CN108660209B

CN108660209B - Product for early detection of colorectal cancer prepared based on BMP3 gene methylation

Info

Publication number: CN108660209B
Application number: CN201810502359.7A
Authority: CN
Inventors: 李存耀; 李慧; 郑伟贤; 杨蛟; 刘刚; 吕宁; 陈一友
Original assignee: Hangzhou Promise Health Technology Co Ltd
Current assignee: Hangzhou Promise Health Technology Co Ltd
Priority date: 2018-05-23
Filing date: 2018-05-23
Publication date: 2020-01-14
Anticipated expiration: 2038-05-23
Also published as: CN108660209A

Abstract

The invention discloses a BMP3 gene methylation sequence-based early colorectal cancer detection method, which can be used for assisting in diagnosing early colorectal cancer by detecting whether a methylation sequence of a BMP3 gene promoter region is methylated or not, wherein the detection method comprises the steps of extracting DNA from a tissue and excrement sample, carrying out real-time quantitative PCR (polymerase chain reaction) determination after bisulfite treatment, and judging whether a △ Ct value is within a critical value or not by calculating a △ Ct value, namely the difference value between the Ct value of a FAM signal of a BMP3 target gene and the Ct value of a JOE signal of a B2M internal reference gene, so that the methylation level is judged.

Description

Product for early detection of colorectal cancer prepared based on BMP3 gene methylation

Technical Field

The invention relates to the field of biotechnology and disease detection, in particular to application of a product for detecting BMP3 gene methylation sites in preparation of a product for early detection of colorectal cancer.

Background

Colorectal cancer (CRC), the third major malignancy in the world, also known as colorectal cancer, occurs in the colon (large intestine) or rectum, and generally develops slowly, resulting in a rapid increase in the incidence of colorectal cancer as food structure and lifestyle changes, as well as environmental issues become more prominent. In China, the incidence rate of colorectal cancer rises year by year, about 40 million cases are estimated to occur every year, and the second case is listed in China's digestive system malignant tumor. The research report of the national cancer early diagnosis and early treatment project expert committee 2013 indicates that the rate of advanced adenomas and early intestinal cancer of high-risk people over 40 years old in China is 6%. These cancerous lesions are not removed in time and in 90% of cases will be transformed into malignant bowel cancer. Research shows that the 5-year survival rate of early colorectal cancer patients can reach more than 90 percent, the 5-year survival rate of middle and late stage patients is only about 10 percent, and about 80 percent of clinically diagnosed colorectal cancer is in middle and late stages, which is one of the key factors causing the death rate to be high. As most patients do not have the consciousness of early cancer screening, the patients are examined in hospitals after the symptoms are found, and cancer cells are diffused and the later curative effect is not obvious when the colorectal cancer is diagnosed, so that the life cycle of nearly half of intestinal cancer patients does not exceed five years. Therefore, early detection, early diagnosis and early treatment of colorectal cancer are important.

Studies have shown that early onset of colorectal cancer is strongly associated with methylation of the promoter region of genes associated with colorectal cancer. The bone morphogenic protein gene (BMP3) belongs to a member of the transforming growth factor-beta (TGF- β) superfamily, originally named for its ability to induce ectopic bone and cartilage formation. Recent researches show that BMP3 gene is closely related to tumorigenesis, development and metastasis, and the expression level of BMP3 gene in colorectal cancer is inhibited, indicating that the methylation level of BMP3 gene can be used as an important biological characteristic of early colorectal cancer.

The present invention addresses the problem of finding methylation sites associated with colorectal cancer development that can be used to aid in the diagnosis of early stage colorectal cancer.

Disclosure of Invention

In order to solve the defects of the prior art, the invention aims to provide the application of a product for detecting BMP3 gene methylation sites in preparing a product for early detection of colorectal cancer, and the diagnosis of early colorectal cancer is assisted by detecting whether a molecular marker of a BMP3 gene promoter region is methylated; extracting DNA from tissue and excrement samples, performing real-time quantitative PCR determination after bisulfite treatment, and judging whether methylation occurs in the samples and the methylation level by calculating the difference value between the Ct value of a BMP3 target gene (FAM signal) and the Ct value of a B2M reference gene (JOE signal); the detection mode is non-invasive and can be used for the auxiliary diagnosis of early colorectal cancer.

In order to achieve the above object, the present invention adopts the following technical solutions:

the application of the product for detecting the methylation sites of the BMP3 gene in preparing the product for early detecting the colorectal cancer,

the methylation sequence of the BMP3 gene is as follows:

GTTAGTTTGGT^mCGGGTGTTTTTAAAAATAAAG^mCGAGGAGGGAAGGTATAGATAGA TTTTGAAAATATT^mCGGGTTATATA^mCGT^mCG^mCGATTTATAGTTTTTTTTTAG^mCGTTG GAGTGGAGA^mCGG^mCGTT^mCGTAG^mCGTTTTG^mCG^mCGGGTGAGGTT^mCG^mCGTAG TTGTTGGGGAAGAGTTTATTTGTTAGGTTG^mCGTTGGGTTAG^mCGTAGTAAGTGGGG TTGGT^mCGTTATTT^mCGTTGTATT^mCGGT^mCG^mCGTTT^mCGGGTTT^mCGTG^mCGTTTT^mCGTTTTAG

^mCG indicates that the C of the CpG island is subjected to methylation modification;

the using method comprises the following steps:

step one, extracting genome DNA from a biological sample;

secondly, designing primers and probes of a BMP3 gene methylation sequence;

step three, treating the extracted genome DNA by a transformation liquid;

step four, carrying out quantitative PCR detection on the DNA treated by the transformation liquid;

step five, judging results:

automatically setting a baseline, manually setting a threshold line, and adjusting the threshold line to the rising inflection point of the FAM and JOE amplification curves according to the actual situation, wherein the threshold line of the target gene FAM signal needs to exceed the threshold line set at the highest point of the normal negative control;

according to the quantitative PCR detection signal of the sample to be detected, the cycle number required for reaching a set threshold line is obtained, and a Ct value is obtained;

if the Ct value of △ Ct ═ BMP3 target gene FAM signal-the Ct value of B2M reference gene JOE signal is less than or equal to the critical value, the sample is a methylation sample, and the early diagnosis of colorectal cancer is judged to be positive;

if the Ct value of △ Ct ═ BMP3 target gene FAM signal-Ct value of B2M internal reference gene JOE signal > critical value, the sample is a sample without methylation, and the early diagnosis of colorectal cancer is judged to be negative;

the critical value is △ Ct value corresponding to 1% proportion methylation reference substance with BMP3 gene detection system detection concentration of 5 ng/. mu.L.

the methylation sequence of the BMP3 gene is as follows:

the using method comprises the following steps:

step one, extracting genome DNA from a biological sample;

designing primers, probes, positive quality control and negative quality control of a BMP3 gene methylation sequence;

internal quality control, using B2M gene as reference gene, the base sequence is the No. of NG _012920.1 from 3886 to 4010 of the gene sequence number in NCBI database, C in the corresponding sequence except CG is converted into T; designing an internal control primer and an internal control probe aiming at the converted sequence, and screening the internal control upstream primer and the internal control downstream primer, so that the non-template system has no obvious amplification curve, and a sample has an obvious normal amplification curve;

step three, treating the extracted genome DNA by a transformation liquid;

judging whether the sample meets the requirement, if FAM signals corresponding to target genes BMP3 of the positive quality control system have obvious amplification curves, JOE corresponding to internal quality control B2M genes have obvious amplification curves, and the difference value of Ct values of the JOE signals, namely △ Ct is less than or equal to a critical value, meeting the requirement, judging that the sample is a methylated sample and is positive for early diagnosis of colorectal cancer;

if the FAM of the negative quality control system has no amplification curve, JOE has an obvious amplification curve, and the difference of the Ct values of JOE signals, namely △ Ct is larger than a critical value, the requirements are met, the detection result is correct, the sample is a methylated sample, and the colorectal cancer early diagnosis is judged to be negative;

The threshold value of the application of the product for detecting the methylation sites of the BMP3 gene in preparing the product for detecting the early colorectal cancer is 9.

step one, extracting genome DNA from a tissue sample;

extracting genome DNA from the FFPE sample by adopting a TaKaRa MiniBEST FFPE DNA Extraction Kit;

the method comprises the following specific steps:

scraping 30mg of paraffin section tissue by using a sterilization scalpel, and removing redundant paraffin;

putting the paraffin section tissue into a 1.5mL centrifuge tube, adding 500 mu L Buffer DP, uniformly mixing, carrying out water bath at 80 ℃ for 1 minute, carrying out vortex oscillation for 10 seconds while the paraffin section tissue is hot, adding 180 mu LBuffer GL, and carrying out vortex oscillation;

centrifuging at 12000rpm at room temperature for 1min to obtain two layers, upper oil phase and lower water phase, adding 20 μ L of protease K, 20mg/mL and 10 μ L of RNase, 10mg/mL into the lower water phase, sucking, mixing, water bathing at 56 deg.C for 1 hr,

carrying out water bath on the treated sample at 90 ℃ for 30 minutes, and cooling to room temperature;

adding 200 mu L of Buffer GB and 200 mu L of 100% ethanol into the treated sample, and carrying out vortex oscillation for 10 seconds;

centrifuging at 12000rpm for 1min at room temperature to obtain two layers of solution, upper oil phase and lower water phase;

placing Spin Column on the Collection Tube, transferring the lower aqueous phase solution of the sample into Spin Column, centrifuging at 12000rpm for 2min at room temperature, and discarding the filtrate;

add 500. mu.L of Buffer WA to Spin Column, centrifuge at 12000rpm for 1min at room temperature, discard the filtrate;

add 500. mu.L of Buffer WB to Spin Column, centrifuge at 12000rpm for 1min at room temperature, discard the filtrate;

repeating the above step, adding 500. mu.L of Buffer WB into Spin Column, centrifuging at 12000rpm for 1min at room temperature, and discarding the filtrate;

spin Column was mounted on the Collection Tube and centrifuged at 12000rpm for 2 minutes at room temperature;

placing Spin Column on a new 1.5mL centrifuge tube, adding 50-100 μ L of sterile water or Elution Buffer at the center of the Spin Column membrane, and standing at room temperature for 5 min;

centrifuging at 12000rpm for 2 minutes at room temperature, and eluting DNA;

detecting the concentration and purity of the DNA solution obtained by centrifugation by using Nanodrop;

and storing the qualified DNA in a refrigerator at the temperature of-20 ℃ for later use.

step one, extracting genome DNA from a fecal sample;

adding a feces sample (4-6g) into 40mL of lysate, carrying out vortex oscillation, fully and uniformly mixing, and then incubating for 16 hours at 50 ℃;

centrifuging at 5000rpm for 10min after incubation, weighing and balancing before centrifuging, and carefully taking out the centrifuge tube without violent shaking after centrifuging;

transferring 9mL of supernatant into a new 50mL centrifuge tube, adding 1mL of extraction adjuvant solution, 60 μ L of magnetic bead solution and 10mL of isopropanol, respectively, performing vortex oscillation for 10sec, incubating at 65 ℃ for 20min, and mixing the mixture by turning upside down every 5min during incubation.

After the incubation is finished, placing a 50mL centrifuge tube on a magnetic frame, standing for 3min, and discarding waste liquid after the magnetic beads are fully adsorbed on the tube wall;

taking out the centrifugal tube from the magnetic frame, adding 12mL of washing solution, carrying out vortex oscillation until the magnetic beads fall off from the tube wall, standing for 3min, putting the tube into the magnetic frame again, standing for 3min, and discarding the waste liquid after the magnetic beads are fully adsorbed on the tube wall;

adding 15mL of 80% ethanol solution, performing vortex oscillation until the magnetic beads fall off from the tube wall, standing for 3min, placing into a magnetic frame, standing for 3min, and discarding the waste liquid after the magnetic beads are fully adsorbed on the tube wall;

repeating the previous step for 1 time;

sucking up residual liquid at the bottom by using a liquid transfer machine, opening a cover, incubating the centrifugal tube at 65 ℃ for 5min, taking out the magnetic beads after the magnetic beads are dried, adding 1.5mL of preheated eluent I, purging the magnetic beads from the tube wall by using a 1000-mu L liquid transfer machine, repeatedly sucking, transferring the magnetic beads together into a 2mL centrifugal tube, closing the centrifugal tube cover, and incubating for 5min at 65 ℃;

centrifuging at 13000rpm for 3min, transferring 600 μ L of supernatant to a new 1.5mL centrifuge tube, adding 600 μ L of column binding solution, and mixing well;

transferring 600 mu L of mixed solution to a DNA purification column, centrifuging at 13000rpm for 1min, and discarding waste liquid;

adding 600 μ L90% ethanol solution into DNA purification column, centrifuging at 13000rpm for 1min, and discarding the waste solution;

repeating the previous step for 2 times;

centrifuging at 13000rpm for 3min, placing the DNA purification column into a new 1.5mL centrifuge tube, opening the centrifuge tube cover, incubating at 65 ℃ for 5min, and drying;

and (3) suspending and dropwise adding 100 mu L of preheated eluent II into the middle position of the DNA purification column, closing a cover, incubating for 5min at 65 ℃, centrifuging for 2min at 13000rpm to obtain an eluted DNA solution, and storing at 2-8 ℃ for later use, wherein the DNA solution needs to be stored at-25 to-15 ℃ if the DNA solution is stored for a long time.

secondly, designing primers and probes of the methylation sequence of the BMP3 gene;

the BMP3 primers comprise: BMP3 forward primer, BMP3 reverse primer;

the BMP3 forward primer comprises:

SEQ ID NO.1：AAATAAAGCGAGGAGGGAAGG；

SEQ ID NO.2：GAGACGGCGTTCGTAGCG；

SEQ ID NO.3：AGCGTTGGAGTGGAGACGG；

the BMP3 reverse primer comprises:

SEQ ID NO.4：CCCAACAACTACGCGAACC；

SEQ ID NO.5：CGAAATAACGACCAACCCCAC；

SEQ ID NO.6：AAACCCGAAACGCGACC；

the BMP3 probe included:

SEQ ID NO.7：TCGGGTTATATACGTCGCGA；

SEQ ID NO.8：GTTCGCGTAGTTGTTGGG；

SEQ ID NO.9：GTGAGGTTCGCGTAGTTGTTG；

the forward primer of BMP3 is SEQ ID NO.3, and the reverse primer of BMP3 is SEQ ID NO. 6;

the BMP3 probe is SEQ ID NO. 9.

the positive standard substance of BMP3 is a nucleotide sequence containing SEQ ID NO. 10; GTTAGTTTGGTCGGGTGTTTTTAAAAATAAAGCGAGGAGGGAAGGTATAGATAGATTTTG AAAATATTCGGGTTATATACGTCGCGATTTATAGTTTTTTTTTAGCGTTGGAGTGGAGACG GCGTTCGTAGCGTTTTGCGCGGGTGAGGTTCGCGTAGTTGTTGGGGAAGAGTTTATTTG TTAGGTTGCGTTGGGTTAGCGTAGTAAGTGGGGTTGGTCGTTATTTCGTTGTATTCGGTCGCGTTTCGGGTTTCGTGCGTTTTCGTTTTAG, respectively;

the negative standard of BMP3 is a nucleotide sequence containing SEQ ID NO. 11; GTTAGTTTGGTTGGGTGTTTTTAAAAATAAAGTGAGGAGGGAAGGTATAGATAGATTTTG AAAATATTTGGGTTATATATGTTGTGATTTATAGTTTTTTTTTAGTGTTGGAGTGGAGAT GGTGTTTGTAGTGTTTTGTGTGGGTGAGGTTTGTGTAGTTGTTGGGGAAGAGTTTATTT GTTAGGTTGTGTTGGGTTAGTGTAGTAAGTGGGGTTGGTTGTTATTTTGTTGTATTTGGTTGTGTTTTGGGTTTTGTGTGTTTTTGTTTTAG, respectively;

the forward quality control primer is SEQ ID NO. 12: TTGTGGATTTTATTATTAYGAAATGG, respectively;

the reverse quality control primer is SEQ ID NO. 13: AAACTACATCTACCTTAAACCCAACC, respectively;

the quality control probe is nucleotide sequence SEQ ID NO. 14: GTATTTTATTTATGGTTATTTTAGAGGGT, respectively;

the quality control standard substance comprises SEQ ID NO. 15: AGAAAAGATTTGTGGATTTTATTATTACGAAATGGCGGTATTTTATTTATGGTTATTTTAGA GGGTAGGTTTTTTTAATGGGTTTGTTTGTTATGTTTAACGTTTTTGGTTGGGTTTAAGGTA GATGTAGTTTAAATTTTTATTAAAATTGTCGAG are provided.

step three, treating the extracted genome DNA by bisulfite conversion solution; the method specifically comprises the following steps:

the extracted genomic DNA was thawed from the freezer and the DNA concentration was diluted to 20 ng/. mu.L. Adding 40 mu L of the diluted DNA solution into a 1.5mL centrifuge tube, then adding 4 mu L of 3M NaOH solution, and incubating for 20min at 42 ℃;

adding 400 mu L of bisulfite conversion solution, mixing uniformly, and incubating for 16 hours at 50 ℃ in the dark;

adding 550 mu L of column binding solution, mixing uniformly, transferring the solution to a DNA purification column, centrifuging at 13000rpm for 90 seconds, discarding the waste liquid, centrifuging again for 3 minutes, and discarding the waste liquid;

adding 600 μ L90% ethanol to DNA purification column, centrifuging at 13000rpm for 90 s, discarding waste liquid, and centrifuging again for 15 s;

adding 300 mu L of desulfurization solution, standing at normal temperature for 30 minutes, centrifuging at 13000rpm for 90 seconds, and discarding the waste liquid;

adding 600 μ L90% ethanol, centrifuging at 13000rpm for 90 s, discarding the waste liquid, repeating the step for 1 time, and centrifuging again for 3 min;

the DNA purification column was placed in a new 1.5mL centrifuge tube, 40. mu.L of the eluent was added, incubated at 50 ℃ for 30 minutes, centrifuged at 13000rpm for 90 seconds to obtain the converted DNA solution, and stored at-20 ℃ for further use.

the quantitative PCR detection comprises the following specific steps:

preparing a detection reaction system, wherein the PCR reaction system comprises the following components:

10 × PCR buffer: 5 to 10 mu L

MgCl₂：2.0～5.0mmol

dNTP：0.2～0.8mmol

Each primer was: 0.1 to 1.0. mu. mol

Each probe was: 0.1 to 1.0. mu. mol

Fast master Premix：5～10μL

Sample DNA template: 2 μ L

The rest is made up to the total volume with ultrapure water: 20 μ L.

The real-time fluorescent PCR amplification reaction conditions are preferably as follows:

the first stage is as follows: 5min at 95 ℃;

and a second stage: at 95 ℃ for 20s, at 60 ℃ for 40s, for 15 cycles;

the third stage is that 30 cycles of 20s at 95 ℃ and 20s at 58 ℃;

third stage, at 58 ℃ in 30 cycles, the fluorescence signal was collected.

The invention has the advantages that:

the method for detecting the diseases by using the molecular marker has high sensitivity, can accurately detect the genomic DNA as low as 0.01 ng/mu L, and is suitable for accurately detecting the cells falling off from the excrement sample, namely the sample with low concentration; the specificity is strong, and the DNA of the excrement sample up to 500ng can be accurately detected, so that the process of diluting the sample can be reduced, and the extracted sample can be accurately detected directly on the mother solution without result misjudgment;

the invention extracts DNA from tissue and excrement samples; the detection mode is non-invasive, and can not bring pain to patients;

the primer and the probe designed by the invention can be complementary with a site to be detected, and have high sensitivity and high specificity;

the detection method of the present invention treats a DNA fragment with bisulfite so as to convert cytosine in a DNA sample into uracil while 5 'methylcytosine is unchanged, obtaining a converted DNA fragment, converting cytosine in a DNA sample into uracil while 5' methylcytosine is unchanged;

the invention detects through real-time fluorescence quantitative PCR, calculate △ Ct value through calculation, the Ct value of △ Ct ═ BMP3 target gene FAM signal-Ct value of B2M reference gene JOE signal is not more than critical value as methylation sample, the Ct value of △ Ct ═ BMP3 target gene FAM signal-Ct value of B2M reference gene JOE signal > critical value is methylation sample not taking place, this detection method has high flux and high sensitive advantage, do not need electrophoresis, hybridization, etc. operation after PCR, have reduced pollution and operation error;

the quality control product is provided with negative quality control and positive quality control of detection primers, so that the omission of detection is avoided, and whether the DNA amount of a sample is in an allowable range is preliminarily judged; in order to avoid false negative and missed detection, positive quality control is arranged, if the positive quality control detection shows a positive result, the detection system has no problem, and false negative results and missed detection cannot occur; in order to avoid false positive and missed detection, a negative control is arranged, if the negative control detection shows a negative result, the detection system has no problem; the design ensures strict detection and effectively avoids the possibility of missed detection and wrong detection.

