SA111320572B1 - A PCR sequencing method based on DNA molecular tag technique and DNA incomplete shearing strategy - Google Patents

Abstract

Abstract: The present invention provides a PCR sequencing method, in which a primer index strategy + a deoxyribonucleic acid (DNA incomplete shearing strategy) strategy + a second generation sequence determination technique ( second sequencing technique (Pair-End sequencing technique) is a high throughput and low cost second generation sequencer, making the sequenceable length of the obtained PCR product It is greater than the sequencing length of the sequencer, which can expand its application range. The present invention also provides primer indexes for the PCR sequencing method described above, and the use of this method for genotyping, namely HLA analysis.

Description

v And a DNA strategy based on the molecular marker technique of PCR acid, an order determination method

DNA is an incomplete cut of an acid

A PCR sequencing method based on DNA molecular tag technique and

DNA incomplete shearing strategy Full description Background of the invention “(nucleic acid sequencing) The present invention relates to the field of determining the sequence of Tory acid on the side of PCR (PCR sequencing) in particular the technical field of determining the sequence of

other PCR; The present invention also relates to the technical field of defining a barcode/index. The methods of the invention are particularly suitable in the identification technique of “PCR-index/barcode” ©, in particular the technique of determining “(second generation sequencing) arrangements in second generation Pair-end sequencing techniques for paired ends 1 clang

HLA and also in determining the genetic type “(second generation sequencing) misleading.” genotyping)

DNA is a technique that takes place as follows: Obtaining a PCR fragment The method of determining the order of 0 and using it in the detection of the PCR of the gene of interest by the method (deoxyribonucleic acid) in order to obtain information about the order of the gene is characterized by strength and accuracy and is used DNA sequencing has long been widely used in the field of gene mutation detection and genotype determination. The PCR barcode/index technique is in which an indicator sequence of a specific starting material can be inserted into 1 of each sample during the PCR process By adding an indicator arrangement of a starting material at the 5th end of the starting material “(Patent Cooperation Treaty) PCT in order to process multiple samples at the same time at stages other than the PCR stage in the detection process in the technology of determining the second generation DNA arrangement represented by in ABI Solid “Roche 454” Illumina GA determinants and other large-scale, high-yield, single-molecule determinants; Finally, the detection result for each sample can be obtained by the qualitative starting material indicator for each sample; This technique is characterized by its low costs, high productivity, and its simultaneous detection of multiple gene locations for a large number of samples.

. The second generation DNA sequencing technique can be performed on a relatively short gia in a continuous a fll sequencing process compared to the first generation DNA sequencing technique (Sanger method for Genome Analyzer from Illumina). Corporation) lumina GA The longest extension of the current 11-pass GA sequence is 000 domain pass When the length of the PCR product is 0 more than Yoo domain pass; GA 1110001208 cannot by specifying The PCR sequence directly determines the sequence of the overall completed PCR product to obtain information on the DNA SH sequence of the detected PCR product.Therefore, the short length of the sequence limits the application of the second generation sequence identification technique There is often a need for a new method to overcome the shortcomings of the second generation DNA sequence selector having an insufficient sequence length in the 208.0 sequence determination field apart from the need to improve the sequence determination technique to obtain a longer actual read sequence. Of the invention when a second-generation rearrangement determination technique is used to simultaneously perform sequence analysis on specific sequences of a specific gene in a large number of samples; the direct PCR Yee rearrangement determination strategy is generally applied using a combination of primer indicator techniques + second-generation rearrangement identification techniques. When the sequence length of the sequence specifier covers the full length of the PCR product the needs may be met by applying the above technique. Contrary to this when the sequence length of the cas il determinant does not cover the full length of the PCR product there is dala to use the sequence selector Other 2nd generation (eg Roche 454 GS-FLX) with a longer arrangement to replace ¢lllumina GA and then 0 if the arrangement length also does not meet the stated needs, there is a need to use a 1st generation arrangement limiter with the cost saving advantage lost and throughput.In fact, Illumina GA has the throughput of SuperAlle. but its order-length is 01 bandpass; Roche 454 68-713 (sad) is the order-length of up to bandwidth" but the cost Higher disaggregation and lower disaggregation throughput; YO the first generation disaggregator has a disposition length of more than 1001 zonal pass; but the disaggregation cost and disaggregation throughput are the same as for the second generation disaggregator.

¢ Is there any technology that takes care of both cost and throughput and increases the sequence length of the sequence determinant on a SPCR product that can be optimized for growth from the high throughput of the primer indicator combination + incomplete DNA cutting strategy + second generation sequence determination technique in the present invention; Likewise, the low cost of the second generation arrangement selector; making the length of order 0 selectable from the order specifier on the PCT product reach greater than the length of the order itself; in order to expand its scope of application. In addition to this, the second generation arrangement identification techniques used in the present invention include a double-ended arrangement identification technique in the second generation arrangement identification technique; The PCR sequence determination technique has a reference sequence of template DNA PCR The present invention provides a method for sequence determination 7018 by which the limitations arising from the short sequence length of the second generation DNA sequence determination technique are reduced; ely to expand its use in the field of PCR sequence determination applications The design of the starting material indicator is based on the empirical rule. Lad pertains to the attributes of the GA-ranking rule m#sl«Alaa; The design of the primer index of the present invention is concerned with the following factors: .1 avoiding an arrangement that includes more than * (Tl) single base repeats in the 1 primer index arrangement; . The total content of base A and base © at the same place in all the starting material indices ranged between 771 and 7070 of the content of all 3 bases. The GC content of the same starting material indicator ranged between ELE Teg Ee among the starting material indices more than 4 bases; . Avoid an arrangement very similar with the starting material to that of GA 8Sn0N111 in the starting material indicators; 1. The lack of occurrence of sharp clamping and dimmer in the PCR primers after adding the indicator “Ye” to the PCR primers. The present invention introduces a primer indicator to two ends of the PCR product on the one hand PCR reaction (indicators of the starting material may be the same or different); So that the indicator of the starting material on any end of the PCR product can distinguish the sample information of the PCR product in a special way. PCR product undergoes a non-ALIS shearing process. Incomplete shearing used herein refers to product obtained by shearing which includes both a complete uncut PCR product and a partially trimmed PCR product. The cutting method includes; without limitation chemical shearing method (eg enzyme digestion) and physical al method; said physical shearing method includes the shearing method

