WO2012000152A1

WO2012000152A1 - Pcr-sequencing method based on technology of dna molecular index and strategy of dna-breaking incompletely

Info

Publication number: WO2012000152A1
Application number: PCT/CN2010/001834
Authority: WO
Inventors: 李剑; 刘涛; 赵美茹; 张现东
Original assignee: 深圳华大基因科技有限公司
Priority date: 2010-06-30
Filing date: 2010-11-15
Publication date: 2012-01-05
Also published as: SA111320572B1; CN101921840A; CN101921840B

Abstract

The present invention provides a sequencing method for nucleic acid, which method comprises: amplifying the target nucleic acid using indexed primers, breaking the amplicons incompletely and purifying and recovering mixed DNAs, sequencing the mixed DNAs by a next-generation sequencing method to obtain the sequences of the broken DNAs, and assembling the sequences of the broken DNAs into a complete sequence for the target nucleic acid. The present invention further provides primer indexes for the sequencing method.

Description

A DNA molecular tagging technique and an incomplete DNA disruption strategy

PCR sequencing method

The invention relates to the field of nucleic acid sequencing technology, in particular to the field of PCR sequencing technology. In another aspect, the invention also relates to the field of PCR-index/barcode technology. The method of the present invention is particularly applicable to second generation sequencing techniques, particularly Pair-end sequencing technology in second generation sequencing technology, and can also be used for HLA genotyping. Background technique

The PCR sequencing method is a technique for obtaining a DNA fragment of a target gene by PCR, and then performing DNA sequence detection on the obtained DNA fragment of the target gene, thereby obtaining a DNA sequence information of the target gene, which is intuitive and accurate. Its characteristics have long been widely used in the field of gene mutation detection and genotyping.

PCR-index/barcode technology, by adding a primer index sequence at the 5' end of the PCR primer, a unique primer label can be introduced into each sample during PCR, allowing the sample to utilize second-generation DNA sequencing technology ( In the detection process of large-scale, high-throughput, single-molecule sequencing sequencer represented by Illumina GA, Roche 454, ABI Solid and other sequencers, except for the PCR section, which must be processed one by one, other experimental links can be more The samples are mixed and processed simultaneously, and finally the results of each sample can be returned by its unique primer tag sequence; this method has the characteristics of low cost, large flux and multiple different gene loci that can simultaneously detect a large number of samples.

The second generation of DNA sequencing technology has a shorter length of sequential sequencing than the first generation (Sanger method) DNA sequencing technology. By Illumina GA (Illumina's The Genome Analyzer sequencer (Illumina GA for short) is an example. The current maximum sequencing length of Illumina GA is 200 bp. When the length of the PCR product is greater than 200 bp, the entire PCR product cannot be tested by Illumina GA sequencing and directly by PCR sequencing. The entire DNA sequence information of the PCR product to be detected is not obtained. Short sequencing reads limit the application of second-generation sequencing technology, in addition to progressively improving sequencing technology to achieve longer actual sequencing reads, development can overcome the second-generation DNA sequencer's existing sequencing read length in PCR sequencing applications New technologies with insufficient fields have also become a top priority. Summary of the invention

Currently, using the second-generation sequencing technology, when sequencing a specific gene-related sequence in a large number of samples simultaneously, a PCR sequencing strategy is generally adopted, and a combination of primer label + second-generation sequencing technology is directly used. This technique is sufficient when the length of the sequencer used can cover the length of the entire PCR product. However, when the length of the sequencer used is not enough to cover the length of the entire PCR product, either replace the Illumina GA with a second-generation sequencer with a longer length (such as Roche 454 GS-FLX) if the length is not sufficient. If you can only sacrifice cost and throughput, switch to the first generation of sequencers.

The reality is that Illumina GA has ultra-high sequencing throughput, but its measurement length is only 200bp; although the length of Roche 454 GS-FLX can reach 500bp, its sequencing cost is higher and the throughput is smaller; the first generation of sequencer Although the length measurement can reach more than lOObp, its throughput and cost cannot be compared with the second generation sequencer.

Is there a technology that combines cost and throughput to increase the length of PCR products that a sequencer can measure? The combination of primer label + DNA incomplete disruption strategy and second-generation sequencing technology in this patent can make the length of the PCR product that the sequencer can measure while making full use of the high-throughput and low-cost characteristics of the second-generation sequencer. The sequencer itself measures more than the length, greatly expanding its scope of application. Wherein the use of the present invention The second-generation sequencing technology includes the Pair-end sequencing technology in the second-generation sequencing technology, and the PCR sequencing technology for the PCR template with the DNA Reference Sequence.

The present invention provides a method for PCR sequencing, which reduces the limitation caused by the short read length of the self-sequencing and expands the application of the second generation DNA sequencing technology in the field of PCR sequencing applications.

The design of the primer label varies according to the experimental platform used. Considering the characteristics of the Illumina GA sequencing platform itself, the present invention mainly considers the following points when designing the primer label: 1: Avoid more than 3 in the primer label sequence (including 3 Single base repeat, 2: the total content of base A and base C in the same site of all primer tags is between 30% and 70% of the total base content, 3: GC of the primer tag sequence itself The content is between 40-60%, 4: the sequence difference between the primer tags is greater than 4 bases, 5: the sequence with high similarity to the Illumina GA sequencing primer is avoided in the primer tag sequence, 6: the primer tag sequence addition is reduced. Upon the introduction of the PCR primer, the hairpin and the dimer were caused by the PCR primer.

The present invention introduces a primer tag at each end of the PCR product by PCR reaction (the primer tag sequence may be the same or different), so that the primer tag at either end of the PCR product can specifically label the sample information of the PCR product. The resulting PCR product was subjected to incomplete typing. The so-called incomplete interruption means that the final product contains a complete unbroken PCR product and a partially interrupted PCR product. The breaking method includes, but is not limited to, a chemical breaking method (for example, enzymatic cutting) and a physical breaking method, and the physical breaking method includes an ultrasonic breaking method or a mechanical breaking method. Interrupted DNA is electrophoresed on 2% agarose, and the gel is purified to recover all DNA bands from the maximum read length of the sequencer to the longest DNA length range that the sequencer can use (the longest DNA available for the Illumina GA sequencer) Is 700bp, this length is the original DNA length, no There are lengths of the library linker included). Purification and recovery methods include, but are not limited to, electrophoretic tapping recovery, magnetic bead recovery, and the like. The recovered DNA fragment is then subjected to a second-generation sequencer sequencing library construction process to construct a sequencing library, followed by sequencing, preferably using a PCR-FREE sequencing library construction process to construct a sequencing library, which is preferably sequenced using the Pair-End method. The procedure for PCR-Free sequencing library construction was constructed according to methods known to those skilled in the art. In the total sequencing data, the sequence information of all the tested samples can be found by the primer tag sequence, and each sequencing sequence is mapped to the corresponding DNA reference sequence (Reference Sequence) of the PCR product by BWA, and then the overlap between the sequencing sequences is performed. And the linkage relationship spliced out the complete sequence of the PCR product (Figure 1). Linkage here refers to the pair-end linkage relationship determined by the characteristics of Pair-End sequencing.