Drawings

FIG. 1 is a flow chart of one embodiment of a detection method of the present invention;

FIG. 2 is a diagram showing the prediction of CpG island of BMP3 promoter region sequence (2000bp) according to the present invention;

FIG. 3 is a schematic diagram showing the positions of 4 amplicons in the promoter region of the BMP3 gene of the present invention;

FIG. 4 shows the percentage of CpG sites in a sample of a patient with intestinal cancer tissue in the promoter region of BMP3 gene according to the present invention;

FIG. 5 is a graph showing the percentage of CpG sites in the promoter region of BMP3 gene of the present invention in a sample of a patient with advanced adenoma tissue;

FIG. 6 is a flow chart of the methylation sequence of the BMP3 gene of the present invention;

FIG. 7 is a comparison amplification curve of different primer probe combinations in the BMP3 gene promoter region according to the present invention;

FIG. 8 is a sensitivity amplification curve of the BMP3 gene methylation detection system of the present invention;

FIG. 9 is a BMP3 gene methylation positive sample amplification curve of the present invention;

FIG. 10 is the amplification curve of the BMP3 gene methylation negative sample of the present invention.

Detailed Description

The invention is described in detail below with reference to the figures and the embodiments.

Experiment one, as shown in fig. 6, the discovery process of methylated CpG islands in the BMP3 gene promoter region is as follows:

first, sample collection

191 clinical samples of different course distributions of enteroscopy pathology were collected, including: 50 colorectal cancer tissue samples, 49 paired adjacent normal tissues, 46 advanced adenoma tissue samples, 46 paired adjacent normal tissues; sample information is shown in table 1:

TABLE 1

Colorectal cancer (CRC) tissue samples	CRC-proximal Normal tissue	Advanced Adenoma (AA) tissue samples	AA-Adjacent Normal tissue
				50	49	46	46

Information on colorectal cancer samples and adjacent normal tissue samples and advanced adenoma samples and adjacent normal tissue samples is shown in table 2:

TABLE 2

Second, tissue sample extraction

Genomic DNA was extracted from the FFPE sample using TaKaRa MiniBEST FFPE DNA Extraction Kit (cat # 9782). The method comprises the following specific steps:

(1) 30mg of paraffin sections were scraped with a sterile scalpel to remove the excess paraffin as much as possible.

(2) The paraffin section tissues are put into a centrifuge tube of 1.5mL, 500 mu L of Buffer DP is added, after mixing uniformly, water bath is carried out for 1 minute at 80 ℃, vortex oscillation is carried out for 10 seconds while the mixture is hot, 180 mu LBuffer GL is added, and vortex oscillation is carried out.

(3) Then, the mixture was centrifuged at 12000rpm at room temperature for 1 minute to form two layers (upper oil phase, lower aqueous phase), and 20. mu.L of protease K (20mg/mL) and 10. mu.L of RNase (10mg/mL) were added to the lower aqueous phase, and the mixture was pipetted and mixed well. Care was taken not to break the separation layer and then a 56 ℃ water bath was used for 1 hour.

(4) And (4) carrying out water bath on the sample treated in the step (3) at 90 ℃ for 30 minutes, and cooling to room temperature.

(5) To the sample treated in step (4) were added 200. mu.L of Buffer GB and 200. mu.L of 100% ethanol, and vortexed for 10 seconds.

(6) Then, the mixture was centrifuged at 12000rpm at room temperature for 1 minute, and the solution formed 2 layers (upper oil phase, lower aqueous phase).

(7) The Spin Column was placed on the Collection Tube, and the lower aqueous phase solution of the sample of step (6) was transferred to the Spin Column. Note that the upper oil phase solution was not taken, and then centrifuged at 12000rpm for 2 minutes at room temperature, and the filtrate was discarded.

(8) mu.L of Buffer WA WAs added to Spin Column, centrifuged at 12000rpm for 1min at room temperature, and the filtrate WAs discarded.

(9) mu.L of Buffer WB was added to Spin Column, centrifuged at 12000rpm for 1min at room temperature, and the filtrate was discarded.

(10) And (5) repeating the step (9).

(11) Spin columns were mounted on a Collection Tube and centrifuged at 12000rpm for 2 minutes at room temperature.

(12) Spin Column was placed on a new 1.5mL centrifuge tube, 50-100 μ L of sterile water or Elution Buffer was added to the center of the Spin Column membrane, and allowed to stand at room temperature for 5 minutes.

(13) The DNA was eluted by centrifugation at 12000rpm for 2 minutes at room temperature.

(14) The DNA solution obtained by centrifugation was subjected to Nanodrop to determine the concentration and purity.

(15) And storing the qualified DNA in a refrigerator at the temperature of-20 ℃ for later use.

Thirdly, forecasting a BMP3 promoter region and designing a primer;

(1) prediction of CpG island in BMP3 gene promoter region

The DNA sequence of the first 2000bp of the BMP3 gene promoter region was downloaded and is shown in the sequence SEQ ID NO.16 (see Table 3). CpG islands were predicted using MethPrimer software, and the prediction results are shown in FIG. 2. As can be seen from FIG. 2, CpG islands are concentrated in the 879bp sequence before the promoter region.

(2) Primer design for amplifying first 1000bp sequence of promoter region

4 pairs of primers were designed for a 1000bp DNA sequence. The primer sequences and the amplicons are shown in SEQ ID NO.17-SEQ ID NO.28 (see Table 3). The relative positions of the amplicons are shown in FIG. 3. 4 pairs of primers were mixed at an equal concentration (2. mu.M) to prepare a mixture of primers Mix, and the mixture was stored at-20 ℃ until use.

TABLE 3

Fourthly, processing with bisulfite;

(1) the extracted genomic DNA was thawed from the freezer and the DNA concentration was diluted to 20 ng/. mu.L. mu.L of the diluted DNA solution was added to a 1.5mL centrifuge tube, followed by 4. mu.L of 3M NaOH solution and incubation at 42 ℃ for 20 min.

(2) 400. mu.L of the transformation solution was added, mixed well and incubated at 50 ℃ for 16 hours in the dark.

(3) 550. mu.L of the column binding solution was added thereto, mixed well, and then the solution was transferred to a DNA purification column, centrifuged at 13000rpm for 90 seconds, discarded, centrifuged again for 3 minutes, and discarded.

(4) 600. mu.L of 90% ethanol was added to the DNA purification column, centrifuged at 13000rpm for 90 seconds, discarded, and centrifuged again for 15 seconds.

(5) mu.L of a desulfurization solution (0.3M NaOH in 90% ethanol) was added thereto, the mixture was left at room temperature for 30 minutes, centrifuged at 13000rpm for 90 seconds, and the waste liquid was discarded.

(6) 600 μ L of 90% ethanol was added, centrifuged at 13000rpm for 90 seconds, the waste was discarded, the procedure was repeated 1 time, and centrifuged again for 3 minutes.

