CN108660209A - Colorectal cancer early detection method based on BMP3 gene methylation sequences - Google Patents
Colorectal cancer early detection method based on BMP3 gene methylation sequences Download PDFInfo
- Publication number
- CN108660209A CN108660209A CN201810502359.7A CN201810502359A CN108660209A CN 108660209 A CN108660209 A CN 108660209A CN 201810502359 A CN201810502359 A CN 201810502359A CN 108660209 A CN108660209 A CN 108660209A
- Authority
- CN
- China
- Prior art keywords
- bmp3
- dna
- seq
- added
- sample
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/154—Methylation markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Analytical Chemistry (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Microbiology (AREA)
- General Health & Medical Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Pathology (AREA)
- Hospice & Palliative Care (AREA)
- Oncology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of colorectal cancer early detection methods based on BMP3 gene methylation sequences, and whether one section of methylated DNA fragments by detecting the gene promoter areas BMP3 methylate, auxiliary diagnosis early stage colorectal cancer；Detection method is to extract DNA from tissue, fecal sample, after bisulf iotate-treated, carries out real-time quantitative PCR measurement, by calculating △ Ct values, i.e.,：The difference of the Ct values of the FAM signals of BMP3 target genes and the Ct values of the JOE signals of B2M reference genes, judgement △ Ct values judge methylation level whether in critical value；Such detection mode is noninvasive, can be used for the auxiliary diagnosis of early stage colorectal cancer.
Description
Technical field
The present invention relates to biotechnology and disease detection field, especially a kind of knot based on BMP3 gene methylation sequences
Carcinoma of the rectum early detection method.
Background technology
Colorectal cancer (CRC) is the big malignant tumour in third place in the world, also referred to as colorectal cancer, is happened at colon (large intestine) or straight
It in intestines, usually develops slowly, becomes increasingly conspicuous with the change and environmental problem of food configuration and living habit, cause big
Intestinal cancer incidence rapid growth.Colorectal cancer incidence rate rises year by year in recent years for China, estimation every year there are about 400,000 new cases,
It comes second in China's alimentary system malignant tumour.National Cancer early diagnosis Zao Zhi projects Committee of Experts research report in 2013
It points out, it is 6% that 40 years old Chinese or more people at highest risk, which suffers from progressive stage adenoma and early stage intestinal cancer ratio,.These canceration lesions are cut not in time
It removes, pernicious intestinal cancer will be converted into the case of 90%.Studies have shown that 5 years survival rates of early stage colorectal cancer patients operation can be high
Up to 90% or more, 5 years survival rates only 10% or so of middle and advanced stage patient, and the colorectal cancer of clinical diagnosis about 80% is middle and advanced stage,
This is one of the key factor for causing its death rate high.Since Most patients do not carry out the meaning of cancer morning screening
Know, is just checked to hospital after finding symptom, until when colorectal cancer is made a definite diagnosis, cancer cell has been spread, and Late curative effect unobvious cause
Nearly half patients with bowel cancer life cycle is no more than 5 years.Therefore early detection, early diagnosis and the early treatment of colorectal cancer seem
It is particularly important.
Studies have shown that the early stage of colorectal cancer occurs to exist very with methylating for colorectal cancer related gene promoter region
Important Relations.Bone morphogenetic protein gene (BMP3) belongs to transforming growth factor-β (TGF-β) superfamily member, initially due to tool
There are induced ectopic bone and chondrogenetic ability and is named.Research in recent years shows BMP3 genes and tumorigenesis and turns
Move it is closely related, in colorectal cancer the expression of BMP3 genes all be suppressed, imply that BMP3 gene methylation levels can
The important biomolecule feature occurred as colorectal cancer early stage.
Relevant methylation sites occur with colorectal cancer if can search out, it will be able to for the auxiliary of early stage colorectal cancer
Diagnosis, the present invention is helped to solve this problem.
Invention content
To solve the deficiencies in the prior art, the purpose of the present invention is to provide the knot based on BMP3 gene methylation sequences is straight
Whether intestinal cancer early detection method, the molecular marked compound by detecting the gene promoter areas BMP3 methylate, auxiliary diagnosis
Early stage colorectal cancer；Detection method is to extract DNA from tissue, fecal sample, and after bisulf iotate-treated, it is fixed in real time to carry out
PCR is measured to measure, by calculating the difference of BMP3 target genes (FAM signals) Ct values and B2M reference genes (JOE signals) Ct values,
Whether methylate in judgement sample and methylation level；Such detection mode is noninvasive, can be used for early stage colorectal cancer
Auxiliary diagnosis.
In order to realize that above-mentioned target, the present invention adopt the following technical scheme that：
Colorectal cancer early detection method based on BMP3 gene methylation sequences,
The methylated DNA fragments of BMP3 genes are as follows：
GTTAGTTTGGTmCGGGTGTTTTTAAAAATAAAGmCGAGGAGGGAAGGTATAGATAGATTTTGAAAATATTmCGGGTTA
TATAmCGTmCGmCGATTTATAGTTTTTTTTTAGmCGTTGGAGTGGAGAmCGGmCGTTmCGTAGmCGTTTTGmCGmCGGGT
GAGGTTmCGmCGTAGTTGTTGGGGAAGAGTTTATTTGTTAGGTTGmCGTTGGGTTAGmCGTAGTAAGTGGGGTTGGTmC
GTTATTTmCGTTGTATTmCGGTmCGmCGTTTmCGGGTTTmCGTGmCGTTTTmCGTTTTAG
mCG indicates that the modification that methylates has occurred in the C on the islands CpG；
Diagnostic method includes the following steps：
Step 1 extracts genomic DNA from biological sample；
Step 2 designs the primer and probe of BMP3 gene methylation sequences；
Step 3 handles the genomic DNA of extraction by conversion fluid；
Conversion fluid treated DNA is carried out quantitative PCR detection by step 4；
Step 5, result judgement：
Automatic setting baseline, manual setting threshold line adjust threshold line to FAM and JOE amplification curves according to actual conditions
At the inflection point of rise, and the threshold line of target gene FAM signals requires more than the threshold value set at the peak of normal negative control
Line；
According to the quantitative PCR detection signal of sample to be tested, reach the cycle-index needed for given threshold line, obtains Ct values；
If Ct values≤critical value of the Ct value-B2M reference gene JOE signals of △ Ct=BMP3 target gene FAM signals,
The sample is the sample that methylates, and is judged as that colorectal cancer early diagnosis is positive；
If the Ct values of the Ct value-B2M reference gene JOE signals of △ Ct=BMP3 target gene FAM signals>Critical value, then
The sample is the sample that do not methylate, is judged as that colorectal cancer early diagnosis is negative；
Critical value is that 1% ratio that BMP3 genetic test system detectable concentrations are 5ng/ μ L methylates the corresponding △ of reference material
Ct values.
Colorectal cancer early detection method based on BMP3 gene methylation sequences,
The methylated DNA fragments of BMP3 genes are as follows：
GTTAGTTTGGTmCGGGTGTTTTTAAAAATAAAGmCGAGGAGGGAAGGTATAGATAGATTTTGAAAATATTmCGGGTTA
TATAmCGTmCGmCGATTTATAGTTTTTTTTTAGmCGTTGGAGTGGAGAmCGGmCGTTmCGTAGmCGTTTTGmCGmCGGGT
GAGGTTmCGmCGTAGTTGTTGGGGAAGAGTTTATTTGTTAGGTTGmCGTTGGGTTAGmCGTAGTAAGTGGGGTTGGTmC
GTTATTTmCGTTGTATTmCGGTmCGmCGTTTmCGGGTTTmCGTGmCGTTTTmCGTTTTAG
mCG indicates that the modification that methylates has occurred in the C on the islands CpG；
Diagnostic method includes the following steps：
Step 1 extracts genomic DNA from biological sample；
Step 2 designs the primer of BMP3 gene methylation sequences, probe, positive quality control and negative Quality Control；
Inner quality control uses B2M genes as reference gene, and base sequence is that gene order number is in ncbi database
C is converted into T in sequence other than NG_012920.1 the 3886 to 4010th, corresponding sequence C G；It is set for the sequence of this section of conversion
Internal control primer and internal control probe are counted, and the upstream and downstream primer of internal control is screened, keeps non-masterplate system not apparent
Amplification curve, sample have apparent amplification curve normal；
Step 3 handles the genomic DNA of extraction by conversion fluid；
Conversion fluid treated DNA is carried out quantitative PCR detection by step 4；
Step 5, result judgement：Whether first judgement sample meets the requirements, if BMP3 pairs of the target gene of positive quality control system
The FAM signals answered have apparent amplification curve, and the corresponding JOE of inner quality control B2M genes has apparent amplification curve, and JOE believes
Number Ct values difference, i.e. △ Ct≤critical value then meet the requirements, and testing result is correct, which is the sample that methylates, and is judged
It is early diagnosed for colorectal cancer positive；
If the FAM of negative quality control system is without amplification curve, JOE has apparent amplification curve, and the difference of the Ct values of JOE signals
Value, i.e. △ Ct ＞ critical values, then meet the requirements, and testing result is correct, which is the sample that methylates, and is judged as colorectal cancer morning
Phase diagnosis is negative；
Critical value is that 1% ratio that BMP3 genetic test system detectable concentrations are 5ng/ μ L methylates the corresponding △ of reference material
Ct values.
Colorectal cancer early detection method above-mentioned based on BMP3 gene methylation sequences, critical value 9.
Colorectal cancer early detection method above-mentioned based on BMP3 gene methylation sequences,
Step 1 extracts genomic DNA from tissue samples；
Genomic DNA is extracted from FFPE samples using TaKaRa MiniBEST FFPE DNA Extraction Kit；
It is as follows：
The paraffin section tissue that 30mg is scraped with sterilizing scalpel, removes extra paraffin；
Paraffin section tissue is put into the centrifuge tube of 1.5mL, 500 μ L Buffer DP of addition, in 80 DEG C of water after mixing
Bath 1 minute, be vortexed concussion 10 seconds while hot, and 180 μ LBuffer GL are added, and be vortexed concussion；
Then 12000rpm room temperatures centrifuge 1 minute, and solution is formed two layers, upper oil phase, lower layer's water phase, into lower layer's water phase
It is added 20 μ L Proteinase K, 20mg/mL and 10 μ L RNase, 10mg/mL, mixing is beaten in suction, then 56 DEG C of water-baths 1 hour,
Will treated 90 DEG C of sample water-bath 30 minutes, be cooled to room temperature；
200 μ 100% ethyl alcohol of L Buffer GB and 200 μ L are added in the sample of processing, be vortexed concussion 10 seconds；
Then 12000rpm room temperatures centrifuge 1 minute, and solution is formed two layers, upper oil phase, lower layer's water phase；
Spin Column are placed on Collection Tube, lower layer's aqueous phase solution of sample is moved into Spin
In Column, then 12000rpm room temperatures centrifuge 2 minutes, abandon filtrate；
The Buffer WA of 500 μ L are added in Spin Column, 12000rpm room temperatures centrifuge 1 minute, abandon filtrate；
The Buffer WB of 500 μ L are added in Spin Column, 12000rpm room temperatures centrifuge 1 minute, abandon filtrate；
Previous step is repeated, the Buffer WB of 500 μ L are added in Spin Column, 12000rpm room temperatures centrifuge 1 minute,
Abandon filtrate；
Spin Column are placed on Collection Tube, 12000rpm room temperatures centrifuge 2 minutes；
Spin Column are placed on new 1.5mL centrifuge tubes, 50- is added in the centre of Spin Column films
100 μ L aqua sterilisas or Elution Buffer are stored at room temperature 5 minutes；
12000rpm room temperatures centrifuge 2 minutes, eluted dna；
DNA solution Nanodrop detectable concentrations and the purity that centrifugation is obtained；
The qualified DNA of detection is stored in -20 DEG C of refrigerators, it is spare.
