L Buffer SLS are first added, is mixed by inversion, 50~500 μ L Proteinase Ks is added, after being mixed by inversion Set 56~75 DEG C of 5~30min of water-bath of thermostat water bath；
3) centrifuge tube is gone into 1~5min of room-temperature water bath, 8000~12000g is centrifuged 1~3min；
4) take 2~6mL supernatant in new centrifuge tube, addition 1~2mL Buffer SDL, mixing of turning upside down, 8000~ 12000g is centrifuged 1~3min；
5) take whole supernatants in new centrifuge tube, then plus 2~5mL organic solvent, mixing of turning upside down, 10000~14000g It is centrifuged 5~15min, abandons supernatant；
6) 100~800 μ L Buffer DTE are added toward centrifuge tube, are vortexed to mix to precipitating and scatter；
7) 10000~14000g is centrifuged 1~5min, the whole liquid of absorption to centrifuge tube, then adds 100~800 μ L toward centrifuge tube Buffer BCB；
8) again toward centrifuge tube be added 10~300 μ L Buffer DPB, after mixing wink from；
9) centrifuge tube is placed in amplification instrument and is converted；
10) after completing conversion, 200~800 μ L Buffer DBB and 300~700 μ L dehydrated alcohols are added, sufficiently oscillation mixes；
11) mixing liquid is added in purification column, 10000~14000g is centrifuged 30~60s, removes liquid in collecting pipe；
12) remaining liq is fully transferred in purification column, 10000~14000g is centrifuged 30~60s, removes liquid in collecting pipe Body；
13) 500~750 μ L Buffer BDD are added in purification column, are stored at room temperature 5~20min, 10000~14000g centrifugation 30~60s removes liquid in collecting pipe；
14) 500~750 μ L Buffer DW1 are added in purification column, 10000~14000g is centrifuged 10~60s, goes to collect Liquid in pipe,
15) 500~750 μ L Buffer DW2 are added in purification column, 10000~14000g is centrifuged 10~60s, goes to collect Liquid in pipe；
16) new collecting pipe is used instead, 10000~14000g is centrifuged 1~5min；
17) collecting pipe is abandoned, purification column is placed in new centrifuge tube；
18) 30~200 μ L Buffer DTE are added dropwise on purification column film, 50~70 DEG C of 1~5min of incubation；
19) 10000~14000g is centrifuged 1~5min, the faeces DNA after being converted.
6. as Claims 1-4 is described in any item a kind of for progressive stage adenoma, colorectal cancer related gene multidigit point methyl Change the excrement detection kit of detection, it is characterised in that: the related gene is MAL/SDC2/TFPI2/Vimentin tetra- Gene.
7. as Claims 1-4 is described in any item a kind of for progressive stage adenoma, colorectal cancer related gene multidigit point methyl Change the excrement detection kit of detection, it is characterised in that:
The primer and probe composition includes: SEQ ID NO:1-SEQ ID NO:131.
8. as Claims 1-4 is described in any item a kind of for progressive stage adenoma, colorectal cancer related gene multidigit point methyl Change detection excrement detection kit, which is characterized in that the primer and probe composition include in the combination such as table 1 extremely A kind of few or multiple groups close joint-detection:
Table 1 progressive stage adenoma, colorectal cancer detection primer probe single group information
9. as claimed in claim 8 a kind of for progressive stage adenoma, colorectal cancer related gene multidigit point DNA methylation assay Excrement detection kit, it is characterised in that: testing result interpretation is related to detecting the Cq value size of the difference of gene and ACTB gene, The yin and yang attribute difference testing result of sample is determined according to size of the difference.
10. as claimed in claim 8 a kind of for progressive stage adenoma, colorectal cancer related gene multidigit point DNA methylation assay Excrement detection kit, it is characterised in that: the Cq value difference value of each target gene combination and the ACTB assortment of genes is according to each gene Performance difference numerical value is not quite identical.
CN201811636672.6A 2018-12-29 2018-12-29 Kit for detecting methylation sites of genes related to advanced adenomas and colorectal cancers in excrement Active CN109486955B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201811636672.6A CN109486955B (en) 2018-12-29 2018-12-29 Kit for detecting methylation sites of genes related to advanced adenomas and colorectal cancers in excrement

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201811636672.6A CN109486955B (en) 2018-12-29 2018-12-29 Kit for detecting methylation sites of genes related to advanced adenomas and colorectal cancers in excrement

Publications (2)

Publication Number Publication Date
CN109486955A true CN109486955A (en) 2019-03-19
CN109486955B CN109486955B (en) 2022-05-24

Family

ID=65713367

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201811636672.6A Active CN109486955B (en) 2018-12-29 2018-12-29 Kit for detecting methylation sites of genes related to advanced adenomas and colorectal cancers in excrement

Country Status (1)