(7) The DNA purification column was placed in a new 1.5mL centrifuge tube, 40. mu.L of the eluent was added, incubated at 50 ℃ for 30 minutes, centrifuged at 13000rpm for 90 seconds to obtain the converted DNA solution, and stored at-20 ℃ for further use.

Fifthly, preparing a library and performing on-machine sequencing;

1. multiplex PCR amplification

PCR amplification was carried out according to the following system and reaction conditions. Multiplex PCR reactions were carried out using QIAGEN Multiplex PCRKit (cat # 206143). The method comprises the following specific steps:

1) the 2 XQIAGEN Multiplex PCR Master Mix and the primer Mix were removed from-20 ℃ and thawed at room temperature. The bisulfite-treated DNA, RNase-free Water, was prepared. Before use, 2 XQIAGEN Multiplex PCRMaster Mix and primer Mix were vortexed and mixed.

2) Master Mix was formulated according to Table 4 and briefly mixed by vortexing.

TABLE 4

1) To each PCR tube, 40. mu.L Master Mix was added, followed by 10. mu.L bisulfite treated DNA.

3) The PCR tubes were vortexed and amplified according to the conditions in Table 5.

TABLE 5

2. Electrophoretic detection of PCR products

1% agarose gel electrophoresis was prepared, 5. mu.L of the PCR product was mixed with 2. mu.L of 6 × Loading Buffer (manufacturer: TaKaRa, cat # 9156), and electrophoresis was performed for detection by Loading a DL2000DNA Marker (manufacturer: TaKaRa, cat # 3427Q) for 40 minutes at 120V.

If the electrophoresis detection has non-specific amplification, the remaining 45. mu.L of PCR product is electrophoresed, cut and recovered (manufacturer: QIAGEN, cat # 28704), and the specific operation is performed according to the kit instructions.

Purification and quantification of PCR products

(1) PCR product Purification was performed using the MinElute PCR Purification Kit from QIAGEN (cat # 28004) according to the Kit instructions.

(2) Using a Qubit^TMThe purified product was quantified using the dsDNA BR Assay Kit (cat # Q32850).

4. Linker attachment and purification

(1) Using NEB

A Quick Ligation Module (cat # E6056L) was used for the linker. Master Mix was formulated as per Table 6.

TABLE 6

(2) The PCR tubes were vortexed and mixed, centrifuged briefly, and then reacted according to the conditions in Table 7.

TABLE 7

Step (ii) of	Temperature of	Time of day	Number of cycles
				Step1
	20℃	15min			1
				Step2		4℃	Hold	1

5. Purifying a connection product;

agencourt AMPure XP beads (manufacturer: BECKMAN COULTER, cat # A63882) were equilibrated by placing in advance from a 4 ℃ refrigerator to room temperature.

(1) The PCR tube was centrifuged at 280g at 20 ℃ for 1 minute to collect the ligation product at the bottom of the tube.

(2) Pipette range was adjusted to 50 μ L and the ligation products were all transferred to a new 96-well plate.

(3) And (3) vortex mixing the AMPure XP magnetic beads for 30 seconds to ensure that the magnetic beads are uniformly dispersed.

(4) To each sample well of the 96-well plate, 56 μ L of AMPure XP magnetic beads were added.

(5) Gently blow and beat for 10 times by a pipette, and mix well.

(6) Incubate at room temperature for 5 minutes at rest.

(7) The 96-well plate was placed on a 96-well magnetic plate and allowed to stand for 2 minutes until the supernatant was clear.

(8) The 96-well plate was kept in place on a 96-well magnetic plate and the supernatant was removed with a pipette.

(9) Keep the 96-well plate placed on a 96-well magnetic plate, add 200 μ L of freshly prepared 80% ethanol to each sample well, incubate for 30 seconds, and then carefully remove the supernatant (first wash).

(10) The 96-well plate was kept in place on a 96-well magnetic plate, 200 μ L of freshly prepared 80% ethanol was added to each sample well, incubated for 30 seconds, then the supernatant was carefully removed and the remaining ethanol removed with a pipette (10 μ L) with a small tip (second wash).

(11) The 96-well plate was held on a magnetic plate and the beads were allowed to air dry for 10 minutes.

(12) The 96-well plate was removed from the magnetic plate and 27.5. mu.L of 10mM Tris (pH 8.5) was added to each sample well. Gently pipette 10 times until the beads are well mixed. Then incubated at room temperature for 2 minutes at rest.

(13) The 96-well plate was placed on a magnetic plate and allowed to stand for 2 minutes until the supernatant was clear.

(14) Carefully pipette 25. mu.L of the supernatant into a new PCR tube and store at-20 ℃ until use.

6, PCR amplification;

(1) using NEBUltra^TMII

Master Mix (cat # M0544) was subjected to PCR amplification.

PCR Mix was prepared as in Table 8, and 5. mu.L of purified ligation product was added.

TABLE 8

Serial number	Name (R)	Dosage (. mu.L)/sample	Final concentration
				1	NEBNext Ultra Q5Master Mix	25	1×
2	Forward Primer(10μM)	5	1μM
				3	Reverse Primer(10μM)	5	1μM
4	Adaptor-ligated DNA	10
				5	Nuclease-free water	5
	Total volume	50

(2) The PCR tubes were vortexed and mixed, centrifuged briefly, and PCR amplified according to the conditions in Table 9.

TABLE 9

Purifying PCR products;

similar to step 5, the description is omitted here.

8. Controlling the quality of the library;

using a Qubit^TMThe quantitative library detection was performed with the dsDNA BR Assay Kit (cat # Q32850), and the size of the library fragment was determined with the Agilent 2100 Bioanalyzer Instruments.

9. Library pooling and on-machine sequencing

Mixing the libraries at equal molar concentrations, and performing machine sequencing; sequencing was performed using Illumina HiSeq2500, reading PE125 in length. Sixthly, data analysis and processing

The data were resolved according to Index, reads alignment was performed using SHRIMP V2.04, and possible methylated CpG sites were analyzed based on the alignment.

The validation results show that 26 CpG sites are found to have significant difference (P <0.01) in methylation frequency between the colorectal cancer tissue sample and the adjacent normal tissue sample, and between the advanced adenoma tissue sample and the adjacent normal tissue sample (see FIGS. 4 and 5). It follows that this methylated sequence can be used for the auxiliary diagnosis of early colorectal cancer.

Tables 10, 11 below are: methylation frequency of BMP3 promoter region in colorectal cancer tissue samples, advanced adenoma tissue samples and adjacent normal tissue samples, wherein the methylation frequency refers to the number of methylated samples of CpG island/total number of methylated samples.

Watch 10

TABLE 11

The relative sites of early colorectal cancer and BMP3 gene methylation sequence are as follows:

remarking:^mCG indicates that the C of the CpG island is methylated.

The BMP3 gene methylated CpG sites are suggested to be a molecular marker for the auxiliary diagnosis of early colorectal cancer; then, primers and probes were designed for the sequences corresponding to these 26 methylation sites, and qPCR validation was performed.

