CN110484625A - For detecting primer combination of probe object, kit and the detection method of PRKY gene methylation - Google Patents
For detecting primer combination of probe object, kit and the detection method of PRKY gene methylation Download PDFInfo
- Publication number
- CN110484625A CN110484625A CN201910805441.1A CN201910805441A CN110484625A CN 110484625 A CN110484625 A CN 110484625A CN 201910805441 A CN201910805441 A CN 201910805441A CN 110484625 A CN110484625 A CN 110484625A
- Authority
- CN
- China
- Prior art keywords
- primer
- specific
- prky
- probe
- sample
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/154—Methylation markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes
Abstract
The present invention provides a kind of for detecting primer combination of probe object, kit and the detection method of PRKY gene methylation.The primer combination of probe object includes: the first specific primer and the first specific probe for detecting the methylation of PRKY locus gene, detect the second specific primer and the second specific probe of reference gene β-actin, 5 ' ends of the first specific probe and the second specific probe are marked with fluorescent reporter group, and 3 ' ends are marked with fluorescent quenching group.Revealed primer combination of probe object, kit and detection method through the invention, realize the quick detection to PRKY gene methylation, with high sensitivity, high specificity, the advantages that simple and efficient to handle, can select tumor-targeting drug and operative treatment to provide accurate reference patients with prostate cancer for clinician.
Description
Technical field
The present invention relates to technical field of gene detection more particularly to a kind of primer spies for detecting PRKY gene methylation
Injection composition, kit and detection method.
Background technique
Prostate cancer is a kind of malignant tumour high-incidence in male.In the U.S., the disease incidence of prostate cancer is in male's evil
First of property tumour, the death rate is also only second to lung cancer and is in second.With factors such as life, eating habit and environment
Variation, the disease incidence of China's prostate cancer improving rapidly in recent years, and in the flourishing city such as Shanghai, Beijing, prostate cancer is
Through becoming the big malignant tumour of male urinary system first.Currently, the early detection means of prostate cancer are mainly forefront in serum
Gland cancer antigen PSA Concentration Testing and digital rectal examination.The abnormal patient of detection needs to carry out further aspiration biopsy of prostatic gland, with
Finally it is confirmed whether with prostate cancer.But all there is certain weakness in both methods for screening, may result in non-
Necessary Biopsy and excessive screening, over-treatment etc. are carried out to clinical unconspicuous patient.Statistics display, due in serum
The positive predictive value of PSA Concentration Testing and digital rectal examination is lower, and about 75% male receives non-essential aspiration biopsy；Separately
Outside, due to the missing inspection of worry prostate cancer, many first patients for puncturing feminine gender will do it to be punctured again, and the big portion in them
It is still negative for dividing puncture result.A large amount of non-essential aspiration biopsy and duplicate aspiration biopsy bring larger to patient
Medical burden, and aspiration biopsy is more painful, and there is bleeding within a certain period of time, and has complication generation, seriously
Reduce the quality of life of patient.
Since PSA is widely accepted and applies as prostatic cancer early diagnosis marker, prostate cancer has been greatly reduced
The death rate, but also bring simultaneously clinically it is excessive diagnosis and over-treatment.In order to reduce the excessive of patients with prostate cancer
Diagnosis and over-treatment, it is desirable to provide the new sensitivity of one kind, specific higher, the higher detection method conduct of positive predictive value
Effective supplement of PSA early screening.
DNA methylation (DNA methylation) is a kind of form of DNA chemical modification, can not change DNA sequence dna
Under the premise of, change Genetic Performance.So-called DNA methylation refers under the action of DNA methylation transferase, in genome CpG
The cytimidine 5' carbon potential covalently bonded of dinucleotides unifies a methyl group.A large number of studies show that DNA methylation can cause to dye
The change of matter structure, DNA conformation, DNA stability and DNA and protein interaction mode, to control gene expression.DNA
Methylation is a kind of epigenetic modification, it refers to one methyl group of addition on the position 5C of cytimidine, is occurred mainly in
The site CpG.The methylation of DNA suffers from highly important effect, the abnormal meeting of methylation level in many biological functions
The disorder for leading to biological function causes the generation of certain diseases.
The study found that there is close to be associated between the exception of DNA methylation and the occurrence and development of tumour, in many cancers
The early stage that disease occurs can be detected the exception of certain gene DNA methylations.In addition, since DNA methylation is a kind of more steady
Fixed epigenetic modification, therefore more and more researchs are using DNA methylation as the marker of early diagnosis of cancer, DNA first
Base marker is considered as a kind of strong tools of great potential on future clinical.
Applicant has found that notification number is that the Chinese invention patent of CN105074010B discloses one kind after carefully retrieving
The detection method of methylate DNA.The prior art relies on the peak separation that exchange chromatography column realizes methylate DNA detection signal, this
It is tantamount to increase the testing cost of methylate DNA detection.And the revealed technical solution of the prior art is not appropriate for
To patient, whether oj C prostate cancer carries out rapid screening and diagnosis in hospital.
In view of this, it is necessary to the genetic test correlation skill in the prior art to the detection of mankind's PRKY gene methylation
Art is improved, to solve the above problems.