Colorectal cancer early detection method above-mentioned based on BMP3 gene methylation sequences,
Step 1 extracts genomic DNA from fecal sample；
Take fecal sample (4-6g) that lysate 40mL is added, vortex oscillation is incubated 16 hours for 50 DEG C after mixing well；
5000rpm centrifuges 10min after incubation, pays attention to weighing balance before centrifuging, after centrifugation, carefully take out from
Heart pipe does not shake acutely；
9mL supernatants are pipetted in new 50mL centrifuge tubes, then be separately added into 1mL extraction assist liquid, 60 μ L magnetic beads liquid and
10mL isopropanols, vortex vibrate 10sec, 65 DEG C of incubation 20min, and incubation period is primary every the 5min mixings that turn upside down.
After incubation, 50mL centrifuge tubes are placed on magnetic frame, 3min is stood, waits for that magnetic bead is fully adsorbed on tube wall,
Abandon waste liquid；
Centrifuge tube is taken out from magnetic frame, 12mL cleaning solutions are added, vortex oscillation falls off up to magnetic bead from tube wall, quiet
3min is set, is placed again into magnetic frame, 3min is stood, waits for that magnetic bead is fully adsorbed on tube wall, abandon waste liquid；
Add 15mL80% ethanol solutions, for vortex oscillation until magnetic bead falls off from tube wall, standing 3min places into magnetic frame
In, 3min is stood, waits for that magnetic bead is fully adsorbed on tube wall, abandons waste liquid；
Repeat previous step 1 time；
Bottom residual liquid is exhausted with pipettor, is uncapped, 5min will be incubated in 65 DEG C of centrifuge tube, is taken after magnetic bead drying
Go out, the eluent I of 1.5mL preheatings is added, magnetic bead is purged from tube wall with 1000 μ L pipettors, is aspirated repeatedly, together with
Magnetic bead is transferred to together in 2mL centrifuge tubes, is closed 65 DEG C of incubation 5min of centrifuge tube lid；
13000rpm centrifuges 3min, pipettes 600 μ L supernatants to new 1.5mL centrifuge tubes, 600 μ L column combination liquid are added,
It mixes well；
It shifts in 600 μ L mixed liquors to DNA purification columns, 13000rpm centrifuges 1min, abandons waste liquid；
90% ethanol solution of 600 μ L is added into DNA purification columns, 13000rpm centrifuges 1min, abandons waste liquid；
Repeat previous step 2 times；
13000rpm centrifuges 3min, and DNA purification columns are put into new 1.5mL centrifuge tubes, opens the 65 DEG C of incubations of centrifuge tube lid
5min, drying；
The eluent II that 100 μ L are preheated vacantly is added dropwise to DNA purification columns centre position, is closed 65 DEG C of incubation 5min of lid,
13000rpm centrifuges 2min, and the DNA solution after must eluting, 2~8 DEG C save backup, if long-term preservation need to be stored in -25~-15
℃。
Colorectal cancer early detection method above-mentioned based on BMP3 gene methylation sequences,
Step 2 designs the primer and probe of the methylated DNA fragments of BMP3 genes；
BMP3 primers include：BMP3 forward primers, BMP3 reverse primers；
BMP3 forward primers include：
SEQ ID NO.1：AAATAAAGCGAGGAGGGAAGG；
SEQ ID NO.2：GAGACGGCGTTCGTAGCG；
SEQ ID NO.3：AGCGTTGGAGTGGAGACGG；
BMP3 reverse primers include：
SEQ ID NO.4：CCCAACAACTACGCGAACC；
SEQ ID NO.5：CGAAATAACGACCAACCCCAC；
SEQ ID NO.6：AAACCCGAAACGCGACC；
BMP3 probes include：
SEQ ID NO.7：TCGGGTTATATACGTCGCGA；
SEQ ID NO.8：GTTCGCGTAGTTGTTGGG；
SEQ ID NO.9：GTGAGGTTCGCGTAGTTGTTG；
Colorectal cancer early detection method above-mentioned based on BMP3 gene methylation sequences,
The forward primer of BMP3 is that the reverse primer of SEQ ID NO.3, BMP3 are SEQ ID NO.6；
BMP3 probes are SEQ ID NO.9.
Colorectal cancer early detection method above-mentioned based on BMP3 gene methylation sequences,
The positive criteria object of BMP3 is the nucleotide sequence containing SEQ ID NO.10；
GTTAGTTTGGTCGGGTGTTTTTAAAAATAAAGCGAGGAGGGAAGGTATAGATAGATTTTGAAAATATTCGGGTTATA
TACGTCGCGATTTATAGTTTTTTTTTAGCGTTGGAGTGGAGACGGCGTTCGTAGCGTTTTGCGCGGGTGAGGTTCGC
GTAGTTGTTGGGGAAGAGTTTATTTGTTAGGTTGCGTTGGGTTAGCGTAGTAAGTGGGGTTGGTCGTTATTTCGTTG
TATTCGGTCGCGTTTCGGGTTTCGTGCGTTTTCGTTTTAG；
Negative standards' object of BMP3 is the nucleotide sequence containing SEQ ID NO.11；
GTTAGTTTGGTTGGGTGTTTTTAAAAATAAAGTGAGGAGGGAAGGTATAGATAGATTTTGAAAATATTTGGGTTATA
TATGTTGTGATTTATAGTTTTTTTTTAGTGTTGGAGTGGAGATGGTGTTTGTAGTGTTTTGTGTGGGTGAGGTTTGT
GTAGTTGTTGGGGAAGAGTTTATTTGTTAGGTTGTGTTGGGTTAGTGTAGTAAGTGGGGTTGGTTGTTATTTTGTTG
TATTTGGTTGTGTTTTGGGTTTTGTGTGTTTTTGTTTTAG；
Positive Quality Control primer is SEQ ID NO.12：TTGTGGATTTTATTATTAYGAAATGG；
Reversed Quality Control primer is SEQ ID NO.13：AAACTACATCTACCTTAAACCCAACC；
Quality Control probe is nucleotide sequence SEQ ID NO.14：GTATTTTATTTATGGTTATTTTAGAGGGT；
Quality control standard object contains SEQ ID NO.15：
AGAAAAGATTTGTGGATTTTATTATTACGAAATGGCGGTATTTTATTTATGGTTATTTTAGAGGGTAGGTTTTTTTA
ATGGGTTTGTTTGTTATGTTTAACGTTTTTGGTTGGGTTTAAGGTAGATGTAGTTTAAATTTTTATTAAAATTGTCG
AG。
Colorectal cancer early detection method above-mentioned based on BMP3 gene methylation sequences,
Step 3 handles the genomic DNA of extraction by bisulfite conversion liquid；Specifically comprise the following steps：
The genomic DNA of extraction is taken out from refrigerator and is thawed, dilution DNA concentration to 20ng/ μ L.After taking 40 μ L dilutions
DNA solution is added in 1.5mL centrifuge tubes, and the NaOH solution of 4 μ L 3M, 42 DEG C of incubation 20min are then added；
400 μ L bisulfite conversion liquid are added, mixing, 50 DEG C are protected from light incubation 16 hours；
550 μ L column combination liquid are added, then solution is transferred to DNA purification columns by mixing, 13000rpm is centrifuged 90 seconds, abandoned
After waste liquid, centrifuges 3 minutes again, abandon waste liquid；
600 μ L, 90% ethyl alcohol is added to DNA purification columns, 13000rpm is centrifuged 90 seconds, after abandoning waste liquid, is centrifuged 15 seconds again；
300 μ L doctor solutions, room temperature 30 minutes are added, 13000rpm is centrifuged 90 seconds, abandons waste liquid；
600 μ L, 90% ethyl alcohol is added, 13000rpm is centrifuged 90 seconds, abandons waste liquid, repeats this step 1 time, centrifuges 3 points again
Clock；
DNA purification columns are put into new 1.5mL centrifuge tubes, 40 μ L eluents are added, 50 DEG C are incubated 30 minutes,
13000rpm is centrifuged 90 seconds, and the DNA solution after must converting is saved backup in -20 DEG C.
Colorectal cancer early detection method above-mentioned based on BMP3 gene methylation sequences,
Conversion fluid treated DNA is carried out quantitative PCR detection by step 4；
Quantitative PCR detection specific steps include：
Detection reaction system is prepared, component is as follows in PCR reaction systems：
10 × PCR buffer solutions：5~10 μ L
MgCl2：2.0~5.0mmol
dNTP：0.2~0.8mmol
Each primer：0.1~1.0 μm of ol
Each probe：0.1~1.0 μm of ol
Fast master Premix：5~10 μ L
Sample DNA templates：2μL
Remaining supplies total volume with ultra-pure water：20μL.
Real-time fluorescent PCR amplification reaction condition is preferably：
First stage：95℃5min；
Second stage：95 DEG C of 20s, 60 DEG C of 40s, 15 cycles；
Phase III:95 DEG C of 20s, 58 DEG C of 20s, 30 cycles；
Phase III:When 58 DEG C in 30 cycles, fluorescence signal is collected.
The invention has the beneficial effects that：
The method that the present invention utilizes molecular labeling analyte detection disease, high sensitivity can be detected accurately down to 0.01ng/ μ L
Genomic DNA, the very low sample of the cell to fall off suitable for fecal sample i.e. concentration also can detect accurately；High specificity,
The fecal sample DNA of up to 500ng also can be detected accurately, therefore, it is possible to reduce the process of diluted sample extracts
The directly upper mother liquor of sample can be detected accurately judges by accident without result；
The present invention extracts DNA from tissue, fecal sample；Such detection mode is noninvasive, will not bring pain to patient；
The primer and probe that the present invention designs can have highly sensitive and high specific with site to be measured complementation；
The detection method bisulf iotate-treated DNA fragmentation of the present invention, to be converted to the cytimidine in DNA sample
Uracil, and 5 ' methylcysteins are constant, obtain the DNA fragmentation by conversion, it is phonetic that the cytimidine in DNA sample is converted to urine
Pyridine, and 5 ' methylcysteins are constant；
The present invention is detected by real-time fluorescence quantitative PCR, and △ Ct values are calculated by calculating：△ Ct=BMP3 target genes
Ct values≤critical value of the Ct value-B2M reference gene JOE signals of FAM signals is the sample that methylates；△ Ct=BMP3 targets
The Ct values of the Ct value-B2M reference gene JOE signals of gene FAM signals>Critical value is the sample that do not methylate.This detection side
Method has the advantages that high-throughput and hypersensitivity, without in operations such as PCR rear electrophoresis, hybridization, reducing pollution and operating error；
The present invention is provided with quality-control product, to whether within the allowable range avoid missing inspection and preliminary judgement sample amount of DNA,
Quality-control product is additionally provided with the positive quality control of negative Quality Control and detection primer；In order to avoid false negative and missing inspection, it is equipped with positive quality control,
If positive quality control tests positive is as a result, illustrate detection architecture, there is no problem, is not in false negative result and missing inspection；In order to keep away
Exempt from false positive and missing inspection, be equipped with negative control, there is no problem as a result, illustrating detection architecture if negative control detection is negative；This
The design of sample to detect it is rigorous, effectively avoid missing inspection, false retrieval possibility.