Seventhly, carrying out qPCR verification on methylated CpG islands in a BMP3 gene promoter region in a tissue sample;

MSP (Methylation-Specific PCR) primers and probes are designed aiming at CpG island sites found in a BMP3 gene promoter region sequence, internal quality control is set simultaneously, and a B2M gene is used as an internal reference gene; the primer probe combinations were screened using 191 tissue samples, extracted DNA was bisulfite treated, and fluorescence quantitative PCR validation was performed using 3 pairs of primer probe combinations of the preferred design.

Step one, extracting genome DNA from 191 tissue samples by adopting a TaKaRa MiniBEST FFPE DNA Extraction Kit;

designing primers, probes, positive quality control and negative quality control of a methylation sequence of a BMP3 gene;

internal quality control, using B2M gene as reference gene, the base sequence is the No. of NG _012920.1 from 3886 to 4010 of the gene sequence number in NCBI database, C in the corresponding sequence except CG is converted into T; designing an internal control primer and an internal control probe aiming at the converted sequence, and screening the internal control upstream primer and the internal control downstream primer, so that a non-template system (NTC) has no obvious amplification curve (no line drawing), and a sample has an obvious amplification curve (line drawing) and is normal.

Designing primers and probes of a methylation sequence of the BMP3 gene;

the BMP3 primers comprise: BMP3 forward primer, BMP3 reverse primer;

the BMP3 forward primer comprises:

SEQ ID NO.1：AAATAAAGCGAGGAGGGAAGG；

SEQ ID NO.2：GAGACGGCGTTCGTAGCG；

SEQ ID NO.3：AGCGTTGGAGTGGAGACGG；

the BMP3 reverse primer comprises:

SEQ ID NO.4：CCCAACAACTACGCGAACC；

SEQ ID NO.5：CGAAATAACGACCAACCCCAC；

SEQ ID NO.6：AAACCCGAAACGCGACC；

the BMP3 probe included:

SEQ ID NO.7：TCGGGTTATATACGTCGCGA；

SEQ ID NO.8：GTTCGCGTAGTTGTTGGG；

SEQ ID NO.9：GTGAGGTTCGCGTAGTTGTTG；

primer-probe combination 1: forward primer sequence: SEQ ID No. 1; reverse primer sequence: SEQ ID No. 4; the probe sequence is as follows: SEQ ID No. 7;

primer-probe combination 2: forward primer sequence: SEQ ID No. 2; reverse primer sequence: SEQ ID No. 5; the probe sequence is as follows: SEQ ID No. 8;

primer probe combination 3: forward primer sequence: SEQ ID No. 3; reverse primer sequence: SEQ ID No. 6; the probe sequence is as follows: SEQ ID No. 9;

Step three, treating the extracted genome DNA by bisulfite conversion solution;

the method specifically comprises the following steps:

adding 300 μ L of desulfurization solution (0.3M NaOH in 90% ethanol), standing at room temperature for 30 min, centrifuging at 13000rpm for 90 s, and discarding the waste solution;

10 × PCR buffer: 5 to 10 mu L

MgCl₂：2.0～5.0mmol

dNTP：0.2～0.8mmol

Each primer was: 0.1 to 1.0. mu. mol

Each probe was: 0.1 to 1.0. mu. mol

Fast master Premix：5～10μL

Sample DNA template: 2 μ L

The rest is made up to the total volume with ultrapure water: 20 μ L.

the first stage is as follows: 5min at 95 ℃;

and a second stage: at 95 ℃ for 20s, at 60 ℃ for 40s, for 15 cycles;

the third stage is that 30 cycles of 20s at 95 ℃ and 20s at 58 ℃;

third stage, at 58 ℃ in 30 cycles, the fluorescence signal was collected.

Collecting fluorescence signals, selecting a fluorescence detection mode corresponding to a fluorophore, automatically setting a baseline, manually setting a threshold line, adjusting the threshold line to the rising inflection point of an FAM and JOE amplification curve according to actual conditions, and setting the threshold line at the highest point of a target gene FAM signal exceeding a normal negative control;

automatically setting a base line, manually setting a Threshold line which is a value just exceeding the highest point of the normal negative control, adjusting Threshold to the rising inflection point of the FAM and JOE amplification curves according to the actual condition to obtain a Ct value, and calculating △ Ct value;

the result judgment is that firstly, the JOE corresponding to the internal quality control B2M gene has an obvious amplification curve and the Ct value of the JOE signal is less than 25, the requirement is met, the FAM signal corresponding to the target gene BMP3 of the positive quality control system has an obvious amplification curve, the JOE corresponding to the internal quality control B2M gene has a difference value of the Ct value of the obvious amplification curve, namely, the Ct value of △ is less than or equal to a critical value, the requirement is met, and the detection result is correct;

FAM of a negative quality control system has no amplification curve, JOE has an obvious amplification curve and the difference of Ct values of JOE signals, namely △ Ct is larger than a critical value, the requirements are met, and the detection result is correct;

and (3) judging the sample, wherein the sample is methylated if the Ct value of △ Ct ═ BMP3 target gene FAM signal-the Ct value of B2M reference gene JOE signal is less than or equal to a critical value, and the sample is unmethylated if the Ct value of △ Ct ═ BMP3 target gene FAM signal-the Ct value of B2M reference gene JOE signal is greater than the critical value.

191 samples of tissues are detected by using 3 groups of primer probe combinations, Ct values of target genes and internal reference genes of each sample are counted, △ Ct values are calculated, namely the Ct value of a BMP3 target gene FAM signal-the Ct value of a B2M internal reference gene JOE signal, the Ct value of △ of a detection result is counted, △ Ct value is used as a detection variable, a pathological result is used as a state variable, a ROC curve is used for analyzing △ Ct value, the three combined detection results are integrated, △ Ct value corresponding to Cutoff is used as 9, and the performance result analysis of the methylation level and the correlation of the intestinal cancer and the advanced adenoma is shown in a table 12, and the performance index of the primer probe combination 3 is better by comparison.

TABLE 12

Remarking:

primer-probe combination 1: a forward primer: SEQ ID NO.1+ reverse primer: SEQ ID NO.4+ Probe: SEQ ID No. 7;

primer-probe combination 2: a forward primer: SEQ ID NO.2+ reverse primer: SEQ ID NO.5+ Probe: SEQ ID No. 8;

primer probe combination 3: a forward primer: SEQ ID NO.3+ reverse primer: SEQ ID No. 6; and (3) probe: SEQ ID No. 9;

sensitivity is methylation detection positive (true positive) sample/total positive sample;

specificity is the sample that is negative for methylation detection (true negative)/total negative sample.

Experiment two: qPCR test of BMP3 promoter region methylated CpG islands in fecal samples;

millions of cells are shed by the average person from the colon wall into the excretory system, including cells in the process of intestinal neoplasia, every day. After entering the excretory system, the cells contain the corresponding DNA, which contains genetic information closely related to the tumor, reflecting the process of colorectal cancer or tumor formation. Early intestinal cancer cells, which are a precursor of intestinal cancer, have methylation changes in some genes and naturally shed into the intestinal tract and excreted together with feces. By detecting these DNA markers, the presence of colorectal cancer, tumor, or the like in the intestinal wall can be detected. Therefore, the DNA is extracted from the excrement for tumor-related gene detection, so that noninvasive, noninvasive and painless sampling at home can be realized, the hospital is not required to be visited, and the restriction of diet or medication is not required. The human biological sample comprises: tissues, cells, blood, secretions and excretions; wherein the excrement is feces. Preferably, the stool sample is preferred for non-invasiveness and low cost convenience.