Summary of the invention
It is an object of the invention to be disclosed for primer combination of probe object, kit and the inspection of detection PRKY gene methylation
Survey method, and based on PRKY gene methylation index to prostate cancer early screening, the early stage of prostate cancer is sieved to realize
Look into diagnosis.
To realize above-mentioned first goal of the invention, the present invention provides a kind of for detecting the primer of PRKY gene methylation
Probe compositions, comprising: the first specific primer and the first specific probe of detection PRKY locus gene methylation, in detection
Join the second specific primer and the second specific probe of gene β-actin；
The forward primer of first specific primer has the nucleotide sequence as shown in SEQ ID NO.1,
The reverse primer of first specific primer has the nucleotide sequence as shown in SEQ ID NO.2,
First specific probe has the nucleotide sequence as shown in SEQ ID NO.3,
The forward primer of second specific primer has the nucleotide sequence as shown in SEQ ID NO.4,
The reverse primer of second specific primer has the nucleotide sequence as shown in SEQ ID NO.5,
Second specific probe has the nucleotide sequence as shown in SEQ ID NO.6.
As a further improvement of the present invention, 5 ' ends of first specific probe and the second specific probe are marked with
Fluorescent reporter group, 3 ' ends are marked with fluorescent quenching group；The fluorescent reporter group be selected from FAM, HEX, TET, JOE, NED,
Any one in VIC, CY3, CY5, ROX or TAMRA, the fluorescent quenching group be selected from MGB, BHQ or
Any one in Phosphorothioate.
Meanwhile to realize above-mentioned second goal of the invention, the present invention also provides one kind for detecting PRKY gene methyl
The kit of change, the kit include drawing using as composed by the above-mentioned first revealed primer combination of probe object of invention
Physical prospecting needle premixed liquid expands premixed liquid, negative quality-control product and positive quality control product；
The amplification premixed liquid is by PCR buffer, PCR protective agent, Taq enzyme, dNTPs, MgCl2Composition；
The feminine gender quality-control product is the non-methylation people PRKY plasmid with the nucleotide sequence as shown in SEQ ID NO.7；
The positive quality control product is the permethylated people PRKY plasmid with the nucleotide sequence as shown in SEQ ID NO.8.
Finally, present invention further teaches a kind of detection methods for detecting PRKY gene methylation, comprising the following steps:
Step (1) extracts biological material sample；
Step (2) extracts sample DNA, adjustment sample DNA to standard purity and normal concentration from biological material sample；
Step (3) is by sample DNA, positive quality control product and negative quality-control product respectively such as second revealed reagent of invention
Box executes pcr amplification reaction；
Step (4) Analysis of test results.
As a further improvement of the present invention, the biological material sample in the step (1) is after people's massage of prostate
Cell in first section urine；
Sample DNA is extracted from biological material sample in the step (2) specifically: selection contains Nonionic Detergents
Cell pyrolysis liquid or purification column kit extract, converted using sulphite conversion reagent box, the sample DNA after conversion makes
Purity is measured with ultraviolet specrophotometer.
As a further improvement of the present invention, the standard purity of sample DNA is that OD260/OD280 is in the step (2)
1.8~2.0, normal concentration is 0.2~2 μ g/ml；
If the concentration of sample DNA is lower than 0.2 μ g/ml, concentration is carried out to sample DNA using ethanol precipitation, if sample
The concentration of this DNA is higher than 2 μ g/ml, and TE buffer is added with by the concentration dilution of sample DNA to normal concentration.
As a further improvement of the present invention, the reaction system of amplified reaction is 50 μ l:10 × PCR in the step (3)
Buffer, MgCl250mM, dNTPs250 μM, 10 × PCR protective agent, 100 μM of the forward primer of the first specific primer, first
100 μM of the reverse primer of specific primer, 100 μM of the first specific probe, the second specific primer 100 μM of forward primer,
100 μM of reverse primer, 100 μM of the second specific probe of second specific primer, sterilizing ultrapure water add to 50 μ l；
The concentration for the positive quality control product that the reaction system of amplified reaction is included is 10~2000copies/ μ l, the yin
Property quality-control product concentration be 10~2000copies/ μ l.
As a further improvement of the present invention, in the step (3) amplified reaction response procedures are as follows:
(1) 95 DEG C of initial denaturation 2min, recurring number 1；
(2) 95 DEG C of denaturation 2min, recurring number 5；
(3) 58 DEG C of annealing extend 1min, recurring number 5；
(4) 95 DEG C of denaturation 15sec, recurring number 40；
(5) 60 DEG C of annealing, extension and fluorescence detection 1min, recurring number 40, the fluorescence detection channel are logical for FAM signal
Road and VIC signal path.
As a further improvement of the present invention, step (4) Analysis of test results specifically:
By the Ct value > 40 or the sample DNA without interpretation of value≤29 Ct of the second specific primer and the first specific primer
It is determined as negative sample；
By value≤40 Ct of Ct value≤29, the first specific primer of the second specific primer, there are indexes for amplification curve
Phase and there are the sample DNAs of clear inflection point to be determined as positive sample with exponential phase for baseline；
The sample DNA of the Ct value > 29 of second specific primer is determined as in vain.