"Adapter" or "library adapter" tag technology refers to the addition of different library linkers to multiple sequencing libraries (the sequence of the different library linkers is different, and the different parts of the sequence are called adapter indices). ), constructing a tag sequencing library, thereby enabling a plurality of different tag sequencing libraries to be mixed and sequenced, and finally a library tagging technique in which the sequencing results of each tag sequencing library can be distinguished from each other.

The use of PCR sequencing methods based on DNA molecular tagging techniques and DNA incomplete disruption strategies greatly increases the number of uniquely labeled samples without increasing the number of primer tags.

The PCR-FREE library construction method combining the library linker technology means that the library linker is directly ligated to both ends of the DNA fragment in the sequencing library, and the introduction process of the library linker is called PCR-Free library construction because there is no PCR involved. . The access method can be ligated using DNA ligase. There is no PCR participation in the whole library construction process, which avoids the error caused by PCR and leads to the final conclusion during the construction of PCR product pooling library with high sequence similarity. Inaccuracy.

In the present invention, by adding a primer label to a positive and negative PCR primer and a DNA incomplete disruption strategy, when the second generation sequencing technology is applied to the field of PCR sequencing, the actual measurable PCR product length exceeds the maximum sequencing of the sequencer. length.

In one aspect of the invention, a set of primer indices is provided comprising at least 10 pairs, or at least 20 pairs, or at least 30 pairs, or at least 40 pairs of 95 pairs of primer labels shown in Table 1. Or at least 50 pairs, at least 60 pairs, or at least 70 pairs, or at least 80 pairs, or at least 90 pairs, or 95 pairs (or the set of primer labels are 10 - 95 pairs of 95 pairs of primer labels shown in Table 1) (eg 10 - 95 pairs, 20 - 95 pairs, 30 - 95 pairs, 40 - 95 pairs, 50 - 95 pairs, 60 - 95 pairs, 70 - 95 pairs, 80 - 95 pairs, 90 - 95 pairs, or 95 pairs ))), and

The set of primer tags preferably comprises at least PI-1 to PI-10, or PI-11 to ΡΙ-20, or PI-21 to ΡΙ-30, or PI-31 in the 95 pairs of primer labels shown in Table 1. To ΡΙ-40, or PI-41 to ΡΙ-50, or PI-51 to ΡΙ-60, or PI-61 to ΡΙ-70, or PI-71 to ΡΙ-80, or PI-81 to ΡΙ-90, Or PI-91 to ΡΙ-95, or a combination of any two or more of them.

According to another aspect of the present invention, there is further provided the use of the primer tag for a PCR sequencing method, wherein, in particular, each pair of primer tags is combined with a PCR primer pair for amplifying a sequence of interest to be tested into a pair of tag primers The 5th ends of the forward and reverse PCR primers have (or are optionally joined by a linker sequence) a forward primer tag and a reverse primer tag, respectively.

In a specific embodiment of the invention, the PCR primer is a PCR primer for amplifying a specific gene of HLA, preferably for amplifying HLA-A/B 2, 3, 4 exon and HLA-DRB1 PCR primers for exon 2, preferably the PCR primers are shown in Table 2. In another aspect of the invention, there is provided a set of tag primers comprising a set of primer tags described above and a PCR primer pair for amplifying a sequence of interest, wherein each pair of primer tags is combined with a PCR primer pair For the label primer, the 5th ends of the forward and reverse PCR primers have (or are optionally joined by a linker sequence) a forward primer label and a reverse primer label, respectively.

In a specific embodiment of the present invention, the PCR primer in the above-described tag primer is a PCR primer for amplifying a specific gene of HLA, preferably for amplifying HLA-A/B 2, 3, 4 PCR primers for the exon and HLA-DRB1 exon 2, preferably the PCR primers are shown in Table 2. In another embodiment of the invention, the tag primer is used in a PCR sequencing method.

In another aspect of the invention, a method of determining a nucleotide sequence of a nucleic acid of interest in a sample, comprising:

1) providing n samples, _n being an integer greater than or equal to 1, the sample preferably being from a mammal, more preferably a human, in particular a human blood sample; alternatively, dividing the n samples to be analyzed into m groups m is an integer and n > m >l;

2) Amplification: For each sample, a pair of label primers are used, and in the presence of a template from the sample, PCR amplification is carried out under conditions suitable for amplifying the nucleic acid of interest, wherein each pair of label primers comprises primers The label's forward label primer and reverse label primer (both may be degenerate primers), wherein the forward label il and the reverse label primer may contain the same or different primer labels; Primer labels are different from each other;

3) Interruption: The resulting PCR product library is incompletely interrupted;

4) Sequencing: The recovered DNA mixture is sequenced using a second generation sequencing technique, preferably a Pair-End technique (e.g., Illumina GA, Illumina Hiseq 2000), to obtain a sequence of the broken DNA;

5) Stitching: Based on the unique primer label for each sample, the sequencing results obtained will be Corresponding to the sample, the alignment sequence (such as Blast, BWA program) is used to locate each sequencing sequence to the corresponding DNA reference sequence of the PCR product, and the complete target nucleic acid is spliced from the sequence of the broken DNA by sequence overlap and linkage. .

1) providing n samples, n being an integer greater than or equal to 1, the sample preferably being from a human, in particular a human blood sample; optionally, dividing n samples to be analyzed into m groups, m being an integer and n > m > 1 ;

2) Amplification: For each sample, a pair of label primers are used, and in the presence of a template from the sample, PCR is performed under conditions suitable for amplifying the nucleic acid of interest, wherein each pair of label primers comprises a primer label The forward label primer and the reverse label primer (both may be degenerate primers), wherein the forward label primer and the reverse label primer may contain the same or different primer labels; the primer label in the label primer pair used for different samples Different from each other;

3) mixing: mixing PCR amplification products of each sample to obtain a PCR product library;

4) interruption: the resulting PCR product library is incompletely interrupted;

5) Building a library: Construct a PCR-Free sequencing library from the interrupted PCR product library, and recover all the DNA bands located between the maximum read length of the sequencer used and the longest DNA length range used by the sequencer used. The library adds different library adapters to distinguish different PCR-Free sequencing libraries;

6) Sequencing: The recovered DNA mixture is sequenced using a second-generation sequencing technique, preferably a Pair-End technique (eg, Illumina GA, Illumina Hiseq 2000), to obtain a sequence of the interrupted DNA;

7) Stitching: Based on the different library linker sequences of each library and the unique primer tags of each sample, the sequencing results obtained are one-to-one corresponding to the samples, and the alignment program is used. For example, Blast, the BWA program, each sequencing sequence is mapped to the corresponding DNA reference sequence of the PCR product, and the complete target nucleic acid is spliced from the sequence of the broken DNA by sequence overlap and linkage.

In a specific embodiment of the present invention, in the sequencing method described above, each pair of primer tags and PCR primer pairs are combined into a pair of tag primers, and the 5th ends of the forward and reverse PCR primers respectively have (or optionally pass The ligation sequence is ligated with a forward primer tag and a reverse primer tag.