ultrasonic or mechanical shear method; among other ways. The trimmed DNA is subjected to oY agarose gel electrophoresis. All DNA bands whose lengths lie between the read length of the sequence marker and the length of the most suitable sequence marker read (Illumina GA Mie of length 008) are purified and extracted. More appropriate is 0.010 zonal pass; which is the length of the original 0.0318 without the length of the library adapter.) The purification method includes; without limitation electrophoresis extraction and magnetic bead extraction; And other ways. The extracted DNA fragments are used to construct the sequence library through the sequence library construction by the second-generation sequence selector; And also to determine the order after that; It is separated by the PCR-FREE sequence library construct process for sequence library construct and preferably determined by the double-ended 0 method (08-200). The PCR-FREE sequence library construct refers to methods well known to those skilled in the art. In Data The overall order; the order information of all samples tested can be verified by the order of the starting material indicator; all fragments specified by the BWT are placed for the corresponding DNA reference order of the PCR product (PCR product) and the full order of the PCR product is collected by Link relationship and overlap between rearranged parts (Fig. 1.) Ye The linker used here is based on a double-ended joint relationship determined by the characteristics of the double-ended ordering process. Atlee or 'library adapter' to a library pointer technology that adds an adapter to a different library (the adapter for different library consists of different arrangements; the different part of the collation is specified as a pointer to the adapter 0); to create a pointer order library To get mixed collation on a multiple collation library having different indices; Thus, in the end, the results of the ranking determination process for each index library can be distinguished from each other. Using the DNA molecular marker technology-based PCR sequence determination method and an incomplete cut strategy can greatly increase the number of samples with a single marker; Without Yo, increase the number of the starting material index. The combined PCR-FREE library construction method with library adapter indicator technology indicates that the library adapter is attached to two ends of a DNA segment in the sequence library. And when it does not interfere

PCR in the process of introducing the library adapter; This method is called PCR-FREE library creation. The liaison method can use .DNA ligase and when PCR is not involved in the entire library creation process; Inaccuracies in final results caused by PCR-induced errors during assembly library generation from highly ordered POR products can be avoided. > in the present invention; By adding a primer indicator to the presented PCR primers and the coverts in combined methods of the incomplete shearing strategy; So the second-generation sequence determination technique has a sequence-determinable PCR product length over the longest sequence determinant arrangement when used in the field of PCR sequence determination in one of the patents; A set of primer indices including at least 0 01 pairs of primer indices of 90 Lag) is provided in Table 1; or at least two Yo pairs or at least two Ye pairs; or at least 560 pairs or at least 50 pairs or at least 01 pairs or at least Ve pairs or at least Ar pairs or at least 90 dag) or 90 pairs (or the group may consist The mentioned starting material indicators from 49-011 pairs in the starting material indicators with 55 pairs in Table 1 (for example, 38-01 pairs, 55-71 pairs, Ye 40-7400 pairs, 5-46 pairs. 82-8 pairs (lag) 58-176 (lag) 39-718 15-86 (10-40 day) pairs or 58 pairs)); etc. It is preferable to include the said set of starting material indices at least from 01-1 to PL 0 of the 15-pair starting material indices in Table 1; or from 11-21 to 20-01 or from 211 to 1-30 or from 21-31 to 01-40 or 21-41 to 1-50©; or PLIST to 0 1-60 or 01-61 to <PI-70 or 01-71 to 1-80©; Or from 1-81 to 0190 or from 2191 to 01-95 or a combination of any two or more ranges mentioned. ad for Sal's pocket of the invention; The invention provides the use of primer indicators for the PCR sequence determination method whereby each primer indicator pair is specifically combined with a pair of PCR primer to amplify the test order as a primer pair for the indicator in which the ends are *5 Yo for each of the primers The foreground and background PCRs respectively possess or are optionally connected by a linker arrangement” with a foreground primer indicator and a background primer indicator.

In one embodiment of the invention; POR primers are used to amplify specific genes from ¢HLA Preferably used to amplify 2 exon 4 exon 3 cexon of HLA-A/B and 2 exon of HLA-DRBI (most preferably PCR as shown in the table.

In another aspect of the invention; A range of index primers are available in the consortium group

© mentioned from the PCR primer and primer indicators to amplify the assay order which is

in which each primer-indicator pair is combined with a primer pair (PCR) as a primer-indicator pair; and wherein the 5" terminals of both the foreground and background POR primers respectively possess or are optionally connected to an arrangement by means of a linkage arrangement; with a foreground primer pointer and a rear primer pointer.

Ve in one embodiment of the invention; PCR primers are used in the mentioned indicator primers to amplify HLA-specific genes (preferably exon 4 “exon 3” exon 2 Jal from exon 25 HLA-A/B from 0821 -1.2t; more preferred The PCR primers are as shown in Table 1. In another embodiment of the invention, the indicator primers are used in the method for determining the PCR order

(nucleotide acid) to invent; A method is available to determine the order of a 1-nucleotide acid in one of the Vo primers of a target nucleic acid in samples; The method includes:

1) Providing a number (n) of samples; where it is « an integer > 10, where it is preferable that the source of the mentioned samples be mammals; Humans are more preferred.” More specifically, they are human blood samples; The number of (n) samples prepared for analysis is optionally divided into a number of (m).