Description of the drawings
Fig. 1 is a kind of flow chart of embodiment of detection method；
Fig. 2 is the islands the CpG prognostic chart of BMP3 promoter region sequences (2000bp) of the present invention；
Fig. 3 is the position view of 4 amplicons in the gene promoter areas BMP3 of the present invention；
Fig. 4 is that percentage occurs for the gene promoter areas BMP3 of the present invention sites CpG in intestinal cancer tissue clinical samples；
Fig. 5 is that percentage occurs for the gene promoter areas BMP3 of the present invention sites CpG in progressive stage adenoma tissue clinical samples
Than；
Fig. 6 is the flow chart that BMP3 gene methylations sequence of the present invention obtains；
Fig. 7 is that the gene promoter areas BMP3 different primers probe combinations of the present invention compare amplification curve；
Fig. 8 is BMP3 gene methylations detection architecture sensitive amplification curve of the present invention；
Fig. 9 is BMP3 gene methylations positive sample amplification curve of the present invention；
Figure 10 is BMP3 gene methylations negative sample amplification curve of the present invention.
Specific implementation mode
Specific introduce is made to the present invention below in conjunction with the drawings and specific embodiments.
Experiment one, as shown in fig. 6, the discovery procedure on the islands BMP3 gene promoter zone methylation CpG is as follows：
One, sample collection
The clinical sample of 191 different courses of disease determined through colonoscopy pathology distribution is had collected, including：50 colorectal cancer groups
Knit sample, 49 pairings close on normal structure, 46 progressive stage adenoma tissue samples, and 46 pairings close on normal structure；
Sample information is as shown in table 1：
Table 1
| Colorectal cancer (CRC) tissue samples | CRC- closes on normal structure | Progressive stage adenoma (AA) tissue samples | AA- closes on normal structure |
| 50 | 49 | 46 | 46 |
It colorectal cancer sample and closes on normal structure sample and progressive stage adenoma sample and closes on normal structure sample information
As shown in table 2：
Table 2
Two, tissue samples extract
Using TaKaRa MiniBEST FFPE DNA Extraction Kit (article No.s：9782) it is carried from FFPE samples
Take genomic DNA.It is as follows：
(1) with the paraffin section tissue of sterilizing scalpel scraping 30mg, extra paraffin is removed as possible.
(2) paraffin section tissue is put into the centrifuge tube of 1.5mL, 500 μ L Buffer DP of addition, in 80 DEG C after mixing
Water-bath 1 minute, be vortexed concussion 10 seconds while hot, and 180 μ LBuffer GL are added, and be vortexed concussion.
(3) and then 12000rpm room temperatures centrifuge 1 minute, and solution forms two layers (upper oil phase, lower layer's water phase), to lower water
20 μ L Proteinase K (20mg/mL) and 10 μ L RNase (10mg/mL) are added in phase, mixing is beaten in suction.It is careful not to destroy
Layering, then 56 DEG C of water-baths 1 hour.
(4) it by step (3) treated 90 DEG C of sample water-bath 30 minutes, is cooled to room temperature.
(5) 200 μ 100% ethyl alcohol of L Buffer GB and 200 μ L are added in the sample handled to step (4), and be vortexed concussion 10
Second.
(6) and then 12000rpm room temperatures centrifuge 1 minute, and solution forms 2 layers (upper oil phase, lower layer's water phases).
(7) Spin Column are placed on Collection Tube, lower layer's aqueous phase solution of step (6) sample is moved
Into Spin Column.It is careful not to get upper oil phase solution, then 12000rpm room temperatures centrifuge 2 minutes, abandon filtrate.
(8) the Buffer WA of 500 μ L are added in Spin Column, 12000rpm room temperatures centrifuge 1 minute, abandon filtrate.
(9) the Buffer WB of 500 μ L are added in Spin Column, 12000rpm room temperatures centrifuge 1 minute, abandon filtrate.
(10) step (9) is repeated.
(11) Spin Column are placed on Collection Tube, 12000rpm room temperatures centrifuge 2 minutes.
(12) Spin Column are placed on new 1.5mL centrifuge tubes, are added in the centre of Spin Column films
50-100 μ L aqua sterilisas or Elution Buffer are stored at room temperature 5 minutes.
(13) 12000rpm room temperatures centrifuge 2 minutes, eluted dna.
(14) DNA solution Nanodrop detectable concentrations and the purity for obtaining centrifugation.
(15) the qualified DNA of detection is stored in -20 DEG C of refrigerators, it is spare.
Three, the prediction of BMP3 promoter regions and design of primers；
(1) prediction on the BMP3 gene promoters area islands CpG
The DNA sequence dna of 2000bp, is shown in sequence SEQ ID NO.16 (being shown in Table 3) before the gene promoter areas download BMP3.With
The islands MethPrimer software prediction CpG, prediction result such as attached drawing 2.By attached drawing 2 as it can be seen that before the islands CpG concentrate on promoter region
The sequence of 879bp.
(2) before promoter region 1000bp sequence amplifications design of primers
4 pairs of primers are designed for the DNA sequence dna of 1000bp.Primer sequence and amplicon are shown in sequence SEQ ID NO.17-SEQ
ID NO.28 (are shown in Table 3).Amplicon relative position such as attached drawing 3.By (2 μM) mixing of 4 pairs of primer isoconcentrations, it is configured to primer
Mix, -20 DEG C save backup.
Table 3
Four, bisulf iotate-treated；
(1) genomic DNA of extraction is taken out from refrigerator and is thawed, dilution DNA concentration to 20ng/ μ L.After taking 40 μ L dilutions
DNA solution be added in 1.5mL centrifuge tubes, be then added the NaOH solution of 4 μ L 3M, 42 DEG C of incubation 20min.
(2) 400 μ L conversion fluids are added, mixing, 50 DEG C are protected from light incubation 16 hours.
(3) 550 μ L column combination liquid are added, then solution is transferred to DNA purification columns by mixing, 13000rpm is centrifuged 90 seconds,
After abandoning waste liquid, centrifuges 3 minutes again, abandon waste liquid.
(4) 600 μ L, 90% ethyl alcohol is added to DNA purification columns, 13000rpm is centrifuged 90 seconds, after abandoning waste liquid, centrifuges 15 again
Second.
(5) be added 300 μ L doctor solutions (90% ethanol solution of 0.3M NaOH), room temperature 30 minutes, 13000rpm from
The heart 90 seconds, abandons waste liquid.
(6) 600 μ L, 90% ethyl alcohol is added, 13000rpm is centrifuged 90 seconds, abandons waste liquid, is repeated this step 1 time, is centrifuged 3 again
Minute.
(7) DNA purification columns are put into new 1.5mL centrifuge tubes, 40 μ L eluents is added, 50 DEG C are incubated 30 minutes,
13000rpm is centrifuged 90 seconds, and the DNA solution after must converting is saved backup in -20 DEG C.
Five, prepared by library is sequenced with upper machine；
1. multiplexed PCR amplification
PCR amplification is carried out according to following system and reaction condition.Multi-PRC reaction uses QIAGEN Multiplex PCR
Kit (article No.s：206143) it carries out.It is as follows：
1) 2 × QIAGEN Multiplex PCR Master Mix, primer Mix are taken out from -20 DEG C, thaw at RT.It is accurate
Get DNA, RNase-free Water after bisulf iotate-treated ready.Before use, by 2 × QIAGEN Multiplex PCR
Master Mix and primer Mix vortex mixings.
2) Master Mix, the of short duration mixing of vortex are prepared according to table 4.
Table 4
| Serial number | Component | Volume (μ L)/reaction | Final concentration |
| 1 | 2×QIAGEN Multiplex PCR Master Mix | 25 | 1× |
| 2 | 10×primer mix(2μM each) | 5 | 0.2μM |
| 3 | RNase-free Water | 10 | |
| 4 | DNA after bisulf iotate-treated | 10 | |
| Total volume | 50 |
1) 40 μ L Master Mix are added into each PCR pipe, the DNA after 10 μ L bisulf iotate-treateds is then added.
3) then vortex mixing PCR pipe is expanded according to the condition of table 5.
Table 5
2. electrophoresis detection PCR product
The agarose gel electrophoresis for preparing 1%, by the PCR product of 5 μ L and 2 μ L 6 × Loading Buffer (producers：
TaKaRa, article No.：9156) it mixes, loading carries out electrophoresis detection, and DNA marker are DL2000DNA Marker (producers：
TaKaRa, article No.：3427Q), 120V electrophoresis 40 minutes.
It, need to be by gel extraction (producer after the PCR product electrophoresis of 45 μ L of residue if electrophoresis detection has non-specific amplification：
QIAGEN, article No.：28704), concrete operations are carried out by kit specification.
3.PCR product purifications with it is quantitative
(1) the MinElute PCR Purification Kit of QIAGEN is used to carry out PCR product purifying (article No.：
28004) it, is carried out according to kit specification.
(2) Qubit is usedTMDsDNA BR Assay Kit kit (article No.s：Q32850 determining for product after purification) is carried out
Amount.
4. connector connects and purifying
(1) use NEB'sQuick Ligation Module (article No.s：E6056L connector connection) is carried out.
Master Mix are prepared according to table 6.
Table 6
| Serial number | Component | Volume (μ L)/reaction |
| 1 | NEBNext Quick Ligation Reaction Buffer(5×) | 10 |
| 2 | Adapter | 5 |
| 3 | Quick T4DNA Ligase | 5 |
| 4 | RNase-free Water | 10 |
| 5 | PCR product after purification | 20 |
| Total volume | 50 |
(2) it by PCR pipe vortex mixing, after of short duration centrifugation, is reacted according to the condition of table 7.
Table 7
| Step | Temperature | Time | Recurring number |
| Step1 | 20℃ | 15min | 1 |
| Step2 | 4℃ | Hold | 1 |
5. connection product purifies；
In advance by Agencourt AMPure XP beads (producers：BECKMAN COULTER, article No.：A63882) from 4
DEG C refrigerator is placed into equilibrium at room temperature.
(1) PCR pipe is centrifuged 1 minute for 20 DEG C in 280g, connection product is made to be collected into tube bottom.
(2) pipettor range is adjusted to 50 μ L, connection product is transferred completely into 96 new orifice plates.
(3) by AMPure XP magnetic bead vortexs mixing 30 seconds, it is ensured that magnetic bead is evenly dispersed.
(4) 56 μ L AMPure XP magnetic beads are added into each sample aperture of 96 orifice plates.
(5) it is gently blown and beaten with pipettor 10 times, mixing.
(6) room temperature is static is incubated 5 minutes.
(7) 96 orifice plates are placed on 96 hole magnetic boards, static 2 minutes, until supernatant is clarified.