In a specific embodiment of the present invention, in the sequencing method described above, the PCR primer is a PCR primer for amplifying a specific gene of HLA, preferably 2 for amplifying HLA-A/B. PCR primers for exon 3, exon 4 and exon 2 of HLA-DRB1, preferably the PCR primers are shown in Table 2.

In a specific embodiment of the present invention, in the sequencing method described above, the primer tag is designed for PCR primers, preferably for PCR primers for amplifying a specific gene of 3⁄4A, more preferably for use. PCR primers for amplifying exon 2, 3, and 4 of HLA-A/B and exon 2 of HLA-DRB1, particularly PCR primers as shown in Table 2, especially including a table 1 at least 10 pairs of 95 pairs of primer labels, or at least 20 pairs, or at least 30 pairs, or at least 40 pairs, or at least 50 pairs, at least 60 pairs, or at least 70 pairs, or at least 80 pairs, or at least 90 Pairs, or 95 pairs (or the set of primer labels are 10 - 95 pairs of 95 pairs of primer labels shown in Table 1 (eg 10 - 95 pairs, 20 - 95 pairs, 30 - 95 pairs, 40 - 95 pairs, 50-95 pairs, 60-95 pairs, 70-95 pairs, 80-95 pairs, 90-95 pairs, or 95 pairs), and

The set of primer tags preferably comprises at least PI-1 to PI-10, or PI-11 to PI-20, or PI-21 to PI-30, or PI-31 in 95 pairs of primer labels shown in Table 1. To PI-40, or PI-41 to PI-50, or PI-51 to PI-60, or PI-61 to PI-70, or PI-71 to PI-80, or PI-81 to PI-90, Or PI-91 to PI-95, or it Any combination of two or more of them.

In a specific embodiment of the present invention, in the sequencing method described above, the DNA disruption includes a chemical disruption method and a physical disruption method, wherein the chemical method includes an enzyme digestion method, and the physical The breaking method includes an ultrasonic breaking method or a mechanical breaking method. After the DNA was disrupted, fragments of 450-750 bp in length were isolated.

In another aspect of the invention, an HLA typing method is provided, comprising: sequencing a sample (especially a blood sample) from a patient using the sequencing method described above, and sequencing the result with an HLA database (eg, IMGT HLA) The standard sequence data alignment in the professional database), the 100% match of the sequence alignment results is the HLA genotype of the corresponding sample. DRAWINGS

Figure 1: Sequence primers for primer labeling, DNA disruption, and DNA sequencing. The positive and negative primer tag sequences Index-NF/R (1) were introduced into the PCR product of the No. N sample. The products of the PCR product interrupted by physical methods include: a product with a primer tag sequence at one end, both ends a product without a primer tag sequence, a product that is completely unbroken, and a tapping purification to recover all DNA bands located between the maximum read length of the sequencer and the longest DNA length range applicable to the sequencer for sequencing (2), Using the Index-NF/R to retrieve the sequencing result of the PCR product belonging to the No. N sample in the sequencing result, and using the known reference sequence information of the PCR product to locate the relative reference position of each sequencing sequence, and according to the overlap between the sequencing sequences And the linkage relationship assembled into a complete PCR product (3, 4).

Figure 2: Electrophoresis results of the corresponding exon PCR products of sample No. 1 HLA-A/B/DRB1. From the electropherogram, the PCR product is a series of single bands with a fragment size of 300bp-500bp, wherein lane M is the molecular weight marker. (DL 2000, Takara), Lanes 1-7 are the HLA-A/B/DRB1 exons of sample No. 1 (A2, A3, A4, B2, B3, B4, DRBl-2) PCR amplification products, negative control (N) without amplification bands. The results for the other samples are similar.

Figure 3: DNA electrophoresis after HLA-Mix interruption (before and after tapping), the tapping area is 450-750 bp. Lane M is a molecular weight marker (NEB-50bp DNA Ladder), lane 1 is the electrophoresis of HLA-Mix before tapping, and lane 2 is the gel of HLA-Mix after tapping.

Figure 4: Screenshot of the consensus sequence constructor for sample No. 1, which illustrates the complete sequence of the spliced PCR product based on the overlap between the primer tag and the DN A fragment. detailed description

The embodiments of the present invention are described in detail below with reference to the accompanying drawings.

In an embodiment of the invention, 95 samples of HLA-A/B 2, 3, and 4 exons were obtained by adopting a combination of primer tag + DNA incomplete disruption strategy + Illumia GA sequencer Pair-End 100 sequencing technology. And the genotyping of exon 2 of HLA-DRB1 (the length of PCR product is between 290bp and 500bp), which proves that this strategy can realize the high-throughput and low-cost of the second-generation sequencer. The typing of gene fragments that exceed the length of the sequencer itself.

Principle: The primers to be analyzed are introduced into the primers of the HLA-A/B 2, 3, 4 exons and the HLA-DRB1 exon 2 PCR product by PCR, so that the specific PCR products are labeled. Sample information. The PCR amplification products of the three sites of HLA-A/B/DRB1 in each sample were mixed together to obtain a PCR product library; the PCR product library was not completely interrupted by ultrasound, and a PCR-Free sequencing library was constructed. The sequencing library was electrophoresed by 2% low melting agarose, pure gel All DNA bands between 450 bp and 750 bp in length were recovered (the library linker was added to both ends of the DNA fragment during the construction of the PCR-Free sequencing library, so that the length of the DNA fragment on the electropherogram is longer than the actual The length is about 250 bp, so the 450 bp to 700 bp fragment is recovered here, which is equivalent to recovering a DNA fragment of 200 bp to 500 bp in length. The recovered DNA was sequenced by Illumina GA PE-100. The sequence information of all the tested samples can be found by the primer tag sequence, and the sequence of the entire PCR product is assembled by the overlapping and linkage relationship between the reference sequence information of the known DNA fragment and the sequence of the DNA fragment, and then passed through HLA-A/ The alignment of the standard database of the corresponding exons of B/DRB1 can assemble the entire sequence of the original PCR product to achieve genotyping of HLA-A/B/DRB1. Example 1

Sample extraction

DNA was extracted from 95 blood samples of known HLA-SBT typing (Chinese Hematopoietic Stem Cell Donor Database (hereinafter referred to as "Zhonghua Marrow Bank") using the KingFisher Automatic Extractor (American Thermo). The main steps are as follows: Take out the deep hole plate and one shallow hole plate of 6 Kingfisher automatic extractor. Add a certain amount of matching reagents according to the instructions and mark them. Place all the well plates with reagents as required. Corresponding position, select the program "Bioeasy a 200ul Blood DNA-KF.msz" program, press "star" to execute the program for nucleic acid extraction. At the end of the program, approximately 100 μL of the eluted product in the plate Elution was collected as the extracted DNA. Example 2

PCR amplification

Different by making PCR primers with different primer tags at the 5, end PCR tag primers, such that different PCR tag primers can be used for different samples, the PCR primers are PCR primers for exons 2, 3, 4 of HLA-A/B and exon 2 of HLA-DRB1. A primer tag is then introduced at both ends of the PCR product by a PCR reaction to specifically label PCR products from different samples.