Compared with prior art, the beneficial effects of the present invention are:
By inventing revealed primer combination of probe object, kit and detection PRKY gene methyl based on the kit
The purpose for quickly detecting PRKY gene methylation may be implemented, to substantially reduce to prostate cancer mark in the detection method of change
The detection time of will object, have high sensitivity, high specificity, it is simple and efficient to handle the advantages that, can for clinician to prostate
Cancer patient selects tumor-targeting drug and operative treatment to provide accurate medical reference.
Detailed description of the invention
Fig. 1 is the amplification curve of positive quality control sample and negative quality-control sample；
Fig. 2 is the amplification curve of the positive quality control product of various concentration；
Fig. 3 is the positive sample that the detection method of revealed detection PRKY gene methylation through the invention detects
Amplification curve；
Fig. 4 is the negative sample that the detection method of revealed detection PRKY gene methylation through the invention detects
Amplification curve.
Specific embodiment
The present invention is described in detail for each embodiment shown in reference to the accompanying drawing, but it should be stated that, these
Embodiment is not limitation of the present invention, those of ordinary skill in the art according to these embodiments made by function, method,
Or equivalent transformation or substitution in structure, all belong to the scope of protection of the present invention within.
Briefly, the revealed a kind of primed probe group of people's Y chromosome PRKY gene methylation detection of the present embodiment
Close object, based on kit prepared by primer combination of probe object and detection method, it can DNA methylation marker to PRKY gene
Screening to prostate cancer avoids living body puncture and relies on PSA index to various problems present in prostate cancer progress screening
With drawback, and can be used for prostate cancer early stage auxiliary screening, thus for targeted drug treat or operative treatment provide accurately according to
According to.Meanwhile term involved in the present embodiment " sec " is chronomere: second, term " rpm " is Speed unit: rev/min；Art
Language " min " is chronomere: minute.
Firstly, this application discloses a kind of for detecting the primer combination of probe object of PRKY gene methylation, comprising: detection
The first specific primer and the first specific probe of PRKY locus gene methylation, the second of detection reference gene β-actin
Specific primer and the second specific probe.
The forward primer (i.e. PRKY forward primer) of first specific primer has the nucleotides sequence as shown in SEQ ID NO.1
The reverse primer (i.e. PRKY reverse primer) of column, first specific primer has the nucleotides sequence as shown in SEQ ID NO.2
Column, first specific probe (i.e. PRKY specific probe) have the nucleotide sequence as shown in SEQ ID NO.3.
The forward primer (i.e. β-actin forward primer) of second specific primer has the nucleosides as shown in SEQ ID NO.4
The reverse primer (i.e. β-actin reverse primer) of acid sequence, second specific primer has the core as shown in SEQ ID NO.5
Nucleotide sequence, second specific probe (i.e. β-actin specific probe) have the nucleotides sequence as shown in SEQ ID NO.6
Column.
Wherein, the reverse primer and the first specificity of the forward primer of the first specific primer and the first specific primer are visited
Needle carries out genetic test, the forward primer of the second specific primer and the to the PRKY gene methylation in people's Y chromosome jointly
The reverse primer of two specific primers and the second specific probe carry out genetic test to reference gene β-actin jointly.Internal reference
Gene β-actin is used as housekeeping gene (Home-keeping Gene, HKG), is usually for mammalian cell expression
Refer to by the albumen of house-keeping gene coding expression.They are relative constant in each tissue and the expression in cell, in the table of detection albumen
Object of reference often is made with it when changing up to level.To for PRKY gene methylation carry out genetic test provide accurately refer to according to
According to.
5 ' ends of the first specific probe and the second specific probe are marked with fluorescent reporter group, and 3 ' ends are marked with fluorescence
Quenching group；The fluorescent reporter group appointing in FAM, HEX, TET, JOE, NED, VIC, CY3, CY5, ROX or TAMRA
It anticipates one kind, any one of the fluorescent quenching group in MGB, BHQ or Phosphorothioate.
For example, in the present embodiment, the sequence of the first specific probe is as follows:
FAM-CGTTTTGGTTGCGGGTT-MGB；
The sequence of second specific probe is as follows:
VIC-CCACCACCCAACACACAATAACAAACA-BHQ；
Meanwhile based on disclosed above for detecting PRKY gene methylation detection reagent, the present embodiment is further disclosed
It is a kind of for detecting the kit of PRKY gene methylation, the kit includes using primer combination of probe as described above
Primed probe premixed liquid (B-PPmix) composed by object is expanded premixed liquid (B-APmix), negative quality-control product and positive quality control product.
The amplification premixed liquid is by PCR buffer, PCR protective agent, Taq enzyme, dNTPs, MgCl2Composition.Wherein, the negative quality-control product is
Non- methylation people PRKY plasmid with the nucleotide sequence as shown in SEQ ID NO.7；The positive quality control product is with such as SEQ
The permethylated people PRKY plasmid of nucleotide sequence shown in ID NO.8.