(8) it keeps 96 orifice plates to be placed on 96 hole magnetic boards, supernatant is removed with pipettor.
(9) it keeps 96 orifice plates to be placed on 96 hole magnetic boards, 80% ethyl alcohol of the 200 fresh configurations of μ L is added to each sample
Kong Zhong is incubated 30 seconds, then carefully removes supernatant (washing for the first time).
(10) it keeps 96 orifice plates to be placed on 96 hole magnetic boards, 80% ethyl alcohol of the 200 fresh configurations of μ L is added to each sample
It in this hole, is incubated 30 seconds, then carefully removes supernatant, remaining ethyl alcohol (the is removed with the pipettor (10 μ L) with small pipette tips
Secondary washing).
(11) it keeps 96 orifice plates on magnetic board, magnetic bead is allowed to spontaneously dry 10 minutes.
(12) 96 orifice plates are removed from magnetic board, in the 10mM Tris (pH 8.5) to each sample aperture for adding 27.5 μ L.
It is gently blown and beaten with pipettor 10 times, until the complete mixing of magnetic bead.Then room temperature is static is incubated 2 minutes.
(13) 96 orifice plates are placed on magnetic board, static 2 minutes, until supernatant is clarified.
(14) it is carefully drawn with pipettor in 25 μ L supernatants to new PCR pipe, -20 DEG C save backup.
6.PCR is expanded；
(1) use NEB'sUltraTM IIMaster Mix (article No.s：M0544 PCR amplification) is carried out.
PCR is prepared according to table 8 and reacts Mix, and the connection products of 5 μ L after purification are then added.
Table 8
| Serial number | Title | Dosage (μ L)/sample | Final concentration |
| 1 | NEBNext Ultra Q5Master Mix | 25 | 1× |
| 2 | Forward Primer(10μM) | 5 | 1μM |
| 3 | Reverse Primer(10μM) | 5 | 1μM |
| 4 | The DNA of connector connection | 10 | |
| 5 | Nuclease-free water | 5 | |
| Total volume | 50 |
(2) by PCR pipe vortex mixing, after of short duration centrifugation, PCR amplification is carried out according to the condition of table 9.
Table 9
7.PCR product purifications；
Same with step 5, details are not described herein.
8. library Quality Control；
Using QubitTMDsDNA BR Assay Kit kit (article No.s：Q32850) library is carried out quantitatively to detect,
2100 Bioanalyzer Instruments of Agilent carry out library fragments size detection.
It is sequenced with upper machine 9. library merges
After library equimolar concentration is mixed, upper machine sequencing；It is sequenced using Illumina HiSeq2500, reads length
PE125。
Six, data analysis and processing
Data are split according to Index, reads comparisons are carried out using SHRiMP V2.04, according to comparison result point
Analyse possible methylated CpG site.
Verification result show find have 26 sites CpG Colorectal Carcinoma sample and close on normal structure sample, into
There are significant difference (P for duration of an exhibition adenoma tissue samples and the frequency that methylates of closing in normal structure sample<0.01), see Fig. 4,5.
Thus infer, which can be used for the auxiliary diagnosis of early stage colorectal cancer.
The following table 10,11 are：It Colorectal Carcinoma sample, progressive stage adenoma tissue samples and closes in normal structure sample
BMP3 promoter zone methylation frequencies, the frequency that methylates refer to sample number/total sample number that the islands CpG methylate.
Table 10
Table 11
Early stage colorectal cancer and the methylated DNA fragments related locus of BMP3 genes are as follows：
GTTAGTTTGGTmCGGGTGTTTTTAAAAATAAAGmCGAGGAGGGAAGGTATAGATAGATTTTGAAAATATTmCGGGTTA
TATAmCGTmCGmCGATTTATAGTTTTTTTTTAGmCGTTGGAGTGGAGAmCGGmCGTTmCGTAGmCGTTTTGmCGmCGGGT
GAGGTTmCGmCGTAGTTGTTGGGGAAGAGTTTATTTGTTAGGTTGmCGTTGGGTTAGmCGTAGTAAGTGGGGTTGGTmC
GTTATTTmCGTTGTATTmCGGTmCGmCGTTTmCGGGTTTmCGTGmCGTTTTmCGTTTTAG
Remarks：mCG indicates that the modification that methylates has occurred in the C on the islands CpG.
Prompt, the sites BMP3 gene methylation CpG may be a kind of molecular marker of early stage colorectal cancer auxiliary diagnosis；
Then, for this corresponding primers of 26 methylation sites and probe, qPCR verifications are carried out.
Seven, qPCR verification of the islands BMP3 gene promoter zone methylations CpG in tissue samples；
For based on the islands the CpG site found in BMP3 gene promoter region sequences, design MSP (Methylation-
Specific PCR) primer and probe, while inner quality control is set, use B2M genes as reference gene；It is organized using 191
Sample screens primer combination of probe, carries out bisulf iotate-treated to the DNA of extraction, is drawn using 3 Dui of preferred design
Object probe combinations carry out quantitative fluorescent PCR verification.
Step 1,191 tissue tissue samples are carried using TaKaRa MiniBEST FFPE DNA Extraction Kit
Take genomic DNA；
Step 2 designs the primer of the methylated DNA fragments of BMP3 genes, probe, positive quality control and negative Quality Control；
Inner quality control uses B2M genes as reference gene, and base sequence is that gene order number is in ncbi database
C is converted into T in sequence other than NG_012920.1 the 3886 to 4010th, corresponding sequence C G；It is set for the sequence of this section of conversion
Internal control primer and internal control probe are counted, and the upstream and downstream primer of internal control is screened, keeps non-masterplate system (NTC) not bright
Aobvious amplification curve (not initial line), sample have apparent amplification curve (initial line) normal.
Design the primer and probe of the methylated DNA fragments of BMP3 genes；
BMP3 primers include：BMP3 forward primers, BMP3 reverse primers；
The BMP3 forward primers include：
SEQ ID NO.1：AAATAAAGCGAGGAGGGAAGG；
SEQ ID NO.2：GAGACGGCGTTCGTAGCG；
SEQ ID NO.3：AGCGTTGGAGTGGAGACGG；
The BMP3 reverse primers include：
SEQ ID NO.4：CCCAACAACTACGCGAACC；
SEQ ID NO.5：CGAAATAACGACCAACCCCAC；
SEQ ID NO.6：AAACCCGAAACGCGACC；
BMP3 probes include：
SEQ ID NO.7：TCGGGTTATATACGTCGCGA；
SEQ ID NO.8：GTTCGCGTAGTTGTTGGG；
SEQ ID NO.9：GTGAGGTTCGCGTAGTTGTTG；
The positive criteria object of BMP3 is the nucleotide sequence containing SEQ ID No.10；
GTTAGTTTGGTCGGGTGTTTTTAAAAATAAAGCGAGGAGGGAAGGTATAGATAGATTTTGAAAATATTCGGGTTATA
TACGTCGCGATTTATAGTTTTTTTTTAGCGTTGGAGTGGAGACGGCGTTCGTAGCGTTTTGCGCGGGTGAGGTTCGC
GTAGTTGTTGGGGAAGAGTTTATTTGTTAGGTTGCGTTGGGTTAGCGTAGTAAGTGGGGTTGGTCGTTATTTCGTTG
TATTCGGTCGCGTTTCGGGTTTCGTGCGTTTTCGTTTTAG；
Negative standards' object of BMP3 is the nucleotide sequence containing SEQ ID No.11；
GTTAGTTTGGTTGGGTGTTTTTAAAAATAAAGTGAGGAGGGAAGGTATAGATAGATTTTGAAAATATTTGGGTTATA
TATGTTGTGATTTATAGTTTTTTTTTAGTGTTGGAGTGGAGATGGTGTTTGTAGTGTTTTGTGTGGGTGAGGTTTGT
GTAGTTGTTGGGGAAGAGTTTATTTGTTAGGTTGTGTTGGGTTAGTGTAGTAAGTGGGGTTGGTTGTTATTTTGTTG
TATTTGGTTGTGTTTTGGGTTTTGTGTGTTTTTGTTTTAG；
Primer combination of probe 1：Forward primer sequence：SEQ ID NO.1；Reverse primer sequences：SEQ ID NO.4；Probe
Sequence：SEQ ID NO.7；
Primer combination of probe 2：Forward primer sequence：SEQ ID NO.2；Reverse primer sequences：SEQ ID NO.5；Probe
Sequence：SEQ ID NO.8；
Primer combination of probe 3：Forward primer sequence：SEQ ID NO.3；Reverse primer sequences：SEQ ID NO.6；Probe
Sequence：SEQ ID NO.9；
Inner quality control uses B2M genes as reference gene, and base sequence is that gene order number is in ncbi database
C is converted into T in sequence other than NG_012920.1 the 3886 to 4010th, corresponding sequence C G；It is set for the sequence of this section of conversion
Internal control primer and internal control probe are counted, and the upstream and downstream primer of internal control is screened, keeps non-masterplate system (NTC) not bright
Aobvious amplification curve (not initial line), sample have apparent amplification curve (initial line) normal.
Positive Quality Control primer is SEQ ID NO.12：TTGTGGATTTTATTATTAYGAAATGG；
Reversed Quality Control primer is SEQ ID NO.13：AAACTACATCTACCTTAAACCCAACC；
Quality Control probe is nucleotide sequence SEQ ID NO.14：GTATTTTATTTATGGTTATTTTAGAGGGT；
Quality control standard object contains SEQ ID NO.15：
AGAAAAGATTTGTGGATTTTATTATTACGAAATGGCGGTATTTTATTTATGGTTATTTTAGAGGGTAGGTTTTTTTA
ATGGGTTTGTTTGTTATGTTTAACGTTTTTGGTTGGGTTTAAGGTAGATGTAGTTTAAATTTTTATTAAAATTGTCG
AG。
Step 3 handles the genomic DNA of extraction by bisulfite conversion liquid；
Specifically comprise the following steps：
The genomic DNA of extraction is taken out from refrigerator and is thawed, dilution DNA concentration to 20ng/ μ L.After taking 40 μ L dilutions
DNA solution is added in 1.5mL centrifuge tubes, and the NaOH solution of 4 μ L 3M, 42 DEG C of incubation 20min are then added；
400 μ L bisulfite conversion liquid are added, mixing, 50 DEG C are protected from light incubation 16 hours；
550 μ L column combination liquid are added, then solution is transferred to DNA purification columns by mixing, 13000rpm is centrifuged 90 seconds, abandoned
After waste liquid, centrifuges 3 minutes again, abandon waste liquid；
600 μ L, 90% ethyl alcohol is added to DNA purification columns, 13000rpm is centrifuged 90 seconds, after abandoning waste liquid, is centrifuged 15 seconds again；
300 μ L doctor solutions (90% ethanol solution of 0.3M NaOH), room temperature 30 minutes, 13000rpm centrifugations is added
90 seconds, abandon waste liquid；
600 μ L, 90% ethyl alcohol is added, 13000rpm is centrifuged 90 seconds, abandons waste liquid, repeats this step 1 time, centrifuges 3 points again
Clock；
DNA purification columns are put into new 1.5mL centrifuge tubes, 40 μ L eluents are added, 50 DEG C are incubated 30 minutes,
13000rpm is centrifuged 90 seconds, and the DNA solution after must converting is saved backup in -20 DEG C.