95 sets of PCR-labeled primers were used to amplify 95 DNA samples, each set of PCR-label primers consisting of a pair of bidirectional primer tags (Table 1) and exons 2, 3, 4 for amplifying HLA-A/B and A PCR primer (Table 2) consisting of exon 2 of HLA-DRB1, wherein each forward PCR primer has a forward primer label attached to a pair of primer tags at the 5' end, and the 5' end of the reverse PCR primer is ligated. A reverse primer label for a pair of primer tags. The primer tag is added directly to the 5, end of the PCR primer when the primer is synthesized.

The 95 DNAs obtained in the sample extraction step of Example 1 were sequentially numbered 1-95, and the PCR reaction was carried out in a 96-well plate, a total of 7 plates, numbered HLA-P-A2, HLA-P-A3, HLA, respectively. -P-A4, HLA-P-B2, HLA-P-B3, HLA-P-B4 and HLA-P-DRB1-2 (A2/3/4, B2/B3/B4, DRB1-2 for amplification) Site), a negative control without template was set in the plate, and the primer used in the negative control was the same as the corresponding primer of template 1. At the same time as the experiment, record the sample number information corresponding to each pair of primer labels.

Table 1, Primer Label Information

Sz PD 0DV0 DV10V13 8r-u

LZ £3 3V3VOVIVOXDI LZ-Ιά

91 ZD XV1019VI30I3 9Ζ-\ά sz ID IV0VXV3V30V3 XVI3XOX3VDV1 sr-u

PZ z 3V0丄 i)丄 03Vf)V丄 PZ-ld

£Z na :) VOlVJ Di:)丄 V £Z-ld

ZZ oia 1V0X3V30IV13 VOV13I3V30DV ΖΖ-Ιά

IZ 68 V IV IODVIO丄 f)V丄 vio i iv)

Oz 80 νονοί):) ί)ν丄 f) V 30V03I3I01DV oz-u

61 Z.S 丄 VO VOVIVIDI 6I-IJ

81 99 9V3031VX0V1D 3VXVI31V303V 8T-U

LI DYDDIDYIDDDD DDD1DD1DDYDD "-Id

91 lyOLDDlYDDDV DXV3V1D3IDV3 9T-IJ

SI £9 YDDYDDLYDIDI : LOVD i );)丄 fXL Si-Id

Za :)丄 OJ^VD!DVJLV:) DVS i:)丄 01331 n-iA

£T ia :) V 30i)Vi 丄 3IV3VOXVODV3 ει-υ

Zl nv 0109 work OVIOV work V Ζ\-Ιά

II XIV ODV!DI OVJ^V丄 XV10303I3V0V II-Id

01 OIV X0303VD10V1V 3I3103V3VI3V 01 -u

6 6V 303V3VI0VI3V 6-Id

8 8V 8-Id

L LY 30VIV103IV9V L-ld

9 9V VO丄 V丄:)丄 30V0I30XV3V1 9-Id

S SV 10iDVf :) JLV丄 VIVO丄:) 3 workers :) s-w

P V :) Vi) OVlOI i) 丄 P-Id

l7C8lOOOlOiN3/X3d S3 0V01V103V3VX £S-Id

ZS I VX03V0X30VXD DOVXVIOVOIVD zs-u

IS £3 03XV9V303V3V V i)丄丄 is-w

OS za 131V1V0V30IV IDI0V1V130VD OS-Id

6P la VOV3V1VOIOD1 3IV1DV1VDOV3 6f"Id

SP rxa VOVIO丄 OVJ^Ol 303I3V3VDV0D 8f-IJ

LP na LP-ld

9P oia DlVOVD i:)丄 3丄 V3V13V31303I 9P-ld

SP 6a 3V0X0V03031V 3V13VOV1V313 Sf-ld

PP 8a V3IV10VXV0I3 DX0V013X3V0V Pf-ld

£P Ld 1:)丄 31Vi)li)\ £P-Id

ZP 9a DLVDVDyDl Dl DLDD1D 1Y1DL ΖΡ-ld

IP sa DDDDYDYIVDDI 1VOVX3X3VIVI IP-Id

OP t VODYDYDDLDYD 3V1V3XVX30V3 ΟΡ-ld

6£ εα DlDDl YDyDOy 6£-ld

S£ za XV13IV0VI03V V3I9V1DI3V3V 8£"Id

LI τα 9V01V0303V3X L£-ld

9£ zio V3VIDOIV1V9X 3030VX010V3V 9£-Id se UD V03X0VXVI3VX

013 31Vi:)i)JLi):)丄 31 f£-IJ εε 60 VXD3V313V1V3 丄 DOOV ££-ld zt 83 3V3VOXV3IVI3 XVOVXV3X3V3V re-id l£ LD VDVt)丄 ViDOiDVl ιε-id

0£ 93 XVID3X3XV3VI DYDIDDDDYDYD οε-Η

6Z S3 3VOVOI3V1V3V VX30V0I3V0V1

l7C8lOO/OlOZN3/X3d ZSTOOO/ZIOZ OAV 8 9D 丄:) DVOViDVliDVJL SL-ld

LL SO V3I303V013VD LL-Ιά

9L PD V3IVDOV13VIV 9L-\d

SL εο DVE VIV )丄 VOO 丄 OOJLVIOVO IV Si-Id L ZD 丄 Vi)丄 V丄 VOl Vf)丄 iDVOV 丄 3JL PL-Id