1 > 01 <n is an integer and satisfies the equation m groups; where Yo

?) magnification: a pair of indicator primers is used for each sample; PCR amplification is performed under appropriate conditions for target nucleic acid amplification in the presence of a template from a sample; Whereas each pair of indicator initiators consists of a leading indicator initiator and a background indicator initiator (these may be degraded [atomically packed] starters) including an indented Bale indicator; It includes article indicators

YO Prefix A foreground cursor prefix and a different or the same background cursor prefix; Also, the starting material indicators in a pair of indicator starting material in different samples must be different indicators;

A

(T shearing: the obtained POR product library undergoes an incomplete shearing process; ;) Arrangement determination: Determination of the sequence of the extracted DNA mixture is determined by the second-generation rearrangement determination technique (GA Sia is preferred). Connected 2000 “(Illumina Hiseq for Post-Cut DNA Sequencing; °©) Clustering: the results of the sequencing process are matched one-on-one with samples based on the specific primer index of each sample; Each identified sequence is superimposed on the corresponding DNA reference sequence from the PCR product using an alignment program (e.g. “BWA” Blast program). Then the complete target nucleic acid can be assembled by the sequence overlap relationship and linkage of the DNA sequences after Shear. Preferably, the source of the samples mentioned should be mammals; More specifically, ple is about human blood samples; The number (‘) of samples prepared for analysis is optionally divided into (m) groups; where - $Y > blood < n is true and satisfies the equation lem is Ye"). Amplification: A pair of indicator primers is used for each sample; PCR amplification is performed under suitable conditions. Sal target DNA in The presence of a template from a sample, and where each pair of indicator initiators consists of a precursor indicator primer and a background indicator primer (they may be degraded [atomically packed]) incorporating an indicator initiator Where the 0 precursor indicators include a precursor indicator primer and two different or identical background indicator primers; the primers in a pair of indicator primers in different samples must also be different indicators; For a PCR product library obtained with an incomplete shearing process; PCR ;) shearing: subject to Ye product library ©) Library creation: the sheared PCR product library is used to generate a collation 0 library 7- All DNA bands are extracted from among the longest read length of the sequence determinant used

the longest length of DNA suitable for the sequence determinant used; The adaptive material can be added to the library

different cad libraries into libraries to distinguish different cad pill libraries ¢PCR-FREE 1) Fell Select identifies the sequence of the DNA mixture extracted by the second generation rearrangement identification technique; Dual tip technology is preferred (eg Illumina Hiseq 2000 “Illumina GA”).

© to get the cut-down DNA arrangement;

(VY) pooling: the results of the collocation process are matched one-on-one with the samples based on the different library adsorbent rearrangements of each library and the specific primer index of each sample; each sequence determined is superimposed on the corresponding DNA reference sequence from the PCR product Using an alignment program (eg BWA Blast) then the complete DNA can be assembled

0 target by the overlay-order-linkage relationship of post-cut DNA arrangements.

In one embodiment of the invention; in the above order determination method; Each primer-indicator pair combines with a PCR primer-initiator pair to form a primer-indicator pair; in which the parties “5 of both the presented PCR primer and the background PCR primer possess an arrangement or are optionally connected to it through a linker arrangement” with the provided primer and the

ve back prefix.

in one embodiment; in the above order determination method; Primer PCR is used to amplify HLA-specific genes (preferably used to amplify 2 bloods called 4 exon of HLA-A/B and 2 exon of <HLA-DRB1). PCR as shown in the table.

Y. in one embodiment; In the method of determining the order contained code, primer indicators are prepared based on the primer material (PCR) It is preferable to depend on the primer PCR used in amplifying HLA-specific genes (more preferably used in amplifying exon 2 “exon 3”). sexon 4 of HLA-A/B and exon 2 of 1114-0831; preferably, PCR primers such as those shown in Table 7. The listed primer indicators include at least 01 pairs of

© Starting material indicators with 40 pairs in Table 1; or at least 01 pairs; or at least 0? pairs; or at least 50 pairs or at least on pairs or at least 60 pairs or at least ve pairs or at least 860 pairs or at least 58 pairs or 55 pairs (or may

01 pairs in the indications of Article 509-01 The mentioned group of indicators of the bad-headed substance consists of Pairs 99-710 Pairs 55-71 Pairs 95-01 (Sha 1 in Table Lag) 10 Prefix Same 45-460 pairs 55-76 pairs 52-50 pairs 11-48 pairs 0-59 pairs 6-9 pairs or 58 pairs)); etc.,

8 Preferably the stated set of initiator indices from PI to PL includes at least 10 of the 30-pair sald indices in Table 1; or from 11-21 to 20-01 or from 211 to 01 -30 or 01-31 to 0140 or 0141 to PESO or 01-51 to 01-0 or 21-61 to 01-70; or 01-71 to 01-80; or 2181 to 01-90 or 01-91 to (POS) or a combination of any two or more ranges mentioned.

1 In one embodiment of the invention “in the order determination method given above” said DNA shearing method includes a chemical shearing method and a physical shearing method; The chemical shearing method includes the enzyme shearing method; The physical shear method includes the ultrasonic shear method or the mechanical shear method. After DNA clipping the fragments in the OV 0 domain pass are separated.

Ve in another aspect of the invention; The method of determining the genotype (HLA) is available, as the method includes: identifying samples (especially blood samples) from patients by the method of determining the arrangement mentioned above, and the results of the determination of the arrangement match the standard arrangement data from the HLA database (for example, a specialized (IMGT HLA) preferably with standard sequence data for exon 4 “exon 3” exon 2 of HLA-A/B or 2 of 2

HLA-DRBL 0 from the HLA database and the result of the ranking alignment that showed a match of 7001 is the HLA genotype of the corresponding sample. Brief explanation of the graphics

Figure 1: is a schematic representation of the assembly of the arrangement after the starting material indicator has been marked. It also indicates the cutting of DNA and determining its order. Leading materials for the foreground and background cursor are entered from

Index-N-F/R 8 at both ends of the PCR product of Sample N (1); Products after physical shearing of the PCR product include: Products with a “starter indicator on one end” Products without a “starter indicator” on both sides; Products that are not completely cut and all DNA strands extracted