The nucleotide sequence of non-methylation people PRKY plasmid (i.e. negative quality-control product) is (SEQ ID NO.7) as follows:
GAGGATTGAGGGATTGGAGATTGTTTTTAGTTGTAGAATTGTTGAGATTTTTTAAAATAAAGGTGTTT
TTAGTTTGATTTTTTGTTGTTTAATGTGTGGTTGGTTAATTGATAGTTTGGGGTGTTTTGGTTGTGGGTTAGGGGA
GTAGTGTTTAGGTTGTGTTAGGTTTGTAAGTTAAGTATTGTTTGTATTTTTTTGGGGAAAGGGGTGATTAAATATT
TAGTTATATTTGTATTTTAAATTTATATGGATAAGAGTTTTAAATATAAGTATGTTTAATTATTGTTTAAGTTATA
TTTATGTTAGGAAAAAAAAAATTTTTGTGTTTTTGAAATTGAAATGTGTTTGTATAGTTTTTTATTAGGTTGTTGT
TGGGGTGTTTAAATAGTGATTAATTAAGTTTTATATGTTATATTTGGTTGGGTGATTTTTTAAATTTGTTTTTTTT
TAGTTTTTTAAATAAATGTTTATTTGGAAAGAATTTTAGATTTATAGGAAGTTGTAAATAAATGTATAGAGTTAAG
TTTATTTTTTTTTTTTTTTTTTAAGTAAAAATGTGGAATTATTAGTTTTATGATGAAATTAGGGTGTTGATTTTGT
TT。
The nucleotide sequence of permethylated people PRKY plasmid (i.e. positive quality control product) is (SEQ ID NO.8) as follows:
AGGATTGAGGGATTGGAGATCGTTTTTAGTCGTAGAATCGTTGAGATTTTTTAAAATAAAGGCGTTTT
TAGTTTGATTTTTTGTTGTTTAATGTGTGGTTGGTTAATCGATAGTTTGGGGCGTTTTGGTTGCGGGTTAGGGGAG
TAGCGTTTAGGTCGTGTTAGGTTCGTAAGTTAAGTATTGTTTGTATTTTTTTGGGGAAAGGGGTGATTAAATATTT
AGTTATATTTGTATTTTAAATTTATACGGATAAGAGTTTTAAATATAAGTATGTTTAATTATTGTTTAAGTTATAT
TTACGTTAGGAAAAAAAAAATTTTTGCGTTTTTGAAATTGAAATGTGTTTGTATAGTTTTTTATTAGGTTGTCGTC
GGGGTGTTTAAATAGTGATTAATTAAGTTTTATACGTTATATTTGGTCGGGCGATTTTTTAAATTTGTTTTTTTTT
AGTTTTTTAAATAAATGTTTATTTGGAAAGAATTTTAGATTTATAGGAAGTTGTAAATAAACGTATAGAGTTAAGT
TTATTTTTTTTTTTTTTTTTTAAGTAAAAATGTGGAATTATTAGTTTTACGACGAAATTAGGGCGTTGATTTTGT
TT。
The sequence design of disclosed primer combination of probe object is as shown in following table one
Table one
Meanwhile the present embodiment further discloses a kind of detection method for detecting PRKY gene methylation, comprising the following steps:
Firstly, executing step (1) extracts biological material sample.Biological material sample in the step (1) is human prostate
The cell in first section urine after massage.Containing the renal epithelial cell largely to fall off in first section urine, and by renal epithelial cell
As biological material, to carry out genetic test to the PRKY gene methylation index in people's Y chromosome.
Then, step (2) are executed and extract sample DNA, adjustment sample DNA to standard purity and mark from biological material sample
Quasi- concentration.Sample DNA is extracted from biological material sample in the step specifically: selects the cell containing Nonionic Detergents
Lysate or purification column kit extract, and are converted using sulphite conversion reagent box, and the sample DNA after conversion uses ultraviolet
Spectrophotometric determination purity.In the present embodiment, it is 1.8~2.0 that the standard purity of sample DNA, which is OD260/OD280, standard
Concentration is 0.2~2 μ g/ml.The liquor capacity of the sample DNA of extraction is about 50 μ l.If the concentration of sample DNA is lower than 0.2 μ g/
Ml carries out concentration to sample DNA using ethanol precipitation, if the concentration of sample DNA is higher than 2 μ g/ml, TE buffer is added
With by the concentration dilution of sample DNA to normal concentration.
Then, step (3) are executed, sample DNA, positive quality control product and negative quality-control product is separately added into reagent described above
The reaction tube of box executes pcr amplification reaction.The 5 μ l of sample DNA being prepared in step (2) is added to PCR instrument (model
ABI7500) in reacting hole, the close membrane or upper tube cap of quantitative fluorescent PCR grade are sealed up, is placed in centrifuge with 2000rpm's
Revolving speed, centrifugal treating 30sec to ensure that sample DNA solution is sufficiently reacted with the reagent in kit, and all sink to PCR pipe
Bottom.
It include primed probe premixed liquid (i.e. B-PPmix) to expand premixed liquid (i.e. B-APmix), negative Quality Control in kit
Product (NC) and positive quality control product (PC).The system of kit is as shown in following table two.