£L ID 丄 :>3:>vi)v 1V3V1VI3IOVX tL ld

ZL ΖΙΛ VlOVOlVi) 丄 30丄 IVOOVlf):)丄 V1V ZL-Id

IL UA VXDV103V3V0D XVOVDVXVI3V3 -id

OL Old ) V丄 OVOliDliD l 丄 OZ.-U

69 6Λ 031V0IV30X3V VX3X3V3VXDV3 69-Id

89 8i IV3XDOXD1DV3 89-Id

L9 Ld DIDDIVDYIDDI V03V010XV3V1 L9-ld

99 9Λ l lV lOOOVi)丄 130X03I3VDVX 99-Id

S9 丄 ) 130丄 I3IDVIVOV3VX S9"Id 9 Λ P9-ld

£9 £Λ £9-ld

19 ΖΛ 3VOXODI3V13X Z9-U

19 ΙΛ I3IVIOX3V1V3 19-Id

09 ΠΉ V013VD1V130X O VDIDIO:)丄 ) V 09-Id

6S na 0V0I03V0313V 6S"Id

8S oia VDOVO丄 3 丄 V0V3V03I0X93 8S"Id

LS DDDyiDDDYDDl LS ld

9S 83 3V9IV030VXVX fJV JD Work V VO丄 3 9S-Id

, a D03V3VXVD0VX SS-Id

PS 93 丄:) 3VI303I3V03V

l7C8lOOOlOiN3/X3d PI-79 TGTATCACGAGC ATGATCGTATAC G7 79

PI-80 TACTGCTATCTC CGCTGCATAGCG G8 80

PI-81 CGCGAGCTCGTC ACTCGATGAGCT G9 81

PI-82 TAGAGTCTGTAT TGTCTATCACAT G10 82

PI-83 TACTATCGCTCT TATGTGACATAC Gil 83

PI-84 TAGATGACGCTC TACTCGTAGCGC G12 84

PI-85 TCGCGTGACATC ATCTACTGACGT HI 85

PI-86 ACACGCTCTACT ACAGTAGCGCAC H2 86

PI-87 TACATAGTCTCG CTAGTATCATGA H3 87

PI-88 TGAGTAGCACGC TCGATCATGCAG H4 88

PI-89 TAGATGCTATAC TACATGCACTCA H5 89

PI-90 ATCGATGTCACG CAGCTCGACTAC H6 90

PI-91 ATCATATGTAGC CTCTACAGTCAC H7 91

PI-92 TAGCATCGATAT AGATAGCACATC H8 92

PI-93 TGATCGACGCTC CTAGATATCGTC H9 93

PI-94 TGCAGCTCATAG TACAGACTGCAC H10 94

PI-95 CGACGTAGAGTC CAGTAGCACTAC Hll 95 Table 2, PCR primers for amplifying the corresponding exons of HLA-A/B/DRB1 before the primer label was added

A-F4 GTGTCCCATGACAGATGCAAAA Expand HLA-A gene 4

430bp

A-R4 GGCCCTGACCCTGCTAAAGG exon

B-F2 AGGAGCGAGGGGACCGCA Expand HLA-B gene 2

400bp

B-R2 CGGGCCGGGGTCACTCAC exon

B-F3 CGGGGCCAGGGTCTCACA expansion HLA-B gene 3

370bp

B-R3 GAGGCCATCCCCGGCGAC exon

B-F4 GCTGGTCACATGGGTGGTCCTA expansion HLA-A gene 4

380bp

B-R4 CTCCTTACCCCATCTCAGGGTG exon

D2-F1 CACGTTTCTTGGAGTACTCTA

D2-F2 GTTTCTTGTGGCAgCTTAAgTT

D2-F3 CCTGTGGCAGGGTAAGTATA

D2-F4 GTTTCTTGAAGCAGGATAAGTT Expansion HLA-DRB1 base

300bp

D2-F5 GCACGTTTCTTGGAGGAGG due to exon 2

D2-F6 TTTCCTGTGGCAGCCTAAGA

D2-F7 GTTTCTTGGAGCAGGTTAAAC

D2-R CCTCACCTCGCCGCTGCAC

D2-F1, D2-F2, D2-F3, D2-F4, D2-F5, D2-F6, D2-F7 are forward primers for amplifying HLA-DRB1 exon 2, and D2-R is for amplifying HLA- Reverse primer for exon 2 of DRB1.

The PCR procedure for HLA-A/B/DRB1 is as follows:

96 2min

95 °C 30s 60 30s 72 "C 20s (32cycles)

∞ HLA-A/B PCR reaction system All reagents were purchased from Promega (Promega)

The PCR reaction system of HLA-DRB1 is as follows:

Wherein PI _Ar A/B/D2-F _{1/2/3/4/5/6/7} represents primer 5, and HLA-A/B/DRB1 with the nth forward primer tag sequence (Table 1) at the end F primer, PI _nr A/B/D2-R _2/3/4 denotes primer 5, and the R primer of HLA-A/B/DRB1 with the nth reverse primer tag sequence at the end (here n < 95 ), others and so on. And each sample corresponds to a specific set of PCR primers ( _nr deletion - Έ listen _{l4 / sl6n} , PI _nr A / B / D2 - R ₂ / 3 / ₄ ).

The PCR reaction was run on a Bio-Rad PTC-200 PCR machine. After the PCR was completed, 2 ul of the PCR product was detected by 1% agarose gel electrophoresis. Figure 2 shows the electrophoresis results of the corresponding exon PCR products of sample No. 1 HLA-A/B/DRB1. The DNA molecular marker is DL 2000 ( Takara). The gel map has a series of single bands with a fragment size of 300bp-500bp, indicating The HLA-A/B/DRB1 exons (A2, A3, A4, B2, B3, B4, DRB1-2) of sample No. 1 were successfully amplified by PCR, and the negative control (N) had no amplified bands. The results of other samples are similar to this. Example 3

PCR product mixing and purification

From the remaining PCR product of 96-well plate HLA-P-A2 (except the negative control), 20 ul each was mixed in a 3 ml EP tube, labeled as HLA-A2-Mix, and the same operation was performed on the other 6 96-well plates. , labeled HLA-A3-Mix, HLA-A4-Mix, HLA-B2-Mix, HLA-B3-Mix _v HLA-B4-Mix and HLA-D2-Mix, oscillating and mixing, from HLA-A2-Mix 200 ul of HLA-A3-Mix, HLA-A4-Mix, HLA-B2-Mix, HLA-B3-Mix, HLA-B4-Mix and HLA-D2-Mix were mixed in a 3 ml EP tube, labeled For HLA-Mix, 500ul DNA mixture from HLA-Mix was purified by Qiagen DNA Purification kit (QIAGEN). For details, see the instructions), 200 ul of DNA obtained was purified, and the concentration of HLA-Mix DNA was determined to be 48 ng/ul by Nanodrop 8000 (Thermo Fisher Scientific). Example 4

Interruption of PCR products and construction of Illumina GA PCR-Free sequencing library

DNA interruption

A total of 5 ug of DNA from the purified HLA-Mix was disrupted on a Covaris S2 DNA interrupter (Covaris) using Covaris microtubes with AFA fiber caps. The breaking conditions are as follows:

Frequency sweeping (fre uency sweeping)

2. Purification after interruption

All the interrupted products of HLA-Mix were recovered and purified by QIAquick PCR Purification Kit and dissolved in 37.5 ul of EB (QIAGEN Elution Buffer);

3. End repair response

DNA end-repairing reaction of HLA-Mix purified after interruption, such as

Polynucleotide Kinase Buffer ( 10x Polynucleotide Kinase Buffer ( B904 ) ) 10

dNTP mixture (each lOmM) (Solution Set ( lOmM each ) ) 4 μL

T4 DNA Polymerase (T4 DNA Polymerase) 5μ

Kleno Fragment (Klenow Fragment)

T4 Polynucleotide Kinase

Total volume 100

The reaction conditions are: Thermomixer (Thermomixer, Eppendorf)

20 warm bath for 30 min.

The reaction product was recovered by QIAquick PCR Purification Kit and dissolved in 34 μM EB (QIAGEN Elution Buffer).

4. 3, end plus A reaction

The DNA was recovered in the previous step, and the end was added with A reaction. The system was as follows (reagents were purchased from Enzymatics):

DNA obtained in the previous step 32

10x blue buffer ( 10x blue buffer ) 5 μL·

dATP (lmM, GE) 10

Klenow (3'-5' exo-) 3

Total volume 50

The reaction conditions were: Constant Temperature Mixer (Thermomixer, Eppendorf) 37 Warm bath for 30 min.