Conversion fluid treated DNA is carried out quantitative PCR detection by step 4；
Detection reaction system is prepared, component is as follows in PCR reaction systems：
10 × PCR buffer solutions：5~10 μ L
MgCl2：2.0~5.0mmol
dNTP：0.2~0.8mmol
Each primer：0.1~1.0 μm of ol
Each probe：0.1~1.0 μm of ol
Fast master Premix：5~10 μ L
Sample DNA templates：2μL
Remaining supplies total volume with ultra-pure water：20μL.
Real-time fluorescent PCR amplification reaction condition is preferably：
First stage：95℃5min；
Second stage：95 DEG C of 20s, 60 DEG C of 40s, 15 cycles；
Phase III:95 DEG C of 20s, 58 DEG C of 20s, 30 cycles；
Phase III:When 58 DEG C in 30 cycles, fluorescence signal is collected.
Fluorescence signal is collected, the fluoroscopic examination pattern of corresponding fluorophor is selected, baseline, manual setting threshold value is set automatically
Line is adjusted according to actual conditions at the inflection point that threshold line rises to FAM and JOE amplification curves, and the threshold of target gene FAM signals
Value line requires more than given threshold line at the peak of normal negative control；
Step 5, data processing：Automatic setting baseline, manual setting threshold line value line, the threshold value line are just super
The value for crossing the peak of normal negative control adjusts what Threshold rose to FAM and JOE amplification curves according to actual conditions
At inflection point, Ct values are obtained, calculate △ Ct values；
Result judgement：The corresponding JOE of inner quality control B2M genes has the Ct values of apparent amplification curve and JOE signals first
Less than 25, then meet the requirements；The corresponding FAM signals of target gene BMP3 of positive quality control system have apparent amplification curve, interior
The corresponding JOE of portion's Quality Control B2M genes has the difference of the Ct values of apparent amplification curve, i.e. △ Ct≤critical value then to meet the requirements,
Testing result is correct；
For the FAM of negative quality control system without amplification curve, JOE has the difference of the Ct values of apparent amplification curve and JOE signals,
That is △ Ct ＞ critical values, then meet the requirements, testing result is correct；
Sample judges：The Ct values of the Ct value-B2M reference gene JOE signals of △ Ct=BMP3 target gene FAM signals≤face
Dividing value is the sample that methylates；The Ct values of the Ct value-B2M reference gene JOE signals of △ Ct=BMP3 target gene FAM signals
>Critical value is the sample that do not methylate.
It is detected using 3 groups of primer combination of probe pair, 191 tissue samples, counts each sample object gene and internal reference
The Ct values of gene calculate △ Ct values：That is the Ct values of the Ct value-B2M reference gene JOE signals of BMP3 target genes FAM signals, system
Count the △ Ct values of testing result.Using △ Ct values as test variable, pathological examination is state variable, with ROC curve to △ Ct values into
Row analysis, comprehensive three kinds of combine detections as a result, using the corresponding △ Ct values of Cutoff be 9 analysis of methylation levels with intestinal cancer and into
The results of property analysis of duration of an exhibition adenoma correlation is shown in Table 12, more excellent by the performance indicator for comparing primer combination of probe 3.
Table 12
Remarks：
Primer combination of probe 1：Forward primer：SEQ ID NO.1+ reverse primers：SEQ ID NO.4+ probes：SEQ ID
NO.7；Primer combination of probe 2：Forward primer：SEQ ID NO.2+ reverse primers：SEQ ID NO.5+ probes：SEQ ID
NO.8；Primer combination of probe 3：Forward primer：SEQ ID NO.3+ reverse primers：SEQ ID NO.6；Probe：SEQ ID
NO.9；Sensitivity is sample/total positive sample of DNA methylation assay positive (true positives)；
Specificity is sample/total negative sample of DNA methylation assay negative (true negative).
Experiment two：QPCR test of the islands BMP3 promoter zone methylation CpG in fecal sample；
Ordinary people's cell millions of daily, which is shedded into from colon wall to excretory system, including intestinal canal tumour, to be formed
Cell in the process.Into corresponding DNA is contained in the cell after excretory system, wherein containing the heredity closely related with tumour
Information reflects the forming process of colorectal cancer or tumour.Some genes methylate transformation in early stage colon-cancer cell, are intestinal cancer
Omen, these cells can nature fall in enteron aisle, be discharged together with excrement.By detecting these DNA markers, so that it may with
It was found that the presence in intestinal wall such as colorectal cancer or tumour.Therefore, DNA is extracted from excrement carry out tumor-related gene detection, it can
With realize Noninvasive, it is noninvasive it is painless, facilitate in family and sample, without going to hospital, limited without diet or medication.Human-body biological
Sample includes：Tissue, cell, blood, secretion and excreta；Wherein excreta is excrement.As a preferred embodiment, being invaded based on nothing
Entering property and cheap facilitate consideration, preferably fecal sample.
Colorectal cancer early detection can be accurately realized in order to verify fecal sample, do following experiment：
Step 1, collecting 49 Patients with Colorectal Cancer, 20 progressive stage adenoma patients and 51 Healthy Peoples, (age is more than 40
Year carries out colorectal cancer screening, as a result negative sample) fecal sample (sample information is shown in Table 13), to this section of methyl of verification
Change CpG islands and carry out qPCR tests (flow chart is shown in Fig. 1), using B2M genes as reference gene in detection architecture.Data are set automatically
Baseline is set, manual setting critical value line adjusts the inflection point that Threshold rises to FAM and JOE amplification curves according to actual conditions
Place obtains Ct values, calculates △ Ct values：That is BMP3 target genes (FAM signals) Ct values and B2M reference genes (JOE signals) Ct values
Difference, if △ Ct≤critical value is to methylate sample；If △ Ct>Critical value is the sample that do not methylate.
Table 13
Genomic DNA is extracted in fecal sample；
Take fecal sample (4-6g) that lysate 40mL is added, vortex oscillation is incubated 16 hours for 50 DEG C after mixing well；
5000rpm centrifuges 10min after incubation, pays attention to weighing balance before centrifuging, after centrifugation, carefully take out from
Heart pipe does not shake acutely；
9mL supernatants are pipetted in new 50mL centrifuge tubes, then be separately added into 1mL extraction assist liquid, 60 μ L magnetic beads liquid and
10mL isopropanols, vortex vibrate 10sec, 65 DEG C of incubation 20min, and incubation period is primary every the 5min mixings that turn upside down.
After incubation, 50mL centrifuge tubes are placed on magnetic frame, 3min is stood, waits for that magnetic bead is fully adsorbed on tube wall,
Abandon waste liquid；
Centrifuge tube is taken out from magnetic frame, 12mL cleaning solutions are added, vortex oscillation falls off up to magnetic bead from tube wall, quiet
3min is set, is placed again into magnetic frame, 3min is stood, waits for that magnetic bead is fully adsorbed on tube wall, abandon waste liquid；
Add 15mL80% ethanol solutions, for vortex oscillation until magnetic bead falls off from tube wall, standing 3min places into magnetic frame
In, 3min is stood, waits for that magnetic bead is fully adsorbed on tube wall, abandons waste liquid；
Repeat previous step 1 time；
Bottom residual liquid is exhausted with pipettor, is uncapped, 5min will be incubated in 65 DEG C of centrifuge tube, is taken after magnetic bead drying
Go out, the eluent I of 1.5mL preheatings is added, magnetic bead is purged from tube wall with 1000 μ L pipettors, is aspirated repeatedly, together with
Magnetic bead is transferred to together in 2mL centrifuge tubes, is closed 65 DEG C of incubation 5min of centrifuge tube lid；
13000rpm centrifuges 3min, pipettes 600 μ L supernatants to new 1.5mL centrifuge tubes, 600 μ L column combination liquid are added,
It mixes well；
It shifts in 600 μ L mixed liquors to DNA purification columns, 13000rpm centrifuges 1min, abandons waste liquid；
90% ethanol solution of 600 μ L is added into DNA purification columns, 13000rpm centrifuges 1min, abandons waste liquid；
Repeat previous step 2 times；
13000rpm centrifuges 3min, and DNA purification columns are put into new 1.5mL centrifuge tubes, opens the 65 DEG C of incubations of centrifuge tube lid
5min, drying；
The eluent II that 100 μ L are preheated vacantly is added dropwise to DNA purification columns centre position, is closed 65 DEG C of incubation 5min of lid,
13000rpm centrifuges 2min, and the DNA solution after must eluting, 2~8 DEG C save backup, if long-term preservation need to be stored in -25~-15
℃。
Step 2 designs the primer of the methylated DNA fragments of BMP3 genes, probe, positive quality control and negative Quality Control；
Inner quality control uses B2M genes as reference gene, and base sequence is that gene order number is in ncbi database
C is converted into T in sequence other than NG_012920.1 the 3886 to 4010th, corresponding sequence C G；It is set for the sequence of this section of conversion
Internal control primer and internal control probe are counted, and the upstream and downstream primer of internal control is screened, keeps non-masterplate system (NTC) not bright
Aobvious amplification curve (not initial line), sample have apparent amplification curve (initial line) normal.
Design the primer and probe of the methylated DNA fragments of BMP3 genes；
BMP3 primers include：BMP3 forward primers, BMP3 reverse primers；
The BMP3 forward primers include：
SEQ ID NO.1：AAATAAAGCGAGGAGGGAAGG；
SEQ ID NO.2：GAGACGGCGTTCGTAGCG；
SEQ ID NO.3：AGCGTTGGAGTGGAGACGG；
The BMP3 reverse primers include：
SEQ ID NO.4：CCCAACAACTACGCGAACC；
SEQ ID NO.5：CGAAATAACGACCAACCCCAC；
SEQ ID NO.6：AAACCCGAAACGCGACC；
BMP3 probes include：
SEQ ID NO.7：TCGGGTTATATACGTCGCGA；
SEQ ID NO.8：GTTCGCGTAGTTGTTGGG；
SEQ ID NO.9：GTGAGGTTCGCGTAGTTGTTG；
The positive criteria object of BMP3 is the nucleotide sequence containing SEQ ID No.10；
GTTAGTTTGGTCGGGTGTTTTTAAAAATAAAGCGAGGAGGGAAGGTATAGATAGATTTTGAAAATATTCGGGTTATA
TACGTCGCGATTTATAGTTTTTTTTTAGCGTTGGAGTGGAGACGGCGTTCGTAGCGTTTTGCGCGGGTGAGGTTCGC
GTAGTTGTTGGGGAAGAGTTTATTTGTTAGGTTGCGTTGGGTTAGCGTAGTAAGTGGGGTTGGTCGTTATTTCGTTG
TATTCGGTCGCGTTTCGGGTTTCGTGCGTTTTCGTTTTAG；
Negative standards' object of BMP3 is the nucleotide sequence containing SEQ ID No.11；
GTTAGTTTGGTTGGGTGTTTTTAAAAATAAAGTGAGGAGGGAAGGTATAGATAGATTTTGAAAATATTTGGGTTATA
TATGTTGTGATTTATAGTTTTTTTTTAGTGTTGGAGTGGAGATGGTGTTTGTAGTGTTTTGTGTGGGTGAGGTTTGT
GTAGTTGTTGGGGAAGAGTTTATTTGTTAGGTTGTGTTGGGTTAGTGTAGTAAGTGGGGTTGGTTGTTATTTTGTTG
TATTTGGTTGTGTTTTGGGTTTTGTGTGTTTTTGTTTTAG；
Primer combination of probe 1：Forward primer sequence：SEQ ID NO.1；Reverse primer sequences：SEQ ID NO.4；Probe
Sequence：SEQ ID NO.7；
Primer combination of probe 2：Forward primer sequence：SEQ ID NO.2；Reverse primer sequences：SEQ ID NO.5；Probe
Sequence：SEQ ID NO.8；
Primer combination of probe 3：Forward primer sequence：SEQ ID NO.3；Reverse primer sequences：SEQ ID NO.6；Probe
Sequence：SEQ ID NO.9；
Inner quality control uses B2M genes as reference gene, and base sequence is that gene order number is in ncbi database
C is converted into T in sequence other than NG_012920.1 the 3886 to 4010th, corresponding sequence C G；It is set for the sequence of this section of conversion
Internal control primer and internal control probe are counted, and the upstream and downstream primer of internal control is screened, keeps non-masterplate system (NTC) not bright
Aobvious amplification curve (not initial line), sample have apparent amplification curve (initial line) normal.