Table two
To ensure whether test operation successful and subsequent Analysis of test results, in detection PRKY gene methylation every time
Setting PC and NC control group is required in the process.PCR pipe or PCR96 orifice plate sequence are put into PCR instrument, according in step (3)
Amplification program execute real-time fluorescence quantitative PCR amplification, and use fluorescence probe method, utilize 5 ' end label fluorescent reporter groups
(such as FAM perhaps VIC) 3 ' end is marked with fluorescent quenching group (such as MGB or BHQ).It should be noted that as fluorescence
The BHQ of quenching group can also be BHQ-1, BHQ-2 or BHQ-3.
The reaction system of amplified reaction is 50 μ l:10 × PCR buffers, MgCl in the step (3)250mM、dNTPs250μ
M, 10 × PCR protective agent, 100 μM of the forward primer of the first specific primer, the first specific primer 100 μM of reverse primer,
First 100 μM of specific probe, 100 μM of the forward primer of the second specific primer, the second specific primer reverse primer 100
μM, 100 μM of the second specific probe, sterilizing ultrapure water add to 50 μ l.
The concentration for the positive quality control product that the reaction system of amplified reaction is included is 10~2000copies/ μ l, the yin
Property quality-control product concentration be 10~2000copies/ μ l.
The response procedures of amplified reaction in the step (3) are as follows:
(1) 95 DEG C of initial denaturation 2min, recurring number 1；
(2) 95 DEG C of denaturation 2min, recurring number 5；
(3) 58 DEG C of annealing extend 1min, recurring number 5；
(4) 95 DEG C of denaturation 15sec, recurring number 40；
(5) 60 DEG C of annealing, extension and fluorescence detection 1min, recurring number 40, the fluorescence detection channel are logical for FAM signal
Road and VIC signal path.
Finally, executing step (4) Analysis of test results, and specifically it is as follows.
(1) quality control standard
1. the measurement result of positive control is positive, and value≤36 Ct.
2. the measurement result of negative control is feminine gender, Ct value is without interpretation (Undetermined).
3. amplification curve should have apparent exponential phase, and baseline and exponential phase, should there is obvious clearly inflection point.
If meeting above-mentioned three quality control standards simultaneously, assert that test is effective；Otherwise, assert that test is invalid.
(2) result interpretation
Feature one: by value≤29 Ct of the second specific primer and the Ct value > 40 of the first specific primer or without interpretation
Sample DNA is determined as negative sample；
Feature two: by value≤40 Ct of Ct value≤29, the first specific primer of the second specific primer, amplification curve is deposited
In exponential phase and baseline there are the sample DNAs of clear inflection point to be determined as positive sample with exponential phase；
Feature three: the sample DNA of the Ct value > 29 of the second specific primer is determined as in vain.
As shown in Figure 1, the measurement result of positive control (i.e. positive quality control product) is the positive, and value≤36 Ct, negative control
The measurement result of (i.e. negative quality-control product) is feminine gender, and Ct is without interpretation (Undetermined)；The amplification of the positive quality control product is bent
Line has apparent exponential phase；, there are obvious clearly inflection point in baseline and exponential phase, it is seen that kit is effective, can carry out next step inspection
It surveys.
As shown in Fig. 2, into PCR pipe be added 10copies/ μ l, 20copies/ μ l, 200copies/ μ l,
When permethylated people PRKY plasmid (i.e. the PC) of 2000copies/ μ l, there are typical amplification curve, and the equal < 40 of Ct value, belongs to
In no non-specific amplification.
As shown in figure 3, having typical amplification curve, β-when the PRKY gene methylation detected is positive sample
Value≤40 Ct of Ct value≤29, PRKY of actin, and amplification curve has apparent exponential phase, baseline and exponential phase, have obvious clear
Clear inflection point, and without non-specific amplification, and accuracy reaches 0.5%.Meet the standard of features described above two, thus by the sample
DNA is determined as positive sample, that is, assert that the PRKY gene methylation in the sample DNA is positive.
As shown in figure 4, when the PRKY gene methylation detected is negative sample, Ct value≤29, PRKY of β-actin
Ct value without interpretation.Meet the standard of features described above one, the sample DNA is thus determined as negative sample, that is, assert the sample
PRKY gene methylation in DNA is negative.
It to sum up, can it is found by the applicant that PRKY gene methylation level and carcinoma of prostate on people's Y chromosome are closely related
Using the diagnosis marker as prostate cancer, screening prostate cancer can be assisted in early days by detecting PRKY gene methylation, is led to
It crosses and cooperates with other diagnostic means, the early stage that prostate cancer may be implemented precisely judges；Meanwhile the present invention is by adjusting PRKY base
Because DNA methylation assay specific primer to and PRKY gene methylation detection specific probe nucleotidesequence, length
Degree and the creativeness such as concentration are related to so that primer and probe has higher specificity, further increase detection accuracy and
Specificity, and only need the sample DNA of 10ng that can complete to detect, detection sensitivity reaches 0.5%.
The series of detailed descriptions listed above only for feasible embodiment of the invention specifically
Protection scope bright, that they are not intended to limit the invention, it is all without departing from equivalent implementations made by technical spirit of the present invention
Or change should all be included in the protection scope of the present invention.