The reaction product was recovered and purified by MiniElute PCR Purification Kit (QIAGEN) and dissolved in 13 μM EB solution (QIAGEN Elution Buffer).

5. Connect the Illumina GA PCR-Free library connector (adapter) The term "PCR-Free library adaptor" refers to a designed set of bases whose primary function is to assist in the immobilization of DNA molecules on a sequencing chip and to provide a binding site for universal sequencing primers. PCR-Free library linkers can pass DNA. The ligase directly ligates it to both ends of the DNA fragment in the sequencing library, and the introduction process of the library linker is called PCR-Free library linker because there is no PCR involved.

The product after addition of A was ligated to the Illumina GA PCR-Free library linker, and the system was as follows (reagents were purchased from Illumina):

DNA obtained in the previous step Ιΐμί

2x Rapid ligation buffer

PCR-free oligonucleotide linker mix (30mM) (PCR-free Adapter Ιμί

Oligo mix )

T4 DNA Ligase (Rapid, L603-HC-L) 3μΙ Total Volume 30

The reaction conditions were: a thermomixer (Thermomixer, Eppendorf) 20X bath for 15 min.

The reaction product was purified by Ampure Beads (Beckman Coulter Genomics) and dissolved in 50 ul of deionized water. The DNA concentration was determined by real-time PCR (QPCR) as follows:

6. Tapping recycling

Take 3 (^L HLA-Mix with 2% low melting point agarose gel for recovery. The electrophoresis conditions are 100V, 100min. The DNA marker is NEB's 50bp DNA marker. The tapping gel recovers the DNA fragment of 450-750bp length range (Figure 3) ). Rubber recycling The material was recovered and purified by QIAquick PCR Purification Kit (QIAGE), and the volume after purification was 32 ul. The DNA concentration was 10.16 nM by real-time PCR (QPCR). Example 5

Illumina GA sequencing

According to the QPCR test results, lOpmol DNA was sequenced using the Illumina GA PE-100 program. The specific procedure is detailed in the Illumina GA operating instructions (Illumina GA Π x ). Example 6

Result analysis

The sequencing result of Illumina GA is a series of DNA sequences. By searching the sequence of the positive and negative primers and the primer sequences in the sequencing results, the sequencing results of the PCR products of the HLA-A/B/DRB1 exons corresponding to each primer label are established. database. The sequencing results of each exon are mapped to the reference sequence of the corresponding exon by BWA (Burrows-Wheeler Aligner) (reference sequence source: http://www.ebi.ac.uk/imgt/hla/) Build consistency across databases

(consistency) sequence, and then the DNA sequence in the database is screened and sequenced for error correction. Corrected DNA sequence through sequence overlap and linkage

The (pair-End linkage) relationship can be assembled into the corresponding sequence of each exon of HLA-A/B/DRB1. The obtained DNA sequence was aligned with the sequence database of the corresponding exons of HLA-A/B/DRB1 in the IMGT HLA professional database, and the 100% match of the sequence alignment results was the HLA-A/B/DRB1 genotype of the corresponding sample. do not. A screenshot of the exon 2 consensus sequence constructor for the HLA-A site of sample No. 1 illustrated in Figure 4 can be seen. For all 95 samples, the results obtained were completely identical to the results of the original known classification. The specific results of the samples No. 1-32 are as follows:

Sample No. Original HLA-A/B/DRB1 Type

Α*02:03 A*ll:01 38:02 B' *48:01 DRB1' "=14:54 DRB1*15:01

2 Α*01:01 Α*30:01 B ^J ^3⁄4 08:01 B*13:02 DRB1' ^3⁄4 03:01 DRB1*07:01

3. Α*01:01 Α*02:01 B ^J 45:11 B*47:01 DRB1*13:02 DRB1*15:01

4 Α*24:08 Α*26:01 ^k 40:01 B' ^k 51:01 DRB1'"04:04 DRB1*09:01

5 Α*01:01 Α*24:02 B ^{J fe} 54:01 B'"55:02DRB1'"04:05 DRB1*09:01

6 Α*01:01 Α*03:02 ^fe 15:ll B' ^37:01 DRB1'"=10:01 DRB1*14:54

7 Α*11:01 Α*30:01 43:02 B' "15:18 DRB1' "=04:04 DRB1*07:01

8 Α*01:01 Α*02:01 "35:03 B' "81:01 DRB1' "11:01 DRB1*15:01

9 Α*02:06 Α*31:01 ^k 27:07 B'"40:02DRB1'"03:01 DRB1*13:02

10 Α*01:01 Α*66:01 ^k 37:01 B'"49:01DRB1' ^fe 10:01 DRB1*13:02

11 Α * 01: 01 Α * 03: 01 35:01 B k 52:! 0l DRB1 '¾ 01:01 DRB1 * 15: 02

12 Α*11:01 Α*11:01 45:01 B*15:05 DRB1' "04:06 DRB1*15:01

13 Α*01:01 Α*11:02 Β*07:02 B*15:02 DRB1' "09:01 DRB1*15:01

14 Α*01:01 Α*02:01 ^k 52:01 B'"67:01DRB1'"15:02 DRB1*16:02

15 Α*01:01 Α*02:05 Β*15:17 B' ^fc 50:01 DRB1'"=07:01 DRB1*15:01

16 Α*01:01 Α*11:01 Β*37:01 B' 0:02 DRB1' ^k 10:01 DRB1*12:02

17 Α*24:07 Α*32:01 Β*35:05 B*40:01 DRB1' "03:01 DRB1*04:05

18 Α*11:01 Α*24:02 ^k 13:01 B'"35:01 DRB1*16:02 DRB1*16:02

19 Α*11:01 Α*11:01 "40:02 B*55:12 DRB1' ^k 04:05 DRB1*15:01

20 Α*02:11 Α*24:02 ^k 40:01 B' 0:06 DRB1*11:01 DRB1*15:01

21 Α*01:01 Α*02:06 ^k 51:01 B' 7:01 DRB1*07:01 DRB1*12:01

22 Α*01:01 Α*29:01 ^k 07:05 B'"15:01DRB1' ^k 04:05 DRB1*07:01

23 Α*01:01 Α*02:07 ^37:01 B' ^fe 46:01 DRB1' ^k 04:03 DRB1*10:01

24 Α*24:85 Α*30:01 Β ^ν 43:02 B'"55:02DRB1' ^fe 07:01 DRB1*15:01

25 Α*11:01 Α*31:01 ^07:06 B' "51:01 DRB1' "12:02 DRB1*14:05

26 Α * 01: 01 Α * 11: 01 k 46:01 B '"57:01DRB1' ¾ 07:01 DRB1 * 08: 03

27 Α*01:01 Α*02:01 45:18 B*37:01 DRB1' ^3⁄4 04:01 DRB1*15:01

28 Α*01:01 Α*24:02 Β*37:01 B'"46:01DRB1' ^k 09:01 DRB1*10:01

29 Α * 26: 01 Α * 66: 01 Β ν k 40:40 B '¾ 41:02 DRB1' ni: 0l DRB1 * 1S: 01

30 Α*02:01 Α*29:02 43:02 B' "45:01 DRB1' "03:01 DRB1*12:02

31 Α*01:01 Α*11:03 Β ^ν 5:01 B'"57:01DRB1' ^fe 07:01 DRB1*15:01

32 Α*11:01 Α*26:01 Β*35:03 B' "38:01 DRB1' "11:03 DRB1*14:04 Sample No. Measured HLA-A/B/DRB1 type