Country Link
CN (1) CN109486955B (en)

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110592224A (en) * 2019-10-16 2019-12-20 厦门信道生物技术有限公司 Primer group, reagent and kit for methylation of specific region of human colorectal cancer related gene and application of primer group, reagent and kit
CN111197073A (en) * 2019-12-19 2020-05-26 武汉艾米森生命科技有限公司 Method for extracting DNA sample from excrement and methylation detection method of colorectal cancer related gene
CN112501305A (en) * 2020-12-18 2021-03-16 江苏默金生物工程技术有限公司 Primer probe combination for quantitative detection of TFPI2 gene methylation and application, kit and method thereof
WO2021164492A1 (en) * 2020-02-19 2021-08-26 伯克利南京医学研究有限责任公司 Application of a group of genes related to colon cancer prognosis
US20220267859A1 (en) * 2019-07-22 2022-08-25 Wuhan Ammunition Life-Tech Co., Ltd. Use of detection reagent for detecting methylation of genes associated with colorectal cancer, and kit
RU2791172C1 (en) * 2019-10-16 2023-03-03 Сямынь Сайндокх Биолоджикал Текнолоджи Ко., Лтд. Primer kit, reagent and commercial kit for methylation of specific gene regions associated with human colorectal cancer and use of the commercial kit
EP3992306A4 (en) * 2019-06-18 2023-11-08 Genomictree, Inc. Method for detecting methylation of sdc2 gene

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102936597A (en) * 2012-09-21 2013-02-20 温州医学院 Biomarker for mass colorectal cancer screening
CN103882119A (en) * 2014-02-21 2014-06-25 郑州艾迪康医学检验所（普通合伙） Primers, method and kit for detecting secreted frizzled-related protein (SFRP)2 gene CpG island methylation
CN104694637A (en) * 2015-02-13 2015-06-10 南京市中医院 Fecal DNA quantitative methylation specific PCR detection kit and applications thereof
WO2017185767A1 (en) * 2016-04-29 2017-11-02 广州市康立明生物科技有限责任公司 Group of primers and probes for detecting kras gene mutation, and kit thereof
CN108220286A (en) * 2018-03-28 2018-06-29 上海锐翌生物科技有限公司 Excrement host DNA methylation detecting method
CN108753963A (en) * 2018-06-01 2018-11-06 安徽达健医学科技有限公司 A kind of detection fecal cast-off cell methylation state of DNA is used to analyze the kit of colorectal cancer

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102936597A (en) * 2012-09-21 2013-02-20 温州医学院 Biomarker for mass colorectal cancer screening
CN103882119A (en) * 2014-02-21 2014-06-25 郑州艾迪康医学检验所（普通合伙） Primers, method and kit for detecting secreted frizzled-related protein (SFRP)2 gene CpG island methylation
CN104694637A (en) * 2015-02-13 2015-06-10 南京市中医院 Fecal DNA quantitative methylation specific PCR detection kit and applications thereof
WO2017185767A1 (en) * 2016-04-29 2017-11-02 广州市康立明生物科技有限责任公司 Group of primers and probes for detecting kras gene mutation, and kit thereof
CN108220286A (en) * 2018-03-28 2018-06-29 上海锐翌生物科技有限公司 Excrement host DNA methylation detecting method
CN108753963A (en) * 2018-06-01 2018-11-06 安徽达健医学科技有限公司 A kind of detection fecal cast-off cell methylation state of DNA is used to analyze the kit of colorectal cancer

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
贾凤洁等: "粪便中SFRP2基因甲基化与大肠癌的相关性", 《中国老年学杂志》 *

Cited By (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3992306A4 (en) * 2019-06-18 2023-11-08 Genomictree, Inc. Method for detecting methylation of sdc2 gene
US20220267859A1 (en) * 2019-07-22 2022-08-25 Wuhan Ammunition Life-Tech Co., Ltd. Use of detection reagent for detecting methylation of genes associated with colorectal cancer, and kit
US11767565B2 (en) * 2019-07-22 2023-09-26 Wuhan Ammunition Life-Tech Co., Ltd. Use of detection reagent for detecting methylation of genes associated with colorectal cancer, and kit
CN110592224A (en) * 2019-10-16 2019-12-20 厦门信道生物技术有限公司 Primer group, reagent and kit for methylation of specific region of human colorectal cancer related gene and application of primer group, reagent and kit
WO2021072786A1 (en) * 2019-10-16 2021-04-22 厦门信道生物技术有限公司 Primer set for methylation of a specific region of a human colorectal cancer-related gene, test, test kit and application thereof
CN110592224B (en) * 2019-10-16 2023-02-28 厦门信道生物技术有限公司 Primer group, reagent and kit for methylation of specific region of human colorectal cancer related gene and application of primer group, reagent and kit
RU2791172C1 (en) * 2019-10-16 2023-03-03 Сямынь Сайндокх Биолоджикал Текнолоджи Ко., Лтд. Primer kit, reagent and commercial kit for methylation of specific gene regions associated with human colorectal cancer and use of the commercial kit
CN111197073A (en) * 2019-12-19 2020-05-26 武汉艾米森生命科技有限公司 Method for extracting DNA sample from excrement and methylation detection method of colorectal cancer related gene
WO2021164492A1 (en) * 2020-02-19 2021-08-26 伯克利南京医学研究有限责任公司 Application of a group of genes related to colon cancer prognosis
CN112501305A (en) * 2020-12-18 2021-03-16 江苏默金生物工程技术有限公司 Primer probe combination for quantitative detection of TFPI2 gene methylation and application, kit and method thereof
CN112501305B (en) * 2020-12-18 2024-02-20 江苏默金生物工程技术有限公司 Primer probe combination for quantitative methylation detection of TFPI2 gene, application, kit and method thereof