It is obvious to a person skilled in the art that invention is not limited to the details of the above exemplary embodiments, Er Qie
In the case where without departing substantially from spirit or essential attributes of the invention, the present invention can be realized in other specific forms.Therefore, no matter
From the point of view of which point, the present embodiments are to be considered as illustrative and not restrictive, and the scope of the present invention is by appended power
Benefit requires rather than above description limits, it is intended that all by what is fallen within the meaning and scope of the equivalent elements of the claims
Variation is included within the present invention.Any reference signs in the claims should not be construed as limiting the involved claims.
In addition, it should be understood that although this specification is described in terms of embodiments, but not each embodiment is only wrapped
Containing an independent technical solution, this description of the specification is merely for the sake of clarity, and those skilled in the art should
It considers the specification as a whole, the technical solutions in the various embodiments may also be suitably combined, forms those skilled in the art
The other embodiments being understood that.
Sequence table
<110>Wuxi City Shen Rui biological products Co., Ltd
<120>for detecting primer combination of probe object, kit and the detection method of PRKY gene methylation
<160> 8
<170> SIPOSequenceListing 1.0
<210> 1
<211> 25
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 1
ttgtttaatg tgtggttggt taatc 25
<210> 2
<211> 18
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 2
gggaacacga cctaaacg 18
<210> 3
<211> 17
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 3
cgttttggtt gcgggtt 17
<210> 4
<211> 19
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 4
gatggaggag gtttagtaa 19
<210> 5
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 5
aataaaacct actcctccct 20
<210> 6
<211> 27
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 6
ccaccaccca acacacaata acaaaca 27
<210> 7
<211> 602
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 7
gaggattgag ggattggaga ttgtttttag ttgtagaatt gttgagattt tttaaaataa 60
aggtgttttt agtttgattt tttgttgttt aatgtgtggt tggttaattg atagtttggg 120
gtgttttggt tgtgggttag gggagtagtg tttaggttgt gttaggtttg taagttaagt 180
attgtttgta tttttttggg gaaaggggtg attaaatatt tagttatatt tgtattttaa 240
atttatatgg ataagagttt taaatataag tatgtttaat tattgtttaa gttatattta 300
tgttaggaaa aaaaaaattt ttgtgttttt gaaattgaaa tgtgtttgta tagtttttta 360
ttaggttgtt gttggggtgt ttaaatagtg attaattaag ttttatatgt tatatttggt 420
tgggtgattt tttaaatttg ttttttttta gttttttaaa taaatgttta tttggaaaga 480
attttagatt tataggaagt tgtaaataaa tgtatagagt taagtttatt tttttttttt 540
ttttttaagt aaaaatgtgg aattattagt tttatgatga aattagggtg ttgattttgt 600
tt 602
<210> 8
<211> 601
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 8
aggattgagg gattggagat cgtttttagt cgtagaatcg ttgagatttt ttaaaataaa 60
ggcgttttta gtttgatttt ttgttgttta atgtgtggtt ggttaatcga tagtttgggg 120
cgttttggtt gcgggttagg ggagtagcgt ttaggtcgtg ttaggttcgt aagttaagta 180
ttgtttgtat ttttttgggg aaaggggtga ttaaatattt agttatattt gtattttaaa 240
tttatacgga taagagtttt aaatataagt atgtttaatt attgtttaag ttatatttac 300
gttaggaaaa aaaaaatttt tgcgtttttg aaattgaaat gtgtttgtat agttttttat 360
taggttgtcg tcggggtgtt taaatagtga ttaattaagt tttatacgtt atatttggtc 420
gggcgatttt ttaaatttgt ttttttttag ttttttaaat aaatgtttat ttggaaagaa 480
ttttagattt ataggaagtt gtaaataaac gtatagagtt aagtttattt tttttttttt 540
tttttaagta aaaatgtgga attattagtt ttacgacgaa attagggcgt tgattttgtt 600
t 601
Claims (9)
1. the primer combination of probe object for detecting PRKY gene methylation characterized by comprising detection PRKY locus gene
Methylation the first specific primer and the first specific probe, detect reference gene β-actin the second specific primer and
Second specific probe；
The forward primer of first specific primer has the nucleotide sequence as shown in SEQ ID NO.1,
The reverse primer of first specific primer has the nucleotide sequence as shown in SEQ ID NO.2,
First specific probe has the nucleotide sequence as shown in SEQ ID NO.3,
The forward primer of second specific primer has the nucleotide sequence as shown in SEQ ID NO.4,
The reverse primer of second specific primer has the nucleotide sequence as shown in SEQ ID NO.5,
Second specific probe has the nucleotide sequence as shown in SEQ ID NO.6.
2. primer combination of probe object according to claim 1, which is characterized in that first specific probe and the second spy
5 ' ends of specific probes are marked with fluorescent reporter group, and 3 ' ends are marked with fluorescent quenching group；The fluorescent reporter group is selected from
Any one in FAM, HEX, TET, JOE, NED, VIC, CY3, CY5, ROX or TAMRA, the fluorescent quenching group is selected from
Any one in MGB, BHQ or Phosphorothioate.