Positive Quality Control primer is SEQ ID NO.12：TTGTGGATTTTATTATTAYGAAATGG；
Reversed Quality Control primer is SEQ ID NO.13：AAACTACATCTACCTTAAACCCAACC；
Quality Control probe is nucleotide sequence SEQ ID NO.14：GTATTTTATTTATGGTTATTTTAGAGGGT；
Quality control standard object contains SEQ ID NO.15：
AGAAAAGATTTGTGGATTTTATTATTACGAAATGGCGGTATTTTATTTATGGTTATTTTAGAGGGTAGGTTTTTTTA
ATGGGTTTGTTTGTTATGTTTAACGTTTTTGGTTGGGTTTAAGGTAGATGTAGTTTAAATTTTTATTAAAATTGTCG
AG。
Step 3 handles the genomic DNA of extraction by bisulfite conversion liquid；
Specifically comprise the following steps：
The genomic DNA of extraction is taken out from refrigerator and is thawed, dilution DNA concentration to 20ng/ μ L.After taking 40 μ L dilutions
DNA solution is added in 1.5mL centrifuge tubes, and the NaOH solution of 4 μ L 3M, 42 DEG C of incubation 20min are then added；
400 μ L bisulfite conversion liquid are added, mixing, 50 DEG C are protected from light incubation 16 hours；
550 μ L column combination liquid are added, then solution is transferred to DNA purification columns by mixing, 13000rpm is centrifuged 90 seconds, abandoned
After waste liquid, centrifuges 3 minutes again, abandon waste liquid；
600 μ L, 90% ethyl alcohol is added to DNA purification columns, 13000rpm is centrifuged 90 seconds, after abandoning waste liquid, is centrifuged 15 seconds again；
300 μ L doctor solutions (90% ethanol solution of 0.3M NaOH), room temperature 30 minutes, 13000rpm centrifugations is added
90 seconds, abandon waste liquid；
600 μ L, 90% ethyl alcohol is added, 13000rpm is centrifuged 90 seconds, abandons waste liquid, repeats this step 1 time, centrifuges 3 points again
Clock；
DNA purification columns are put into new 1.5mL centrifuge tubes, 40 μ L eluents are added, 50 DEG C are incubated 30 minutes,
13000rpm is centrifuged 90 seconds, and the DNA solution after must converting is saved backup in -20 DEG C.
Conversion fluid treated DNA is carried out quantitative PCR detection by step 4；
Detection reaction system is prepared, component is as follows in PCR reaction systems：
10 × PCR buffer solutions：5~10 μ L
MgCl2：2.0~5.0mmol
dNTP：0.2~0.8mmol
Each primer：0.1~1.0 μm of ol
Each probe：0.1~1.0 μm of ol
Fast master Premix：5~10 μ L
Sample DNA templates：2μL
Remaining supplies total volume with ultra-pure water：20μL.
Real-time fluorescent PCR amplification reaction condition is preferably：
First stage：95℃5min；
Second stage：95 DEG C of 20s, 60 DEG C of 40s, 15 cycles；
Phase III:95 DEG C of 20s, 58 DEG C of 20s, 30 cycles；
Phase III:When 58 DEG C in 30 cycles, fluorescence signal is collected.
Fluorescence signal is collected, the fluoroscopic examination pattern of corresponding fluorophor is selected, baseline, manual setting threshold value is set automatically
Line is adjusted according to actual conditions at the inflection point that threshold line rises to FAM and JOE amplification curves, and the threshold of target gene FAM signals
Value line requires more than given threshold line at the peak of normal negative control；
Step 5, data processing：Automatic setting baseline, manual setting threshold line value line, the threshold value line are just super
The value for crossing the peak of normal negative control adjusts what Threshold rose to FAM and JOE amplification curves according to actual conditions
At inflection point, Ct values are obtained, calculate △ Ct values；
Result judgement：The corresponding JOE of inner quality control B2M genes has the Ct values of apparent amplification curve and JOE signals first
Less than 25, then meet the requirements；The corresponding FAM signals of target gene BMP3 of positive quality control system have apparent amplification curve, interior
The corresponding JOE of portion's Quality Control B2M genes has the difference of the Ct values of apparent amplification curve, i.e. △ Ct≤critical value then to meet the requirements,
Testing result is correct；
For the FAM of negative quality control system without amplification curve, JOE has the difference of the Ct values of apparent amplification curve and JOE signals,
That is △ Ct ＞ critical values, then meet the requirements, testing result is correct；
Sample judges：The Ct values of the Ct value-B2M reference gene JOE signals of △ Ct=BMP3 target gene FAM signals≤face
Dividing value is the sample that methylates；The Ct values of the Ct value-B2M reference gene JOE signals of △ Ct=BMP3 target gene FAM signals
>Critical value is the sample that do not methylate.
It is detected using 3 pairs of primer combination of probe pair, 120 fecal samples, counts each sample object gene and internal reference
The Ct values of gene calculate △ Ct values：That is the Ct values of the Ct value-B2M reference gene JOE signals of BMP3 target genes FAM signals, system
Count the △ Ct values of testing result.Using △ Ct values as test variable, pathological examination is state variable, with ROC curve to △ Ct values into
Row analysis, comprehensive three kinds of combine detections as a result, using the corresponding △ Ct values of Cutoff be 9 analysis of methylation levels with intestinal cancer and into
The results of property analysis of duration of an exhibition adenoma correlation is shown in Table 14, more excellent by the performance indicator for comparing primer combination of probe 3.
Table 14
Remarks：
Primer combination of probe 1：Forward primer：SEQ ID NO.1+ reverse primers：SEQ ID NO.4+ probes：SEQ ID
NO.7；
Primer combination of probe 2：Forward primer：SEQ ID NO.2+ reverse primers：SEQ ID NO.5+ probes：SEQ ID
NO.8；
Primer combination of probe 3：Forward primer：SEQ ID NO.3+ reverse primers：SEQ ID NO.6；Probe：SEQ ID
NO.9；
Sensitivity is sample/total positive sample of DNA methylation assay positive (true positives)；
Specificity is sample/total negative sample of DNA methylation assay negative (true negative).
The present invention is methylated by detecting one section of methylated DNA fragments of the gene promoter areas BMP3, for auxiliary diagnosis early stage
Colorectal cancer；The present invention extracts DNA from fecal sample；Such detection mode is noninvasive, will not bring pain to patient；This hair
The primer and probe of bright design can have highly sensitive and high specific with site to be measured complementation；The detection method of the present invention is used
Bisulf iotate-treated DNA fragmentation, so that the cytimidine in DNA sample is converted to uracil, and 5 ' methylcysteins are constant,
The DNA fragmentation by conversion is obtained, the cytimidine in DNA sample is converted into uracil, and 5 ' methylcysteins are constant；This hair
It is bright by carrying out real-time quantitative PCR detection, pass through and calculate BMP3 target genes (FAM signals) Ct values and B2M reference genes (JOE
Signal) Ct values difference, whether methylate in judgement sample and methylation level；Such detection have it is high-throughput and
The advantages of hypersensitivity, without in operations such as PCR rear electrophoresis, hybridization, reducing pollution and operating error.
The basic principles, main features and advantages of the invention have been shown and described above.The technical staff of the industry should
Understand, the invention is not limited in any way above-described embodiment, all to be obtained by the way of equivalent substitution or equivalent transformation
Technical solution is all fallen in protection scope of the present invention.
Claims (10)
1. the colorectal cancer early detection method based on BMP3 gene methylation sequences, which is characterized in that
BMP3 gene methylation sequences are as follows：
GTTAGTTTGGTmCGGGTGTTTTTAAAAATAAAGmCGAGGAGGGAAGGTATAGATAGATTTTGAAAATATTmCGG
GTTATATAmCGTmCGmCGATTTATAGTTTTTTTTTAGmCGTTGGAGTGGAGAmCGGmCGTTmCGTAGmCGTTTTGmCGmC
GGGTGAGGTTmCGmCGTAGTTGTTGGGGAAGAGTTTATTTGTTAGGTTGmCGTTGGGTTAGmCGTAGTAAGTGGGGTT
GGTmCGTTATTTmCGTTGTATTmCGGTmCGmCGTTTmCGGGTTTmCGTGmCGTTTTmCGTTTTAG；
mCG indicates that the modification that methylates has occurred in the C on the islands CpG；
Diagnostic method includes the following steps：
Step 1 extracts genomic DNA from biological sample；
Step 2 designs the primer and probe of BMP3 gene methylation sequences；
Step 3 handles the genomic DNA of extraction by conversion fluid；
Conversion fluid treated DNA is carried out quantitative PCR detection by step 4；
Step 5, result judgement：
Automatic setting baseline, manual setting threshold line adjust threshold line to FAM and JOE amplification curves according to actual conditions and rise
Inflection point at, and the threshold line of target gene FAM signals requires more than the threshold line set at the peak of normal negative control；
According to the quantitative PCR detection signal of sample to be tested, reach the cycle-index needed for given threshold line, obtains Ct values；
If Ct values≤critical value of the Ct value-B2M reference gene JOE signals of △ Ct=BMP3 target gene FAM signals, the sample
This is the sample that methylates, and is judged as that colorectal cancer early diagnosis is positive；
If the Ct values of the Ct value-B2M reference gene JOE signals of △ Ct=BMP3 target gene FAM signals>Critical value, the then sample
This is the sample that do not methylate, is judged as that colorectal cancer early diagnosis is negative；
The critical value is that 1% ratio that BMP3 genetic test system detectable concentrations are 5ng/ μ L methylates the corresponding △ of reference material
Ct values.