Also Published As

Publication number Publication date
CN109486955B (en) 2022-05-24

Similar Documents

Publication Publication Date Title
CN109486955A (en) It is a kind of for excrement Detection progress phase adenoma, the kit of colorectal cancer related gene methylation sites
CA3010143C (en) Molecular detection/diagnosis reagent for tumor
CN108531591B (en) The detection kit and application of Septin9 and NDRG4 gene methylation
CN108048570A (en) For primer pair, kit and the method for colorectal cancer related gene Septin9 DNA methylation assays
CN106570349B (en) Specific tumour probe area design method and device and probe for target area capture high-flux sequence
CN110484624B (en) Gastric cancer biomarker based on peripheral blood and detection method and application thereof
TWI680296B (en) Gene marker, reagent set for detecting pancreatic cancer, and method for detecting pancreatic cancer
CN107663533A (en) A kind of lung cancer EGFR L858R and 19Del ddPCR detection methods and application
CN108085395A (en) Primer sets, kit and the method for cervical carcinoma polygenes DNA methylation assay based on high-flux sequence
CN110343764A (en) Detect application and the kit of the detection reagent of colorectal cancer related gene methylation
CN111778332A (en) Marker combination and kit for early diagnosis of adenoma and colorectal cancer
CN108441552B (en) One kind serum/plasma miRNA marker relevant to intrahepatic cholestasis of pregnancy auxiliary diagnosis and its application
CN110373470A (en) Primer, probe and the kit of colorectal carcinoma specific methylation detection
CN110331142A (en) A kind of polygene combined detection reagent
CN112609015A (en) Microbial marker for predicting colorectal cancer risk and application thereof
CN112538529B (en) Molecular marker for colorectal cancer in blood and detection kit and method thereof
CN114774540A (en) Application of exosome miR-106b-3p, miR-330-5p and the like in lung cancer diagnosis
CN108531586A (en) A kind of relevant cycle miRNA marker and its application on X chromosome of and Computer-aided Diagnosis of Breast Cancer
CN108660209B (en) Product for early detection of colorectal cancer prepared based on BMP3 gene methylation
CN110157808A (en) A kind of application of non-coding RNA relevant to larynx squamous carcinoma occurrence and development
CN109609634A (en) One kind circulation miRNA marker relevant to carcinoma of endometrium auxiliary diagnosis and its application
TW201934568A (en) Gene marker for detecting esophageal cancer, use thereof and detection method therefor
CN108866187A (en) One kind long-chain non-coding RNA marker relevant to lung cancer auxiliary diagnosis and its application
CN107988365A (en) A kind of prostate cancer screening and lymphatic metastasis prediction kit
CN109825585A (en) A kind of biomarker of nasopharyngeal carcinoma diagnosis and/or prognosis evaluation

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
TA01 Transfer of patent application right

Effective date of registration: 20210305

Address after: 361000 one of 39 Dingshan Road, Haicang District, Xiamen City, Fujian Province

Applicant after: Xiamen Xiawei Health Technology Co.,Ltd.

Address before: No. 39, Haicang Ding Shan Road, Haicang District, Xiamen, Fujian

Applicant before: AMOY DIAGNOSTICS Co.,Ltd.

TA01 Transfer of patent application right
GR01 Patent grant
GR01 Patent grant
TR01 Transfer of patent right

Effective date of registration: 20220819

Address after: Room 2440, 24th Floor, Building 1, No. 795, No. 18 Street, Baiyang Street, Qiantang District, Hangzhou City, Zhejiang Province, 310000

Patentee after: Hangzhou Avic Biotechnology Co.,Ltd.

Address before: 361000 one of 39 Dingshan Road, Haicang District, Xiamen City, Fujian Province

Patentee before: Xiamen Xiawei Health Technology Co.,Ltd.

TR01 Transfer of patent right