3. the kit for detecting PRKY gene methylation, which is characterized in that the kit includes using such as claim 1
Or primed probe premixed liquid composed by primer combination of probe object described in 2, expand premixed liquid, negative quality-control product and positive matter
Control product；
The amplification premixed liquid is by PCR buffer, PCR protective agent, Taq enzyme, dNTPs, MgCl2Composition；
The feminine gender quality-control product is the non-methylation people PRKY plasmid with the nucleotide sequence as shown in SEQ ID NO.7；It is described
Positive quality control product is the permethylated people PRKY plasmid with the nucleotide sequence as shown in SEQ ID NO.8.
4. a kind of detection method for detecting PRKY gene methylation, which comprises the following steps:
Step (1) extracts biological material sample；
Step (2) extracts sample DNA, adjustment sample DNA to standard purity and normal concentration from biological material sample；
Sample DNA, positive quality control product and negative quality-control product are separately added into kit as claimed in claim 3 by step (3), are held
Row pcr amplification reaction；
Step (4) Analysis of test results.
5. detection method according to claim 4, which is characterized in that the biological material sample in the step (1) is behaved
The cell in first section urine after massage of prostate；
Sample DNA is extracted from biological material sample in the step (2) specifically: selection contains the thin of Nonionic Detergents
Cellular lysate liquid or purification column kit extract, and are converted using sulphite conversion reagent box, and the sample DNA after conversion uses purple
Outer spectrophotometric determination purity.
6. detection method according to claim 5, which is characterized in that the standard purity of sample DNA is in the step (2)
OD260/OD280 is 1.8~2.0, and normal concentration is 0.2~2 μ g/ml；
If the concentration of sample DNA is lower than 0.2 μ g/ml, concentration is carried out to sample DNA using ethanol precipitation, if sample DNA
Concentration be higher than 2 μ g/ml, TE buffer is added with by the concentration dilution of sample DNA to normal concentration.
7. detection method according to claim 5, which is characterized in that the reaction system of amplified reaction in the step (3)
For 50 μ l:10 × PCR buffers, MgCl250mM, dNTPs250 μM, the forward direction of 10 × PCR protective agent, the first specific primer
100 μM of primer, 100 μM of the reverse primer of the first specific primer, 100 μM of the first specific probe, the second specific primer
100 μM of forward primer, 100 μM of the reverse primer of the second specific primer, 100 μM of the second specific probe, sterilizing ultrapure water add
To 50 μ l；
The concentration for the positive quality control product that the reaction system of amplified reaction is included is 10~2000copies/ μ l, the feminine gender matter
The concentration of control product is 10~2000copies/ μ l.
8. detection method according to claim 5, which is characterized in that the response procedures of amplified reaction in the step (3)
Are as follows:
(1) 95 DEG C of initial denaturation 2min, recurring number 1；
(2) 95 DEG C of denaturation 2min, recurring number 5；
(3) 58 DEG C of annealing extend 1min, recurring number 5；
(4) 95 DEG C of denaturation 15sec, recurring number 40；
(5) 60 DEG C annealing, extend and fluorescence detection 1min, recurring number 40, the fluorescence detection channel be FAM signal path with
VIC signal path.
9. detection method according to claim 5, which is characterized in that step (4) Analysis of test results specifically:
By value≤29 Ct of the second specific primer and the Ct value > 40 of the first specific primer or the sample DNA without interpretation determine
For negative sample；
By value≤40 Ct of Ct value≤29, the first specific primer of the second specific primer, amplification curve there are exponential phase and
There are the sample DNAs of clear inflection point to be determined as positive sample with exponential phase for baseline；
The sample DNA of the Ct value > 29 of second specific primer is determined as in vain.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910805441.1A CN110484625A (en) | 2019-08-29 | 2019-08-29 | For detecting primer combination of probe object, kit and the detection method of PRKY gene methylation |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910805441.1A CN110484625A (en) | 2019-08-29 | 2019-08-29 | For detecting primer combination of probe object, kit and the detection method of PRKY gene methylation |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN110484625A true CN110484625A (en) | 2019-11-22 |
Family
ID=68555259
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910805441.1A Pending CN110484625A (en) | 2019-08-29 | 2019-08-29 | For detecting primer combination of probe object, kit and the detection method of PRKY gene methylation |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110484625A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111154876A (en) * | 2020-01-17 | 2020-05-15 | 无锡市申瑞生物制品有限公司 | Primer probe composition, kit and detection method for detecting methylation of human ADD3 and CDH23 genes |
| CN111411156A (en) * | 2020-04-20 | 2020-07-14 | 无锡市申瑞生物制品有限公司 | Kit and detection method for early detection of cancer |