2. the colorectal cancer early detection method based on BMP3 gene methylation sequences, which is characterized in that
BMP3 gene methylation sequences are as follows：
GTTAGTTTGGTmCGGGTGTTTTTAAAAATAAAGmCGAGGAGGGAAGGTATAGATAGATTTTGAAAATATTmCGG
GTTATATAmCGTmCGmCGATTTATAGTTTTTTTTTAGmCGTTGGAGTGGAGAmCGGmCGTTmCGTAGmCGTTTTGmCGmC
GGGTGAGGTTmCGmCGTAGTTGTTGGGGAAGAGTTTATTTGTTAGGTTGmCGTTGGGTTAGmCGTAGTAAGTGGGGTT
GGTmCGTTATTTmCGTTGTATTmCGGTmCGmCGTTTmCGGGTTTmCGTGmCGTTTTmCGTTTTAG；
mCG indicates that the modification that methylates has occurred in the C on the islands CpG；
Diagnostic method includes the following steps：
Step 1 extracts genomic DNA from biological sample；
Step 2 designs the primer of BMP3 gene methylation sequences, probe, positive quality control and negative Quality Control；
Inner quality control uses B2M genes as reference gene, and base sequence is that gene order number is NG_ in ncbi database
012920.1 the 3886 to 4010th, C is converted into T in sequence other than corresponding sequence C G；For the sequence design of this section of conversion
Internal control primer and internal control probe, and the upstream and downstream primer of internal control is screened, so that non-masterplate system is not expanded significantly
Increase curve, if sample has apparent amplification curve, is judged as normal；
Step 3 handles the genomic DNA of extraction by conversion fluid；
Conversion fluid treated DNA is carried out quantitative PCR detection by step 4；
Step 5, result judgement：Whether first judgement sample meets the requirements,
If the corresponding FAM signals of the target gene BMP3 of positive quality control system have apparent amplification curve, inner quality control B2M genes
Corresponding JOE has apparent amplification curve, and the difference of the Ct values of JOE signals, i.e. △ Ct≤critical value then to meet the requirements, inspection
It is correct to survey result, which is the sample that methylates, and is judged as that colorectal cancer early diagnosis is positive；
If the FAM of negative quality control system is without amplification curve, JOE has apparent amplification curve, and the difference of the Ct values of JOE signals,
That is △ Ct ＞ critical values, then meet the requirements, and testing result is correct, which is the sample that methylates, and is judged as colorectal cancer early stage
Diagnosis is negative；
The critical value is that 1% ratio that BMP3 genetic test system detectable concentrations are 5ng/ μ L methylates the corresponding △ of reference material
Ct values.
3. the colorectal cancer early detection method according to claim 1 or 2 based on BMP3 gene methylation sequences, special
Sign is that the critical value is 9.
4. the colorectal cancer early detection method according to claim 1 based on BMP3 gene methylation sequences, feature
It is,
Step 1 extracts genomic DNA from tissue samples；
Genomic DNA is extracted from FFPE samples using TaKaRa MiniBEST FFPE DNA Extraction Kit；
It is as follows：
The paraffin section tissue that 30mg is scraped with sterilizing scalpel, removes extra paraffin；
Paraffin section tissue is put into the centrifuge tube of 1.5mL, 500 μ L Buffer DP are added, divide in 80 DEG C of water-baths 1 after mixing
Clock, be vortexed concussion 10 seconds while hot, and 180 μ LBuffer GL are added, and be vortexed concussion；
Then 12000rpm room temperatures centrifuge 1 minute, and solution is formed two layers, and upper oil phase, lower layer's water phase is added into lower layer's water phase
Mixing is beaten in 20 μ L Proteinase K, 20mg/mL and 10 μ L RNase, 10mg/mL, suction, then 56 DEG C of water-baths 1 hour,
Will treated 90 DEG C of sample water-bath 30 minutes, be cooled to room temperature；
200 μ 100% ethyl alcohol of L Buffer GB and 200 μ L are added in the sample of processing, be vortexed concussion 10 seconds；
Then 12000rpm room temperatures centrifuge 1 minute, and solution is formed two layers, upper oil phase, lower layer's water phase；
Spin Column are placed on Collection Tube, lower layer's aqueous phase solution of sample is moved into Spin Column
In, then 12000rpm room temperatures centrifuge 2 minutes, abandon filtrate；
The Buffer WA of 500 μ L are added in Spin Column, 12000rpm room temperatures centrifuge 1 minute, abandon filtrate；
The Buffer WB of 500 μ L are added in Spin Column, 12000rpm room temperatures centrifuge 1 minute, abandon filtrate；
Previous step is repeated, the Buffer WB of 500 μ L are added in Spin Column, 12000rpm room temperatures centrifuge 1 minute, abandon filter
Liquid；
Spin Column are placed on Collection Tube, 12000rpm room temperatures centrifuge 2 minutes；
Spin Column are placed on new 1.5mL centrifuge tubes, 50-100 μ L are added in the centre of Spin Column films
Aqua sterilisa or Elution Buffer are stored at room temperature 5 minutes；
12000rpm room temperatures centrifuge 2 minutes, eluted dna；
DNA solution Nanodrop detectable concentrations and the purity that centrifugation is obtained；
The qualified DNA of detection is stored in -20 DEG C of refrigerators, it is spare.
5. the colorectal cancer early detection method according to claim 1 based on BMP3 gene methylation sequences, feature
It is,
Step 1 extracts genomic DNA from fecal sample；
Take fecal sample 4-6g that lysate 40mL is added, vortex oscillation is incubated 16 hours for 50 DEG C after mixing well；
5000rpm centrifuges 10min after incubation, pays attention to balance of weighing before centrifuging, and after centrifugation, carefully takes out centrifugation
Pipe does not shake acutely；
9mL supernatants are pipetted in new 50mL centrifuge tubes, then is separately added into 1mL extractions and assists liquid, 60 μ L magnetic beads liquid and 10mL
Isopropanol, vortex vibrate 10sec, and 65 DEG C of incubation 20min, incubation period is primary every the 5min mixings that turn upside down,
After incubation, 50mL centrifuge tubes are placed on magnetic frame, 3min is stood, waits for that magnetic bead is fully adsorbed on tube wall, abandon useless
Liquid；
Centrifuge tube is taken out from magnetic frame, 12mL cleaning solutions are added, vortex oscillation falls off up to magnetic bead from tube wall, stands
3min is placed again into magnetic frame, is stood 3min, is waited for that magnetic bead is fully adsorbed on tube wall, abandon waste liquid；
Adding 15mL80% ethanol solutions, until magnetic bead falls off from tube wall, standing 3min is placed into magnetic frame vortex oscillation,
3min is stood, waits for that magnetic bead is fully adsorbed on tube wall, abandons waste liquid；
Repeat previous step 1 time；
Bottom residual liquid is exhausted with pipettor, is uncapped, 5min will be incubated in 65 DEG C of centrifuge tube, takes out, adds after magnetic bead drying
Magnetic bead is purged from tube wall with 1000 μ L pipettors, is aspirated repeatedly, together with magnetic bead one by the eluent I for entering 1.5mL preheatings
It rises and is transferred in 2mL centrifuge tubes, be closed 65 DEG C of incubation 5min of centrifuge tube lid；
13000rpm centrifuges 3min, pipettes 600 μ L supernatants to new 1.5mL centrifuge tubes, 600 μ L column combination liquid is added, fully
Mixing；
It shifts in 600 μ L mixed liquors to DNA purification columns, 13000rpm centrifuges 1min, abandons waste liquid；
90% ethanol solution of 600 μ L is added into DNA purification columns, 13000rpm centrifuges 1min, abandons waste liquid；
Repeat previous step 2 times；
13000rpm centrifuges 3min, and DNA purification columns are put into new 1.5mL centrifuge tubes, opens 65 DEG C of incubation 5min of centrifuge tube lid,
Drying；
The eluent II that 100 μ L are preheated vacantly is added dropwise to DNA purification columns centre position, is closed 65 DEG C of incubation 5min of lid,
13000rpm centrifuges 2min, and the DNA solution after must eluting, 2~8 DEG C save backup, if long-term preservation need to be stored in -25~-15
℃。
6. the colorectal cancer early detection method according to claim 1 based on BMP3 gene methylation sequences, feature
It is,
Step 2 designs the primer and probe of the methylated DNA fragments of BMP3 genes；
BMP3 primers include：BMP3 forward primers, BMP3 reverse primers；
The BMP3 forward primers include：
SEQ ID NO.1：AAATAAAGCGAGGAGGGAAGG；
SEQ ID NO.2：GAGACGGCGTTCGTAGCG；
SEQ ID NO.3：AGCGTTGGAGTGGAGACGG；
The BMP3 reverse primers include：
SEQ ID NO.4：CCCAACAACTACGCGAACC；
SEQ ID NO.5：CGAAATAACGACCAACCCCAC；
SEQ ID NO.6：AAACCCGAAACGCGACC；
The BMP3 probes include：
SEQ ID NO.7：TCGGGTTATATACGTCGCGA；
SEQ ID NO.8：GTTCGCGTAGTTGTTGGG；
SEQ ID NO.9：GTGAGGTTCGCGTAGTTGTTG.
7. the colorectal cancer early detection method according to claim 6 based on BMP3 gene methylation sequences, feature
It is, the forward primer of the BMP3 is that the reverse primer of SEQ ID NO.3, the BMP3 are SEQ ID NO.6；The BMP3
Probe is SEQ ID NO.9.
8. the colorectal cancer early detection method according to claim 2 based on BMP3 gene methylation sequences, feature
It is,
The positive criteria object of BMP3 is the nucleotide sequence containing SEQ ID NO.10；
GTTAGTTTGGTCGGGTGTTTTTAAAAATAAAGCGAGGAGGGAAGGTATAGATAGATTTTGAAAATATTCGGGTTATA
TACGTCGCGATTTATAGTTTTTTTTTAGCGTTGGAGTGGAGACGGCGTTCGTAGCGTTTTGCGCGGGTGAGGTTCGC
GTAGTTGTTGGGGAAGAGTTTATTTGTTAGGTTGCGTTGGGTTAGCGTAGTAAGTGGGGTTGGTCGTTATTTCGTTG
TATTCGGTCGCGTTTCGGGTTTCGTGCGTTTTCGTTTTAG；
Negative standards' object of BMP3 is the nucleotide sequence containing SEQ ID NO.11；
GTTAGTTTGGTTGGGTGTTTTTAAAAATAAAGTGAGGAGGGAAGGTATAGATAGATTTTGAAAATATTTGGGTTATA
TATGTTGTGATTTATAGTTTTTTTTTAGTGTTGGAGTGGAGATGGTGTTTGTAGTGTTTTGTGTGGGTGAGGTTTGT
GTAGTTGTTGGGGAAGAGTTTATTTGTTAGGTTGTGTTGGGTTAGTGTAGTAAGTGGGGTTGGTTGTTATTTTGTTG
TATTTGGTTGTGTTTTGGGTTTTGTGTGTTTTTGTTTTAG；
Positive Quality Control primer is SEQ ID NO.12：TTGTGGATTTTATTATTAYGAAATGG；
Reversed Quality Control primer is SEQ ID NO.13：AAACTACATCTACCTTAAACCCAACC；
Quality Control probe is nucleotide sequence SEQ ID NO.14：GTATTTTATTTATGGTTATTTTAGAGGGT；
Quality control standard object contains SEQ ID NO.15：
AGAAAAGATTTGTGGATTTTATTATTACGAAATGGCGGTATTTTATTTATGGTTATTTTAGAGGGTAGGTTTTTTTA
ATGGGTTTGTTTGTTATGTTTAACGTTTTTGGTTGGGTTTAAGGTAGATGTAGTTTAAATTTTTATTAAAATTGTCG
AG。
9. the colorectal cancer early detection method according to claim 1 based on BMP3 gene methylation sequences, feature
It is,
Step 3 handles the genomic DNA of extraction by bisulfite conversion liquid；Specifically comprise the following steps：
The genomic DNA of extraction is taken out from refrigerator and is thawed, dilution DNA concentration to 20ng/ μ L takes the DNA after 40 μ L dilutions molten
Liquid is added in 1.5mL centrifuge tubes, and the NaOH solution of 4 μ L 3M, 42 DEG C of incubation 20min are then added；
400 μ L bisulfite conversion liquid are added, mixing, 50 DEG C are protected from light incubation 16 hours；
550 μ L column combination liquid are added, then solution is transferred to DNA purification columns by mixing, 13000rpm is centrifuged 90 seconds, abandons waste liquid
Afterwards, it centrifuges 3 minutes again, abandons waste liquid；
600 μ L, 90% ethyl alcohol is added to DNA purification columns, 13000rpm is centrifuged 90 seconds, after abandoning waste liquid, is centrifuged 15 seconds again；
300 μ L doctor solutions, room temperature 30 minutes are added, 13000rpm is centrifuged 90 seconds, abandons waste liquid；
600 μ L, 90% ethyl alcohol is added, 13000rpm is centrifuged 90 seconds, abandons waste liquid, repeats this step 1 time, is centrifuged 3 minutes again；
DNA purification columns are put into new 1.5mL centrifuge tubes, be added 40 μ L eluents, 50 DEG C be incubated 30 minutes, 13000rpm from
The heart 90 seconds, the DNA solution after must converting are saved backup in -20 DEG C.