1 A*02:03 A*ll:01 B*38:02 B*48:01 DRB1*14:54 DRB1*15:01 2 A*01 01 A*30:01 B*08:01 B*13:02 DRB1*03:01 DRB1*07:01

3 A*01 01 A*02:01 B*15:ll B*47:01 DRB1*13:02 DRB1*15:01

4 A*24 08 A*26:01 B*40:01 B*51:01 DRB1*04:04 DRB1*09:01

5 A*01 01 A*24:02 B*54:01 B*55:02 DRB1*04:05 DRB1*09:01

6 A*01 01 A*03:02 B*15:ll B*37:01 DRB1*10:01 DRB1*14:54

7 A*ll 01 A*30:01 B*13:02 B*15:18 DRB1*04:04 DRB1*07:01

8 A*01 01 A*02:01 B*35:03 B*81:01 DRB1*11:01 DRB1*15:01

9 A*02 06 A*31:01 B*27:07 B*40:02 DRB1*03:01 DRB1*13:02

10 A*01 01 A*66:01 B*37:01 B*49:01 DRB1*10:01 DRB1*13:02

11 A*01 01 A*03:01 B*35:01 B*52:01 DRB1*01:01 DRB1*15:02

12 A*ll 01 A*ll:01 B*15:01 B*15:05 DRB1*04:06 DRB1*15:01

13 A*01 01 A*ll:02 B*07:02 B*15:02 DRB1*09:01 DRB1*15:01

14 A*01 01 A*02:01 B*52:01 B*67:01 DRB1*15:02 DRB1*16:02

15 A*01 01 A*02:05 B*15:17 B*50:01 DRB1*07:01 DRB1*15:01

16 A*01 01 A*ll:01 B*37:01 B*40:02 DRB1*10:01 DRB1*12:02

17 A*24 07 A*32:01 B*35:05 B*40:01 DRB1*03:01 DRB1*04:05

18 A*ll 01 A*24:02 B*13:01 B*35:01 DRB1*16:02 DRB1*16:02

19 A*ll 01 A* 11 :01 B*40:02 B*55:12 DRB1*04:05 DRB1*15:01

20 A*02 11 A*24:02 B*40:01 B*40:06 DRB1*11:01 DRB1*15:01

21 A*01 01 A*02:06 B*51:01 B*57:01 DRB1*07:01 DRB1*12:01

22 A*01 01 A*29:01 B*07:05 B*15:01 DRB1*04:05 DRB1*07:01

23 A*01 01 A*02:07 B*37:01 B 6.01 DRB1*04:03 DRB1*10:01

24 A*24 85 A*30:01 B* 13:02 B*55:02 DRB1*07:01 DRB1*15:01

25 A*ll 01 A*31:01 B*07:06 B*51:01 DRB1*12:02 DRB1*14:05

26 A*01 01 A*ll:01 B*46:01 B*57:01 DRB1*07:01 DRB1*08:03

27 A*01 01 A*02:01 B*15:18 B*37:01 DRB1*04:01 DRB1*15:01

28 A*01 01 A*24:02 B*37:01 B*46:01 DRB1*09:01 DRB1*10:01

29 A*26 01 A*66:01 B*40:40 B*41:02 DRB1*12:01 DRB1*15:01

30 A*02 01 A*29:02 B*13:02 B*45:01 DRB1*03:01 DRB1*12:02

31 A*01 01 A*ll:03 B*15:01 B*57:01 DRB1*07:01 DRB1*15:01

32 A*ll 01 A*26:01 B*35:03 B*38:01 DRB1*11:03 DRB1*14:04 Note: DRB1*1201 in HLA-DRBl type does not exclude DRB1*1206/1210/ The possibility of 1217, DRB1*1454 does not exclude the possibility of DRB1*1401, since the above alleles have identical sequences in exon 2 of HLA-DRB1. Although specific embodiments of the invention have been described in detail, those skilled in the art will understand. Various modifications and substitutions may be made to those details in light of the teachings of the invention, which are within the scope of the invention. The full scope of the invention is given by the appended claims and any equivalents thereof. references

[1]. http://www.ebi.ac.uk/imgt/hla/stats.html

[2]. Tiercy J M. Molecular basis of HLA polymorphism: implications in clinical transplantation. [J]. Transpl Immunol, 2002, 9: 173-180.

[3]. C. Antoine, S. Muller, A. Cant, et al. Long-term survival and transplantation of haemopoietic stem cells for immunodeficiencies: report of the European experience. 1968-99.

[J]. The Lancet, 2003, 9357: 553-560.

[4]. H. A. Erlich, G. Opelz, J. Hansen, et al. HLA DNA Typing and Transplantation. [J]. Immunity, 2001, 14: 347-356.

[5]. Lillo R, Balas A, Vicario JL, et al. Two new HLA class allele, DPBl*02014, by sequence-based typing. [J]. Tissue Antigens, 2002, 59: 47-48,

[6]. A. Dormoy, N. Froelich . Leisenbach, et al. Mono-allelic amplification of exons 2-4 using allele group-specific primers for sequence-based typing (SBT) of the HLA-A, -B and - C genes: Preparation and validation of ready-to-use pre-SBT mini-kits. [J]. Tissue Antigens, 2003, 62: 201-216.

[7]. Elaine R. Mardis. The impact of next-generation sequencing technology on genetics. [J]. Trends in Genetics. 2008, 24: 133-141.

[8]. Christian Hoffmannl, Nana Minkahl, Jeremy Leipzig. DNA barcoding and pyrosequencing to identify rare HIV drug resistance mutations. [J]. Nucleic Acids Research, 2007, l-8.

[9]. Shannon J. Odelberg, Robert B. Weiss, Akira Hata. Template-switching during DNA synthesis by Therm us aquaticus DNA polymerase I. [J]. Nucleic Acids Research.1995, 23:2049-2057.

[10]. Sayer D, Whidborne R, Brestovac B. HLA - DRB1 DNA sequencing based typing typing: an approach suitable for high throughput typing including unrelated bone marrow registry donors. [J]. Tissue Antigens. 2001, 57(l):46 -54.

[11]. Iwanka Kozarewa, Zemin Ning, Michael A Quail. Amplification-free Illumina sequencing-library preparation facilitates improved mapping and assembly of (G+C)-biased genomes. [J]. Nature Methods. 2009, 6:291 - 295.

Claims

Rights request

A method of determining a nucleotide sequence of a nucleic acid of interest in a sample, comprising:

1) providing n samples, n being an integer greater than or equal to 1, the sample preferably being from a mammal, more preferably a human, in particular a human blood sample; alternatively, dividing the n samples to be analyzed into m groups , m is an integer and n > m > l;

2) Amplification: For each sample, one or more pairs of label primers are used, and in the presence of a template from the sample, PCR amplification is performed under conditions suitable for amplifying the nucleic acid of interest, wherein each pair of label primers The forward label primer and the reverse label primer (both may be degenerate primers) including the primer label, wherein the forward label primer and the reverse label primer may contain the same or different primer labels; the label primer pair used for different samples The primer labels in each other are different from each other;

3) mixing: when η>1, the PCR amplification products of each sample are mixed together;

4) Interruption: the obtained amplification product is incompletely interrupted, and purified and recovered;

5) Sequencing: The recovered DNA mixture is sequenced using a second-generation sequencing technique, preferably a Pair-End technique (eg, IUumina GA, IUumina Hiseq 2000), to obtain a sequence of interrupted DNA;

6) Stitching: The sequencing results obtained are based on the unique primer labels of each sample, and the sequencing sequences (for example, Blast, BWA program) are used to locate each sequencing sequence on the corresponding DNA reference sequence of the PCR product, by overlapping the sequences. And the linkage relationship, the complete target nucleic acid is spliced from the sequence of the interrupted DNA.

2. The method of claim 1 wherein each pair of primer tags and PCR primer pairs are combined into a pair of tag primers, the 5th ends of the forward and reverse PCR primers having (or optionally joined by a linker sequence) a forward primer tag and Reverse primer label.

3. The method of claim 1 wherein the PCR primer is for amplification PCR primers for exon 2, 3, and 4 of HLA-A/B and exon 2 of HLA-DRB1, and the PCR primers are preferably shown in Table 2.

4. The method of claim 1, wherein the primer tag is designed for PCR primers, preferably for PCR primers for amplifying specific genes of HLA, more preferably for amplifying HLA-A/B PCR primers for exons 2, 3, and 4 and exon 2 of HLA-DRB1, in particular, PCR primers as shown in Table 2, which specifically include 95 pairs of primer tags shown in Table 1. At least 10 pairs, or at least 20 pairs, or at least 30 pairs, or at least 40 pairs, or at least 50 pairs, at least 60 pairs, or at least 70 pairs, or at least 80 pairs, or at least 90 pairs, or 95 pairs (or A set of primer labels consists of 10 - 95 pairs of 95 pairs of primer labels shown in Table 1 (eg 10 - 95 pairs, 20 - 95 pairs, 30 - 95 pairs, 40 - 95 pairs, 50 - 95 pairs, 60 - 95 pairs) 70-95 pairs, 80-95 pairs, 90-95 pairs, or 95 pairs), and the set of primer labels preferably includes at least PI-1 to PI- in 95 pairs of primer labels shown in Table 1. 10, or PI-11 to PI-20, or PI-21 to PI-30, or PI-31 to PI-40, or PI-41 to PI-50, or PI -51 to PI-60, or PI-61 to PI-70, or PI-71 to PI-80, or PI-81 to PI-90, or PI-91 to PI-95, or any two or more of them Combination of one.

5. The method of claim 1, wherein the DNA disruption comprises a chemical disruption method and a physical disruption method, wherein the chemical method comprises an enzymatic cleavage method, the physical disruption method comprising an ultrasonic disruption method or a mechanical method Interrupt the method.

6. The method of claim 1, wherein after the DNA is interrupted, the purification recovers all DNA bands from a maximum read length of the sequencer to a range of the longest DNA length to which the sequencer is applicable, wherein the purification Recovery methods include, but are not limited to, electrophoretic tapping recovery, or magnetic bead recovery.

7. The method of claim 1 wherein the method further comprises the steps 1) - 4) of claim 1 and the following steps: 5) Building a library: Construct a PCR-Free sequencing library from the interrupted PCR product library, and add different library adapters to the library to distinguish different PCR-Free sequencing libraries. The purification and recovery are located at the maximum read length of the sequencer used. All DNA bands between the length of the longest DNA length to which the sequencer used is suitable, preferably a DNA fragment of 450-750 bp length;

7) Stitching: Based on the different library linker sequences of each library and the unique primer tags of each sample, the obtained sequencing results are in one-to-one correspondence with the samples, and the alignment products (for example, Blast, BWA program) are used to locate the PCR products. On the corresponding DNA reference sequence, the complete target nucleic acid is spliced from the sequence of the broken DNA by sequence overlap and linkage.

8. Use of the method according to any one of claims 1 to 7 for HLA typing, characterized in that it comprises: a sample (in particular a blood sample) from a patient using the method according to any one of claims 1-7 Sequencing, and sequencing results with the HLA database

(For example, the IMGT HLA professional database) The sequence data of HLA-DRB1 exon 2 is aligned, and the 100% match of the sequence alignment results is the HLA-DRB1 genotype of the corresponding sample.

9. A set of primer labels comprising at least 10 pairs of 95 pairs of primer labels shown in Table 1, or at least 20 pairs, or at least 30 pairs, or at least 40 pairs, or at least 50 pairs, at least 60 pairs, or at least 70 Yes, or at least 80 pairs, or at least 90 pairs, or 95 pairs (or the set of primer labels are 10 - 95 pairs of 95 pairs of primer labels shown in Table 1 (eg, 10 - 95 pairs, 20 - 95 pairs, 30-95 pairs, 40-95 pairs, 50-95 pairs, 60-95 pairs, 70-95 pairs, 80-95 pairs, 90-95 pairs, or 95 pairs), and the set of primer labels are preferred At least 95 pairs of primer labels shown in Table 1 PI-1 to PI-10, or PI-11 to PI-20, or PI-21 to PI-30, or PI-31 to PI-40, or PI-41 to PI-50, or PI-51 to PI-60, or PI-61 to PI-70, or PI-71 to PI-80, or PI-81 to PI-90, or PI-91 to PI-95, or a combination of any two or more thereof .

10. Use of a set of primer tags according to claim 9 for a PCR sequencing method, wherein, in particular, each pair of primer tags is combined with a PCR primer pair for amplifying a sequence of interest to be tested into a pair of tag primers, positive and negative The 5th ends of the PCR primers have (or are optionally joined by a linker sequence) a forward primer tag and a reverse primer tag, respectively.

11. The use according to claim 10, wherein the PCR primer is a PCR primer for amplifying a specific gene of HLA, preferably an exon 2, 3, 4 for amplifying HLA-A/B and HLA-DRB1 PCR primers for exon 2, preferably the PCR primers are shown in Table 2.

12. A set of label primers comprising a set of primer tags of claim 9 in combination with PCR primer pairs for amplifying a sequence of interest, wherein each pair of primer tags and PCR primer pairs are combined into a pair of tag primers, positive and negative PCR The 5' ends of the primers each have (or are optionally joined by a ligation sequence) a primer tag.

The tag primer according to claim 12, wherein the PCR primer is a PCR primer for amplifying a specific gene of HLA, preferably exon 2, 3, 4 for amplifying HLA-A/B and PCR primers for exon 2 of HLA-DRB1, preferably the PCR primers are shown in Table 2.

14. Use of the tag primer of claim 12 for a PCR sequencing method.