Obtain the longest read length of the used sequencer and the longest length of DNA suitable for the used sequencer from an electrophoresis gel (7); Then the sequence determination result of the PCR product for sample N of all sequence determination results is detected by Index- 21-18 and each sequence determined is placed on the corresponding reference locus using information 0 known about the product reference sequence (PCR) and then compile the result of the entire sequence determination of the PCR product by the sequence overlap relationship and the link between the sequenced segments. Figure ?: Shows the result of electrophoresis of the PCR product from the corresponding exons in HHLA-A/B/DRBI of sample .1 from an electrophoresis diagram; PCR products are sequenced at individual bands of a= F ee 00 bandpasses in length where ASAD 14 is the molecular marker 0 (DL 2000, Takara Co. Blocks 1-7 are PCR amplification products from each (A2, A3, A4, B2, 83, B4, DRBI-2) exon of 1 dell HLA-A/B/DRB1 The negative comparative example (N) has no bands amplified. Results for other samples are similar. The oF figure shows the electrophoresis carried out by DNA after clipping of the HLA mixture (compare removing the bands); in which the extracted bands ranged in the range of 0 5;-0 75 bandpass; the M block is the molecular marker (NEB-50bp DNA Ladder), slot 1 represents electrophoresis before HLA mixture extraction, and slot ¥ stands for Electrophoresis after HLA mixture extraction FIGURE 4: Represents a TV snapshot taken of the compatibility determination generation program for sample 1 showing the complete sequencing of the assembled PCR product based on the overlap relationship between the DNA segments and the All ve material indicator. The embodiments of the invention are in the following contents in more detail with accompanying examples; Notwithstanding this those skilled in the art realize that the following examples are used solely to illustrate Invention YO without limiting its scope. In the examples of the invention; A combination of primer markers + DNA incomplete shearing strategy + 100 pair-end sequencing technique by yy selector (exon 4 exon 3 exon 2) is used to determine the genotype of 11101018 GA collation Among PCR from 90 samples; HLA-DRBI products range in length from exon 25 to HLA-A/B high Lely domain passability; the benefit of using this strategy has been demonstrated to be 0 0 throughput and cost effective. pertains to the determinant of the second generation rearrangement; however, it can also genotype those parts of a gene that have a length greater than the length that can be rearranged for the determinant © rearrangement. exon 2 of PCR General idea: For test samples inserted two ends of a product with a primer indicator by HLA-DRBI from exon 2 and HLA-A/B from exon 4; 3 PCR mixes specifically for distinguishing information about a sample of the “PCR” product Loci of DE HLA-A/B/DRBI amplified PCR samples were interacted with 0 PCR products and a PCR product library (PCR product library) from each batch to obtain an amplified product library. Obtaining them to an ultrasonic incomplete cut process in order to establish

LY agarose and the sequence library is subjected to gel electrophoresis (PCR-FREE) A sequence library with band-passing DNA where YOu 5 800 segments are added between DNA and each bands extracted so that the length of the PCR- FREE library adapter material at both ends during the creation of the oe sequence library You pass this is longer than its original length by about DNA pass-through domains correspond to 0158 fragments with 000-480 domains; thus, the extracted fragments are with The extract is subject to a domain passaging DNA sequence determination process by its original length. It undergoes 0-0 call. Information about the sequence can be detected by the substance indicator 11100(012 GA PE-100). 0 Then, the known DNA arrangement, linkage relationship, and overlap between DNA parts, the arrangement of the corresponding part in the original exons, are combined with the results of matching with a standard database of the complete POR of a product, so that the genetic diversity of the product can be determined. (HLA-A/B/DRBI .HLA-A/B/DRBI

Vd ve sample extraction

VY

DNA extracted from HLA-SBT from 40 blood samples with known genetic diversity (CDMP) from the well-known “China Hematopoietic Stem Cell Donors Data Bank” (Thermo CO. USA) KingFisher by Autoextractor Use + 1 deep-well dishes and 1 flat-eye dish by Autoextractor according to the evidence added with the amount of specific and commonly used agents. The corresponding required; (asterisk) is used to extract the DNA after “star” and it works by clicking on “DNA_KF.msz”

DNA Jie Elution 001 µL of product exchange in plate Program end; Collect about an extract, such as ?0

PCR amplification with different PCR indices By synthesizing PCR primers starting materials with different index POR are obtained different starting material at tip 57; So that starting materials with the indicator “HLA-A/B (exon 4) can be used for PCR of different samples, where the starting materials are

Then the starting material indicators are entered into the two ends of the product HLA-DRBI and 2 “e” from 0 different samples. PCR specifically to mark the PCR products by means of a reaction where DNA is formed (to magnification 30). A PCR sample using a set of 10 indicator primers

PCR primers and primers 1) from a pair of primer indices (Table PCR) each primer with an index and the oY end binds (HLA-DRBI table from exon and 2 HLA-A/B to enlarge 4 pools of primer with primer indicator provided for a pair of primer indicators; PCR for each primer 557 - 0 reversed with primer indicator reversed for a pair of PCR terminal 57 of each primer directly bound PCR Starter material indicators. The primer indicator is added to the 5th end of the starting material when synthesizing. Two outputs from the sample extraction steps in DNA 55 to 95-1 given sequential numbering from in plates having 17 samples with a total of 7 Plates; PCR numbers are formed and the reaction of the example is carried out ©

HLA-P-B3 HLA-P-B2 (HLA-P-A4 (HLA-P-A3) (HLA-P-A2) dishes sequentially amplification sites). 10121-2 “B2/B3/B4 <A2/ 3/4 (representing HLA-P-DRB1-2 4-TDMA1L and

A negative comparative example without a template is placed in each Bada where the same starting materials are with the corresponding starting materials in the template 1. Record the corresponding sample number information for each starting material indicator. Table 1: Corresponding information on the starting material indicators Lie; Corresponding locations (lal) Corresponding Qom Sa rattles Prefix signs Prefix index number | hase : indicative : in dish has 157 (group prefix prefix reversed 7 eye 0 ACGTGICTATCA |TACATGCIGAGC| PI6 | | HA A8 | ATCTCGIGACAG |ACAGATGCACGC| PL8 | | 8 ACTAGTACACGC | TAGATCGTACAT | 119 | | QUICK | DRIVE B6 | CTAGTATCGCAG | ACGCATCTATAC | PL-18 | | 18 BY | TCTAGCTCATGA |CATCTGCTATAG | PL-21 | 21 [ P1-29 29 yo 4 | D6 [TCGTGACAGATC | TGTATGCTCGIC | 0142 44 | 08 | CTGATAGTATCCA |AGACTCTGAGTC| Pl-44 45 A D9 [ATCGCGAGTGAC | CTCATAGACTAC| PI-45 60 [E12 [TGCTATCACTGA |ACTCGTCTGACG| 0160 66 | F6 | TGACGCTCATCT | TACACTCGTGCT| 0166 68 | F8 | CACTGTGCTCAT |TGTATGATCTCG | PI-68 69 [ F9 | ACTGCATGATCG | CAGTACACTCTA | 01-69 75 G3 | CGATCATATGAG | ATCGACTATGCT | 5 80 | G8 [CGCTGCATAGCG | TACTGCTATCIC | PL§0