In order to verify that the fecal sample can accurately realize early detection of colorectal cancer, the following experiment is carried out:

collecting feces samples (sample information is shown in table 13) of 49 colorectal cancer patients, 20 advanced adenoma patients and 51 healthy people (samples with age more than 40 years old and negative results), carrying out qPCR (quantitative polymerase chain reaction) test on the section of verified methylated CpG island (see a flow chart shown in figure 1), taking a B2M gene as an internal reference gene in a detection system, automatically setting a base line for data, manually setting a critical value line, adjusting Threshold to the rising inflection point of FAM and JOE amplification curves according to actual conditions to obtain a Ct value, and calculating a △ Ct value, namely the difference value between the Ct value of a BMP3 target gene (FAM signal) and the Ct value of a B2M internal reference gene (JOE signal), wherein a methylated sample is obtained if the Ct value is △ is not more than the critical value, and a methylated sample is obtained if the Ct value is △ Ct > is a sample without methylation.

Watch 13

Extracting genome DNA from a fecal sample;

repeating the previous step for 1 time;

repeating the previous step for 2 times;

Designing primers and probes of a methylation sequence of the BMP3 gene;

the BMP3 primers comprise: BMP3 forward primer, BMP3 reverse primer;

the BMP3 forward primer comprises:

SEQ ID NO.1：AAATAAAGCGAGGAGGGAAGG；

SEQ ID NO.2：GAGACGGCGTTCGTAGCG；

SEQ ID NO.3：AGCGTTGGAGTGGAGACGG；

the BMP3 reverse primer comprises:

SEQ ID NO.4：CCCAACAACTACGCGAACC；

SEQ ID NO.5：CGAAATAACGACCAACCCCAC；

SEQ ID NO.6：AAACCCGAAACGCGACC；

the BMP3 probe included:

SEQ ID NO.7：TCGGGTTATATACGTCGCGA；

SEQ ID NO.8：GTTCGCGTAGTTGTTGGG；

SEQ ID NO.9：GTGAGGTTCGCGTAGTTGTTG；

Step three, treating the extracted genome DNA by bisulfite conversion solution;

the method specifically comprises the following steps:

10 × PCR buffer: 5 to 10 mu L

MgCl₂：2.0～5.0mmol

dNTP：0.2～0.8mmol

Each primer was: 0.1 to 1.0. mu. mol

Each probe was: 0.1 to 1.0. mu. mol

Fast master Premix：5～10μL

Sample DNA template: 2 μ L

The rest is made up to the total volume with ultrapure water: 20 μ L.

the first stage is as follows: 5min at 95 ℃;

and a second stage: at 95 ℃ for 20s, at 60 ℃ for 40s, for 15 cycles;

the third stage is that 30 cycles of 20s at 95 ℃ and 20s at 58 ℃;

third stage, at 58 ℃ in 30 cycles, the fluorescence signal was collected.

The method comprises the steps of detecting 120 cases of excrement samples by using 3 pairs of primer probe combinations, counting Ct values of target genes and internal reference genes of each sample, calculating △ Ct values, namely the Ct value of a BMP3 target gene FAM signal-the Ct value of a B2M internal reference gene JOE signal, counting △ Ct values of detection results, analyzing △ Ct values by using an ROC curve by using △ Ct values as detection variables and pathological results as state variables, integrating the three combined detection results, analyzing the methylation level and the correlation performance results of intestinal cancer and advanced adenoma by using △ Ct values corresponding to Cutoff as 9, and comparing the performance indexes of the primer probe combination 3 to obtain better results, wherein the results are shown in a table 14.

TABLE 14

Remarking:

The method is used for assisting in diagnosing early colorectal cancer by detecting methylation of a methylation sequence in a BMP3 gene promoter region; the invention extracts DNA from a fecal sample; the detection mode is non-invasive, and can not bring pain to patients; the primer and the probe designed by the invention can be complementary with a site to be detected, and have high sensitivity and high specificity; the detection method of the present invention treats a DNA fragment with bisulfite so as to convert cytosine in a DNA sample into uracil while 5 'methylcytosine is unchanged, obtaining a converted DNA fragment, converting cytosine in a DNA sample into uracil while 5' methylcytosine is unchanged; the method judges whether methylation occurs in a sample and the methylation level by carrying out real-time quantitative PCR detection and calculating the difference value between the Ct value of a BMP3 target gene (FAM signal) and the Ct value of a B2M reference gene (JOE signal); the detection has the advantages of high flux and high sensitivity, does not need operations such as electrophoresis, hybridization and the like after PCR, and reduces pollution and operation errors.

The foregoing illustrates and describes the principles, general features, and advantages of the present invention. It should be understood by those skilled in the art that the above embodiments do not limit the present invention in any way, and all technical solutions obtained by using equivalent alternatives or equivalent variations fall within the scope of the present invention.

Claims

1. Application of a product for detecting BMP3 gene methylation sites in preparing a product for early detection of colorectal cancer is characterized in that,

the methylation sequence of BMP3 gene is as follows:

GTTAGTTTGGT^mCGGGTGTTTTTAAAAATAAAG^mCGAGGAGGGAAGGTATAGATAGATTTTGAAAATATT^mCGGGTTATATA^mCGT^mCG^mCGATTTATAGTTTTTTTTTAG^mCGTTGGAGTGGAGA^mCGG^mCGTT^mCGTAG^mCGTTTTG^mCG^mCGGGTGAGGTT^mCG^mCGTAGTTGTTGGGGAAGAGTTTATTTGTTAGGTTG^mCGTTGGGTTAG^mCGTAGTAAGTGGGGTTGGT^mCGTTATTT^mCGTTGTATT^mCGGT^mCG^mCGTTT^mCGGGTTT^mCGTG^mCGTTTT^mCGTTTTAG；

the detection method of the product comprises the following steps:

step one, extracting genome DNA from a biological sample;

designing primers and probes of a BMP3 gene methylation sequence, and carrying out positive quality control, negative quality control and internal quality control;

internal quality control, using B2M gene as reference gene, the base sequence is the No. of NG _012920.1 from 3886 to 4010 of the gene sequence number in NCBI database, C in the corresponding sequence except CG is converted into T; designing an internal quality control primer and an internal quality control probe aiming at the converted sequence, and screening the internal control upstream and downstream primers to ensure that a non-template system has no obvious amplification curve, and if a sample has an obvious amplification curve, judging the sample to be normal;

the BMP3 primers comprise: BMP3 forward primer, BMP3 reverse primer;

the BMP3 forward primer comprises:

SEQ ID NO.1：AAATAAAGCGAGGAGGGAAGG；

SEQ ID NO.2：GAGACGGCGTTCGTAGCG；

SEQ ID NO.3：AGCGTTGGAGTGGAGACGG；

the BMP3 reverse primer comprises:

SEQ ID NO.4：CCCAACAACTACGCGAACC；

SEQ ID NO.5：CGAAATAACGACCAACCCCAC；

SEQ ID NO.6：AAACCCGAAACGCGACC；

the BMP3 probe included:

SEQ ID NO.7：5’-TCGGGTTATATACGTCGCGA-3’；

SEQ ID NO.8：5’-TCGGGTTATATACGTCGCGA-3’；

SEQ ID NO. 9: 5'-GTGAGGTTCGCGTAGTTGTTG-3', probes are all labeled with FAM;

the positive standard substance of BMP3 positive quality control is a nucleotide sequence containing SEQ ID NO. 10; GTTAGTTTGGTCGGGTGTTTTTAAAAATAAAGCGAGGAGGGAAGGTATAGATAGATTTTGAAAATATTCGGGTTATATACGTCGCGATTTATAGTTTTTTTTTAGCGTTGGAGTGGAGACGGCGTTCGTAGCGTTTTGCGCGGGTGAGGTTCGCGTAGTTGTTGGGGAAGAGTTTATTTGTTAGGTTGCGTTGGGTTAGCGTAGTAAGTGGGGTTGGTCGTTATTTCGTTGTATTCGGTCGCGTTTCGGGTTTCGTGCGTTTTCGTTTTAG, respectively;

the negative standard substance of BMP3 negative quality control is a nucleotide sequence containing SEQ ID NO. 11; GTTAGTTTGGTTGGGTGTTTTTAAAAATAAAGTGAGGAGGGAAGGTATAGATAGATTTTGAAAATATTTGGGTTATATATGTTGTGATTTATAGTTTTTTTTTAGTGTTGGAGTGGAGATGGTGTTTGTAGTGTTTTGTGTGGGTGAGGTTTGTGTAGTTGTTGGGGAAGAGTTTATTTGTTAGGTTGTGTTGGGTTAGTGTAGTAAGTGGGGTTGGTTGTTATTTTGTTGTATTTGGTTGTGTTTTGGGTTTTGTGTGTTTTTGTTTTAG, respectively;

the forward internal quality control primer is SEQ ID NO. 12: TTGTGGATTTTATTATTAYGAAATGG, respectively;

the reverse internal quality control primer is SEQ ID NO. 13: AAACTACATCTACCTTAAACCCAACC, respectively;

the internal quality control probe is a nucleotide sequence SEQ ID NO. 14: 5'-GTATTTTATTTATGGTTATTTTAGAGGGT-3', marker JOE;

the standard substance of internal quality control is a nucleotide sequence containing SEQ ID NO. 15: AGAAAAGATTTGTGGATTTTATTATTACGAAATGGCGGTATTTTATTTATGGTTATTTTAGAGGGTAGGTTTTTTTAATGGGTTTGTTTGTTATGTTTAACGTTTTTGGTTGGGTTTAAGGTAGATGTAGTTTAAATTTTTATTAAAATTGTCGAG, respectively;

step three, treating the extracted genome DNA by a transformation liquid so as to convert cytosine in the DNA into uracil, wherein 5' methylcytosine is unchanged;

automatically setting a base line, manually setting a Threshold line value line, adjusting Threshold to the rising inflection point of the FAM and JOE amplification curve according to the actual situation to obtain a Ct value, and calculating △ Ct value, wherein the Ct value is △ Ct value of a FAM signal of a BMP3 target gene-the Ct value of a JOE signal of a reference gene in B2M;

and (3) sample judgment, wherein △ Ct (Ct value of BMP3 target gene FAM signal) -B2M reference gene JOE signal Ct value is less than or equal to a critical value, the sample is methylated, and is judged to be positive for early diagnosis of colorectal cancer, △ Ct (Ct value of BMP3 target gene FAM signal Ct value-B2M reference gene JOE signal Ct value > critical value, the sample is unmethylated, and is judged to be negative for early diagnosis of colorectal cancer, and the critical value is △ Ct value corresponding to 1% proportion methylation reference substance with the detection concentration of the BMP3 gene detection system of 5 ng/mu L.

2. Use of the product for detecting the methylation site of BMP3 gene according to claim 1, wherein the cut-off value is 9.

3. The use of the product for detecting the methylation site of BMP3 gene according to claim 1, for preparing a product for early detection of colorectal cancer,

step one, extracting genome DNA from a tissue sample;

the method comprises the following specific steps:

placing Spin Column on the Collection Tube, transferring the lower aqueous phase solution of the sample into the Spin Column, centrifuging at 12000rpm for 2 minutes at room temperature, and removing the filtrate;

centrifuging at 12000rpm for 2 minutes at room temperature, and eluting DNA;

4. The use of the product for detecting the methylation site of BMP3 gene according to claim 1, for preparing a product for early detection of colorectal cancer,

step one, extracting genome DNA from a fecal sample;

adding 4-6g of a fecal sample into 40mL of lysate, carrying out vortex oscillation, fully and uniformly mixing, and then incubating for 16 hours at 50 ℃;

transferring 9mL of supernatant into a new 50mL centrifuge tube, respectively adding 1mL of extraction adjuvant solution, 60 μ L of magnetic bead solution and 10mL of isopropanol, carrying out vortex oscillation for 10sec, incubating at 65 ℃ for 20min, turning the centrifuge tube upside down and uniformly mixing once every 5min during incubation, after the incubation is finished, placing the 50mL centrifuge tube on a magnetic frame, standing for 3min, and discarding the waste liquid after the magnetic beads are fully adsorbed on the tube wall;

repeating the previous step for 1 time;

repeating the previous step for 2 times;

5. The use of the product for detecting the methylation site of BMP3 gene according to claim 1, for preparing a product for early detection of colorectal cancer,

taking out the extracted genome DNA from a refrigerator, thawing, diluting the DNA concentration to 20 ng/. mu.L, adding 40. mu.L of the diluted DNA solution into a 1.5mL centrifuge tube, then adding 4. mu.L of 3M NaOH solution, and incubating at 42 ℃ for 20 min;

6. The use of the product for detecting the methylation site of BMP3 gene according to claim 1, for preparing a product for early detection of colorectal cancer,

the quantitative PCR detection comprises the following specific steps:

10 × PCR buffer: 5 to 10 mu L

MgCl₂：2.0～5.0mmol

dNTP：0.2～0.8mmol

Each primer was: 0.1 to 1.0. mu. mol

Each probe was: 0.1 to 1.0. mu. mol

Fast master Premix：5～10μL

Sample DNA template: 2 μ L

The rest is made up to the total volume with ultrapure water: 20 mu L of the solution;

the real-time fluorescent PCR amplification reaction conditions are as follows:

the first stage is as follows: 5min at 95 ℃;

and a second stage: at 95 ℃ for 20s, at 60 ℃ for 40s, for 15 cycles;

the third stage is that 30 cycles of 20s at 95 ℃ and 20s at 58 ℃;

third stage, at 58 ℃ in 30 cycles, the fluorescence signal was collected.