| CN113308522A (en) * | 2021-07-05 | 2021-08-27 | 孙成铭 | Method for establishing real-time fluorescence quantitative detection of PER2 promoter methylation level |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101724685A (en) * | 2007-04-12 | 2010-06-09 | 维里德克斯有限责任公司 | Detecting prostate cancer |
| CN102308003A (en) * | 2008-08-05 | 2012-01-04 | 维里德克斯有限责任公司 | Prostate cancer methylation assay |
| CN106636390A (en) * | 2016-12-16 | 2017-05-10 | 江苏为真生物医药技术股份有限公司 | Gene methylation detection method, detection kit and application thereof |
| CN107385039A (en) * | 2017-07-27 | 2017-11-24 | 北京泛生子基因科技有限公司 | A kind of reagent set and detection method for the horizontal detection of mankind's mgmt gene promoter methylation |
| CN107988365A (en) * | 2017-12-01 | 2018-05-04 | 上海纽思格生物科技有限公司 | A kind of prostate cancer screening and lymphatic metastasis prediction kit |
| CN110117660A (en) * | 2019-06-20 | 2019-08-13 | 上海奕谱生物科技有限公司 | It can be used for the marker STAMP-EP11 and its detection reagent of tumour identification |
-
2019
- 2019-08-29 CN CN201910805441.1A patent/CN110484625A/en active Pending
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101724685A (en) * | 2007-04-12 | 2010-06-09 | 维里德克斯有限责任公司 | Detecting prostate cancer |
| CN102308003A (en) * | 2008-08-05 | 2012-01-04 | 维里德克斯有限责任公司 | Prostate cancer methylation assay |
| CN106636390A (en) * | 2016-12-16 | 2017-05-10 | 江苏为真生物医药技术股份有限公司 | Gene methylation detection method, detection kit and application thereof |
| CN107385039A (en) * | 2017-07-27 | 2017-11-24 | 北京泛生子基因科技有限公司 | A kind of reagent set and detection method for the horizontal detection of mankind's mgmt gene promoter methylation |
| CN107988365A (en) * | 2017-12-01 | 2018-05-04 | 上海纽思格生物科技有限公司 | A kind of prostate cancer screening and lymphatic metastasis prediction kit |
| CN110117660A (en) * | 2019-06-20 | 2019-08-13 | 上海奕谱生物科技有限公司 | It can be used for the marker STAMP-EP11 and its detection reagent of tumour identification |
Non-Patent Citations (1)
| Title |
|---|
| LUSHUAI YAO等: "Identification of specific DNA methylation sites on the Y-chromosome as biomarker in prostate cancer", 《ONCOTARGET》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111154876A (en) * | 2020-01-17 | 2020-05-15 | 无锡市申瑞生物制品有限公司 | Primer probe composition, kit and detection method for detecting methylation of human ADD3 and CDH23 genes |
| CN111154876B (en) * | 2020-01-17 | 2023-01-20 | 无锡市申瑞生物制品有限公司 | Primer probe composition, kit and detection method for detecting methylation of human ADD3 and CDH23 genes |
| CN111411156A (en) * | 2020-04-20 | 2020-07-14 | 无锡市申瑞生物制品有限公司 | Kit and detection method for early detection of cancer |
| CN113308522A (en) * | 2021-07-05 | 2021-08-27 | 孙成铭 | Method for establishing real-time fluorescence quantitative detection of PER2 promoter methylation level |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US10221458B2 (en) | Method for screening cancer | |
| CN111676292B (en) | Composition for detecting liver cancer, kit and application thereof | |
| CN106244724A (en) | The primer of detection septin9 gene methylation and test kit | |
| CN110484625A (en) | For detecting primer combination of probe object, kit and the detection method of PRKY gene methylation | |
| CN110452984A (en) | A kind of methylated genes combination for cervical carcinoma DNA methylation assay, primer and probe combination, kit and its application method | |
| CN113604563A (en) | Nucleic acid combination for liver cancer diagnosis or auxiliary diagnosis, detection kit and application thereof | |
| CN108315478A (en) | The probe and kit of RAA Fluorometric assay hydrophobins | |
| CN108060231A (en) | For the primer pair, kit and method of cervical cancer gene FAM19A4, miR-124-2 DNA methylation assay | |
| WO2023098788A1 (en) | Primer and probe and test kit for screening liver cancer, and applications thereof | |
| CN108130362A (en) | Kit and application for EGFR genetic mutation detection | |
| CN111826446A (en) | Primer, probe and kit for early screening and auxiliary diagnosis of bladder cancer | |
| CN111808963A (en) | Composition for noninvasive screening of early lung cancer, application and kit and sample processing method | |
| WO2020134950A1 (en) | Gene mutation/fusion combination and kit for identification of benign and malignant pulmonary nodules | |
| TWI385252B (en) | Cancer screening method | |
| CN107475443A (en) | Cervix cancer detects set group | |
| CN110144386A (en) | For detecting the primer, probe and kit of POLE gene mutation | |
| CN110373454A (en) | A kind of kit and method of joint-detection EGFR genetic mutation | |
| CN111850129B (en) | Primer pair, kit and method for detecting stability of NR21 locus of microsatellite | |
| CN112226507B (en) | Papillary thyroid carcinoma serum marker and application | |
| CN111621557B (en) | Kit for detecting osteoporosis susceptibility gene by cocktail and using method thereof | |
| WO2021159562A1 (en) | Circulating mirna and carcino-embryonic mirna marker related to pan-tumor auxiliary diagnosis, and use thereof | |
| CN110317870B (en) | miRNA marker for diagnosing prostate cancer, kit, system, application and detection method | |
| CN109680100A (en) | Detect the nucleic acid compositions of enterovirus, the application method of kit and kit | |
| CN116555432B (en) | Rapid detection kit for bladder cancer | |
| CN111154876B (en) | Primer probe composition, kit and detection method for detecting methylation of human ADD3 and CDH23 genes |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20191122 |
|
| RJ01 | Rejection of invention patent application after publication |