1 1461416006161 PI-83

TACTCGTAGCGC | TAGATGACGCTC| PI-84

ATCTACTGACGT | TCGCGTGACATC| 1-5 8 | H2 | ACAGTAGCGCAC | ACACGCTCTACT | PI-86

CTAGTATCATGA | TACATAGTCTCG

TCGATCATGCAG | TGAGTAGCACGC| PI-88 8 | H5 | TACATGCACTCA | TAGATGCTATAC| PI-89 9% | 116 | CAGCTCGACTAC | ATCGATGTCACG| PI-90

CTCTACAGTCAC [| ATCATATGTAGC| PIO]

AGATAGCACATC | TAGCATCGATAT | PI-92

CTAGATATCGTC | TGATCGACGCTC | 1-53

TACAGACTGCAC | TGCAGCTCATAG]| PI-94

CAGTAGCACTAC | CGACGTAGAGTC| PI-95 Before adding HLA-A/B/DRBI1 exons to enlarge PCR Table »: Starters Precursor Substance Usage Product Length Lal No. Article Primer Arrangement Prefix .| CCTCTGYGGGGAGAAGCAA ba! 80 | HLA-A enlargement OD A TCTCGGACCCGGAGACTG AR2 domain exon 2 -1 CGGGGCCAGGTTCICACAC EMRA £34 | HLA-A Magnification Resolution 8606 passes GGYGATATTCTAGTGITGGICC | It has two domains, exon 3 CAA, passing 470 | HLA-A gene amplification GTGTCCCATGACAGATGCAAA domain exon 4 GGCCCTGACCCTGCTAAAGG .| AGGAGCGAGGGGACCGCA Emra £++ | HLA-B enlarged pass gene per CGGGCCGGGGTCACTCAC BR2 domain exon 2 .| CGGGGCCAGGGTCTCACA EMRA 700 1 HLA-B amplification Pass gene oe GAGGCCATCCCCGGCGAC B-R3 domain exon 3 . | GCTGGTCACATGGGTGGTCCTA

Il 850 | HLA-B al 8606 SC CTTACCCCATCTCAGGGTG | BR my domain is exon 4

CACGTTTCTTGGAGTACICTA | D2-Fi

GTTTCTTGTGGCAgCTTAALTT | D2-F2 fel 00 . | CCTGTGGCAGGGTAAGTATA D2-F3 2% JHLA-DRBI Enlarge | GTC TTGAAGCAGGATAAGTT | 4 tag gene 2 GCACGTTTCTTGGAGGAGG D2-F5

TTTCCTGTGGCAGCCTAAGA D2-F6

GTTTCTTGGAGCAGGTTAAAC

B being 02-11 02-12 “D2-F6 02-25” D2-F4 “D2-F3 02-27 is Ahab material provided for magnification 2 of 0151-1 at; 5 D2-R is the reverse primer for exon 2 amplification of HLA-DRBI1. The PCR program for the HLA-A/B/DRBI amplification is as follows: 0 45 mnemonic 8sperm Fo sec - > 10”Celsius To sec -> 77”Celsius Yo sec -> TY) Cycle 0”Cross 0 The PCR Jeli System for HLA-A/B is as follows; All agents produced by Promega Co.: een ¥ ¥ µl µl) 1 µl µl) 1 µl µl) 01 The PCR reaction system for HLA-DRBI is as follows: Mixture 0077 (each *, milligrams/|? µl µl) µl)

Ya

Tee µL) µL) µL) µL) µL represents EUR 12/02-17/L4M,71 Primer F for HLA-A/B/DRB1 by the number « of the primer index order presented (Table) 1 at tip 57 ead PowerPuri PL A/B/D2-R represents primer R for HLA-A/B/DRB1 with the N number of primer indicator order provided (Table 1) At tip 57 eal and here “ > 40) and other primers © similarly. Each sample corresponds to a specific set of PCR primers (Joe Euro 3/102-7 dam-02/damaged]a). A PCR reaction is performed on a PTC-200 PCR amplifier from Corporation 510-880. After (PCR) ? µl of PCR products are exposed to 71 gel electrophoresis 88817088. Figure ? Electrophoresis of PCR products is labeled with Corresponding HLA-A/B/DRBI exons of sample 0 #1a; where DNA partial marker is 112000 ¢ (Takara Corporation) where a sequence of single domains between Ves domain pass-through and 0085 pass

Yq

HLA-A/B/DRBI from exon of each domain PCR in gel to amplification success The negative comparator example does not have oY from sample no. (A2, A3, A4, B2, 83, 84, DRBI -2) Zoom range. Results from other starting materials are identical. (N) 3 Example PCR Mixing and purification of © 47 HLA-P-A2 products from each residue in the PCR plate 01 μl of products removed HLA-A2- sample except from negative comparative example and mixed in a capacitance tube? milliliters teach like

HLA- (HLA-A3-Mix Jie) and 7 other dishes with 47 eyes perform the same process and learn Mix

Ja 1335 ¢HLA-D2-Mix s HLA-B4-Mix (HLA-B3-Mix (HLA-B2-Mix ¢A4-Mix)

HLA- (HLA-A2-Mix) Mixture from each tube of 700 µl all apertures. Removed 0

HLA- 3 HLA-B4-Mix (HLA-B3-Mix) “HLA-B2-Mix (HLA-A4-Mix) We find A ives (HLA-Mix) in a tube of 10 # capacity ? ml and know like D2- Mix and purify on a column with an HLA-Mix kit of DNA 000 microliters of the mixture still Yoo according to the guide.

Nanodrop 8000 (Thermo Fisher Scientific DNA purification μl Ve ng/μl.$A as HLA-Mix DNA' 355% from Corporation) 4 Example lumina GA PCR-Free And the creation of a library of ordering PCR shearing products

DNA 1 cut pure and subjected to shearing on a HLA-Mix trimmer from Total © μg Ja Y DNA with Covaris fibers using Covaris 52 DNA microtubules (Covaris Corporation) The conditions for shearing are as follows: ‎ . Snap-Cap 5 AFA Frequency scanning AAA

Y. The cleft after sternum.

QIAquick PCR Purification Using HLA-Mix All Cut Products from AT. (QIAGEN Homogenetic Buffer) EB YV,0 μl and sequentially dissolved in ?. Tip repair reaction The reaction system is as follows: “Pure DNA to HLA-Mix tip repair reaction exposed °: (Enzymatics Corporation) (all factors are obtained from L me ene a” microliter 0 poly kinase * 01 pH stabilizer (B904) mMN nucleotide ?; 01 μL (ANTP 1 gram solution group each) am located at rt treasure At (Eppendorf Corporation) Thermomixer, the reaction is carried out in a water bath for 10 minutes. ) EB 0 μl at tip “3” A “; an addition reaction at tip 37 and A recovered in the previous step is subjected to a DNA addition reaction (Enzymatics Corporation): The reaction system is as follows (All factors obtained from 0 μL GE “aba mMJ dATP (Corporation) 1)

The reaction is carried out in ples water on an (Eppendorf Corporation) Thermomixer at set Te for min. Reaction products were purified using QIAquick PCR Purification Bac and dissolved in 11 μl (QIAGEN Elution Buffer) EB. © © . [Humina GA PCR-Free Library Adapter Adapter] The term “PCR-Free library adapter) PCR-Free used herein refers to eda from designed bases; Their primary function is to help anchor DNA molecules to sequence chips and to provide binding sites for universal sequence initiators. The PCR-Free Library Adapter can be attached to both ends of the DNA segments in the sequence library; As the library 0 degradation process does not include a library lid (PCR), it is called a metamorphosis like the PCR-Free library adapter. After adding “m”, the product communicates with the Illumina GA PCR-Free library adapter and the reaction system is as follows (obtained On all factors (Enzymatics Corporation Grammolecular) the reaction was carried out in a water bath over an (Eppendorf Corporation) Thermomixer at 0” incubator for 15 minutes. Vo reaction products were quantified using Beckman Coulter Genomics. Ampure Beads were dissolved in 0 μl deionized ele, then combined by PCR the fluorescence quota (qPCR) of the DNA concentration was as follows:

LY text Removal from gel and retrieval retrieval “0 μl HLA-Mix on AY low melting point agarose gel. Electrophoresis conditions are 100 volts; 100 min. DNA is 0 0 bandpass from NEB Corporation DAN Marker DNA fragments are removed in a length range of 0 5.0 ;-.20 bandpass from the gel (see Figure 3). eluted with YY Jie (QIAGEN Corporation) QIAquick PCR Purification se μl in volume after purification; 0106 nanogram DNA concentration determined by 11110165660626 quota PCR (QPCR) ex 5 lumina GA 5) 0 in order Grammar picomolecular DNA 01 using “QPCR according to the result” and the detailed process refers to the “Illumina GA PE-100” manual using the program “Jdllumina GA manual (Illumina GA II x) 6 example results analysis 1 (DNA is a sequence of sequences) 111070108 GA The sequence results produced by GA 111070108 originate from each PCR database for each primer indicator against a product sequence result from each sample by finding the primer indicator rearrangements presented and reversed HLA-A/B/DRBI exon on the reference exon order and the starting material arrangements in the order results. The ranking result falls for each

BWA via http://www.ebi.ac.uk/imgt/hla/ (from Jolie exon to © consensus ranking per rule Lan +p1p80171015-117116) at the same time; Aligner) in the database and is subject to an order error correction. DNA data; Rearrangements are then selected by HLA-A/B/DRBI overlap from the corrected exon of each DNA. The resulting rearrangements can be assembled with the DNA base and linkage relationship (double-ended linkage). Capil rearrangements lined up in HLA-A/B/DRBI profiling database Matched exons Arrangement data from Yo (genotyping) Match to lineup results is genotype 7001 identified and is IMGT HLA

Yy for the corresponding sample. Figure shows; Graphical snapshot of HLA-A/B/DRBI generative software 1. From sample HLA-A from 6002 at a site of 97 samples evading the results of genotyping The results of genotyping are As follows: 7-1 where the sound results of the sample are 0 the known essential genetic 0081 07:01 | 1st 3:01 8:13:02 | B¥08:01 | A*30:01 | 01:01*2pm 01r 14:54 | DRBI#10.01 437:01 | B*I5:11 | ¥03:02 | 01:011 km 6

DRBI*15:01 | DRBI*11:01 838101 | B¥35:03 | A*02:01 | A001] 3 - 1 081 713:02 | DRBI#03:01 | 8:40:02 | B*27:07 | A*31:01 02:06 km | 9 "DRBI712:02 | DRBIF10:01 | B*40:02 | B¥37:01 | AF1L:01 [A101] 16

DRB1*15:01 | DRB1*12:01 | B*41:02 | B*40:40 | A*66:01 | A*26:01 29 o

Yi for A UT for Fd a channel 1 1 2 1 1 1 2 ns | oo Te 1 2 1 1 1 1 3 ou do ld 1 4 1 1 1 1 8 4 esto msa whe aas 1 5 2 1 2 1 5 a a we |, 4 1 1 I 2 1 stor wT wb bole, 1 4 8 2 1 1 7 oi dd PO 1 1 1 3 1 1 esta si be wh RTE], 2 1 2 7 1 6 blll ad dP 2 1 1 1 1 I 10 dl 2 1 | 1 1 1 ] 11 no aa aa 1 6 5 1 1 1 12 i no aa aa aa 1 1 2 2 2 1 13 stn war we a aa 2 2 I 1 ] 1 14 blll ol 1 1 1 7 5 1 15 at sw Ti , 2 1 2 1 1 1 16 te M Taa Sak course 1 1 5 1 7 17 2 2 1 1 2 1 18 1 5 2 2 1 1 19

DRB1*15:0 | DRB1*11:0 { B*40:0 | B*40:0 | A*24:0 | 1 1 1 1 1 6 1 21 1 5 1 5 I 1 22 1 3 1 1 7 1 23 1 1 2 2 1 5 24 yo

DRB1#14:0 | DRB1*12:0 | B*51:0 | B*07:0 | A*31:0 | A*11:0 2 1 6 1 1 25

DRB1*08:0 | 0151*07:0 | 3*57:0 | B*46:0 | A*11:0 | 00 3 1 1 1 1 1 26

DRB1*¥15:0 | DRB1*04:0 | B*37:0 | B*15:1 | A*02:0 | A*01:0 1 1 1 8 1 1 27

DRB1*¥10:0 | DRB1*09:0 | B*46:0 | B*37:0 | A*24:0 * 00 1 i 1 1 2 1 28

DRBI1*15:0 | DRB1*¥12:0 | B*41:0 | B*40:4 | A*66:0 | A*26:0 1 1 2 0 1 1 29

DRB1#12:0 | DRB1#03:0 | B*45:0 1 B*13:0 | A*29:0 | 0 2 1 1 2 2 1 30

DRB1#15:0 | DRB1*07:0 | B*57:0 | B*15:0 | A*11:0 | 0 1 1 1 1 3 1 31

DRB1*14:0 | DRB1*11:0 | B*38:0 | B*35:0 | A*26:0 | A*11:0 4 3 1 3 1 1 32 HLA-DRBI Possibility in DRB1#1201 Note: The genotype does not return because “DRB1*1401 Possibility DRBI*1454 Does Not Return” <DRB1*1206/1210/1217 . be completely identical to 1114-0811 exon 2 above on the alleles arrangements Although embodiments of the present invention are already described in detail, a person skilled in the art may realize the possibility of making several modifications and substitutions to these lozenges according to the study. 0 described herein and all such changes are within the scope of the protection of the present invention. All prospects of the present invention are available with appended claims, etc. References [1]. http://www.ebi.ac.uk/imgt/hla/stats. html

[2]. Tiercy J M. Molecular basis of HLA polymorphism: implications in Ve clinical transplantation. [J]. Transpl Immunol, 2002, 9: 173-180.

[3]. C.Antoine, S.Miiller, A.Cant, et al. Long-term survival and transplantation of haemopoietic stem cells for immunodeficiencies: report of the European experience. 1968-99. [J]. The Lancet, 2003, 9357:553-560.

[4]. 11. A. Erlich, ©. Opelz, J. Hansen, et al. HLA DNA Typing and Yo

Transplantation. [J]. Immunity, 2001, 14:347-356.

[5]. Lillo R, Balas A, Vicario JL, et al. two new HLA class alleles,

DPB1%02014, by sequence-based typing. [J]. Tissue Antigens, 2002, 59: 47-48.

[6]. A. Dormoy, N. Froelich. Leisenbach, et al. Mono-allelic amplification of exons 2-4 using allele group-specific primers for sequence-based typing (SBT) of the HLA-A, -B and -C genes: preparation and validation of ready-to-use pre-SBT mini- kits. [J]. Tissue Antigens, 2003, 62: 201-216.

[7]. Elaine R. Mardis. The impact of next-generation sequencing e technology on genetics. [J]. Trends in Genetics.2008,24:133-141.

[8]. Christian Hoffmann1, Nana Minkahl, Jeremy Leipzig. DNA barcoding and pyrosequencing to identify rare HIV drug resistance mutations. [J]. Nucleic Acids Research, 2007, 1-8.

[9]. Shannon J.Odelberg, Robert B. Weiss, Akira Hata, Template- ye switching during DNA synthesis by Thermus aquaticus DNA polymerase 1. [J].

Nucleic Acids Research.1995, 23:2049-2057.

[10]. Sayer D, Whidborne R, Brestovac B. HLA-DRB1 DNA sequencing based typing: an approach suitable for high throughput typing including unrelated bone marrow registry donors. [J]. Tissue antigens. 2001, 57(1): .46- Yo 54.

[11]. Iwanka Kozarewa, Zemin Ning, Michael A Quail. Amplification-free

Hlumina sequencing-library preparation facilitated improved mapping and assembly of (G+C)-biased genomes. [J]. Nature Methods. 2009, 6:291 —- 295.

Claims (1)

B Claims 1-1 A method for determining the order of a nucleotide acid for a given 86:0 nucleic acid in the available samples, which includes: (1) v Providing samples en is an integer > )¢ Where it is preferable that the mentioned sample be from; (Y) 1 amplification: a pair of indicator primers is used for each sample; PCR amplification is performed under VY conditions suitable for amplification of a given nucleic acid in the presence of a template from the sample; where A is Each indicator ASU pair consists of a precursor primer and an inverted 4-indicator primer (both can be degenerative primers) that includes the AL indicator primer where 0 includes the precursor indices in the precursor precursor and the precursor for an inverse index 11 that can be the same or different; the starting substance indices in the substance pair must be the 0” leading indicator for a different sample; (l) Mixing: at « > 1a the PCR amplification products from each de are mixed together; (8) Shearing: resulting POR product library is subjected to incomplete shearing; (1) 15 Sequencing: DNA mixture retrieved by 2G technology is sequenced; double-ended technology (e.g. GA) is preferred Mnsaac 2000 and 1156 assemblies! 1); to produce DNA sequencing after shearing; and VY (7) assembly: sequencing results are aligned one by one with samples on the basis of the 0 primer index assigned to each sample; and JS is located A specific arrangement on a reference DNA sequence corresponding to a PCR 4 product using the aligning program (such as (Blast, BWA program) and then a specific Yo nucleic acid can be assembled complete with afi fll overlap and linkage relationship from YY DNA arrangements after shearing. 5 for the introduced PCR primer and the reversed PCR primer through a linkage arrangement with an indicator ; . prefix presenter and inverted prefix pointer. YA is used for PCR amplification where the starting material is 1 ?-method in Claim 1 PCR of 111.4-018131; Primers exton and 2 HLA-A/B from exon 2,3,4 0X shown in Table ?.” Where the primer indicators are designed based on the Article 1 method in the claim - 4 1 HLA used to amplify specific genes from PCR preferred depending on PCR primer material _" exton 2 and HLA-A/B from exon 2, 3, 4 used PCR amplified more preferred Starter “includes the oF indices described in the PCR table and specifically the starting material (HLA-DRBI) from € 40 pairs of primer indices in Table 01 of the listed starting material at least 5 A pair; or at least 0 pairs; or at least "0 pairs; or at least 01 or at least 1 3 pairs; or at least 468 pairs; or at least Ve pairs or at least Te pair; or at least 200" pairs; or at least 95 pairs (or the said combination of primer indices of lesser te (eg 1 pair in 10 pairs of primer indices in Table 50 -01 includes 4 pairs; e 48-4460 0 pair)) and do or 1" preferably include a set of primer indices at least from 1-21 to 10-11 from 01-21 pair of primer indices in table 0) or from 11-21 to 01-20 or from 58 ME 1-60 to 01-30 or from 01-31 to 01-40 or from 21-41 to 01-50 or from 01-51 to ve or 1-81 to 01-90 or P1-80 or 01-71 to < PI-70 or 21-61 to 01-95; or a combination of any two or more thereof. 01-91 1" chemical cut method DNA method is given in claim 1; includes cut method -#1 includes enzyme and a physical cut method; where includes chemical cut method Shearing method "physical shearing method, ultrasonic shearing method or mechanical shearing method." v4 1 +- The method in Claim 1, where after cutting (DNA) all DNA bands are retrieved whose "longest read ranges the length of the sequence and the best length of the DNA of the sequence" where the remedial method includes without ¥ limiting electrophoresis retrieval and retrieval magnetic ball. 1 #- The method in Claim 1, where the method includes steps (1)-(?) in Claim 1 or the following steps: 1 (*) Create a library: The library of the screened PCR product is used to generate a sequencing library; (PCR-Free) Various adapters can be added to the libraries to distinguish different PCR-Free© libraries of the sequence; all DNA strands are retrieved between the longest read length of the sequence used and the longest DNA length 1 appropriate for the sequence used. Preferably DNA domains length 45 - “5 pass” domains; 4 (1) Arrangement: Recovered DNA mixture is sequenced by second generation sequencing technology; 4 double-ended “Illumina Hiseq 2000 dllumina GA Jie” technology is preferred to produce DNA sequence after 0 shearing; (V) 1 Clustering: Rank results are aligned one by one with samples depending on the different library adapter IY rankings for all libraries and the starting material index assigned to each sample; Each specific 0" sequence is located on a reference DNA sequence of the PCR product by using the Blast, ic) line-up program (BWA program Vf) and then a complete specific nucleic acid can be assembled by overlapping 1 -_ The arrangement and splice relationship of post-cut DNA arrangement. “HLA (genotyping) for use in determining genotype 7-1 Method in claim -” 1 which is characterized by the inclusion of: We segregate samples (particularly blood samples) from patients by a method from any of Y Claims 7-1 and line up the sequencing results with standard sequencing data from a database ; 111 (such as IMGT HLA Professional Database preferred with standard ranking data from © 2, 3,4 e” from HLA-A/B and/or 2 (exon 1114-0831) from the HLA database. 3 The result of the alignment of the order with a match of 1007 is the determination of the HLA genotype of the corresponding sample. 1 4- A set of indented Bale indicators; include at least 01 of the 30 starting material indicator pairs in Table 1; or at least 01 pairs; or at least Te is a pair; or at least 50 pairs; or at least 00 pairs; or on Te J pairs; or at least Ve pairs; or ; .at least 0 pairs or at least 90 pairs; or at least 30 pairs (or the said set of starting material indicators that include 55-01 pairs in 98 pairs of starting material indicators 1 in Joule 1 (on Sybil article 58-0 pair 19-700 Zerg; 7 and 5 pairs; .40-5 pairs; 0-90 pairs; N pairs; Ht pairs: 6m pairs; A 38-40 pairs or 0 pairs)); And 9 preferably includes at least a set of starting material indicators from 1-01 to 10-11 out of 90 00 pairs of starting material indicators in Table 1 or from 11-21 to 20-01 or from 21-21 11 to 1-30©; OR 21-31 to PL-40 OR 01-41 to 01-50 OR 01-51 to 1-60 VY OR 01-61 to <PI-70 OR 01-71 to PI-80, 01-81 to 01-90, OF 01-901 to 01-95, or a combination of any two or more of these. -01-1 Using the set (set) of primer indicators in claim 4 for the “Seq PCR” method which is characterized by each primer-indicator pair combining with a PCR primer pair ¥ to form a pair of indicator primers whereby the 5 ends of each of the PCR primer; precursor and reverse PCR primer optionally connect through a splicing arrangement with indicator A precursor and indicator 2 reverse primer. Claim 0; where the PCR primer is the same as that used ¥ magnification 2, 3, 4 work of HLA-A/B and exton 2 of HLA-DRB1 primers are preferred 1. Described in Table 208 Y 1?1- A set (set) of an indicator primer by the union of a primer indices set in “protectant 9 and a PCR primer pair to amplify the order specified for test; where “each dab indicator pair combines with a PCR primer pair to form a pair of primers that it ; to an indicator where the terminals 5 of each of the primer primer PCR primer and reverse primer 5 are optionally connected by a splicing arrangement with primer indicator present and reverse primer indicator. mY 1 primer primer in claim VY where the PCR primer is the same as used to amplify exon 2, 3, 4 of HLA-A/B and exton 2 of 017831-1112; It is preferable to use "PCR primers shown in Table 14-1" to use indicator primers in claim VY for the PCR sequencing method.