10. the colorectal cancer early detection method according to claim 1 based on BMP3 gene methylation sequences, feature
It is,
Conversion fluid treated DNA is carried out quantitative PCR detection by step 4；
Quantitative PCR detection specific steps include：
Detection reaction system is prepared, component is as follows in PCR reaction systems：
10 × PCR buffer solutions：5~10 μ L
MgCl2：2.0~5.0mmol
dNTP：0.2~0.8mmol
Each primer：0.1~1.0 μm of ol
Each probe：0.1~1.0 μm of ol
Fast master Premix：5~10 μ L
Sample DNA templates：2μL
Remaining supplies total volume with ultra-pure water：20μL；
Real-time fluorescent PCR amplification reaction condition is preferably：
First stage：95℃5min；
Second stage：95 DEG C of 20s, 60 DEG C of 40s, 15 cycles；
Phase III:95 DEG C of 20s, 58 DEG C of 20s, 30 cycles；
Phase III:When 58 DEG C in 30 cycles, fluorescence signal is collected.
Priority Applications (11)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810502359.7A CN108660209B (en) | 2018-05-23 | 2018-05-23 | Product for early detection of colorectal cancer prepared based on BMP3 gene methylation |
| PCT/US2019/033831 WO2019226942A1 (en) | 2018-05-23 | 2019-05-23 | The kit for screening colorectal cancer and advanced adenoma and its application |
| KR1020207037127A KR20210035094A (en) | 2018-05-23 | 2019-05-23 | Kit for screening colorectal cancer and advanced adenoma and application thereof |
| EP19806858.7A EP3797112A4 (en) | 2018-05-23 | 2019-05-23 | The kit for screening colorectal cancer and advanced adenoma and its application |
| JP2020564893A JP2021526370A (en) | 2018-05-23 | 2019-05-23 | Kits for screening colorectal cancer and advanced adenomas and their applications |
| CA3098028A CA3098028A1 (en) | 2018-05-23 | 2019-05-23 | The kit for screening colorectal cancer and advanced adenoma and its application |
| CN201980033966.6A CN112752763A (en) | 2018-05-23 | 2019-05-23 | Kit for screening colorectal cancer and advanced adenoma and application thereof |
| US17/057,227 US20210207221A1 (en) | 2018-05-23 | 2019-05-23 | The kit for screening colorectal cancer and advanced adenoma and its application |
| SG11202010208YA SG11202010208YA (en) | 2018-05-23 | 2019-05-23 | The kit for screening colorectal cancer and advanced adenoma and its application |
| AU2019275073A AU2019275073A1 (en) | 2018-05-23 | 2019-05-23 | The kit for screening colorectal cancer and advanced adenoma and its application |
| BR112020023274-2A BR112020023274A2 (en) | 2018-05-23 | 2019-05-23 | kit for colorectal cancer and advanced adenoma screening and its application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810502359.7A CN108660209B (en) | 2018-05-23 | 2018-05-23 | Product for early detection of colorectal cancer prepared based on BMP3 gene methylation |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108660209A true CN108660209A (en) | 2018-10-16 |
| CN108660209B CN108660209B (en) | 2020-01-14 |
Family
ID=63777561
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810502359.7A Active CN108660209B (en) | 2018-05-23 | 2018-05-23 | Product for early detection of colorectal cancer prepared based on BMP3 gene methylation |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108660209B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109943638A (en) * | 2019-05-08 | 2019-06-28 | 湖南百伯基因技术有限公司 | A kind of primer combination of probe detecting NDRG4, SDC2 and BMP3 gene methylation and its application and kit |
| CN111500730A (en) * | 2020-05-18 | 2020-08-07 | 苏州唯善生物科技有限公司 | Early diagnosis marker for colorectal cancer and precancerous lesion thereof and application thereof |
| CN113308522A (en) * | 2021-07-05 | 2021-08-27 | 孙成铭 | Method for establishing real-time fluorescence quantitative detection of PER2 promoter methylation level |
Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2012067830A2 (en) * | 2010-11-15 | 2012-05-24 | Exact Sciences Corporation | Methylation assay |
| WO2015153284A1 (en) * | 2014-03-31 | 2015-10-08 | Mayo Foundation For Medical Education And Research | Detecting colorectal neoplasm |
| CN104975110A (en) * | 2015-06-02 | 2015-10-14 | 浙江诺辉生物技术有限公司 | Primer and probe for detecting methylation levels of BMP3 and NDRG4 in biological sample |
| WO2016094839A2 (en) * | 2014-12-12 | 2016-06-16 | Exact Sciences Corporation | Compositions and methods for performing methylation detection assays |
| CN106399570A (en) * | 2016-11-30 | 2017-02-15 | 杭州诺辉健康科技有限公司 | Kit for early stage colorectal cancer auxiliary diagnosis and use method and detection system thereof |
| CN106893777A (en) * | 2017-03-02 | 2017-06-27 | 武汉艾米森生命科技有限公司 | For detecting many site methylating reagent boxes of colorectal cancer related gene and application |
| US9719131B2 (en) * | 2000-09-01 | 2017-08-01 | Epigenomics Ag | Method for determining the degree of methylation of defined cytosines in genomic DNA in the sequence context of 5′-CpG-3′ |
-
2018
- 2018-05-23 CN CN201810502359.7A patent/CN108660209B/en active Active
Patent Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US9719131B2 (en) * | 2000-09-01 | 2017-08-01 | Epigenomics Ag | Method for determining the degree of methylation of defined cytosines in genomic DNA in the sequence context of 5′-CpG-3′ |
| WO2012067830A2 (en) * | 2010-11-15 | 2012-05-24 | Exact Sciences Corporation | Methylation assay |
| WO2015153284A1 (en) * | 2014-03-31 | 2015-10-08 | Mayo Foundation For Medical Education And Research | Detecting colorectal neoplasm |
| WO2016094839A2 (en) * | 2014-12-12 | 2016-06-16 | Exact Sciences Corporation | Compositions and methods for performing methylation detection assays |
| CN104975110A (en) * | 2015-06-02 | 2015-10-14 | 浙江诺辉生物技术有限公司 | Primer and probe for detecting methylation levels of BMP3 and NDRG4 in biological sample |
| CN106399570A (en) * | 2016-11-30 | 2017-02-15 | 杭州诺辉健康科技有限公司 | Kit for early stage colorectal cancer auxiliary diagnosis and use method and detection system thereof |
| CN106893777A (en) * | 2017-03-02 | 2017-06-27 | 武汉艾米森生命科技有限公司 | For detecting many site methylating reagent boxes of colorectal cancer related gene and application |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109943638A (en) * | 2019-05-08 | 2019-06-28 | 湖南百伯基因技术有限公司 | A kind of primer combination of probe detecting NDRG4, SDC2 and BMP3 gene methylation and its application and kit |
| CN111500730A (en) * | 2020-05-18 | 2020-08-07 | 苏州唯善生物科技有限公司 | Early diagnosis marker for colorectal cancer and precancerous lesion thereof and application thereof |
| CN113308522A (en) * | 2021-07-05 | 2021-08-27 | 孙成铭 | Method for establishing real-time fluorescence quantitative detection of PER2 promoter methylation level |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108660209B (en) | 2020-01-14 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP6989863B2 (en) | How to diagnose colorectal cancer | |
| CN112322736B (en) | Reagent combination for detecting liver cancer, kit and application thereof | |
| CN109097471A (en) | A kind of kit detected for colorectal cancer and precancerous lesion and its application method | |
| CN108676878A (en) | Colorectal cancer early detection method based on NDRG4 gene methylation sequences | |
| JP6897970B2 (en) | How to check for colorectal tumors | |
| ES2691404T3 (en) | Non-invasive cancer diagnosis | |
| JP2018512048A (en) | Mutation detection for cancer screening and fetal analysis | |
| CN105603101B (en) | Detect application of the system of 8 miRNA expression quantity in diagnosis or auxiliary diagnosis of hepatoma product is prepared | |
| Chan et al. | Quantitative analysis of the transrenal excretion of circulating EBV DNA in nasopharyngeal carcinoma patients | |
| CN112501293B (en) | Reagent combination for detecting liver cancer, kit and application thereof | |
| CN112280865B (en) | Reagent combination for detecting liver cancer, kit and application thereof | |
| CN108660209A (en) | Colorectal cancer early detection method based on BMP3 gene methylation sequences | |
| CN109112216A (en) | The kit and method of triple qPCR detection DNA methylations | |
| CN110246539A (en) | A kind of method and device of immunity level assessment | |
| CN109055555B (en) | Lung cancer early stage metastasis diagnosis marker and kit and application thereof | |
| CN108300787A (en) | Special application of the methylation sites as early diagnosing mammary cancer marker | |
| CN107164531A (en) | A kind of related serum LncRNA marks of screening lung cancer and its application | |
| Hamada et al. | Diagnostic usefulness of PCR profiling of the differentially expressed marker genes in thyroid papillary carcinomas | |
| CN108707667A (en) | A kind of kit and its application method for colorectal cancer early diagnosis | |
| US7217515B2 (en) | HURP gene as a molecular marker for bladder cancer | |
| CN115851958A (en) | Primer, probe, kit and method for detecting pancreatic cancer related gene methylation | |
| CN113215255B (en) | Biomarker for early diagnosis or prognosis of liver cancer and application thereof | |
| CN114107498A (en) | Colorectal cancer blood detection marker and application thereof | |
| CN113215257A (en) | Nucleic acid composition, kit and detection method for detecting breast cancer related gene methylation | |
| CN108998528B (en) | Lung cancer diagnosis molecular marker lncRNA LINC00516, kit and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |