KR102475292B1 - Composition for Amplifying HLA genes and Uses thereof - Google Patents

Composition for Amplifying HLA genes and Uses thereof Download PDF

Info

Publication number
KR102475292B1
KR102475292B1 KR1020200112432A KR20200112432A KR102475292B1 KR 102475292 B1 KR102475292 B1 KR 102475292B1 KR 1020200112432 A KR1020200112432 A KR 1020200112432A KR 20200112432 A KR20200112432 A KR 20200112432A KR 102475292 B1 KR102475292 B1 KR 102475292B1
Authority
KR
South Korea
Prior art keywords
hla
dna
artificial sequence
drb1
dqb1
Prior art date
Application number
KR1020200112432A
Other languages
Korean (ko)
Other versions
KR20220030744A (en
Inventor
김지연
송해인
장미미
김광중
Original Assignee
주식회사 엔젠바이오
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 주식회사 엔젠바이오 filed Critical 주식회사 엔젠바이오
Priority to KR1020200112432A priority Critical patent/KR102475292B1/en
Priority to PCT/KR2021/011854 priority patent/WO2022050721A1/en
Publication of KR20220030744A publication Critical patent/KR20220030744A/en
Application granted granted Critical
Publication of KR102475292B1 publication Critical patent/KR102475292B1/en

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6869—Methods for sequencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6881—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for tissue or cell typing, e.g. human leukocyte antigen [HLA] probes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2531/00—Reactions of nucleic acids characterised by
    • C12Q2531/10—Reactions of nucleic acids characterised by the purpose being amplify/increase the copy number of target nucleic acid
    • C12Q2531/113—PCR

Abstract

본 발명은 HLA 유전자 증폭용 조성물에 관한 것으로, 더욱 자세하게는 HLA-A/B/C, HLA-DRB1/3/4/5, DQA1, DQB1, DPA1 및 DPB1 유전자 각각을 증폭할 수 있는 특이적 프라이머를 포함하는 HLA 유전자 증폭용 프라이머 세트 및 이의 용도에 관한 것이다. 본 발명에 따른 조성물을 이용하면, HLA 유전자를 높은 정확도로 충분한 양을 증폭할 수 있어 관련된 HLA typing을 높은 민감도와 정확도 수행할 수 있어 유용하다.The present invention relates to a composition for amplifying HLA genes, and more particularly, specific primers capable of amplifying HLA-A/B/C, HLA-DRB1/3/4/5, DQA1, DQB1, DPA1 and DPB1 genes, respectively It relates to a primer set for HLA gene amplification comprising a and uses thereof. Using the composition according to the present invention, it is possible to amplify a sufficient amount of HLA gene with high accuracy, which is useful because it can perform related HLA typing with high sensitivity and accuracy.

Description

HLA 유전자 증폭용 조성물 및 이의 용도 {Composition for Amplifying HLA genes and Uses thereof}Composition for Amplifying HLA genes and Uses thereof {Composition for Amplifying HLA genes and Uses thereof}

본 발명은 HLA 유전자 증폭용 조성물 및 이의 용도에 관한 것으로, 더욱 자세하게는 HLA-A/B/C, HLA-DRB1/3/4/5, DQA1, DQB1, DPA1 및 DPB1을 각각 증폭할 수 있는 프라이머 세트를 포함하는 조성물 및 이의 용도에 관한 것이다. The present invention relates to a composition for amplifying an HLA gene and a use thereof, and more specifically, primers capable of amplifying HLA-A/B/C, HLA-DRB1/3/4/5, DQA1, DQB1, DPA1 and DPB1, respectively Compositions comprising sets and uses thereof.

사람 백혈구 항원(Human Leukocyte Antigen, HLA)은 조혈모세포(골수) 및 장기 등의 이식 시 거부 반응을 일으키는 주요 인자를 생성하는 면역 반응 조절 유전자로, 조직적합항원으로도 알려져 있다. 타인의 골수 세포나 바이러스 등 외래 물질이 신체에 들어올 경우 사람의 신체는 자신을 보호하기 위하여 이를 제거하기 위한 행동을 취하게 되며, 이때, 그 물질이 자기 자신과 같은 것인지 여부의 판단에서 중요한 역할을 하는 것이 HLA이다.Human Leukocyte Antigen (HLA) is an immune response regulating gene that generates a major factor causing rejection during transplantation of hematopoietic stem cells (bone marrow) and organs, and is also known as histocompatibility antigen. When foreign substances such as bone marrow cells or viruses from others enter the body, the human body takes action to remove them to protect itself, and at this time, it plays an important role in determining whether the substance is the same as itself. What it does is HLA.

고형 장기와 조혈모세포 이식에 있어 근본적인 장애는 타인의 항원에 대한 면역반응의 결과인 거부현상으로, 공여자와 수여자간의 완전한 HLA형 일치가 성공적인 이식을 위한 가장 중요한 요소이다. 보통 조직적합성 검사는 HLA-A, HLA-B, HLA-DR 등의 유전자좌를 검사하며, 이들 3개 유전자좌에 대해 모두 적합한 경우 6/6 적합(match) 또는 0 부적합 (zero match)로 판단된다.A fundamental obstacle in solid organ and hematopoietic stem cell transplantation is rejection, which is a result of an immune response to another person's antigen, and complete HLA type matching between donor and recipient is the most important factor for successful transplantation. Usually, the histocompatibility test examines loci such as HLA-A, HLA-B, and HLA-DR, and when all three loci are suitable, it is judged as a 6/6 match or a zero match.

장기이식 시, 5년 생존율은 HLA가 완전히 일치하는 형제자매의 경우 84%, HLA 1개 일배체형 일치 가족의 경우는 73%, 타인인 공여자의 경우 66% 등의 순서로 부적합한 HLA 항원의 개수가 증가할수록 생존율이 단계적으로 낮아진다.In organ transplantation, the 5-year survival rate was 84% for fully matched HLA siblings, 73% for single HLA haplotype matched families, and 66% for other donors, in the order of the number of unsuitable HLA antigens. As the number increases, the survival rate gradually decreases.

조혈모세포이식의 경우, 공여자의 전체 면역 시스템이 환자에게 이식되기 때문에 더 정확하고 정밀한 검사 (High resolution HLA typing)가 필요하며, 고해상도 수준에서 불일치하면 거부반응, 급성 이식편대숙주병, 사망률 등이 높아진다는 연구 결과가 보고되었다(N Engl J Med, 92:3515-20, 1998).In the case of hematopoietic stem cell transplantation, since the entire immune system of the donor is transplanted to the patient, a more accurate and precise test (high resolution HLA typing) is required, and rejection, acute graft-versus-host disease, and mortality increase if mismatches occur at the high resolution level. A study result was reported ( N Engl J Med , 92:3515-20, 1998).

현재 시행되고 있는 HLA 검사 방법으로는 검사의 해상도(resolution)에 따라 저해상도(low resolution), 중해상도(middle resolution), 고해상도(high resolution)로 분류된다.Current HLA test methods are classified into low resolution, middle resolution, and high resolution according to the resolution of the test.

저해상도 분석인 혈청학적 방법은 고도의 숙련된 기술과 경험이 요구되며, DNA 검사법들과 비교하여 불일치하는 결과가 보고되면서, 점차 소규모 검사실에서도 쉽게 수행할 수 있는 DNA 검사법이 기존의 혈청학적 검사 방법을 급속히 대체하고 있다.The serological method, which is a low-resolution analysis, requires highly skilled skills and experience, and as inconsistent results are reported compared to DNA tests, the DNA test method, which can be easily performed in small laboratories, gradually replaces the existing serological test method. are rapidly replacing

중해상도 분석을 위해 이용되는 SSOP(sequence specific oligonucleotide probe) 방법은 PCR 증폭 후에 스트립에 고정된 프로브와의 혼성화 반응 양상을 토대로 결과를 판정하는 방법이다. SSOP 방법은 혈청학적 검사법에서 흔히 보이는 교차 반응 및 약한 반응성 등으로 인해 모호한 결과가 보이는 현상이 적어 판독이 다소 용이하다는 점과 많은 양의 검체를 동시에 처리할 수 있는 장점이 있으나, PCR 후에 혼성화 과정을 거치므로 시간이 다소 걸린다는 점과 양성 밴드 판정에 있어 애매한 경우가 간혹 발생한다는 단점이 있다.The SSOP (sequence specific oligonucleotide probe) method used for medium-resolution analysis is a method of determining a result based on a hybridization reaction pattern with a probe immobilized on a strip after PCR amplification. The SSOP method has the advantage of being somewhat easier to read due to less ambiguous results due to cross-reactivity and weak reactivity, which are common in serological tests, and being able to process a large amount of samples at the same time. There are disadvantages in that it takes some time because of the process and that ambiguous cases sometimes occur in determining positive bands.

중해상도 분석을 위해 이용되는 PCR-SSP(Polymerase Chain Reaction-Sequence Specific Primer) 기법은 PCR 프라이머의 염기서열 차이를 이용하여 유전자를 선택적으로 증폭하며, PCR 프라이머 세트의 수를 조절하여 원하는 수준의 형질을 판정하는 기법이다. PCR-SSP 기법은 PCR 과정에서 특정 대립유전자군만 증폭하여 그 결과를 판정하기 때문에 PCR 이후 전기영동을 통해 바로 결과를 확인할 수 있다는 장점이 있는 반면 다수의 검체를 동시에 검사하기가 어렵다는 단점이 있다.The PCR-SSP (Polymerase Chain Reaction-Sequence Specific Primer) technique used for medium-resolution analysis selectively amplifies genes using differences in nucleotide sequences of PCR primers, and adjusts the number of PCR primer sets to obtain desired levels of traits. It is a method of judging The PCR-SSP technique has the advantage of being able to confirm the result immediately through electrophoresis after PCR because it amplifies only a specific allele group in the PCR process and determines the result, but has the disadvantage that it is difficult to test multiple samples at the same time.

고해상도 방법으로 이용되는 SBT(sequence-based typing) 방법은 새로운 형질 분석을 위한 가장 우수한 방법이며, HLA 형질 수의 급격한 증가에 기여한 방법이기도 하다. 그러나, 대립유전자의 변이부분이 시스(cis)형인지 트랜스(trans)형인지를 구별하지 못하는 위상 모호성(phase ambiguity) 문제가 있고, 시간과 노동력, 비용이 많이 드는 단점이 있다.The sequence-based typing (SBT) method used as a high-resolution method is the best method for analyzing new traits, and it is also a method that has contributed to the rapid increase in the number of HLA traits. However, there is a problem of phase ambiguity in which it is not possible to distinguish whether the variant part of the allele is cis or trans type, and there are disadvantages in that time, labor, and cost are high.

검사 대상 exon 이외에 추가 영역에 대한 분석을 수행해야만 구분되는 대립유전자의 빈도 또한 증가하고 있으며, 질병에 특이적인 HLA 유전자형, 즉 강직성 척추염에서의 HLA-B27, 베체트 질환에서의 HLA-B51, 건선에서의 HLA-Cw*06 유전자 형별에 대한 검사법의 유전자 증폭 조건이 모두 달라서 기존 검사법으로 동시 검사를 수행하기 어려운 실정이다.In addition to the exon to be tested, the frequency of alleles that can be distinguished only by performing analysis on additional regions is also increasing, and disease-specific HLA genotypes, namely HLA-B27 in ankylosing spondylitis, HLA-B51 in Behcet's disease, and psoriasis Since the gene amplification conditions of the test method for HLA-Cw*06 genotyping are all different, it is difficult to perform simultaneous test with the existing test method.

최근 분자진단에 도입되고 있는 차세대염기서열분석(NGS) 기술이 초고해상도 검사로서 기존 검사법의 한계(판독 모호성)를 극복할 수 있는 대안으로 부상하고 있으며, 기존 고해상도 방법인 SBT(sequence-based typing)를 사용한 결과에 비해 현저히 모호성이 줄어든 결과가 보고되고 있다 (Proc Natl Acad Sci U S A.;109(22):8676-81, 2012). 그러나, 아직까지는 NGS 기기를 이용한 서열분석(sequencing) 비용이 상대적으로 높기 때문에 서열분석 처리량과 비용 면에서 기존 SBT에 기초한 HLA 분석 방법에 비해 NGS 기반 방법이 현저히 우수한 것으로 인정될 수 없으며, 또한, 특정 NGS 기기에 의존적이라는 단점이 있다. HLA 고해상도 분석법의 내재적 한계인 위상 모호성의 문제를 근원적으로 해결하고 낮은 비용으로 대량 샘플 처리가 용이한 HLA 고해상도 검사법의 개발이 여전히 요구되고 있다.Next-generation sequencing (NGS) technology, which has recently been introduced in molecular diagnosis, is emerging as an alternative that can overcome the limitations (reading ambiguity) of existing inspection methods as a super-resolution test, and the existing high-resolution method SBT (sequence-based typing) Compared to the results using , results with significantly reduced ambiguity have been reported ( Proc Natl Acad Sci US A. ; 109(22):8676-81, 2012). However, since the cost of sequencing using NGS equipment is relatively high, the NGS-based method cannot be recognized as significantly superior to the existing SBT-based HLA analysis method in terms of sequencing throughput and cost. The downside is that it is dependent on the NGS device. There is still a need to develop an HLA high-resolution assay that fundamentally solves the problem of phase ambiguity, which is an inherent limitation of the HLA high-resolution assay, and can easily process large quantities of samples at low cost.

HLA 유전자는 거의 모든 세포에서 발현되는 부류 I 분자에 속하는 HLA-A, HLA-B, HLA-C, 및 주로 면역계의 세포에서 발현되는 부류 II 분자에 속하는 HLA-DR, HLA-DQ, HLA-DP로, 사람이 갖고 있는 유전자중 다형성(polymoprphism)이 가장 심한 특징을 가지고 있고, 현재까지 약 18,000 종류 이상의 대립유전자가 밝혀졌다. HLA genes are HLA-A, HLA-B, and HLA-C belonging to class I molecules expressed in almost all cells, and HLA-DR, HLA-DQ, HLA-DP belonging to class II molecules mainly expressed in cells of the immune system. As a result, polymorphism is the most severe feature among genes possessed by humans, and more than 18,000 alleles have been identified so far.

호소미치(Hosomichi) 등은 부류 I 분자에 속하는 HLA-A, HLA-B, HLA-C, 및 주로 면역계의 세포에서 발현되는 부류 II 분자에 속하는 HLA-DRB1, HLA-DQB1, HLA-DPB1 유전자 각각의 상류 영역 및 하류 영역에 특이적으로 어닐링(annealing)된 프라이머를 생산하고 프라이머 및 차세대 서열 분석기(next-generation sequencer, NGS)를 이용한 긴(long range) PCR 방법으로 HLA 유전자의 염기서열을 결정하는 방법을 보고하였다(Hosomichi, K. et al., BMC Genomics, 14:355, 2013). 그러나, 다른 발명자들은 일본인을 대상으로 한 예비 실험에서, 상기 언급된 프라이머를 사용한 긴 PCR은 HLA-C에 대해서는 높은 증폭 효율 및 HLA-DRB1에 대해서는 매우 낮은 증폭 효율을 나타냈기 때문에 균일한 증폭을 달성할 수 없다는 문제점 및 HLA-DRB1에서, 특정 종류의 대립유전자는 거의 증폭되지 않았으며 HLA-DRB3 등과 같은 표적 이외의 유전자가 증폭될 뿐만 아니라, 대상체가 일본인일 경우 뿐만 아니라 아시아인, 백인 또는 흑인인 경우에도 비슷한 문제를 보고하였다(Ehrenberg, P.K. et al., BMC Genomics, 15:864, 2014).Hosomichi et al. reported HLA-A, HLA-B, and HLA-C belonging to class I molecules, and HLA-DRB1, HLA-DQB1, and HLA-DPB1 genes belonging to class II molecules mainly expressed in cells of the immune system, respectively. To produce primers specifically annealed to the upstream and downstream regions of and determine the nucleotide sequence of the HLA gene by long range PCR method using primers and a next-generation sequencer (NGS) method was reported (Hosomichi, K. et al., BMC Genomics , 14:355, 2013). However, in a preliminary experiment with Japanese subjects, other inventors achieved uniform amplification because long PCR using the above-mentioned primers showed high amplification efficiency for HLA-C and very low amplification efficiency for HLA-DRB1. In HLA-DRB1 and HLA-DRB1, specific types of alleles were rarely amplified, and genes other than the target, such as HLA-DRB3, were amplified, as well as when the subject was Japanese, Asian, Caucasian, or black. In this case, a similar problem was reported (Ehrenberg, PK et al ., BMC Genomics , 15:864, 2014).

상기 언급된 방법의 문제를 해결하기 위해, Ehrenberg 등이 1 종류의 프라이머 (HLA-A 및 HLA-C의 경우) 또는 3 종류의 프라이머 (HLA-DRB1의 경우)를 상기 언급된 프라이머에 첨가하여 PCR을 수행하였다는 것이 보고되었다(Ehrenberg, P.K. et al., BMC Genomics, 15:864, 2014). 그러나, 균일한 증폭은 상기 언급된 PCR에서 각 유전자에 대해 상이한 수의 프라이머에 의해 영향을 받는다. 또한, HLA-DRB1과 관련하여, 프라이머 서열은 표적 유전자 이외의 유전자와 완전히 동일하므로 의도하지 않은 유전자가 증폭될 수 있다.In order to solve the problem of the above-mentioned method, Ehrenberg et al. added one type of primer (for HLA-A and HLA-C) or three types of primers (for HLA-DRB1) to the above-mentioned primers to perform PCR It was reported that it was performed (Ehrenberg, PK et al ., BMC Genomics , 15:864, 2014). However, uniform amplification is effected by different numbers of primers for each gene in the PCR mentioned above. Also, with respect to HLA-DRB1, since the primer sequence is completely identical to genes other than the target gene, unintended genes can be amplified.

HLA 유전자 타이핑에 대한 다른 접근법으로서, 상기 언급된 6 종류의 HLA 유전자를 위해, 데이터베이스를 기반으로 HLA 대립유전자의 다양한 서열에 상응하는 120-염기 프로브(probe)를 설계하는 단계, 및 NGS에 의해 cDNA 및 프로브를 혼성화(hybridizing)하여 수득된 게놈 단편을 판독하는 단계를 포함하는 방법이 보고되었다(Wittig, M. et al., Nucleic Acids Res., 43: e70, 2015). 그러나, 이 방법에서, 데이터베이스에 등록된 HLA 대립유전자의 가능한 한 많은 서열을 커버하도록 무려 10,000 종류의 프로브가 설계되었으며, 이는 결국 감소된 증폭 균일성 및 수집 효율의 문제를 유발한다. 또한, 커버된 HLA 대립유전자 이외의 대립유전자를 검출하기 어렵고 표적 유전자 이외의 유전자의 게놈 단편이 혼합될 수 있는 단점이 있다.As another approach to HLA genotyping, designing 120-base probes corresponding to various sequences of HLA alleles based on a database for the above-mentioned 6 types of HLA genes, and cDNA by NGS And a method comprising reading a genomic fragment obtained by hybridizing the probe has been reported (Wittig, M. et al., Nucleic Acids Res ., 43: e70, 2015). However, in this method, as many as 10,000 types of probes are designed to cover as many sequences as possible of HLA alleles registered in the database, which eventually causes problems of reduced amplification uniformity and collection efficiency. In addition, it is difficult to detect alleles other than the covered HLA alleles, and genomic fragments of genes other than the target gene may be mixed.

이에 본 발명자들은 민감도와 정확성이 높은 HLA 유전자 증폭용 조성물을 개발하기 위하여 예의 노력한 결과, 인간백혈구 항원 중 HLA-A/B/C, HLA-DRB1/3/4/5, DQA1, DQB1, DPA1 및 DPB1대립유전자를 특이적으로 증폭할 수 있는 프라이머 세트를 이용하여 분석할 경우, 샘플의 HLA 대립유전자를 높은 민감도와 정확도로 분석할 수 있음을 확인하고, 본 발명을 완성하였다. Accordingly, the present inventors have made diligent efforts to develop a composition for amplifying HLA genes with high sensitivity and accuracy. When analyzing using a primer set capable of specifically amplifying the DPB1 allele, it was confirmed that the HLA allele of the sample can be analyzed with high sensitivity and accuracy, and the present invention was completed.

본 발명의 목적은 민감도와 정확도가 향상된 HLA-A/B/C, HLA-DRB1/3/4/5, DQA1, DQB1, DPA1 및 DPB1유전자 증폭 및 형별 진단용 조성물을 제공하는 것이다. An object of the present invention is to provide a composition for amplification and type diagnosis of HLA-A/B/C, HLA-DRB1/3/4/5, DQA1, DQB1, DPA1 and DPB1 genes with improved sensitivity and accuracy.

본 발명의 다른 목적은 상기 조성물을 이용한 HLA 유전자의 서열분석 방법을 제공하는 것이다. Another object of the present invention is to provide a method for sequencing the HLA gene using the composition.

본 발명의 또 다른 목적은 상기 조성물을 이용한 HLA 유전자의 타이핑 방법을 제공하는 것이다. Another object of the present invention is to provide a method for typing HLA genes using the composition.

본 발명의 또 다른 목적은 상기 조성물을 포함하는 HLA 유전자 증폭용 키트를 제공하는 것이다. Another object of the present invention is to provide a kit for HLA gene amplification comprising the composition.

상기 목적을 달성하기 위해서, 본 발명은In order to achieve the above object, the present invention

다음 표 1에 표시된 (a)~(k)의 프라이머 세트를 포함하는 HLA 유전자 증폭용 조성물을 제공한다:Provided is a composition for amplifying an HLA gene comprising primer sets (a) to (k) shown in Table 1 below:

(a) HLA-A 유전자를 증폭할 수 있는 제1 내지 제6 프라이머 세트; (a) first to sixth primer sets capable of amplifying the HLA-A gene;

(b) HLA-B 유전자를 증폭할 수 있는 제7 내지 제10 프라이머 세트;(b) 7th to 10th primer sets capable of amplifying the HLA-B gene;

(c) HLA-C 유전자를 증폭할 수 있는 제11 내지 제18 프라이머 세트;(c) 11th to 18th primer sets capable of amplifying the HLA-C gene;

(d) HLA-DRB1 유전자를 증폭할 수 있는 제19 내지 제27 프라이머 세트;(d) 19th to 27th primer sets capable of amplifying the HLA-DRB1 gene;

(e) HLA-DRB3 유전자를 증폭할 수 있는 제28 내지 제35 프라이머 세트;(E) 28th to 35th primer sets capable of amplifying the HLA-DRB3 gene;

(f) HLA-DRB4 유전자를 증폭할 수 있는 제36 내지 제43 프라이머 세트;(f) 36th to 43rd primer sets capable of amplifying the HLA-DRB4 gene;

(g) HLA-DRB5 유전자를 증폭할 수 있는 제44 및 제45 프라이머 세트;(g) 44th and 45th primer sets capable of amplifying the HLA-DRB5 gene;

(h) HLA-DQA1 유전자를 증폭할 수 있는 제46 내지 제56 프라이머 세트;(h) 46th to 56th primer sets capable of amplifying the HLA-DQA1 gene;

(i) HLA-DQB1 유전자를 증폭할 수 있는 제57 내지 제65 프라이머 세트;(i) 57th to 65th primer sets capable of amplifying the HLA-DQB1 gene;

(j) HLA-DPA1 유전자를 증폭할 수 있는 제66 내지 제76 프라이머 세트; 및(j) 66th to 76th primer sets capable of amplifying the HLA-DPA1 gene; and

(k) HLA-DPB 유전자를 증폭할 수 있는 제77 내지 제81 프라이머 세트.(k) 77th to 81st primer sets capable of amplifying the HLA-DPB gene.

프라이머 세트primer set 이름name 서열번호sequence number 프라이머 세트primer set 이름name 서열번호sequence number 프라이머 세트primer set 이름name 서열번호sequence number 1One HLA-A_#1_F1HLA-A_#1_F1 1One 2727 HLA-DRB1_#9_F9HLA-DRB1_#9_F9 6262 5858 HLA-DQB1_#2_F2HLA-DQB1_#2_F2 131131 HLA-A_#1_R1HLA-A_#1_R1 22 HLA-DRB1_#9_F10-1HLA-DRB1_#9_F10-1 6363 HLA-DQB1_#2_R2HLA-DQB1_#2_R2 132132 22 HLA-A_#2_F2-1HLA-A_#2_F2-1 33 HLA-DRB1_#9_F10-2HLA-DRB1_#9_F10-2 6464 5959 HLA-DQB1_#3_F3HLA-DQB1_#3_F3 133133 HLA-A_#2_F2-2HLA-A_#2_F2-2 44 HLA-DRB1_#9_F11HLA-DRB1_#9_F11 6565 HLA-DQB1_#3_R3HLA-DQB1_#3_R3 134134 HLA-A_#2_R2-1HLA-A_#2_R2-1 55 HLA-DRB1_#9_F12HLA-DRB1_#9_F12 6666 6060 HLA-DQB1_#4_F4HLA-DQB1_#4_F4 135135 HLA-A_#2_R2-2HLA-A_#2_R2-2 66 HLA-DRB1_#9_F13HLA-DRB1_#9_F13 6767 HLA-DQB1_#4_R4HLA-DQB1_#4_R4 136136 HLA-A_#2_R2-3HLA-A_#2_R2-3 77 HLA-DRB1_#9_F14HLA-DRB1_#9_F14 6868 6161 HLA-DQB1_#5_F5-1HLA-DQB1_#5_F5-1 137137 33 HLA-A_#3_F3-1HLA-A_#3_F3-1 88 HLA-DRB1_#9_F15HLA-DRB1_#9_F15 6969 HLA-DQB1_#5_F5-2HLA-DQB1_#5_F5-2 138138 HLA-A_#3_F3-2HLA-A_#3_F3-2 99 HLA-DRB1_#9_R9HLA-DRB1_#9_R9 7070 HLA-DQB1_#5_R4-1HLA-DQB1_#5_R4-1 139139 HLA-A_#3_R3HLA-A_#3_R3 1010 2828 HLA-DRB3_#1_F1HLA-DRB3_#1_F1 7171 HLA-DQB1_#5_R4-2HLA-DQB1_#5_R4-2 140140 44 HLA-A_#4_F4HLA-A_#4_F4 1111 HLA-DRB3_#1_R1HLA-DRB3_#1_R1 7272 HLA-DQB1_#5_R4-3HLA-DQB1_#5_R4-3 141141 HLA-A_#4_R4HLA-A_#4_R4 1212 2929 HLA-DRB3_#2_F2HLA-DRB3_#2_F2 7373 6262 HLA-DQB1_#6_F6HLA-DQB1_#6_F6 142142 55 HLA-A_#5_F4HLA-A_#5_F4 1111 HLA-DRB3_#2_R2HLA-DRB3_#2_R2 7474 HLA-DQB1_#6_R5HLA-DQB1_#6_R5 143143 HLA-A_#5_R5-1HLA-A_#5_R5-1 1313 3030 HLA-DRB3_#3_F3HLA-DRB3_#3_F3 7575 6363 HLA-DQB1_#7_F7HLA-DQB1_#7_F7 144144 HLA-A_#5_R5-2HLA-A_#5_R5-2 1414 HLA-DRB3_#3_R3HLA-DRB3_#3_R3 7676 HLA-DQB1_#7_R4-1HLA-DQB1_#7_R4-1 139139 66 HLA-A_#6_F5HLA-A_#6_F5 1515 3131 HLA-DRB3_#4_F4HLA-DRB3_#4_F4 7777 HLA-DQB1_#7_R4-4HLA-DQB1_#7_R4-4 145145 HLA-A_#6_R6HLA-A_#6_R6 1616 HLA-DRB3_#4_R4HLA-DRB3_#4_R4 7878 HLA-DQB1_#7_R4-5HLA-DQB1_#7_R4-5 146146 77 HLA-B_#1_F1HLA-B_#1_F1 1717 3232 HLA-DRB3_#5_F5HLA-DRB3_#5_F5 7979 6464 HLA-DQB1_#8_F7HLA-DQB1_#8_F7 144144 HLA-B_#1_R1HLA-B_#1_R1 1818 HLA-DRB3_#5_R5HLA-DRB3_#5_R5 8080 HLA-DQB1_#8_R5-1HLA-DQB1_#8_R5-1 147147 88 HLA-B_#2_F2-1HLA-B_#2_F2-1 1919 3333 HLA-DRB3_#6_F6HLA-DRB3_#6_F6 8181 HLA-DQB1_#8_R5-2HLA-DQB1_#8_R5-2 148148 HLA-B_#2_F2-2HLA-B_#2_F2-2 2020 HLA-DRB3_#6_R6HLA-DRB3_#6_R6 8282 6565 HLA-DQB1_#9_F8HLA-DQB1_#9_F8 149149 HLA-B_#2_R2-1HLA-B_#2_R2-1 2121 3434 HLA-DRB3_#7_F7HLA-DRB3_#7_F7 8383 HLA-DQB1_#9_R6-1HLA-DQB1_#9_R6-1 150150 HLA-B_#2_R2-2HLA-B_#2_R2-2 2222 HLA-DRB3_#7_R7HLA-DRB3_#7_R7 8484 HLA-DQB1_#9_R6-2HLA-DQB1_#9_R6-2 151151 99 HLA-B_#3_F3HLA-B_#3_F3 2323 3535 HLA-DRB3_#8_F8HLA-DRB3_#8_F8 8585 6666 HLA-DPA1_#1_F1HLA-DPA1_#1_F1 152152 HLA-B_#3_R3HLA-B_#3_R3 2424 HLA-DRB3_#8_R8-1HLA-DRB3_#8_R8-1 8686 HLA-DPA1_#1_R1HLA-DPA1_#1_R1 153153 1010 HLA-B_#4_F4-1HLA-B_#4_F4-1 2525 HLA-DRB3_#8_R8-2HLA-DRB3_#8_R8-2 8787 6767 HLA-DPA1_#2_F2HLA-DPA1_#2_F2 154154 HLA-B_#4_F4-2HLA-B_#4_F4-2 2626 3636 HLA-DRB4_#1_F1HLA-DRB4_#1_F1 8888 HLA-DPA1_#2_R2HLA-DPA1_#2_R2 155155 HLA-B_#4_R4HLA-B_#4_R4 2727 HLA-DRB4_#1_R1HLA-DRB4_#1_R1 8989 6868 HLA-DPA1_#3_F3-1HLA-DPA1_#3_F3-1 156156 1111 HLA-C_#1_F1-1HLA-C_#1_F1-1 2828 3737 HLA-DRB4_#2_F2HLA-DRB4_#2_F2 9090 HLA-DPA1_#3_F3-2HLA-DPA1_#3_F3-2 157157 HLA-C_#1_F1-2HLA-C_#1_F1-2 2929 HLA-DRB4_#2_R2HLA-DRB4_#2_R2 9191 HLA-DPA1_#3_F3-3HLA-DPA1_#3_F3-3 158158 HLA-C_#1_R1HLA-C_#1_R1 3030 3838 HLA-DRB4_#3_F3HLA-DRB4_#3_F3 9292 HLA-DPA1_#3_R3HLA-DPA1_#3_R3 159159 1212 HLA-C_#2_F2HLA-C_#2_F2 3131 HLA-DRB4_#3_R3HLA-DRB4_#3_R3 9393 6969 HLA-DPA1_#4_F4HLA-DPA1_#4_F4 160160 HLA-C_#2_R2-1HLA-C_#2_R2-1 3232 3939 HLA-DRB4_#4_F4HLA-DRB4_#4_F4 9494 HLA-DPA1_#4_R4HLA-DPA1_#4_R4 161161 HLA-C_#2_R2-2HLA-C_#2_R2-2 3333 HLA-DRB4_#4_R4HLA-DRB4_#4_R4 9595 7070 HLA-DPA1_#5_F5HLA-DPA1_#5_F5 162162 1313 HLA-C_#3_F3-1HLA-C_#3_F3-1 3434 4040 HLA-DRB4_#5_F5HLA-DRB4_#5_F5 9696 HLA-DPA1_#5_R5HLA-DPA1_#5_R5 163163 HLA-C_#3_F3-2HLA-C_#3_F3-2 3535 HLA-DRB4_#5_R5HLA-DRB4_#5_R5 9797 7171 HLA-DPA1_#6_F6HLA-DPA1_#6_F6 164164 HLA-C_#3_R2-1HLA-C_#3_R2-1 3232 4141 HLA-DRB4_#6_F6HLA-DRB4_#6_F6 9898 HLA-DPA1_#6_R5HLA-DPA1_#6_R5 163163 HLA-C_#3_R2-2HLA-C_#3_R2-2 3333 HLA-DRB4_#6_R6HLA-DRB4_#6_R6 9999 7272 HLA-DPA1_#7_F5HLA-DPA1_#7_F5 162162 1414 HLA-C_#4_F4HLA-C_#4_F4 3636 4242 HLA-DRB4_#7_F7HLA-DRB4_#7_F7 100100 HLA-DPA1_#7_R6HLA-DPA1_#7_R6 165165 HLA-C_#4_R2-1HLA-C_#4_R2-1 3232 HLA-DRB4_#7_R7HLA-DRB4_#7_R7 101101 7373 HLA-DPA1_#8_F6HLA-DPA1_#8_F6 164164 HLA-C_#4_R2-2HLA-C_#4_R2-2 3333 4343 HLA-DRB4_#8_F7HLA-DRB4_#8_F7 100100 HLA-DPA1_#8_R6HLA-DPA1_#8_R6 165165 1515 HLA-C_#5_F2HLA-C_#5_F2 3131 HLA-DRB4_#8_R8HLA-DRB4_#8_R8 102102 7474 HLA-DPA1_#9_F5HLA-DPA1_#9_F5 162162 HLA-C_#5_R3-1HLA-C_#5_R3-1 3737 4444 HLA-DRB5_#1_F1HLA-DRB5_#1_F1 103103 HLA-DPA1_#9_R7HLA-DPA1_#9_R7 166166 HLA-C_#5_R3-2HLA-C_#5_R3-2 3838 HLA-DRB5_#1_R1HLA-DRB5_#1_R1 104104 7575 HLA-DPA1_#10_F6HLA-DPA1_#10_F6 164164 1616 HLA-C_#6_F3-1HLA-C_#6_F3-1 3434 4545 HLA-DRB5_#2_N-R1HLA-DRB5_#2_N-R1 105105 HLA-DPA1_#10_R7HLA-DPA1_#10_R7 166166 HLA-C_#6_F3-2HLA-C_#6_F3-2 3535 HLA-DRB5_#2_N-F5HLA-DRB5_#2_N-F5 106106 7676 HLA-DPA1_#11_F7HLA-DPA1_#11_F7 167167 HLA-C_#6_R3-1HLA-C_#6_R3-1 3737 4646 HLA-DQA1_#1_F1HLA-DQA1_#1_F1 107107 HLA-DPA1_#11_R8HLA-DPA1_#11_R8 168168 HLA-C_#6_R3-2HLA-C_#6_R3-2 3838 HLA-DQA1_#1_R1HLA-DQA1_#1_R1 108108 7777 HLA-DPB1_#1_F1HLA-DPB1_#1_F1 169169 1717 HLA-C_#7_F4HLA-C_#7_F4 3636 4747 HLA-DQA1_#2_F2HLA-DQA1_#2_F2 109109 HLA-DPB1_#1_R1HLA-DPB1_#1_R1 170170 HLA-C_#7_R3-1HLA-C_#7_R3-1 3737 HLA-DQA1_#2_R2HLA-DQA1_#2_R2 110110 7878 HLA-DPB1_#2_F2HLA-DPB1_#2_F2 171171 HLA-C_#7_R3-2HLA-C_#7_R3-2 3838 4848 HLA-DQA1_#3_F3HLA-DQA1_#3_F3 111111 HLA-DPB1_#2_R2HLA-DPB1_#2_R2 172172 1818 HLA-C_#8_F5HLA-C_#8_F5 3939 HLA-DQA1_#3_R3HLA-DQA1_#3_R3 112112 7979 HLA-DPB1_#3_F3HLA-DPB1_#3_F3 173173 HLA-C_#8_R4HLA-C_#8_R4 4040 4949 HLA-DQA1_#4_F4HLA-DQA1_#4_F4 113113 HLA-DPB1_#3_R3-1HLA-DPB1_#3_R3-1 174174 1919 HLA-DRB1_#1_F1HLA-DRB1_#1_F1 4141 HLA-DQA1_#4_R4HLA-DQA1_#4_R4 114114 HLA-DPB1_#3_R3-2HLA-DPB1_#3_R3-2 175175 HLA-DRB1_#1_R1HLA-DRB1_#1_R1 4242 5050 HLA-DQA1_#5_F5HLA-DQA1_#5_F5 115115 HLA-DPB1_#3_R3-3HLA-DPB1_#3_R3-3 176176 2020 HLA-DRB1_#2_F2HLA-DRB1_#2_F2 4343 HLA-DQA1_#5_R5-1HLA-DQA1_#5_R5-1 116116 8080 HLA-DPB1_#4_F4HLA-DPB1_#4_F4 177177 HLA-DRB1_#2_R2HLA-DRB1_#2_R2 4444 HLA-DQA1_#5_R5-2HLA-DQA1_#5_R5-2 117117 HLA-DPB1_#4_R4-1HLA-DPB1_#4_R4-1 178178 2121 HLA-DRB1_#3_F3-1HLA-DRB1_#3_F3-1 4545 HLA-DQA1_#5_R5-3HLA-DQA1_#5_R5-3 118118 HLA-DPB1_#4_R4-2HLA-DPB1_#4_R4-2 179179 HLA-DRB1_#3_F3-2HLA-DRB1_#3_F3-2 4646 5151 HLA-DQA1_#6_F6HLA-DQA1_#6_F6 119119 HLA-DPB1_#5_F5HLA-DPB1_#5_F5 180180 HLA-DRB1_#3_R3-1HLA-DRB1_#3_R3-1 4747 HLA-DQA1_#6_R6HLA-DQA1_#6_R6 120120 HLA-DPB1_#5_R5HLA-DPB1_#5_R5 181181 HLA-DRB1_#3_R3-2HLA-DRB1_#3_R3-2 4848 5252 HLA-DQA1_#7_F4HLA-DQA1_#7_F4 113113 8181 HLA-DPB1_#6_F4HLA-DPB1_#6_F4 177177 2222 HLA-DRB1_#4_F4HLA-DRB1_#4_F4 4949 HLA-DQA1_#7_R6HLA-DQA1_#7_R6 120120 HLA-DPB1_#6_R4-1HLA-DPB1_#6_R4-1 178178 HLA-DRB1_#4_R4HLA-DRB1_#4_R4 5050 5353 HLA-DQA1_#8_F7HLA-DQA1_#8_F7 121121 HLA-DPB1_#6_R4-2HLA-DPB1_#6_R4-2 179179 2323 HLA-DRB1_#5_F5HLA-DRB1_#5_F5 5151 HLA-DQA1_#8_R7HLA-DQA1_#8_R7 122122 HLA-DPB1_#6_F5HLA-DPB1_#6_F5 180180 HLA-DRB1_#5_R5HLA-DRB1_#5_R5 5252 5454 HLA-DQA1_#9_F7HLA-DQA1_#9_F7 121121 HLA-DPB1_#6_R6HLA-DPB1_#6_R6 182182 2424 HLA-DRB1_#6_F6HLA-DRB1_#6_F6 5353 HLA-DQA1_#9_R8-1HLA-DQA1_#9_R8-1 123123 HLA-DRB1_#6_R6HLA-DRB1_#6_R6 5454 HLA-DQA1_#9_R8-2HLA-DQA1_#9_R8-2 124124 2525 HLA-DRB1_#7_F7HLA-DRB1_#7_F7 5555 5555 HLA-DQA1_#10_F7HLA-DQA1_#10_F7 121121 HLA-DRB1_#7_R7HLA-DRB1_#7_R7 5656 HLA-DQA1_#10_R9-1HLA-DQA1_#10_R9-1 125125 2626 HLA-DRB1_#8_F8HLA-DRB1_#8_F8 5757 HLA-DQA1_#10_R9-2HLA-DQA1_#10_R9-2 126126 HLA-DRB1_#8_R8-1HLA-DRB1_#8_R8-1 5858 5656 HLA-DQA1_#11_F8HLA-DQA1_#11_F8 127127 HLA-DRB1_#8_R8-2HLA-DRB1_#8_R8-2 5959 HLA-DQA1_#11_R10HLA-DQA1_#11_R10 128128 HLA-DRB1_#8_R8-3HLA-DRB1_#8_R8-3 6060 5757 HLA-DQB1_#1_F1HLA-DQB1_#1_F1 129129 HLA-DRB1_#8_R8-4HLA-DRB1_#8_R8-4 6161 HLA-DQB1_#1_R1HLA-DQB1_#1_R1 130130

본 발명은 또한, 상기 프라이머 세트를 사용하는 것을 포함하는, HLA 유전자를 증폭하는 방법을 제공한다.The present invention also provides a method for amplifying the HLA gene, comprising using the primer set.

본 발명은 또한, 상기 방법에 의해 수득된 증폭산물을 포함하는, HLA 유전자의 서열분석(sequencing) 방법을 제공한다.The present invention also provides a method for sequencing an HLA gene, including an amplification product obtained by the above method.

본 발명은 또한, 상기 방법에 의해 수득된 염기서열 정보를 사용하는 것을 포함하는, HLA 유전자의 타이핑(typing) 방법을 제공한다.The present invention also provides a method for typing the HLA gene, including using the nucleotide sequence information obtained by the above method.

본 발명은 또한, 상기 프라이머 세트를 포함하는, HLA 유전자 증폭용 키트(kit)를 제공한다.The present invention also provides a kit for amplifying the HLA gene, including the primer set.

본 발명에 따른 HLA 유전자 증폭용 조성물은 HLA 유전자의 형별을 높은 민감도와 정확도로 분석할 수 있어, 골수 또는 장기이식을 위한 조직적합성 검사에 유용하다. The composition for amplifying the HLA gene according to the present invention can analyze the type of HLA gene with high sensitivity and accuracy, and is useful for histocompatibility testing for bone marrow or organ transplantation.

도 1은 본 발명에 따른 프라이머 세트(HLAaccuTest)의 각 HLA 유전자 좌위별 증폭 위치를 나타낸 개략도이다.
도 2는 본 발명에 따른 프라이머 세트(HLAaccuTest)를 이용하여 조직적합성 검사 방법을 나타낸 모식도이다.
도 3은 본 발명에 따른 프라이머 세트(HLAaccuTest)를 이용하여 157개의 표준검체에 대한 각 HLA 유전자 좌위의 형별 분석성능의 정확도 시험결과를 나타낸 것이다.
도 4는 본 발명에 따른 프라이머 세트(HLAaccuTest)를 이용하여 165개의 임상검체에 대한 HLA-A, B, C, DRB1 및 DQB1의 대립유전자 형별 분석의 임상적 성능 시험 결과를 나타낸 것이다.
도 5는 본 발명에 따른 프라이머 세트와 타사 제품을 이용하여 5개의 샘플에서 11개의 HLA 유전자 좌위를 증폭한 결과를 나타낸 것이다.
도 6은 본 발명에 따른 프라이머 세트와 타사 제품을 이용하여 165개의 임상검체에 대한 DRB1 및 DQB1의 대립유전자의 allele balance를 비교 분석한 결과를 나타낸 것이다.
도 7은 본 발명에 따른 프라이머 세트와 타사 제품의 DQB1과 DPB1의 전체 Exon을 타겟팅 범위를 비교하여 나타낸 것이다.1 is a schematic diagram showing amplification positions for each HLA gene locus of a primer set (HLAaccuTest) according to the present invention.
2 is a schematic diagram showing a histocompatibility test method using a primer set (HLAaccuTest) according to the present invention.
Figure 3 shows the accuracy test results of the type analysis performance of each HLA gene locus for 157 standard samples using the primer set (HLAaccuTest) according to the present invention.
Figure 4 shows the clinical performance test results of HLA-A, B, C, DRB1 and DQB1 allele typing analysis for 165 clinical samples using the primer set (HLAaccuTest) according to the present invention.
Figure 5 shows the results of amplifying 11 HLA gene loci in 5 samples using the primer set according to the present invention and a third-party product.
Figure 6 shows the results of comparative analysis of the allele balance of DRB1 and DQB1 alleles for 165 clinical samples using the primer set according to the present invention and another company's product.
7 shows a comparison of the targeting ranges of the primer set according to the present invention and the entire exon of DQB1 and DPB1 of other products.

다른 식으로 정의되지 않는 한, 본 명세서에서 사용된 모든 기술적 및 과학적 용어들은 본 발명이 속하는 기술 분야에서 숙련된 전문가에 의해서 통상적으로 이해되는 것과 동일한 의미를 갖는다. 일반적으로 본 명세서에서 사용된 명명법은 본 기술 분야에서 잘 알려져 있고 통상적으로 사용되는 것이다.Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In general, the nomenclature used herein is one well known and commonly used in the art.

본 발명에서의 용어 “NGS”는 Next Generation Sequencing을 의미하는 것으로, 차세대 시퀀싱, 차세대 염기서열 분석을 의미하기도 한다. 이는 전장유전체(Whole genome)를 조각 내고, 상기 조각을 화학적인 반응(hybridization)에 기초하여 대용량으로 시퀀싱을 수행하거나, multiplex PCR로 표적 유전자 영역들을 증폭시켜 대용량으로 시퀀싱을 수행하는 기술을 의미하고, Agilent, Illumina, Roche 및 Life Technologies사의 기술을 포함하고, 넓은 의미로는 제3세대 기술인 Pacificbio사의 기술, Nanopore Technology 등의 기술 및 제 4세대 기술을 포함하는 것으로 정의한다.In the present invention, the term "NGS" means Next Generation Sequencing, and also means next-generation sequencing and next-generation sequencing. This means a technology that fragments the whole genome and performs mass sequencing based on chemical reactions (hybridization) on the fragments, or performs mass sequencing by amplifying target gene regions by multiplex PCR, It includes technologies of Agilent, Illumina, Roche, and Life Technologies, and in a broad sense, it is defined as including technologies such as 3rd generation technology, Pacificbio technology, Nanopore Technology, and 4th generation technology.

본래 차세대 염기서열 분석(Next Generation Sequencing, NGS)으로 지칭되는 기술은 자동화로는 제2세대 기술에 해당된다. NGS는 이전의 첫 자동화 기기와 구분하고, 이후에 탄생한 Next NGS 기기(차차세대, 혹은 제3세대 NGS라고도 지칭됨)와 따로 구분하기 위하여 불리는 이름이다. 그러나, 효율적인 염기서열 분석 기술의 개발경쟁이 가속화되고 새로운 기술의 도입 및 플랫폼의 사용 목적에 기초한 염기서열 분석 기술이 지속적으로 개발됨에 따라, 각 세대의 염기서열 분석기술은 그 구분이 모호해지고, NGS는 자동화된 생어 염기서열 분석기술 이후의 염기서열 분석기술을 모두 아우르는 광의의 의미로 사용되고 있다.The technology originally referred to as next-generation sequencing (NGS) corresponds to the second-generation technology in terms of automation. NGS is a name called to distinguish it from the first automation device before and to distinguish it from the Next NGS device (also referred to as the next generation or the third generation NGS) that was born later. However, as competition for development of efficient sequencing technologies accelerates and sequencing technologies based on the introduction of new technologies and the purpose of platform use are continuously developed, the distinction between each generation of sequencing technologies is becoming ambiguous, and NGS is used in a broad sense encompassing all sequencing technologies after the automated Sanger sequencing technology.

본 발명에서는 HLA 유전자 형질을 높은 민감도와 정확도로 분석하기 위해, 정확하고 충분한 양의 증폭산물을 수득할 수 있는 조성물을 설계하고자 하였다.In the present invention, in order to analyze HLA gene traits with high sensitivity and accuracy, it was intended to design a composition capable of obtaining an accurate and sufficient amount of amplification product.

즉, 본 발명의 일 실시예에서는 HLA-A/B/C, HLA-DRB1/3/4/5, DQA1, DQB1, DPA1 및 유전자를 각각 증폭하여 하나의 튜브에 모은 다음, NGS 방법으로 분석하여, 높은 민감도와 정확도로 각 HLA 유전자의 형별을 분석할 수 있는 프라이머 세트를 설계하여 그 성능이 기존에 사용되는 타회사 제품 대비 월등히 뛰어난 것을 확인하였다(도 5).That is, in one embodiment of the present invention, HLA-A / B / C, HLA-DRB1 / 3 / 4 / 5, DQA1, DQB1, DPA1 and genes are respectively amplified, collected in one tube, and then analyzed by NGS method , By designing a primer set capable of analyzing the type of each HLA gene with high sensitivity and accuracy, it was confirmed that its performance was significantly superior to other companies' products previously used (FIG. 5).

본 발명의 다른 실시예에서는 본 발명에 따른 HLAaccuTest 프라이머 세트를 사용한 경우, HLA-DRB1와 HLA-DQB1 유전자좌의 PCR 산물의 PCR bias가 NGSgo 키트(GenDx 사)를 사용한 경우보다 적어, Heterozygote 형별에 대해 안정적인 allele balance를 확보할 수 있는 것을 확인하였다(도 6).In another embodiment of the present invention, when the HLAaccuTest primer set according to the present invention is used, the PCR bias of the PCR products of the HLA-DRB1 and HLA-DQB1 loci is less than when using the NGSgo kit (GenDx), resulting in stable Heterozygote typing. It was confirmed that allele balance could be secured (FIG. 6).

본 발명이 또 다른 실시예에서는 HLA-DQB1과 HLA-DPB1의 경우, 기존의 타사 제품인 NGSgo 키트(GenDx 사)와 Alltype NGS 키트(One lambda사)의 경우, PCR에 의하여 증폭되는 엑손의 타겟 영역이 좁아 검출 시, 엑손 모호성(exon ambiguity) rate가 높았으나, 본 발명의 HLAaccuTest 프라이머 셋트는 DQB1과 DPB1의 전체 Exon을 타겟팅하고 있어(도 7), HLA-DQB1/DPB1 타이핑 시에 엑손 모호성을 감소시킬 수 있는 것을 확인하였다. In another embodiment of the present invention, in the case of HLA-DQB1 and HLA-DPB1, in the case of NGSgo kit (GenDx) and Alltype NGS kit (One lambda), which are existing third-party products, the target region of the exon amplified by PCR is At narrow detection, the exon ambiguity rate was high, but the HLAaccuTest primer set of the present invention targets the entire exon of DQB1 and DPB1 (FIG. 7), reducing exon ambiguity during HLA-DQB1/DPB1 typing confirmed what could be done.

따라서, 본 발명은 일 관점에서 다음 표 1에 표시된 (a)~(k)의 프라이머 세트를 포함하는 HLA 유전자 증폭용 조성물에 관한 것이다:Accordingly, in one aspect, the present invention relates to a composition for amplifying an HLA gene comprising primer sets (a) to (k) shown in Table 1 below:

(a) HLA-A 유전자를 증폭할 수 있는 제1 내지 제6 프라이머 세트; (a) first to sixth primer sets capable of amplifying the HLA-A gene;

(b) HLA-B 유전자를 증폭할 수 있는 제7 내지 제10 프라이머 세트;(b) 7th to 10th primer sets capable of amplifying the HLA-B gene;

(c) HLA-C 유전자를 증폭할 수 있는 제11 내지 제18 프라이머 세트;(c) 11th to 18th primer sets capable of amplifying the HLA-C gene;

(d) HLA-DRB1 유전자를 증폭할 수 있는 제19 내지 제27 프라이머 세트;(d) 19th to 27th primer sets capable of amplifying the HLA-DRB1 gene;

(e) HLA-DRB3 유전자를 증폭할 수 있는 제28 내지 제35 프라이머 세트;(E) 28 to 35 primer sets capable of amplifying the HLA-DRB3 gene;

(f) HLA-DRB4 유전자를 증폭할 수 있는 제36 내지 제43 프라이머 세트;(f) 36th to 43rd primer sets capable of amplifying the HLA-DRB4 gene;

(g) HLA-DRB5 유전자를 증폭할 수 있는 제44 및 제45 프라이머 세트;(g) 44th and 45th primer sets capable of amplifying the HLA-DRB5 gene;

(h) HLA-DQA1 유전자를 증폭할 수 있는 제46 내지 제56 프라이머 세트;(h) 46th to 56th primer sets capable of amplifying the HLA-DQA1 gene;

(i) HLA-DQB1 유전자를 증폭할 수 있는 제57 내지 제65 프라이머 세트;(i) 57th to 65th primer sets capable of amplifying the HLA-DQB1 gene;

(j) HLA-DPA1 유전자를 증폭할 수 있는 제66 내지 제76 프라이머 세트; 및(j) 66th to 76th primer sets capable of amplifying the HLA-DPA1 gene; and

(k) HLA-DPB 유전자를 증폭할 수 있는 제77 내지 제81 프라이머 세트.(k) 77th to 81st primer sets capable of amplifying the HLA-DPB gene.

[표 1] [Table 1]

Figure 112020093433187-pat00001
Figure 112020093433187-pat00001

Figure 112020093433187-pat00002
Figure 112020093433187-pat00002

Figure 112020093433187-pat00003
Figure 112020093433187-pat00003

본 발명에 있어서, 상기 증폭은 NGS를 이용한 증폭인 것을 특징으로 할 수 있어, 골수 또는 장기이식 시의 조직적합성 분석용인 것을 특징으로 할 수 있다. In the present invention, the amplification can be characterized in that it is amplified using NGS, and it can be characterized in that it is for histocompatibility analysis at the time of bone marrow or organ transplantation.

도 1에는 상기 표 1에 나타낸 본 발명에 따른 프라이머 세트의 각 HLA 유전좌위별 증폭 위치를 나타내었다. 본 발명의 '비번역부위', Untranslated Region(UTR)은 단백질로 번역되는 엑손 영역과 엑손 사이의 인트론 영역 이외에 각 HLA 유전자의 5' 말단 또는 3' 말단을 포함하며, 구체적으로는 아래 표 2에 나타난 길이의 서열을 포함한다.Figure 1 shows the amplification position for each HLA locus of the primer set according to the present invention shown in Table 1 above. The 'untranslated region', Untranslated Region (UTR) of the present invention includes the 5' end or 3' end of each HLA gene in addition to the exon region translated into protein and the intron region between exons. Specifically, in Table 2 below Include sequences of the indicated length.

유전자gene 5'-UTR 길이 (bp)5'-UTR length (bp) 3'-UTR 길이 (bp)3'-UTR length (bp) HLA-AHLA-A 8484 429429 HLA-BHLA-B 8787 435435 HLA-CHLA-C 6565 420420 HLA-DRB1HLA-DRB1 9494 321321 HLA-DRB3HLA-DRB3 4040 317317 HLA-DRB4HLA-DRB4 7171 320320 HLA-DRB5HLA-DRB5 55 362362 HLA-DQA1HLA-DQA1 5353 721721 HLA-DQB1HLA-DQB1 8282 772772 HLA-DPA1HLA-DPA1 107107 791791 HLA-DPB1HLA-DPB1 116116 31623162

본 발명의 '올리고뉴클레오타이드'는 일반적으로 약 10개 내지 약 100개의 뉴클레오타이드로 구성된 뉴클레오타이드 고분자를 의미한다. 그러나, 뉴클레오타이드의 길이는 100개 이상이거나 10개 이하일 수 있다.In the present invention, 'oligonucleotide' generally means a nucleotide polymer composed of about 10 to about 100 nucleotides. However, the length of the nucleotides may be greater than 100 or less than 10.

본 발명의 '뉴클레오타이드'는 포스페이트 그룹, 5-탄당 및 질소 염기로 구성된 핵산의 기본 단위이다. RNA에서 5-탄당은 리보스이다. DNA에서 5-탄당은 2-데옥시리보스이다. 5-뉴클레오타이드의 경우, 당은 5-탄당-2에서 하이드록실그룹(-OH)을 함유한다. 이 용어는 또한 리보스의 2 위치에 메톡시 그룹과 같이 상기 기본 단위의 유사체를 포함한다.The 'nucleotide' of the present invention is a basic unit of nucleic acid composed of a phosphate group, a 5-carbon sugar and a nitrogen base. The 5-carbon sugar in RNA is ribose. The 5-carbon sugar in DNA is 2-deoxyribose. In the case of 5-nucleotides, the sugar contains a hydroxyl group (-OH) at the 5-carbon sugar-2. The term also includes analogs of these base units, such as the methoxy group at the 2 position of ribose.

본 발명의 프라이머는 통상의 클로닝 방법(Maniatis, T., et al. Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, New York, 1982)을 이용하여 목적하는 서열을 클로닝하거나 시판되는 DNA 합성기를 이용하여 화학적으로 합성하여 다량으로 얻을 수 있다. The primers of the present invention are cloned using a conventional cloning method (Maniatis, T., et al. Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, New York, 1982) or a commercially available DNA synthesizer. It can be obtained in large quantities by chemical synthesis.

본 발명의 프라이머는 바람직하게 단리 또는 정제된다. "단리 또는 정제된"이라는 것은 천연 또는 합성된 상태로부터 목적 성분 이외의 성분을 제거하는 조작이 적용됨을 의미한다. (w/w)%에서 단리 또는 정제된 프라이머의 순도(총 핵산에 포함된 표적 프라이머의 백분율)는 일반적으로 50% 이상, 바람직하게는 70% 이상, 보다 바람직하게는 90% 이상, 가장 바람직하게는 95% 이상(예컨대, 100 %)이다. 프라이머의 순도는 용매 및 고체 또는 액체의 상태에 따라 적절히 변화될 수 있다. 순도의 단위는 (w/v)% 또는 (v/v)%일 수 있고, 목적하는 순도는 상기 언급된 (w/w)%에서 순도의 정의를 고려하여 적절하게 계산될 수 있다.Primers of the present invention are preferably isolated or purified. "Isolated or purified" means that an operation to remove components other than the target component from a natural or synthesized state is applied. (w/w) % purity of the isolated or purified primers (percentage of target primers contained in total nucleic acids) is generally greater than 50%, preferably greater than 70%, more preferably greater than 90%, most preferably greater than 50%. is greater than 95% (eg, 100%). The purity of the primer can be appropriately changed depending on the solvent and solid or liquid state. The unit of purity may be (w/v)% or (v/v)%, and the desired purity may be appropriately calculated in consideration of the above-mentioned definition of purity in (w/w)%.

이들 프라이머는 건조 상태 또는 알코올 침전 상태에서 고체로 제공될 수 있거나, 또는 물 또는 적합한 완충액(예컨대, TE 완충액 등)에 용해시켜 제공될 수도 있다.These primers may be provided as a solid in a dry or alcohol precipitated state, or may be provided dissolved in water or a suitable buffer (eg, TE buffer, etc.).

본 발명의 '앰플리콘'은 프라이머에 의해 증폭되는 증폭 산물을 의미한다.An 'amplicon' in the present invention refers to an amplification product amplified by a primer.

본 발명에 있어서, 상기 프라이머는 각 유전자를 증폭할 수 있고, GC 비율이 30 내지 80% 범위를 유지하며, 종열반복 배열이 없는 유전자 서열과 상보적인 것을 특징으로 할 수 있다. In the present invention, the primers can amplify each gene, maintain a GC ratio in the range of 30 to 80%, and can be characterized in that they are complementary to gene sequences without tandem repeats.

본 발명에서 용어 '증폭'은 핵산 분자를 증폭하는 반응을 의미한다. 다양한 증폭 반응들이 당업계에 보고되어 있으며, 이는 중합효소 연쇄반응(이하 PCR이라 한다)(미국특허 제4,683,195, 4,683,202, 및 4,800,159호), 역전사-중합효소 연쇄반응(이하 RT-PCR로 표기한다)(Sambrook et al., Molecular Cloning. A Laboratory Manual, 3rd ed. Cold Spring Harbor Press(2001)), WO 89/06700 및 EP 329,822의 방법, 리가아제 연쇄 반응(ligase chain reaction; LCR, WO 90/01069), 복구 연쇄 반응(repair chain reaction; EP 439,182), 전사-중재 증폭(transcription-mediated amplification; MA, WO 88/10315), 자가 유지 염기서열 복제(self-sustained sequence replication, WO 90/06995), 타겟 폴리뉴클레오티드 염기서열의 선택적 증폭(selective amplification of target polynucleotide sequences, 미국특허 제6,410,276호), 컨센서스 서열 프라이밍 중합효소 연쇄 반응(consensus sequence primed polymerase chain reaction; CP-PCR, 미국특허 제4,437,975호), 임의적 프라이밍 중합효소 연쇄 반응(arbitrarily primed polymerase chain reaction; AP-PCR, 미국특허 제5,413,909호 및 제5,861,245호), 핵산 염기서열 기반 증폭(nucleic acid sequence based amplification; NASBA, 미국특허 제5,130,238호, 제5,409,818호, 제5,554,517호, 및 제6,063,603호), 가닥 치환 증폭(strand displacement amplification) 및 고리-중재 항온성 증폭(loop-mediated isothermal amplification; LAMP)을 포함하나, 이에 한정되지는 않는다.In the present invention, the term 'amplification' means a reaction to amplify a nucleic acid molecule. Various amplification reactions have been reported in the art, including polymerase chain reaction (hereinafter referred to as PCR) (U.S. Patent Nos. 4,683,195, 4,683,202, and 4,800,159), reverse transcription-polymerase chain reaction (hereinafter referred to as RT-PCR) (Sambrook et al., Molecular Cloning. A Laboratory Manual, 3rd ed. Cold Spring Harbor Press (2001)), methods of WO 89/06700 and EP 329,822, ligase chain reaction (LCR, WO 90/01069) ), repair chain reaction (EP 439,182), transcription-mediated amplification (MA, WO 88/10315), self-sustained sequence replication (WO 90/06995), Selective amplification of target polynucleotide sequences (U.S. Patent No. 6,410,276), consensus sequence primed polymerase chain reaction (CP-PCR, U.S. Patent No. 4,437,975), optional Arbitrarily primed polymerase chain reaction (AP-PCR, U.S. Patent Nos. 5,413,909 and 5,861,245), nucleic acid sequence based amplification (NASBA, U.S. Patent Nos. 5,130,238 and 5,409,818) , 5,554,517, and 6,063,603), strand displacement amplification and loop-mediated isotherm amplification ermal amplification; LAMP), but is not limited thereto.

사용가능한 다른 증폭 방법들은 미국특허 제5,242,794, 5,494,810, 4,988,617호 및 미국특허 제09/854,317호에 기술되어 있다.Other amplification methods that may be used are described in U.S. Patent Nos. 5,242,794, 5,494,810, 4,988,617 and U.S. Patent No. 09/854,317.

PCR은 가장 잘 알려진 핵산증폭 방법으로, 그의 많은 변형과 응용들이 개발되어 있다. 예를 들어, PCR의 특이성 또는 민감성을 증진시키기 위해 전통적인 PCR 절차를 변형시켜 터치다운(touchdown) PCR, 핫 스타트(hot start) PCR, 네스티드(nested) PCR 및 부스터(booster) PCR이 개발되었다. 또한, 실시간(real-time) PCR, 분별 디스플레이 PCR(differential display PCR, D-PCR), cDNA 말단의 신속 증폭(rapid amplification of cDNA ends, RACE), DL-PCR(PC), 인버스 중합효소 연쇄반응(inverse polymerase chain reaction: IPCR), 벡토레트(vectorette) PCR, 및 TAIL-PCR(thermal asymmetric interlaced PCR)이 특정한 응용을 위해 개발되었다. PCR에 대한 자세한 내용은 McPherson, M.J., 및 Moller, S.G. PCR. BIOS Scientific Publishers, Springer-Verlag New York Berlin Heidelberg, N.Y. (2000)에 기재되어 있으며, 그의 교시사항은 본 명세서에 참조로 삽입된다.PCR is the most well-known nucleic acid amplification method, and many variations and applications thereof have been developed. For example, touchdown PCR, hot start PCR, nested PCR and booster PCR have been developed by modifying traditional PCR procedures to enhance the specificity or sensitivity of PCR. In addition, real-time PCR, differential display PCR (D-PCR), rapid amplification of cDNA ends (RACE), DL-PCR (PC), inverse polymerase chain reaction (inverse polymerase chain reaction: IPCR), vectorette PCR, and thermal asymmetric interlaced PCR (TAIL-PCR) have been developed for specific applications. For details on PCR, see McPherson, M.J., and Moller, S.G. PCR. BIOS Scientific Publishers, Springer-Verlag New York Berlin Heidelberg, N.Y. (2000), the teachings of which are incorporated herein by reference.

본 발명에서 PCR은 상기 기재된 방법 이외의 공지된 PCR 방법이면 제한없이 이용가능하나, 바람직하게는 long range PCR인 것을 특징으로 할 수 있으며, 이에 한정되는 것은 아니다.In the present invention, PCR can be used without limitation as long as it is a known PCR method other than the method described above, but it can be characterized in that it is preferably long range PCR, but is not limited thereto.

본 발명의 일 실시예에서는 상기 조건을 만족하는 프라이머 세트를 하기 표 3와 같이 구성하였다.In one embodiment of the present invention, primer sets satisfying the above conditions were configured as shown in Table 3 below.

프라이머 세트 및 이의 서열Primer sets and their sequences 서열번호sequence number 이름name 서열order 1One HLA-A_#1_F1HLA-A_#1_F1 TCTCCCTCTCCCAACCTACGTCTCCCTCTCCCAACCTACG 22 HLA-A_#1_R1HLA-A_#1_R1 CCCCTGCAACAAATCAGCACCCCCTGCAACAAATCAGCAC 33 HLA-A_#2_F2-1HLA-A_#2_F2-1 ATTGGGTGTCGGGTTTCCAGATTGGGTGTCGGGTTTCCAG 44 HLA-A_#2_F2-2HLA-A_#2_F2-2 ATTGGGTGTCGGGTTTCTAGATTGGGTGTCGGGTTTCTAG 55 HLA-A_#2_R2-1HLA-A_#2_R2-1 TGGCCAGAACAGAAACTGGGTGGCCAGAACAGAAACTGGG 66 HLA-A_#2_R2-2HLA-A_#2_R2-2 TGGCCCGAACAGAAACTGGGTGGCCCGAACAGAAACTGGG 77 HLA-A_#2_R2-3HLA-A_#2_R2-3 TGGCCAGAACAGAAACTAGGTGGCCAGAACAGAAACTAGG 88 HLA-A_#3_F3-1HLA-A_#3_F3-1 CGAAGGCGGTGTATGGATTGCGAAGGCGGTGTATGGATTG 99 HLA-A_#3_F3-2HLA-A_#3_F3-2 CGAAGGCGGTATATGGATTGCGAAGGCGGTATATGGATTG 1010 HLA-A_#3_R3HLA-A_#3_R3 CTCTCCTCCCCTGCAACAAATCTCTCCTCCCCTGCAACAAAT 1111 HLA-A_#4_F4HLA-A_#4_F4 TGGATACTCACGACGCGGACTGGATACTCACGACGCGGAC 1212 HLA-A_#4_R4HLA-A_#4_R4 TTGCAGAAACAAAGTCAGGGTTCTTCAAGTTTGCAGAAACAAAGTCAGGGTTCTTCAAGT 1313 HLA-A_#5_R5-1HLA-A_#5_R5-1 GTCAGGGTTCTTCAAGTCACAAAGGGAGTCAGGGTTCTTCAAGTCACAAAGGGA 1414 HLA-A_#5_R5-2HLA-A_#5_R5-2 GTCAGGGTACTTCAAGTCACAAAGGGAGTCAGGGTACTTCAAGTCACAAAGGGA 1515 HLA-A_#6_F5HLA-A_#6_F5 TGGATACTCACGACGCGGACCCAGTGGATACTCACGACGCGGACCCAG 1616 HLA-A_#6_R6HLA-A_#6_R6 GCAGGTGCCTTTGCAGAAACAAAGGCAGGTGCCTTTGCAGAAACAAAG 1717 HLA-B_#1_F1HLA-B_#1_F1 CAACACCAAATGGGCACAGGCAACACCAAATGGGCACAGG 1818 HLA-B_#1_R1HLA-B_#1_R1 CCCACTCCCCTGAGTTTCACCCCACTCCCCTGAGTTTCAC 1919 HLA-B_#2_F2-1HLA-B_#2_F2-1 CAGCTCCCACTGGACAAGTTCAGCTCCCACTGGACAAGTT 2020 HLA-B_#2_F2-2HLA-B_#2_F2-2 CAGCTCCCGCTGGACAAGTTCAGCTCCCGCTGGACAAGTT 2121 HLA-B_#2_R2-1HLA-B_#2_R2-1 TGTGTCGGGTCCTTCTTCCATGTGTCGGGTCCTTCTTCCA 2222 HLA-B_#2_R2-2HLA-B_#2_R2-2 TATGTCGGGTCCTTCTTCCATATGTCGGGTCCTTCTTCCA 2323 HLA-B_#3_F3HLA-B_#3_F3 GCAGCTCAGTGCACGTAAAGGCAGCTCAGTGCACGTAAAG 2424 HLA-B_#3_R3HLA-B_#3_R3 ACTTGTGTCGGGTCCTTCTTCACTTGTGTCGGGTCCTTCTTC 2525 HLA-B_#4_F4-1HLA-B_#4_F4-1 CTGGGGAGGAAACACAGGTCAGCATGGGAACCTGGGGAGGAAACACAGGTCAGCATGGGAAC 2626 HLA-B_#4_F4-2HLA-B_#4_F4-2 CTGGGGAGGGAACACAGGTCAGTGTGGGGACCTGGGGAGGGAACACAGGTCAGTGTGGGGAC 2727 HLA-B_#4_R4HLA-B_#4_R4 GGCAGACAGTGTGACAAAGAGGCGGCAGACAGTGTGACAAAGAGGC 2828 HLA-C_#1_F1-1HLA-C_#1_F1-1 GCAGCACACGATCAGGTTTCGCAGCACACGATCAGGTTTC 2929 HLA-C_#1_F1-2HLA-C_#1_F1-2 GCAGCACACAATCAGGTTTCGCAGCACACAATCAGGTTTC 3030 HLA-C_#1_R1HLA-C_#1_R1 CCCCAATTCCCACTCCCATTCCCCAATTCCCACTCCCATT 3131 HLA-C_#2_F2HLA-C_#2_F2 TGGGGACAGGGGTCACGGTGGACTGGGGACAGGGTCACGGTGGAC 3232 HLA-C_#2_R2-1HLA-C_#2_R2-1 AGTGTGACAAAGATGCTTGGTGTAGGAGAAGTGTGACAAAGATGCTTGGTGTAGGAGA 3333 HLA-C_#2_R2-2HLA-C_#2_R2-2 AGTGTGACAAAGATGCATGGTGTAGGAGAAGTGTGACAAAGATGCATGGTGTAGGAGA 3434 HLA-C_#3_F3-1HLA-C_#3_F3-1 ATTCTGGAAGGTTCTCAGGTCTTTATTTGCATTCTGGAAGGTTCTCAGGTCTTTATTTGC 3535 HLA-C_#3_F3-2HLA-C_#3_F3-2 ATTCTGGAAAGTTCTCAGGTCTTTATTTGCATTCTGGAAAGTTCTCAGGTCTTTATTTGC 3636 HLA-C_#4_F4HLA-C_#4_F4 ATCAGGTTTCTCTCTTCAGGAAGGAACAAATCAGGTTTCTCTCTTCAGGAAGGAACAA 3737 HLA-C_#5_R3-1HLA-C_#5_R3-1 GGGTTCTAGAGAAGCCAATCAGCGTCTGGGTTCTAGAGAAGCCAATCAGCGTCT 3838 HLA-C_#5_R3-2HLA-C_#5_R3-2 GGATTCTAGAGAAGCCAATCAGCGTCTGGATTCTAGAGAAGCCAATCAGCGTCT 3939 HLA-C_#8_F5HLA-C_#8_F5 TCGGGGAGGGAACACAGGTCAGTGTGGGGACTCGGGGAGGGAACACAGGTCAGTGTGGGGAC 4040 HLA-C_#8_R4HLA-C_#8_R4 TCAGGCACACAGTGTGACAAAGATTCAGGCACACAGTGTGACAAAGAT 4141 HLA-DRB1_#1_F1HLA-DRB1_#1_F1 GGGAGGCCATACGGTTTAGGGGGAGGCCATACGGTTTAGG 4242 HLA-DRB1_#1_R1HLA-DRB1_#1_R1 GCTGGCTACAATAGCTCCCCGCTGGCTACAATAGCTCCCC 4343 HLA-DRB1_#2_F2HLA-DRB1_#2_F2 TTGGAGCCAAATGGACCAGATTGGAGCCAAATGGACCAGA 4444 HLA-DRB1_#2_R2HLA-DRB1_#2_R2 TGGGTGGAGGGGTTCATAGTTGGGTGGAGGGGTTCATAGT 4545 HLA-DRB1_#3_F3-1HLA-DRB1_#3_F3-1 CCATGTGACCCATGAAGCCTCCATGTGACCCATGAAGCCT 4646 HLA-DRB1_#3_F3-2HLA-DRB1_#3_F3-2 CCACGTGACCCATGAAGCCTCCACGTGACCCATGAAGCCT 4747 HLA-DRB1_#3_R3-1HLA-DRB1_#3_R3-1 GCTGTCCGTGTCTTCTCAGGGCTGTCCGTGTCTTCTCAGG 4848 HLA-DRB1_#3_R3-2HLA-DRB1_#3_R3-2 CTGTCCGTGTCTTCTCAGGACTGTCCGTGTCTTCTCAGGA 4949 HLA-DRB1_#4_F4HLA-DRB1_#4_F4 CAGGGCAGAAAGGAGCAGAACAGGGCAGAAAGGAGCAGAA 5050 HLA-DRB1_#4_R4HLA-DRB1_#4_R4 GTCCGTGTCTTCTCAGGAGGGTCCGTGTCTTCTCAGGAGG 5151 HLA-DRB1_#5_F5HLA-DRB1_#5_F5 CTCTGCAGGCCACAAGCTATCTCTGCAGGCCACAAGCTAT 5252 HLA-DRB1_#5_R5HLA-DRB1_#5_R5 CGGGTGCTGAGCTACTATGGCGGGTGCTGAGCTACTATGG 5353 HLA-DRB1_#6_F6HLA-DRB1_#6_F6 ACCACAACCCACACCAACCAACCACAACCCACACCAACCA 5454 HLA-DRB1_#6_R6HLA-DRB1_#6_R6 TGACCCAAGTAGAAGAGATCGTGTTGACCCAAGTAGAAGAGATCGTGT 5555 HLA-DRB1_#7_F7HLA-DRB1_#7_F7 AGATTTCTCTAACACCACAACCCAAGATTTTCTCTAACACCACAACCCA 5656 HLA-DRB1_#7_R7HLA-DRB1_#7_R7 TCAGTGCTAAGAAGTGTCATCATTTCAGTGCTAAGAAGTGTCATCATT 5757 HLA-DRB1_#8_F8HLA-DRB1_#8_F8 AGGCCACAAGCTATTATGCTTTAGGCCACAAGCTATTATGCTTT 5858 HLA-DRB1_#8_R8-1HLA-DRB1_#8_R8-1 GGGAATCTTCTATTATTCTCTGCTCTGGGAATCTTCTATTATTCTCTGCTCT 5959 HLA-DRB1_#8_R8-2HLA-DRB1_#8_R8-2 TGGATATCTTCTATTATTCTCTGTTCTTGGATATCTTCTTATTATTCTCTGTTCT 6060 HLA-DRB1_#8_R8-3HLA-DRB1_#8_R8-3 TGAGATCATCCTATTATTCTCTGTTCTTGAGATCATCCTATTATTCTCTGTTCT 6161 HLA-DRB1_#8_R8-4HLA-DRB1_#8_R8-4 GAGATCATCCTATTATTCTCTGCTCTGAGATCATCCTATTATTCTCTGCTCT 6262 HLA-DRB1_#9_F9HLA-DRB1_#9_F9 AAGGAAGTGTTCACAGGGTGAAGAAGGAAGTGTTCACAGGGTGAAG 6363 HLA-DRB1_#9_F10-1HLA-DRB1_#9_F10-1 CAGAGAGTGTCTTTGGGGCTCCAGAGAGTGTCTTTGGGGCTC 6464 HLA-DRB1_#9_F10-2HLA-DRB1_#9_F10-2 CAGAGAGTGCCTTTGGGGCTCCAGAGAGTGCCTTTGGGGCTC 6565 HLA-DRB1_#9_F11HLA-DRB1_#9_F11 gAACAGGCTGGAGGTAGGGAgAACAGGCTGGAGGTAGGGA 6666 HLA-DRB1_#9_F12HLA-DRB1_#9_F12 cGCCTCAGGAAGACAGAGGAcGCCTCAGGAAGACAGAGGA 6767 HLA-DRB1_#9_F13HLA-DRB1_#9_F13 CGGGTGGGGCCAGATAGTGCGGGTGGGGCCAGATAGTG 6868 HLA-DRB1_#9_F14HLA-DRB1_#9_F14 GGTGgGTGCTGTTTAAGGgAAGGGTGgGTGCTGTTTAAGGgAAG 6969 HLA-DRB1_#9_F15HLA-DRB1_#9_F15 GCCCCTGGGCTGCTGGTCGCCCCTGGGCTGCTGGTC 7070 HLA-DRB1_#9_R9HLA-DRB1_#9_R9 CATCTTGCTCTGTGCAGATTCAGCATCTTGCTCTGTGCAGATTCAG 7171 HLA-DRB3_#1_F1HLA-DRB3_#1_F1 GCAGGCCACAAGCTATTATGCGCAGGCCACAAGCTATTATGC 7272 HLA-DRB3_#1_R1HLA-DRB3_#1_R1 ATAGTCCCCTAGGCCCCCATAGTCCCCTAGGCCCCC 7373 HLA-DRB3_#2_F2HLA-DRB3_#2_F2 TCTGCAGGCCACAAGCTATTATCTGCAGGCCACAAGCTATTA 7474 HLA-DRB3_#2_R2HLA-DRB3_#2_R2 CCCCGTTCGCCTGAGGAAACCCCGTTCGCCTGAGGAAA 7575 HLA-DRB3_#3_F3HLA-DRB3_#3_F3 CCTGTTGGCTGAAGTCCAGACCTGTTGGCTGAAGTCCAGA 7676 HLA-DRB3_#3_R3HLA-DRB3_#3_R3 GTGACCGGATCCTTCGTGTGTGACCGGATCCTTCGTGT 7777 HLA-DRB3_#4_F4HLA-DRB3_#4_F4 TCACAGTCCCAGATCTCCCATCACAGTCCCAGATCTCCCA 7878 HLA-DRB3_#4_R4HLA-DRB3_#4_R4 GTGTGACCGGATCCTTCGTGTGTGACCGGATCCTTCGT 7979 HLA-DRB3_#5_F5HLA-DRB3_#5_F5 TAACCTCAGCAAAGCTCTATTTCCTAACCTCAGCAAAGCTCTATTTCC 8080 HLA-DRB3_#5_R5HLA-DRB3_#5_R5 AATGAATCCGCTCGCCATCAAATGAATCCGCTCGCCATCA 8181 HLA-DRB3_#6_F6HLA-DRB3_#6_F6 ACTAACCTCAGCAAAGCTCTATTACTAACCTCAGCAAAGCTCTATT 8282 HLA-DRB3_#6_R6HLA-DRB3_#6_R6 GACACCTCTCTGCCATCGTTGACACCTCCTGCCATCGTT 8383 HLA-DRB3_#7_F7HLA-DRB3_#7_F7 ACTAACCTCAGCAAAGCTCTATTTCACTAACCTCAGCAAAGCTCTATTTC 8484 HLA-DRB3_#7_R7HLA-DRB3_#7_R7 AACTTCGGGAAGGACTGTGCAACTTCGGGAAGGACTGTGC 8585 HLA-DRB3_#8_F8HLA-DRB3_#8_F8 CATCTTGCTCTGTGCAGATTCAGCATCTTGCTCTGTGCAGATTCAG 8686 HLA-DRB3_#8_R8-1HLA-DRB3_#8_R8-1 AGAAGGGGTTTTCCCGCATAAGAAGGGGTTTTCCCGCATA 8787 HLA-DRB3_#8_R8-2HLA-DRB3_#8_R8-2 AGAAGGGGTTTCCCCGCATAAGAAGGGGTTTCCCCGCATA 8888 HLA-DRB4_#1_F1HLA-DRB4_#1_F1 TGACTTGCTGGCTGGTTTCTTGACTTGCTGGCTGGTTTCT 8989 HLA-DRB4_#1_R1HLA-DRB4_#1_R1 CCCATCATGCCCTCAGCTTTCCCATCATGCCCTCAGCTTT 9090 HLA-DRB4_#2_F2HLA-DRB4_#2_F2 TCTGCAGGCCACAAGCTATTTTCTGCAGGCCACAAGCTATT 9191 HLA-DRB4_#2_R2HLA-DRB4_#2_R2 ATCAGAAGGGGTTTTCCCGCATCAGAAGGGGTTTTCCCGC 9292 HLA-DRB4_#3_F3HLA-DRB4_#3_F3 CTGCCATCATTCTAGGGAAACTGCTGCCATCATTCTAGGGAAACTG 9393 HLA-DRB4_#3_R3HLA-DRB4_#3_R3 CAGGCACAAGGTCAGCACTACAGGCACAAGGTCAGCACTA 9494 HLA-DRB4_#4_F4HLA-DRB4_#4_F4 GCCATCATTCTAGGGAAACTGAATGCCATCATTCTAGGGAAACTGAAT 9595 HLA-DRB4_#4_R4HLA-DRB4_#4_R4 AAGGAACCGGTAAAGCGTGTAAGGAACCGGTAAAGCGTGT 9696 HLA-DRB4_#5_F5HLA-DRB4_#5_F5 GAAACGCAGTCTCAGACCCAGAAACGCAGTCTCAGACCCA 9797 HLA-DRB4_#5_R5HLA-DRB4_#5_R5 TACCCTTATCAGATGATATTTGCCATACCCTTATCAGATGATATTTGCCA 9898 HLA-DRB4_#6_F6HLA-DRB4_#6_F6 CACATACACAGATTCCCCGCTCCACATACACAGATTCCCCGCTC 9999 HLA-DRB4_#6_R6HLA-DRB4_#6_R6 CCCGCCCAGGGAGTCCGCCCGCCCAGGGAGTCCG 100100 HLA-DRB4_#7_F7HLA-DRB4_#7_F7 CATCTTGCTCTGTGCAGATTCAGCATCTTGCTCTGTGCAGATTCAG 101101 HLA-DRB4_#7_R7HLA-DRB4_#7_R7 TCTGTCTTCATGACTCATTCCCATCTGTCTTCATGACTCATTCCCA 102102 HLA-DRB4_#8_R8HLA-DRB4_#8_R8 ACCCTTATCAGATGATATTTGCCAACCCTTATCAGATGATATTTGCCA 103103 HLA-DRB5_#1_F1HLA-DRB5_#1_F1 CAACCAGGGCCTGAGAAAGTCAACCAGGGCCTGAGAAAGT 104104 HLA-DRB5_#1_R1HLA-DRB5_#1_R1 CAGGAAGACGGAGGATGAGCCAGGAAGACGGAGGATGAGC 105105 HLA-DRB5_#2_N-R1HLA-DRB5_#2_N-R1 CATCTTGCTCTGTGCAGATTCAGCATCTTGCTCTGTGCAGATTCAG 106106 HLA-DRB5_#2_N-F5HLA-DRB5_#2_N-F5 GATGAACGCGGTGGGAGTTAGGATGAACGCGGTGGGAGTTAG 107107 HLA-DQA1_#1_F1HLA-DQA1_#1_F1 GCTGCATCACAAGGGGATTGGCTGCATCACAAGGGGATTG 108108 HLA-DQA1_#1_R1HLA-DQA1_#1_R1 TTAGAGCCATGAGGTCGCTGTTAGAGCCATGAGGTCGCTG 109109 HLA-DQA1_#2_F2HLA-DQA1_#2_F2 CTGCATCACAAGGGGATTGCCTGCATCACAAGGGGATTGC 110110 HLA-DQA1_#2_R2HLA-DQA1_#2_R2 TCACTGATGCAGGTAGCATGGTCACTGATGCAGGTAGCATGG 111111 HLA-DQA1_#3_F3HLA-DQA1_#3_F3 TAGAGGCTGCATCACAAGGGTAGAGGCTGCATCACAAGGG 112112 HLA-DQA1_#3_R3HLA-DQA1_#3_R3 TTTAGAGCCATGAGGTCGCTGTTTAGAGCCATGAGGTCGCTG 113113 HLA-DQA1_#4_F4HLA-DQA1_#4_F4 TGCATCACAAGGGGATTGCCTGCATCACAAGGGGATTGCC 114114 HLA-DQA1_#4_R4HLA-DQA1_#4_R4 TTCTCTTACCAATCCAATCTCAGCCTTCTCTTACCAATCCAATCTCAGCC 115115 HLA-DQA1_#5_F5HLA-DQA1_#5_F5 GCCAGGGAGGGAAATCAACTGCCAGGGAGGGAAATCAACT 116116 HLA-DQA1_#5_R5-1HLA-DQA1_#5_R5-1 GCTGGGGATTTCTGAAGATATTGCTGGGGATTTCTGAAGATATT 117117 HLA-DQA1_#5_R5-2HLA-DQA1_#5_R5-2 GCTGGGGATTTCTGAAGATATCGCTGGGGATTTCTGAAGATATC 118118 HLA-DQA1_#5_R5-3HLA-DQA1_#5_R5-3 GCTGGGGATTTCTGAAGATACTGCTGGGGATTTCTGAAGATACT 119119 HLA-DQA1_#6_F6HLA-DQA1_#6_F6 CCCTAGGTAGGTGGGGTCAGCCCTAGGTAGGTGGGGTCAG 120120 HLA-DQA1_#6_R6HLA-DQA1_#6_R6 GCTGGGGATTTCTGAAGATATTGGCGCTGGGGATTTCTGAAGATATTGGC 121121 HLA-DQA1_#8_F7HLA-DQA1_#8_F7 GGTTTGGTTTGGGTGTCTTCAGATTGGTTTGGTTTGGGTGTCTTCAGATT 122122 HLA-DQA1_#8_R7HLA-DQA1_#8_R7 CACTTCCCAATTCCCCTACAACTTTCACTTCCCAATTCCCCTACAACTTT 123123 HLA-DQA1_#9_R8-1HLA-DQA1_#9_R8-1 CTGCAACAGGGCAGACATGAGATCTGCAACAGGGCAGACATGAGAT 124124 HLA-DQA1_#9_R8-2HLA-DQA1_#9_R8-2 CTGCAACAGGaCAGACATGAGATCTGCAACAGGaCAGACATGAGAT 125125 HLA-DQA1_#10_R9-1HLA-DQA1_#10_R9-1 TATGATAAATCGGGCCAGAGAATAGTGCTATATGATAAATCGGGCCAGAGAATAGTGCTA 126126 HLA-DQA1_#10_R9-2HLA-DQA1_#10_R9-2 TATGATAAATGGGGCCAGAAAATAATGCTATATGATAAATGGGGCCAGAAAATAATGCTA 127127 HLA-DQA1_#11_F8HLA-DQA1_#11_F8 AGACATGCACACACCAGAGAAGATTCAGACATGCACACACCAGAGAAGATTC 128128 HLA-DQA1_#11_R10HLA-DQA1_#11_R10 TCATCATCATGCCACTTCCCAATTCTCATCATCATGCCACTTCCCAATTC 129129 HLA-DQB1_#1_F1HLA-DQB1_#1_F1 CTCGTTGAATATCTGGAACTAGTAACTTCTCGTTGAATATCTGGAACTAGTAACTT 130130 HLA-DQB1_#1_R1HLA-DQB1_#1_R1 CTCTTCTAAAGCACATTAGTGGTGGCTCTTCTAAAGCACATTAGTGGTGG 131131 HLA-DQB1_#2_F2HLA-DQB1_#2_F2 TTTGAAACACCAGTGACCAAGGATTTTGAAACACCAGTGACCAAGGAT 132132 HLA-DQB1_#2_R2HLA-DQB1_#2_R2 TCTGCCCAGAGACAGATGAGGTTCTGCCCAGAGACAGATGAGGT 133133 HLA-DQB1_#3_F3HLA-DQB1_#3_F3 TTCTTGATCGATGTGACTTTCCAGTTCTTGATCGATGTGACTTTCCAG 134134 HLA-DQB1_#3_R3HLA-DQB1_#3_R3 CCCAGAGACAGATGAGGTCCTTCCCCAGAGACAGATGAGGTCCTTC 135135 HLA-DQB1_#4_F4HLA-DQB1_#4_F4 TTCTTGATCGATGTGACTTTCCAGATTCTTGATCGATGTGACTTTCCAGA 136136 HLA-DQB1_#4_R4HLA-DQB1_#4_R4 GACAGATGAGGTCCTTCAGCTCCGACAGATGAGGTCCTTCAGCTCC 137137 HLA-DQB1_#5_F5-1HLA-DQB1_#5_F5-1 GAAACACCAGTGACCAAGGGTCAGAAACACCAGTGACCAAGGGTCA 138138 HLA-DQB1_#5_F5-2HLA-DQB1_#5_F5-2 GAAACACCAGTGACCAAGGATCAGAAACACCAGTGACCAAGGATCA 139139 HLA-DQB1_#5_R4-1HLA-DQB1_#5_R4-1 TGCCCAGAGACAGATGAGGTCCTTGCCCAGAGACAGATGAGGTCCT 140140 HLA-DQB1_#5_R4-2HLA-DQB1_#5_R4-2 TGCCTAGAGACAGATGAGGTCCTTGCCTAGAGACAGATGAGGTCCT 141141 HLA-DQB1_#5_R4-3HLA-DQB1_#5_R4-3 TGCCCAGAGACAGATTAGGTCCTTGCCCAGAGACAGATTAGGTCCT 142142 HLA-DQB1_#6_F6HLA-DQB1_#6_F6 TTTCATGTGCTTCTCTTGAGCAGTCTTTTCATGTGCTTCTCTTGAGCAGTCT 143143 HLA-DQB1_#6_R5HLA-DQB1_#6_R5 TGACAGCAATTTTCTCTCCCCTGAATGACAGCAATTTTCTCTCCCCTGAA 144144 HLA-DQB1_#7_F7HLA-DQB1_#7_F7 GGTGGGGATGAAAGGAGATGACGGTGGGGATGAAAGGAGATGAC 145145 HLA-DQB1_#7_R4-4HLA-DQB1_#7_R4-4 TGCCTA GAGACAGATTAGGTCCTTGCCTAGAGACAGATTAGGTCCT 146146 HLA-DQB1_#7_R4-5HLA-DQB1_#7_R4-5 TGCCCAGAGACAGATGAGGTTCTTGCCCAGAGACAGATGAGGTTCT 147147 HLA-DQB1_#8_R5-1HLA-DQB1_#8_R5-1 CTGCCAGGTACATCAGATCCATCAGCTGCCAGGTACATCAGATCCATCAG 148148 HLA-DQB1_#8_R5-2HLA-DQB1_#8_R5-2 CTGCCAGCTACATCAGATCCATCAGCTGCCAGCTACATCAGATCCATCAG 149149 HLA-DQB1_#9_F8HLA-DQB1_#9_F8 AGCCCCAGCACGAAGCCTCCAGCCCCAGCACGAAGCCTCC 150150 HLA-DQB1_#9_R6-1HLA-DQB1_#9_R6-1 CGCGGGCGGTTCCACAGCTCCCGCGGGCGGTTCCACAGCTCC 151151 HLA-DQB1_#9_R6-2HLA-DQB1_#9_R6-2 CGCGGGCTGTTCCACAGCTCCCGCGGGCTGTTCCACAGCTCC 152152 HLA-DPA1_#1_F1HLA-DPA1_#1_F1 AAGCTCAGGGGCTGTGAATGGAATCAAGCTCAGGGCTGTGAATGGAATC 153153 HLA-DPA1_#1_R1HLA-DPA1_#1_R1 CATTAAACGCGTAGCATTCCTGCCGCATTAAACGCGTAGCATTCCTGCCG 154154 HLA-DPA1_#2_F2HLA-DPA1_#2_F2 TGATTTAAGTTCTCCCACATGGAGTTGATTTAAGTTCTCCCACATGGAGT 155155 HLA-DPA1_#2_R2HLA-DPA1_#2_R2 CTAAAATTCTCCCATCTCTTCCCCACTAAAATTCTCCCATCTCTTCCCCA 156156 HLA-DPA1_#3_F3-1HLA-DPA1_#3_F3-1 AATATCCTCAGACCTTTCCGTTCAAATATCCTCAGACCTTTCCGTTCA 157157 HLA-DPA1_#3_F3-2HLA-DPA1_#3_F3-2 AATATCCTCAGACCTTTCCATTCAAATATCCTCAGACCTTTCCATTCA 158158 HLA-DPA1_#3_F3-3HLA-DPA1_#3_F3-3 AATATCCTCAGACCTTTCCATTCAGAATATCCTCAGACCTTTCCATTCAG 159159 HLA-DPA1_#3_R3HLA-DPA1_#3_R3 GGAGGTGGACCTGAAAGAAAGATTAGGAGGTGGACCTGAAAGAAAGATTA 160160 HLA-DPA1_#4_F4HLA-DPA1_#4_F4 CAAATCTCTTCCCTCAGAGACTTCACAAATCTCTTCCCTCAGAGACTTCA 161161 HLA-DPA1_#4_R4HLA-DPA1_#4_R4 CATTGTTACCACAGGTAATGCTGTCCATTGTTACCACAGGTAATGCTGTC 162162 HLA-DPA1_#5_F5HLA-DPA1_#5_F5 GGTCATGGCCAGAACGCAGGTCATGGCCAGAACGCA 163163 HLA-DPA1_#5_R5HLA-DPA1_#5_R5 TCCTGTGCTCACAGTCATCAATTATAGACCTCCTGTGCTCACAGTCATCAATTATAGACC 164164 HLA-DPA1_#6_F6HLA-DPA1_#6_F6 ACATTCCCACCTTTACAGTATTTCACAGACATTCCCACCTTTACAGTATTTCACAG 165165 HLA-DPA1_#7_R6HLA-DPA1_#7_R6 CATGCGCCCTGAAGACAGAATCATGCGCCCTGAAGACAGAAT 166166 HLA-DPA1_#9_R7HLA-DPA1_#9_R7 TTGAGAGCCCTCTCCTTGGCTTTTTGAGAGCCCTCTCCTTGGCTTT 167167 HLA-DPA1_#11_F7HLA-DPA1_#11_F7 CGCAGAGACTTTATGATGAGGACCGCAGAGACTTTATGATGAGGAC 168168 HLA-DPA1_#11_R8HLA-DPA1_#11_R8 ATCAGAGCTGTGATCTTGAGAGCATCAGAGCTGTGATCTTGAGAGC 169169 HLA-DPB1_#1_F1HLA-DPB1_#1_F1 AGGCAAGACAGACAGACTCAGACCTAGGCAAGACAGACAGACTCAGACCT 170170 HLA-DPB1_#1_R1HLA-DPB1_#1_R1 TAGGTTCCCTTCATTCTGCTGGGGATAGGTTCCTTCATTCTGCTGGGGGA 171171 HLA-DPB1_#2_F2HLA-DPB1_#2_F2 TCCCTGTAGATGGGCCAGCAGAATATCCCTGTAGATGGGCCAGCAGAATA 172172 HLA-DPB1_#2_R2HLA-DPB1_#2_R2 GTGTGGCTTCTCTTTCCTGACTCCCGTGTGGCTTCTCTTTCCTGACTCCC 173173 HLA-DPB1_#3_F3HLA-DPB1_#3_F3 AACACACCCTTGGACAAAGGCAAGAAACACACCCTTGGACAAAGGCAAGA 174174 HLA-DPB1_#3_R3-1HLA-DPB1_#3_R3-1 AAGAGAGCTGCTGTGCACTGATTGTAAGAGAGCTGCTGTGCACTGATTGT 175175 HLA-DPB1_#3_R3-3HLA-DPB1_#3_R3-3 AAGAGAGCTGCTGTGCACTGATTATAAGAGAGCTGCTGTGCACTGATTAT 176176 HLA-DPB1_#3_R3-4HLA-DPB1_#3_R3-4 CAGAGAGCTGCTGTGCACTGATTGTCAGAGAGCTGCTGTGCACTGATTGT 177177 HLA-DPB1_#4_F4HLA-DPB1_#4_F4 ATGATGGTTCTGCAGGTTTCTGCATGATGGTTCTGCAGGTTTCTGC 178178 HLA-DPB1_#4_R4-1HLA-DPB1_#4_R4-1 TTGCTCCTGTTGTTTTGCATGTAGGATTGCTCTGTTGTTTTGCATGTAGGA 179179 HLA-DPB1_#4_R4-2HLA-DPB1_#4_R4-2 TTGCTCCTGTTGTTTTGCATTTAGGATTGCTCTGTTGTTTTGCATTTAGGA 180180 HLA-DPB1_#5_F5HLA-DPB1_#5_F5 AGAGAGAGCGCTTAGCTATGGAAAAGAGAAAGAGAGAGCGCTTAGCTATGGAAAAAGAGAA 181181 HLA-DPB1_#5_R5HLA-DPB1_#5_R5 AAGAAGGGAACATGGTTGGAGGCAAGAAGGGAACATGGTTGGAGGC 182182 HLA-DPB1_#6_R6HLA-DPB1_#6_R6 GGGGTTCAtGCCTGAGATTCCGGGGTTCAtGCCTGAGATTCC

본 발명에서, PCR의 주형(template)이 되는 DNA는 시험 샘플로부터 제조될 수 있다. 시험 샘플은 특별히 제한되지 않으며, 예를 들어 혈액 골수흡인생검(BMA) 등과 같은 체액 샘플, 구강 점막 등과 같은 세포를 포함한다.In the present invention, DNA serving as a template for PCR can be prepared from a test sample. The test sample is not particularly limited, and includes, for example, a body fluid sample such as blood bone marrow aspiration biopsy (BMA) and the like, cells such as oral mucosa and the like.

DNA는 프로테아제 K/페놀 추출법, 페놀/클로로포름 추출법, 알칼리 용해법, 비등법 등과 같은 공지된 방법을 사용하여 제조할 수 있다. 시판되는 DNA/RNA 추출 키트를 사용하여 미량 샘플로부터 빠르고도 간편하게 순도 높은 DNA를 제조할 수 있다.DNA can be prepared using known methods such as protease K/phenol extraction method, phenol/chloroform extraction method, alkali dissolution method, boiling method and the like. Using a commercially available DNA/RNA extraction kit, high-purity DNA can be prepared quickly and easily from trace samples.

발명의 프라이머 세트를 사용하는 HLA를 위한 PCR의 반응조건은 예를 들어 하기 조건일 수 있다:The reaction conditions of PCR for HLA using the primer set of the invention may be, for example, the following conditions:

열 변성 단계 (예컨대, 92°C 내지 98°C);a heat denaturation step (eg, 92°C to 98°C);

어닐링 단계 (예컨대, 55°C 내지 72°C); 및annealing step (eg, 55°C to 72°C); and

신장 단계 (예컨대, 65°C 내지 80°C).elongation step (eg, 65°C to 80°C).

상기 언급된 PCR에서, 어닐링 단계 및 신장 단계는 하나의 단계 (셔틀 방법(shuttle method))로 수행될 수 있거나, 또는 어닐링 온도를 더 높게 설정하고 각 사이클에서 온도를 점차적으로 낮추는 것을 포함하는 방법이 채택될 수 있다(터치다운 방법(touchdown method)). 대안적으로, 이들은 조합될 수 있다. 셔틀 방법이 수행될 때, 어닐링 단계 및 신장 단계의 온도는 전형적으로 65 내지 72 ℃이다.In the above-mentioned PCR, the annealing step and the elongation step can be carried out in one step (shuttle method), or a method comprising setting the annealing temperature higher and gradually lowering the temperature in each cycle is can be employed (touchdown method). Alternatively, they may be combined. When the shuttle method is carried out, the temperature of the annealing step and the stretching step is typically 65 to 72 °C.

상기 언급된 PCR에서, 어닐링 단계 및 신장 단계는 하나의 단계 (셔틀 방법(shuttle method))로 수행될 수 있거나, 또는 어닐링 온도를 더 높게 설정하고 각 사이클에서 온도를 점차적으로 낮추는 것을 포함하는 방법이 채택될 수 있다(터치다운 방법(touchdown method)). 대안적으로, 이들은 조합될 수 있다. 셔틀 방법이 수행될 때, 어닐링 단계 및 신장 단계의 온도는 전형적으로 65 내지 72 ℃이다.In the above-mentioned PCR, the annealing step and the elongation step can be carried out in one step (shuttle method), or a method comprising setting the annealing temperature higher and gradually lowering the temperature in each cycle is can be employed (touchdown method). Alternatively, they may be combined. When the shuttle method is carried out, the temperature of the annealing step and the stretching step is typically 65 to 72 °C.

NGS를 사용한 서열 분석의 방법은 NGS의 종류에 따라 다르며, 예를 들어 각 회사의 매뉴얼 (예컨대, NexteraR XT DNA Library Prep Reference Guide)에 따라 수행될 수 있다. 수득된 샘플을 서열 분석하기 위해 페어드-엔드 분석(Paired-end analysis)이 바람직하게 사용된다. 다음에, Illumina, Inc.의 MiSeq을 사용한 서열 분석 절차의 요약이 기재된다. 다른 장치(Life Technologies에 의해 제조된 Ion Proton, Roche Diagnostics K.K.의 GS FLX+ 등)를 사용하는 경우에도, 장치에 적합한 방법에 의해 염기서열을 유사하게 결정할 수 있다(도 2).The method of sequence analysis using NGS varies depending on the type of NGS, and may be performed according to, for example, each company's manual (eg, Nextera R XT DNA Library Prep Reference Guide). Paired-end analysis is preferably used to sequence the obtained samples. Next, a summary of the sequencing procedure using the MiSeq from Illumina, Inc. is described. Even when using other devices (Ion Proton manufactured by Life Technologies, GS FLX+ of Roche Diagnostics KK, etc.), the nucleotide sequence can be similarly determined by a method suitable for the device (FIG. 2).

1. 각 샘플의 증폭 생성물은 DNA 샘플 처리키트를 사용하여 태그멘테이션(Tagmentation)한다.1. The amplification products of each sample are tagged using a DNA sample processing kit.

2. 인덱스 키트를 사용하여, 샘플마다 다른 인덱스 서열을 수득된 단편 서열의 양측에 첨가하고 PCR을 수행한다.2. Using an index kit, index sequences different for each sample are added to both sides of the obtained fragment sequence and PCR is performed.

3. 증폭 생성물을 정제한다.3. Purify the amplification product.

4. 각 샘플로부터의 증폭 생성물을 사용하여, 라이브러리 크기(library size)를 확인한다.4. Using the amplification products from each sample, check the library size.

5. 샘플 사이의 농도를 조정한다.5. Adjust the concentration between samples.

6. 샘플의 증폭 생성물을 풀링(pooling)하고, 풀링된 증폭 생성물에 대해 정량적 PCR을 수행한다.6. Pool the amplification products of the samples and perform quantitative PCR on the pooled amplification products.

7. 풀링된 증폭 생성물을 MiSeq를 사용하여 서열분석한다.7. Sequence the pooled amplification products using MiSeq.

이러한 방식으로, HLA 유전자의 유전자형은 NGS에 의해 수득된 증폭 생성물의 염기서열 정보를 기반으로 한 데이터베이스(이후 리드)를 사용하여 결정(타이핑)될 수 있다. 데이터베이스의 예는 18,000 종류 이상의 대립유전자가 등록된 IPD-IMGT/HLA 데이터베이스를 포함한다. In this way, the genotype of the HLA gene can be determined (typed) using a database (hereinafter read) based on the nucleotide sequence information of the amplification product obtained by NGS. Examples of databases include the IPD-IMGT/HLA database in which more than 18,000 alleles are registered.

NGS에 의해 수득된 증폭 생성물의 염기서열 정보를 기반으로 한 타이핑 방법의 예는, 리드를 복수의 HLA 유전자의 대립유전자에 맵핑(mapping)하는 단계, 그의 결과를 선형 프로그래밍 문제에 적용하는 단계 및 가장 적합한 대립유전자 쌍을 검출하는 단계를 포함하는 방법(OptiType)(Szolek, A. et al., Bioinformatics, Vol. 30, pp. 3310-3316, 2014), 리드 맵핑 결과를 신규로 조립하는 단계 및 결과로부터 대립유전자를 결정하는 단계(HLA reporter) (Huang, Y. et al., Genome Med, Vol. 7, pp. 25, 2015), 항원-제시 부위의 엑손으로부터의 대립유전자 쌍과 비교하는 단계 및 후속적으로 탐색 범위를 모든 엑손으로 확장시키는 단계, 따라서 IPD-IMGT/HLA (HLA-HD)의 모든 대립유전자의 타이핑을 가능하게 하는 단계(Kawaguchi, et al., Human Mutation, Vol. 38, pp. 788-797, 2017) 등을 포함하는 방법을 포함하나, 이에 제한되지는 않는다.An example of a typing method based on the nucleotide sequence information of an amplification product obtained by NGS is mapping reads to alleles of a plurality of HLA genes, applying the results to a linear programming problem, and Method comprising detecting suitable allele pairs (OptiType) (Szolek, A. et al., Bioinformatics, Vol. 30, pp. 3310-3316, 2014), steps and results of de novo assembly of lead mapping results Determining alleles from (HLA reporter) (Huang, Y. et al., Genome Med, Vol. 7, pp. 25, 2015), comparing allele pairs from exons of the antigen-presenting site and Subsequently extending the search range to all exons, thus enabling typing of all alleles of IPD-IMGT/HLA (HLA-HD) (Kawaguchi, et al., Human Mutation, Vol. 38, pp 788-797, 2017) and the like, but are not limited thereto.

본 발명은 다른 관점에서, 상기 프라이머 세트를 사용하는 것을 특징으로 하는, HLA 유전자의 서열분석(sequencing) 방법에 관한 것이다.In another aspect, the present invention relates to a method for sequencing an HLA gene, characterized in that the primer set is used.

본 발명은 또 다른 관점에서 상기 방법에 의해 수득된 염기서열 정보를 사용하는 것을 특징으로 하는, HLA 유전자의 타이핑(typing) 방법에 관한 것이다.In another aspect, the present invention relates to a method for typing an HLA gene, characterized in that the nucleotide sequence information obtained by the above method is used.

본 발명은 또 다른 관점에서 상기 프라이머 세트를 포함하는, HLA 유전자 증폭용 키트(kit)에 관한 것이다.In another aspect, the present invention relates to a kit for amplifying the HLA gene, including the primer set.

본 발명의 키트는 상기 언급된 본 발명의 프라이머 세트 이외에 PCR에 필요한 다른 시약 및 NGS 라이브러리 제작용 시약을 포함할 수 있다. 상기 언급된 시약이 본 발명의 프라이머 세트와 공존하여 보존한 후 반응에 악영향을 미치지 않는 경우, 프라이머 세트와 혼합되어 키트에 포함될 수 있다. 대안적으로, 상기 언급된 시약 및 본 발명의 프라이머 세트는 혼합되지 않고 별도로 제공될 수 있다. 상기 언급된 시약의 예는 DNA 추출시약, DNA 폴리머라아제 효소, dNTP, 반응 완충액, PCR에서 증폭효율을 향상시키는 인헨서, 설명서 등을 포함한다. 상기 언급된 DNA 폴리머라아제 효소는 시판되는 제품일 수 있다. DNA 폴리머라아제 효소의 예는 PrimeSTAR GXL DNA 폴리머라아제, Tks Gflex DNA 폴리머라아제, Promega에 의해 제조된Go Tag, Qiagen에 의해 제조된 LongRange PCR Enzyme Mix, NEB에 의해 제조된 LongAmp Taq DNA Polymerase 및 Thermo Scientific에 의해 제조된 Long PCR Enzyme Mix를 포함하지만, 이에 제한되지는 않는다.The kit of the present invention may include other reagents required for PCR and reagents for NGS library construction in addition to the above-mentioned primer set of the present invention. If the above-mentioned reagent does not adversely affect the reaction after coexistence and preservation with the primer set of the present invention, it may be mixed with the primer set and included in the kit. Alternatively, the reagents mentioned above and the primer set of the present invention may be provided separately without being mixed. Examples of the reagents mentioned above include DNA extraction reagents, DNA polymerase enzymes, dNTPs, reaction buffers, enhancers for improving amplification efficiency in PCR, instructions, and the like. The above-mentioned DNA polymerase enzymes may be commercially available products. Examples of DNA polymerase enzymes include PrimeSTAR GXL DNA polymerase, Tks Gflex DNA polymerase, Go Tag manufactured by Promega, LongRange PCR Enzyme Mix manufactured by Qiagen, LongAmp Taq DNA Polymerase manufactured by NEB, and Long PCR Enzyme Mix manufactured by Thermo Scientific, but is not limited thereto.

이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 예시하기 위한 것으로서, 본 발명의 범위가 이들 실시예에 의해 제한되는 것으로 해석되지 않는 것은 당업계에서 통상의 지식을 가진 자에 있어서 자명할 것이다.Hereinafter, the present invention will be described in more detail through examples. These examples are only for exemplifying the present invention, and it will be apparent to those skilled in the art that the scope of the present invention is not to be construed as being limited by these examples.

실시예 1: 생체시료 분석을 위한 프라이머 제작Example 1: Preparation of primers for biological sample analysis

HLA-A/B/C, HLA-DRB1/3/4/5, DQA1, DQB1, DPA1 및 DPB1유전자의 형별을 효과적으로 분석하기 위하여, 상기 표 1과 같은 구성의 서열번호 1 내지 182의 프라이머를 제작하였다(표 3). In order to effectively analyze the types of HLA-A/B/C, HLA-DRB1/3/4/5, DQA1, DQB1, DPA1, and DPB1 genes, primers of SEQ ID NOs: 1 to 182 having the configuration shown in Table 1 above were prepared. (Table 3).

실시예 2: 제작된 프라이머를 이용한 HLA-A/B/C, HLA-DRB1/3/4/5, DQA1, DQB1, DPA1 및 DPB1의 증폭성능 확인Example 2: Confirmation of amplification performance of HLA-A/B/C, HLA-DRB1/3/4/5, DQA1, DQB1, DPA1 and DPB1 using the prepared primers

HLA-A/B/C, HLA-DRB1/3/4/5, DQA1, DQB1, DPA1 및 DPB1 유전자에 대한 157개의 표준검체(Coriell Institute, International Histocompatibility Working Group, University of California Los Angeles )의 각 HLA 유전자 좌위의 형별 분석 성능을 확인하였다. Each HLA of 157 standard samples (Coriell Institute, International Histocompatibility Working Group, University of California Los Angeles) for HLA-A/B/C, HLA-DRB1/3/4/5, DQA1, DQB1, DPA1 and DPB1 genes The typing performance of the locus was confirmed.

실험 방법은 각 샘플로부터 수득한 gDNA를 LR-PCR로 증폭하여 전기영동을 통해 증폭 유무를 확인하였으며, PCR 증폭조건은 다음과 같다:As for the experimental method, the gDNA obtained from each sample was amplified by LR-PCR, and the presence or absence of amplification was confirmed through electrophoresis, and the PCR amplification conditions were as follows:

Figure 112020093433187-pat00004
Figure 112020093433187-pat00004

한 결과를 도 3에 나타내었으며, 100% 정확도로 각 형별분석이 가능한 것을 확인하였다. A result is shown in Figure 3, and it was confirmed that each type analysis was possible with 100% accuracy.

HLA-A/B/C, HLA-DRB1 및 DQB1 유전자에 대한 165개의 임상검체(화순전남대학교병원)의 각 HLA 유전자 좌위의 형별 분석 성능을 확인한 결과를 도 4에 나타내었으며, 모두 99.4% 이상의 정확도로 각 형별분석이 가능한 것을 확인하였다. The results of confirming the typing analysis performance of each HLA gene locus of 165 clinical samples (Hwasun Chonnam National University Hospital) for the HLA-A/B/C, HLA-DRB1 and DQB1 genes are shown in FIG. 4, all with accuracy of 99.4% or more It was confirmed that each type analysis was possible.

실시예 3: 제작된 프라이머를 이용한 HLA-A/B/C, HLA-DRB1/3/4/5, DQA1, DQB1, DPA1 및 DPB1증폭 성능 확인Example 3: Confirmation of HLA-A/B/C, HLA-DRB1/3/4/5, DQA1, DQB1, DPA1 and DPB1 amplification performance using the prepared primers

HLA-A/B/C, HLA-DRB1/3/4/5, DQA1, DQB1, DPA1 및 DPB1유전자에 대하여, 실시예 1에서 제작한 프라이머 세트(HLAaccuTest)와 타사제품(Alltype NGS 키트, One lambda사)과의 비교실험을 총 5개의 세포주를 이용하여 성능을 확인하였다. For HLA-A/B/C, HLA-DRB1/3/4/5, DQA1, DQB1, DPA1 and DPB1 genes, the primer set (HLAaccuTest) prepared in Example 1 and other products (Alltype NGS kit, One lambda G), the performance was confirmed using a total of 5 cell lines.

실험 방법은 각 샘플로부터 수득한 gDNA를 LR-PCR로 증폭하여 전기영동을 통해 증폭 유무를 확인하였으며, PCR 증폭조건은 실시예 2와 같다:As for the experimental method, the gDNA obtained from each sample was amplified by LR-PCR, and the presence or absence of amplification was confirmed through electrophoresis, and the PCR amplification conditions were the same as in Example 2:

그 결과, 도 5에 기재된 바와 같이, One lambda사의 키트를 사용한 경우, 특정 검체에서 HLA 유전자가 증폭되지 않았으나, 본 발명의 프라이머 세트를 사용한 경우(HLAaccuTest)는 absence locus인 DRB5를 제외하고는 모든 유전자가 증폭되는 것을 확인하였다. As a result, as shown in FIG. 5, when using One lambda's kit, the HLA gene was not amplified in a specific sample, but when using the primer set of the present invention (HLAaccuTest), all genes except for DRB5, an absence locus, were not amplified. was confirmed to be amplified.

실시예 4: 대립유전자(allele) 특이적 PCR 산물의 바이어스 최소화에 따른 대립유전자 비율(allele balance)의 향상Example 4: Improvement of allele balance by minimizing bias of allele-specific PCR products

HLA의 11개 유전자좌 중 HLA-DRB1와 HLA-DQB1의 경우는 유전형(genotype)에 따라, 인트론(intron) 내에 긴 삽입부위(large-insertion)가 존재하는 경우가 있다 [표 5]. 이러한 긴 삽입부위는 상기 두 유전자좌를 PCR로 증폭하는 경우, PCR 산물의 크기의 차이가 유전형 별로 심하게 차이(PCR bias)가 나게 된다. Among the 11 loci of HLA, in the case of HLA-DRB1 and HLA-DQB1, depending on the genotype, a large-insertion may exist in the intron [Table 5]. When the two loci are amplified by PCR, such a long insertion site causes a severe difference (PCR bias) in the size of the PCR product for each genotype.

Figure 112020093433187-pat00005
Figure 112020093433187-pat00005

본 실시예에서는 본 발명에 따른 HLAaccuTest 프라이머 세트와 NGSgo 키트(GenDx 사)를 사용하여, 165개의 임상검체에 대한 DRB1, DQB1 대립유전자에 대한 PCR을 실시하여, allele balance를 비교분석하였다. In this example, PCR was performed on the DRB1 and DQB1 alleles of 165 clinical samples using the HLAaccuTest primer set according to the present invention and the NGSgo kit (GenDx), and allele balance was compared and analyzed.

그 결과, 도 6에 나타난 바와 같이, 본 발명에 따른 HLAaccuTest 프라이머 셋트를 사용한 경우, HLA-DRB1와 HLA-DQB1 유전자좌의 PCR 산물의 PCR bias가 NGSgo 키트(GenDx 사)를 사용한 경우보다 적어, Heterozygote 형별에 대해 안정적인 allele balance를 확보할 수 있는 것을 확인하였다.As a result, as shown in FIG. 6, when the HLAaccuTest primer set according to the present invention was used, the PCR bias of the PCR products of the HLA-DRB1 and HLA-DQB1 loci was less than when using the NGSgo kit (GenDx), resulting in heterozygote detection. It was confirmed that a stable allele balance could be secured for

실시예 5: 유전자 타겟 영역 확장에 따른 모호성 감소Example 5: Ambiguity Reduction by Gene Target Region Expansion

HLA의 11개 유전자 좌위 중 DQB1과 DPB1의 경우, 기존의 타사 제품인 NGSgo 키트(GenDx 사)와 Alltype NGS 키트(One lambda사)의 경우, PCR에 의하여 증폭되는 엑손의 타겟 영역이 좁아 검출 시, 엑손 모호성(exon ambiguity) rate가 높았다. 본 발명의 HLAaccuTest 프라이머 셋트는 DQB1과 DPB1의 전체 Exon을 타겟팅하고 있다(도 7). 따라서, HLA-DQB1/DPB1 타이핑 시에 엑손 모호성을 감소시킬 수 있다. In the case of DQB1 and DPB1 among the 11 loci of HLA, in the case of NGSgo kit (GenDx) and Alltype NGS kit (One lambda), which are existing third-party products, the target region of exons amplified by PCR is narrow, so when detecting exons The exon ambiguity rate was high. The HLAaccuTest primer set of the present invention targets the entire exon of DQB1 and DPB1 (FIG. 7). Thus, exon ambiguity can be reduced in HLA-DQB1/DPB1 typing.

이를 확인하기 위하여, 질병관리본부에서 제공받은 96개 검체에서 분리한 gDNA를 대상으로 하여, 본 발명의 HLAaccuTest 키트와 Alltype NGS 키트(One lambda사)를 사용하여 HLA-DQB1/DPB1 타이핑을 실시하였다.To confirm this, HLA-DQB1/DPB1 typing was performed using the HLAaccuTest kit of the present invention and the Alltype NGS kit (One lambda) for gDNA isolated from 96 samples provided by the Centers for Disease Control and Prevention.

그 결과, 표 6에 나타난 바와 같이, HLAaccuTest 키트를 사용한 결과가 엑손 모호성이 감소된 것을 확인할 수 있었다. As a result, as shown in Table 6, it was confirmed that the exon ambiguity was reduced as a result of using the HLAaccuTest kit.

Figure 112020093433187-pat00006
Figure 112020093433187-pat00006

이상으로 본 발명 내용의 특정한 부분을 상세히 기술하였는바, 당업계의 통상의 지식을 가진 자에게 있어서, 이러한 구체적 기술은 단지 구체적인 실시양태일 뿐이며, 이에 의해 본 발명의 범위가 제한되는 것이 아닌 점은 명백할 것이다. 따라서 본 발명의 실질적인 범위는 첨부된 청구항들과 그것들의 등가물에 의하여 정의된다고 할 것이다. Having described specific parts of the present invention in detail above, it is clear to those skilled in the art that these specific descriptions are only specific embodiments, and the scope of the present invention is not limited thereby. something to do. Accordingly, the substantial scope of the present invention will be defined by the appended claims and their equivalents.

<110> NGeneBio <120> Composition for Amplifying HLA genes and Uses thereof <130> P20-B026 <160> 182 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HLA-A_#1_F1 <400> 1 tctccctctc ccaacctacg 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HLA-A_#1_R1 <400> 2 cccctgcaac aaatcagcac 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HLA-A_#2_F2-1 <400> 3 attgggtgtc gggtttccag 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HLA-A_#2_F2-2 <400> 4 attgggtgtc gggtttctag 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HLA-A_#2_R2-1 <400> 5 tggccagaac agaaactggg 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HLA-A_#2_R2-2 <400> 6 tggcccgaac agaaactggg 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HLA-A_#2_R2-3 <400> 7 tggccagaac agaaactagg 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HLA-A_#3_F3-1 <400> 8 cgaaggcggt gtatggattg 20 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HLA-A_#3_F3-2 <400> 9 cgaaggcggt atatggattg 20 <210> 10 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> HLA-A_#3_R3 <400> 10 ctctcctccc ctgcaacaaa t 21 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HLA-A_#4_F4 <400> 11 tggatactca cgacgcggac 20 <210> 12 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> HLA-A_#4_R4 <400> 12 ttgcagaaac aaagtcaggg ttcttcaagt 30 <210> 13 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> HLA-A_#5_R5-1 <400> 13 gtcagggttc ttcaagtcac aaaggga 27 <210> 14 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> HLA-A_#5_R5-2 <400> 14 gtcagggtac ttcaagtcac aaaggga 27 <210> 15 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> AHL-A_#6_F5 <400> 15 tggatactca cgacgcggac ccag 24 <210> 16 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> HLA-A_#6_R6 <400> 16 gcaggtgcct ttgcagaaac aaag 24 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HLA-B_#1_F1 <400> 17 caacaccaaa tgggcacagg 20 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HLA-B_#1_R1 <400> 18 cccactcccc tgagtttcac 20 <210> 19 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HLA-B_#2_F2-1 <400> 19 cagctcccac tggacaagtt 20 <210> 20 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HLA-B_#2_F2-2 <400> 20 cagctcccgc tggacaagtt 20 <210> 21 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HLA-B_#2_R2-1 <400> 21 tgtgtcgggt ccttcttcca 20 <210> 22 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HLA-B_#2_R2-2 <400> 22 tatgtcgggt ccttcttcca 20 <210> 23 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HLA-B_#3_F3 <400> 23 gcagctcagt gcacgtaaag 20 <210> 24 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> HLA-B_#3_R3 <400> 24 acttgtgtcg ggtccttctt c 21 <210> 25 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> HLA-B_#4_F4-1 <400> 25 ctggggagga aacacaggtc agcatgggaa c 31 <210> 26 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> HLA-B_#4_F4-2 <400> 26 ctggggaggg aacacaggtc agtgtgggga c 31 <210> 27 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> HLA-B_#4_R4 <400> 27 ggcagacagt gtgacaaaga ggc 23 <210> 28 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HLA-C_#1_F1-1 <400> 28 gcagcacacg atcaggtttc 20 <210> 29 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HLA-C_#1_F1-2 <400> 29 gcagcacaca atcaggtttc 20 <210> 30 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HLA-C_#1_R1 <400> 30 ccccaattcc cactcccatt 20 <210> 31 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> HLA-C_#2_F2 <400> 31 tggggacagg ggtcacggtg gac 23 <210> 32 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> HLA-C_#2_R2-1 <400> 32 agtgtgacaa agatgcttgg tgtaggaga 29 <210> 33 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> HLA-C_#2_R2-2 <400> 33 agtgtgacaa agatgcatgg tgtaggaga 29 <210> 34 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> HLA-C_#3_F3-1 <400> 34 attctggaag gttctcaggt ctttatttgc 30 <210> 35 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> HLA-C_#3_F3-2 <400> 35 attctggaaa gttctcaggt ctttatttgc 30 <210> 36 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> HLA-C_#4_F4 <400> 36 atcaggtttc tctcttcagg aaggaacaa 29 <210> 37 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> HLA-C_#5_R3-1 <400> 37 gggttctaga gaagccaatc agcgtct 27 <210> 38 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> HLA-C_#5_R3-2 <400> 38 ggattctaga gaagccaatc agcgtct 27 <210> 39 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> HLA-C_#8_F5 <400> 39 tcggggaggg aacacaggtc agtgtgggga c 31 <210> 40 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> HLA-C_#8_R4 <400> 40 tcaggcacac agtgtgacaa agat 24 <210> 41 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HLA-DRB1_#1_F1 <400> 41 gggaggccat acggtttagg 20 <210> 42 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HLA-DRB1_#1_R1 <400> 42 gctggctaca atagctcccc 20 <210> 43 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HLA-DRB1_#2_F2 <400> 43 ttggagccaa atggaccaga 20 <210> 44 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HLA-DRB1_#2_R2 <400> 44 tgggtggagg ggttcatagt 20 <210> 45 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HLA-DRB1_#3_F3-1 <400> 45 ccatgtgacc catgaagcct 20 <210> 46 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HLA-DRB1_#3_F3-2 <400> 46 ccacgtgacc catgaagcct 20 <210> 47 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HLA-DRB1_#3_R3-1 <400> 47 gctgtccgtg tcttctcagg 20 <210> 48 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HLA-DRB1_#3_R3-2 <400> 48 ctgtccgtgt cttctcagga 20 <210> 49 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HLA-DRB1_#4_F4 <400> 49 cagggcagaa aggagcagaa 20 <210> 50 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HLA-DRB1_#4_R4 <400> 50 gtccgtgtct tctcaggagg 20 <210> 51 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HLA-DRB1_#5_F5 <400> 51 ctctgcaggc cacaagctat 20 <210> 52 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HLA-DRB1_#5_R5 <400> 52 cgggtgctga gctactatgg 20 <210> 53 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HLA-DRB1_#6_F6 <400> 53 accacaaccc acaccaacca 20 <210> 54 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> HLA-DRB1_#6_R6 <400> 54 tgacccaagt agaagagatc gtgt 24 <210> 55 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> HLA-DRB1_#7_F7 <400> 55 agatttctct aacaccacaa ccca 24 <210> 56 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> HLA-DRB1_#7_R7 <400> 56 tcagtgctaa gaagtgtcat catt 24 <210> 57 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> HLA-DRB1_#8_F8 <400> 57 aggccacaag ctattatgct tt 22 <210> 58 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> HLA-DRB1_#8_R8-1 <400> 58 gggaatcttc tattattctc tgctct 26 <210> 59 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> HLA-DRB1_#8_R8-2 <400> 59 tggatatctt ctattattct ctgttct 27 <210> 60 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> HLA-DRB1_#8_R8-3 <400> 60 tgagatcatc ctattattct ctgttct 27 <210> 61 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> HLA-DRB1_#8_R8-4 <400> 61 gagatcatcc tattattctc tgctct 26 <210> 62 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> HLA-DRB1_#9_F9 <400> 62 aaggaagtgt tcacagggtg aag 23 <210> 63 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> HLA-DRB1_#9_F10-1 <400> 63 cagagagtgt ctttggggct c 21 <210> 64 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> HLA-DRB1_#9_F10-2 <400> 64 cagagagtgc ctttggggct c 21 <210> 65 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HLA-DRB1_#9_F11 <400> 65 gaacaggctg gaggtaggga 20 <210> 66 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HLA-DRB1_#9_F12 <400> 66 cgcctcagga agacagagga 20 <210> 67 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> HLA-DRB1_#9_F13 <400> 67 cgggtggggc cagatagtg 19 <210> 68 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> HLA-DRB1_#9_F14 <400> 68 ggtgggtgct gtttaaggga ag 22 <210> 69 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> HLA-DRB1_#9_F15 <400> 69 gcccctgggc tgctggtc 18 <210> 70 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> HLA-DRB1_#9_R9 <400> 70 catcttgctc tgtgcagatt cag 23 <210> 71 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> HLA-DRB3_#1_F1 <400> 71 gcaggccaca agctattatg c 21 <210> 72 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> HLA-DRB3_#1_R1 <400> 72 atagtcccct aggccccc 18 <210> 73 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> HLA-DRB3_#2_F2 <400> 73 tctgcaggcc acaagctatt a 21 <210> 74 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> HLA-DRB3_#2_R2 <400> 74 ccccgttcgc ctgaggaaa 19 <210> 75 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HLA-DRB3_#3_F3 <400> 75 cctgttggct gaagtccaga 20 <210> 76 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> HLA-DRB3_#3_R3 <400> 76 gtgaccggat ccttcgtgt 19 <210> 77 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HLA-DRB3_#4_F4 <400> 77 tcacagtccc agatctccca 20 <210> 78 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> HLA-DRB3_#4_R4 <400> 78 gtgtgaccgg atccttcgt 19 <210> 79 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> HLA-DRB3_#5_F5 <400> 79 taacctcagc aaagctctat ttcc 24 <210> 80 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HLA-DRB3_#5_R5 <400> 80 aatgaatccg ctcgccatca 20 <210> 81 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> HLA-DRB3_#6_F6 <400> 81 actaacctca gcaaagctct att 23 <210> 82 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HLA-DRB4_#2_F2 <400> 82 gacacctctc tgccatcgtt 20 <210> 83 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> HLA-DRB3_#7_F7 <400> 83 actaacctca gcaaagctct atttc 25 <210> 84 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HLA-DRB3_#7_R7 <400> 84 aacttcggga aggactgtgc 20 <210> 85 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> HLA-DRB3_#8_F8 <400> 85 catcttgctc tgtgcagatt cag 23 <210> 86 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HLA-DRB3_#8_R8-1 <400> 86 agaaggggtt ttcccgcata 20 <210> 87 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HLA-DRB3_#8_R8-2 <400> 87 agaaggggtt tccccgcata 20 <210> 88 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HLA-DRB4_#1_F1 <400> 88 tgacttgctg gctggtttct 20 <210> 89 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HLA-DRB4_#1_R1 <400> 89 cccatcatgc cctcagcttt 20 <210> 90 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HLA-DRB4_#2_F2 <400> 90 tctgcaggcc acaagctatt 20 <210> 91 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HLA-DRB4_#2_R2 <400> 91 atcagaaggg gttttcccgc 20 <210> 92 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> HLA-DRB4_#3_F3 <400> 92 ctgccatcat tctagggaaa ctg 23 <210> 93 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HLA-DRB4_#3_R3 <400> 93 caggcacaag gtcagcacta 20 <210> 94 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> HLA-DRB4_#4_F4 <400> 94 gccatcattc tagggaaact gaat 24 <210> 95 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HLA-DRB4_#4_R4 <400> 95 aaggaaccgg taaagcgtgt 20 <210> 96 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HLA-DRB4_#5_F5 <400> 96 gaaacgcagt ctcagaccca 20 <210> 97 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> HLA-DRB4_#5_R5 <400> 97 tacccttatc agatgatatt tgcca 25 <210> 98 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> HLA-DRB4_#6_F6 <400> 98 cacatacaca gattccccgc tc 22 <210> 99 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> HLA-DRB4_#6_R6 <400> 99 cccgcccagg gagtccg 17 <210> 100 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> HLA-DRB4_#7_F7 <400> 100 catcttgctc tgtgcagatt cag 23 <210> 101 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> HLA-DRB4_#7_R7 <400> 101 tctgtcttca tgactcattc cca 23 <210> 102 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> HLA-DRB4_#8_R8 <400> 102 acccttatca gatgatattt gcca 24 <210> 103 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HLA-DRB5_#1_F1 <400> 103 caaccagggc ctgagaaagt 20 <210> 104 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HLA-DRB5_#1_R1 <400> 104 caggaagacg gaggatgagc 20 <210> 105 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> HLA-DRB5_#2_N-R1 <400> 105 catcttgctc tgtgcagatt cag 23 <210> 106 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> HLA-DRB5_#2_N-F5 <400> 106 gatgaacgcg gtgggagtta g 21 <210> 107 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HLA-DQA1_#1_F1 <400> 107 gctgcatcac aaggggattg 20 <210> 108 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HLA-DQA1_#1_R1 <400> 108 ttagagccat gaggtcgctg 20 <210> 109 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HLA-DQA1_#2_F2 <400> 109 ctgcatcaca aggggattgc 20 <210> 110 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> HLA-DQA1_#2_R2 <400> 110 tctgtcttca tgactcattc cca 23 <210> 111 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HLA-DQA1_#3_F3 <400> 111 tagaggctgc atcacaaggg 20 <210> 112 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> HLA-DQA1_#3_R3 <400> 112 tttagagcca tgaggtcgct g 21 <210> 113 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HLA-DQA1_#4_F4 <400> 113 tgcatcacaa ggggattgcc 20 <210> 114 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> HLA-DQA1_#4_R4 <400> 114 ttctcttacc aatccaatct cagcc 25 <210> 115 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HLA-DQA1_#5_F5 <400> 115 gccagggagg gaaatcaact 20 <210> 116 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> HLA-DQA1_#5_R5-1 <400> 116 gctggggatt tctgaagata tt 22 <210> 117 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> HLA-DQA1_#5_R5-2 <400> 117 gctggggatt tctgaagata tc 22 <210> 118 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> HLA-DQA1_#5_R5-3 <400> 118 gctggggatt tctgaagata ct 22 <210> 119 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HLA-DQA1_#6_F6 <400> 119 ccctaggtag gtggggtcag 20 <210> 120 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> HLA-DQA1_#6_R6 <400> 120 gctggggatt tctgaagata ttggc 25 <210> 121 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> HLA-DQA1_#8_F7 <400> 121 ggtttggttt gggtgtcttc agatt 25 <210> 122 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> HLA-DQA1_#8_R7 <400> 122 cacttcccaa ttcccctaca acttt 25 <210> 123 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> HLA-DQA1_#9_R8-1 <400> 123 ctgcaacagg gcagacatga gat 23 <210> 124 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> HLA-DQA1_#9_R8-2 <400> 124 ctgcaacagg acagacatga gat 23 <210> 125 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> HLA-DQA1_#10_R9-1 <400> 125 tatgataaat cgggccagag aatagtgcta 30 <210> 126 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> HLA-DQA1_#10_R9-2 <400> 126 tatgataaat ggggccagaa aataatgcta 30 <210> 127 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> HLA-DQA1_#11_F8 <400> 127 agacatgcac acaccagaga agattc 26 <210> 128 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> HLA-DQA1_#11_R10 <400> 128 tcatcatcat gccacttccc aattc 25 <210> 129 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> HLA-DQB1_#1_F1 <400> 129 ctcgttgaat atctggaact agtaactt 28 <210> 130 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> HLA-DQB1_#1_R1 <400> 130 ctcttctaaa gcacattagt ggtgg 25 <210> 131 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> HLA-DQB1_#2_F2 <400> 131 tttgaaacac cagtgaccaa ggat 24 <210> 132 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> HLA-DQB1_#2_R2 <400> 132 tctgcccaga gacagatgag gt 22 <210> 133 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> HLA-DQB1_#3_F3 <400> 133 ttcttgatcg atgtgacttt ccag 24 <210> 134 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> HLA-DQB1_#3_R3 <400> 134 cccagagaca gatgaggtcc ttc 23 <210> 135 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> HLA-DQB1_#4_F4 <400> 135 ttcttgatcg atgtgacttt ccaga 25 <210> 136 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> HLA-DQB1_#4_R4 <400> 136 gacagatgag gtccttcagc tcc 23 <210> 137 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> HLA-DQB1_#5_F5-1 <400> 137 gaaacaccag tgaccaaggg tca 23 <210> 138 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> HLA-DQB1_#5_F5-2 <400> 138 gaaacaccag tgaccaagga tca 23 <210> 139 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> HLA-DQB1_#5_R4-1 <400> 139 tgcccagaga cagatgaggt cct 23 <210> 140 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> HLA-DQB1_#5_R4-2 <400> 140 tgcctagaga cagatgaggt cct 23 <210> 141 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> HLA-DQB1_#5_R4-3 <400> 141 tgcccagaga cagattaggt cct 23 <210> 142 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> HLA-DQB1_#6_F6 <400> 142 tttcatgtgc ttctcttgag cagtct 26 <210> 143 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> HLA-DQB1_#6_R5 <400> 143 tttcatgtgc ttctcttgag cagtct 26 <210> 144 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> HLA-DQB1_#7_F7 <400> 144 ggtggggatg aaaggagatg ac 22 <210> 145 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> HLA-DQB1_#7_R4-4 <400> 145 tgcctagaga cagattaggt cct 23 <210> 146 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> HLA-DQB1_#7_R4-5 <400> 146 tgcccagaga cagatgaggt tct 23 <210> 147 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> HLA-DQB1_#8_R5-1 <400> 147 ctgccaggta catcagatcc atcag 25 <210> 148 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> HLA-DQB1_#8_R5-2 <400> 148 ctgccagcta catcagatcc atcag 25 <210> 149 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HLA-DQB1_#9_F8 <400> 149 agccccagca cgaagcctcc 20 <210> 150 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> HLA-DQB1_#9_R6-1 <400> 150 cgcgggcggt tccacagctc c 21 <210> 151 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> HLA-DQB1_#9_R6-2 <400> 151 cgcgggctgt tccacagctc c 21 <210> 152 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> HLA-DPA1_#1_F1 <400> 152 aagctcaggg gctgtgaatg gaatc 25 <210> 153 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> HLA-DPA1_#1_R1 <400> 153 cattaaacgc gtagcattcc tgccg 25 <210> 154 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> HLA-DPA1_#2_F2 <400> 154 tgatttaagt tctcccacat ggagt 25 <210> 155 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> HLA-DPA1_#2_R2 <400> 155 ctaaaattct cccatctctt cccca 25 <210> 156 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> HLA-DPA1_#3_F3-1 <400> 156 aatatcctca gacctttccg ttca 24 <210> 157 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> HLA-DPA1_#3_F3-2 <400> 157 aatatcctca gacctttcca ttca 24 <210> 158 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> HLA-DPA1_#3_F3-3 <400> 158 aatatcctca gacctttcca ttcag 25 <210> 159 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> HLA-DPA1_#3_R3 <400> 159 ggaggtggac ctgaaagaaa gatta 25 <210> 160 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> HLA-DPA1_#4_F4 <400> 160 caaatctctt ccctcagaga cttca 25 <210> 161 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> HLA-DPA1_#4_R4 <400> 161 cattgttacc acaggtaatg ctgtc 25 <210> 162 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> HLA-DPA1_#5_F5 <400> 162 ggtcatggcc agaacgca 18 <210> 163 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> HLA-DPA1_#5_R5 <400> 163 tcctgtgctc acagtcatca attatagacc 30 <210> 164 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> HLA-DPA1_#6_F6 <400> 164 acattcccac ctttacagta tttcacag 28 <210> 165 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> HLA-DPA1_#7_R6 <400> 165 catgcgccct gaagacagaa t 21 <210> 166 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> HLA-DPA1_#9_R7 <400> 166 ttgagagccc tctccttggc ttt 23 <210> 167 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> HLA-DPA1_#11_F7 <400> 167 cgcagagact ttatgatgag gac 23 <210> 168 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> HLA-DPA1_#11_R8 <400> 168 atcagagctg tgatcttgag agc 23 <210> 169 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> HLA-DPB1_#1_F1 <400> 169 aggcaagaca gacagactca gacct 25 <210> 170 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> HLA-DPB1_#1_R1 <400> 170 taggttccct tcattctgct gggga 25 <210> 171 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> HLA-DPB1_#2_F2 <400> 171 tccctgtaga tgggccagca gaata 25 <210> 172 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> HLA-DPB1_#2_R2 <400> 172 gtgtggcttc tctttcctga ctccc 25 <210> 173 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> HLA-DPB1_#3_F3 <400> 173 aacacaccct tggacaaagg caaga 25 <210> 174 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> HLA-DPB1_#3_R3-1 <400> 174 aagagagctg ctgtgcactg attgt 25 <210> 175 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> HLA-DPB1_#3_R3-3 <400> 175 aagagagctg ctgtgcactg attat 25 <210> 176 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> HLA-DPB1_#3_R3-4 <400> 176 cagagagctg ctgtgcactg attgt 25 <210> 177 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> HLA-DPB1_#4_F4 <400> 177 atgatggttc tgcaggtttc tgc 23 <210> 178 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> HLA-DPB1_#4_R4-1 <400> 178 ttgctcctgt tgttttgcat gtagga 26 <210> 179 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> HLA-DPB1_#4_R4-2 <400> 179 ttgctcctgt tgttttgcat ttagga 26 <210> 180 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> HLA-DPB1_#5_F5 <400> 180 agagagagcg cttagctatg gaaaagagaa 30 <210> 181 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> HLA-DPB1_#5_R5 <400> 181 aagaagggaa catggttgga ggc 23 <210> 182 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> HLA-DPB1_#6_R6 <400> 182 ggggttcatg cctgagattc c 21 <110> NGeneBio <120> Composition for Amplifying HLA genes and Uses thereof <130> P20-B026 <160> 182 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HLA-A_#1_F1 <400> 1 tctccctctc ccaacctacg 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HLA-A_#1_R1 <400> 2 cccctgcaac aaatcagcac 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HLA-A_#2_F2-1 <400> 3 attgggtgtc gggtttccag 20 <210> 4 <211> 20 <212> DNA < 213> Artificial Sequence <220> <223> HLA-A_#2_F2-2 <400> 4 attgggtgtc gggtttctag 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HLA-A_ #2_R2-1 <400> 5 tggccagaac agaaactggg 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HLA-A_#2_R2-2 <400> 6 tggcccgaac agaaactggg 20 <210 > 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HLA-A_#2_R2-3 <400> 7 tggccagaac agaaactagg 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HLA-A_#3_F3-1 <400> 8 cgaaggcggt g tatggattg 20 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HLA-A_#3_F3-2 <400> 9 cgaaggcggt atatggattg 20 <210> 10 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> HLA-A_#3_R3 <400> 10 ctctcctccc ctgcaacaaa t 21 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HLA- A_#4_F4 <400> 11 tggatactca cgacgcggac 20 <210> 12 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> HLA-A_#4_R4 <400> 12 ttgcagaaac aaagtcaggg ttcttcaagt 30 <210> 13 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> HLA-A_#5_R5-1 <400> 13 gtcagggttc ttcaagtcac aaaggga 27 <210> 14 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> HLA-A_#5_R5-2 <400> 14 gtcagggtac ttcaagtcac aaaggga 27 <210> 15 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> AHL-A_#6_F5 <400> 15 tggatactca cgacgcggac ccag 24 <210> 16 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> HLA-A_#6_R6 <400> 16 gcaggtgcct ttgcagaaac aaag 24 <210> 17 <211 > 20 <212> DNA <213> Artificial Seq uence <220> <223> HLA-B_#1_F1 <400> 17 caacaccaaa tgggcacagg 20 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HLA-B_#1_R1 <400> 18 cccactcccc tgagtttcac 20 <210> 19 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HLA-B_#2_F2-1 <400> 19 cagctcccac tggacaagtt 20 <210> 20 <211> 20 < 212> DNA <213> Artificial Sequence <220> <223> HLA-B_#2_F2-2 <400> 20 cagctcccgc tggacaagtt 20 <210> 21 <211> 20 <212> DNA <213> Artificial Sequence <220> <223 > HLA-B_#2_R2-1 <400> 21 tgtgtcgggt ccttcttcca 20 <210> 22 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HLA-B_#2_R2-2 <400> 22 tatgtcgggt ccttcttcca 20 <210> 23 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HLA-B_#3_F3 <400> 23 gcagctcagt gcacgtaaag 20 <210> 24 <211> 21 <212> DNA < 213> Artificial Sequence <220> <223> HLA-B_#3_R3 <400> 24 acttgtgtcg ggtccttctt c 21 <210> 25 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> HLA-B_# 4_F4-1 <400> 25 ctggggagga aacacaggtc agcatgggaa c 31 <210> 26 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> HLA-B_#4_F4-2 <400> 26 ctggggaggg aacacaggtc agtgtgggga c 31 <210> 27 <211> 23 <212> DNA <213> Artificial Sequence < 220> <223> HLA-B_#4_R4 <400> 27 ggcagacagt gtgacaaaga ggc 23 <210> 28 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HLA-C_#1_F1-1 <400 > 28 gcagcacacg atcaggtttc 20 <210> 29 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HLA-C_#1_F1-2 <400> 29 gcagcacaca atcaggtttc 20 <210> 30 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HLA-C_#1_R1 <400> 30 ccccaattcc cactcccatt 20 <210> 31 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> HLA-C_#2_F2 <400> 31 tggggacagg ggtcacggtg gac 23 <210> 32 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> HLA-C_ #2_R2-1 <400> 32 agtgtgacaa agatgcttgg tgtaggaga 29 <210> 33 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> HLA-C_#2_R2-2 <400> 33 agtgtgacaa agatgcatgg tgtaggaga 29 <210> 34 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> HLA-C_#3_F3-1 <400> 34 attctggaag gttctcaggt ctttattgc 30 <210> 35 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> HLA-C_#3_F3-2 <400> 35 attctggaaa gttctcaggt ctttatttgc 30 <210> 36 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> HLA -C_#4_F4 <400> 36 atcaggtttc tctcttcagg aaggaacaa 29 <210> 37 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> HLA-C_#5_R3-1 <400> 37 gggttctaga gaagccaatc agcgtct 27 <210> 38 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> HLA-C_#5_R3-2 <400> 38 ggattctaga gaagccaatc agcgtct 27 <210> 39 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> HLA-C_#8_F5 <400> 39 tcggggaggg aacacaggtc agtgtgggga c 31 <210> 40 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> HLA-C_#8_R4 <400> 40 tcaggcacac agtgtgacaa agat 24 <210> 41 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HLA-DRB1_#1_F1 <400> 41 gggaggccat acggtttagg 20 <210> 42 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HLA-DRB1_#1_R1 <400> 42 gctggctaca atagctcccc 20 <210> 43 <211> 20 <212> DNA <213> Artificial Sequence <220> <223 > HLA-DRB1_#2_F2 <400> 43 ttggagccaa atggaccaga 20 <210> 44 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HLA-DRB1_#2_R2 <400> 44 tgggtggagg ggttcatagt 20 <210 > 45 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HLA-DRB1_#3_F3-1 <400> 45 ccatgtgacc catgaagcct 20 <210> 46 <211> 20 <212> DNA <213> Artificial Sequence <220> <223 > HLA-DRB1_#3_F3-2 <400> 46 ccacgtgacc catgaagcct 20 <210> 47 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HLA-DRB1_#3_R3-1 <400> 47 gctgtccgtg tcttctcagg 20 <210> 48 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HLA-DRB1_#3_R3-2 <400> 48 ctgtccgtgt cttctcagga 20 <210> 49 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HLA-DRB1_#4_F4 <400> 49 cagggcagaa aggagcagaa 20 <210> 50 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HLA-DRB1_ #4_R4 <400> 50 gtccgtgtct tctcaggagg 20 <210> 51 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HLA-DRB1_#5_F5 <400> 51 ctctgcaggc cacaagctat 20 <210> 52 <211 > 20 <212> DNA <213> Artificial Sequence <220> <223> HLA-DRB1_#5_R5 <400> 52 cgggtgctga gctactatgg 20 <210> 53 <211> 20 <212> DNA <213> Artificial Sequence <220> < 223> HLA-DRB1_#6_F6 <400> 53 accacaaccc acaccaacca 20 <210> 54 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> HLA-DRB1_#6_R6 <400> 54 tgacccaagt agaagagatc gtgt 24 <210> 55 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> HLA-DRB1_#7_F7 <400> 55 agatttctct aacaccacaa ccca 24 <210> 56 <211> 24 <212> DNA <213> Artificial Sequence <220> <223 > HLA-DRB1_#7_R7 <400> 56 tcagtgctaa gaagtgtcat catt 24 <210> 57 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> HLA-DRB1_#8_F8 <400> 57 aggccacaag ctattatgct tt 22 <210> 58 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> HLA-DRB1_#8_R8-1 <400> 58 gggaatcttc tattattctc tgctct 26 <210> 59 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> HLA-DRB1_#8_R8-2 <400> 59 tggatatctt ctattattct ctgttct 27 <210> 60 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> HLA -DRB1_#8_R8-3 <400> 60 tgagatcatc ctattattct ctgttct 27 <210> 61 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> HLA-DRB1_#8_R8-4 <400> 61 gagatcatcc tattattctc tgctct 26 <210> 62 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> HLA-DRB1_#9_F9 <400> 62 aaggaagtgt tcacagggtg aag 23 <210> 63 <211> 21 <212> DNA <213> l Sequence <220> <223> HLA-DRB1_#9_F10-1 <400> 63 cagagagtgt ctttggggct c 21 <210> 64 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> HLA-DRB1_# 9_F10-2 <400> 64 cagagagtgc ctttggggct c 21 <210> 65 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HLA-DRB1_#9_F11 <400> 65 gaacaggctg gaggtaggga 20 <210> 66 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HLA-DRB1_#9_F12 <400> 66 cgcctcagga agacagagga 20 <210> 67 <211> 19 <212> DNA <213> Artificial Sequence <220 > <223> HLA-DRB1_#9_F13 <400> 67 cgggtggggc cagatagtg 19 <210> 68 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> HLA-DRB1_#9_F14 <400> 68 ggtgggtgct gtttaaggga ag 22 <210> 69 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> HLA-DRB1_#9_F15 <400> 69 gcccctgggc tgctggtc 18 <210> 70 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> HLA-DRB1_#9_R9 <400> 70 catcttgctc tgtgcagatt cag 23 <210> 71 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> HLA-DRB3_#1_F1 <400> 71 gcaggccaca agctattatg c 21 <210> 72 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> HLA- DRB3_#1_R1 <400> 72 atagtcccct aggccccc 18 <210> 73 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> HLA-DRB3_#2_F2 <400> 73 tctgcaggcc acaagctatt a 21 <210> 74 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> HLA-DRB3_#2_R2 <400> 74 ccccgttcgc ctgaggaaa 19 <210> 75 <211> 20 <212> DNA <213> Artificial Sequence <220 > <223> HLA-DRB3_#3_F3 <400> 75 cctgttggct gaagtccaga 20 <210> 76 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> HLA-DRB3_#3_R3 <400> 76 gtgaccggat ccttcgtgt 19 <210> 77 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HLA-DRB3_#4_F4 <400> 77 tcacagtccc agatctccca 20 <210> 78 <211> 19 <212> DNA <213 > Artificial Sequences <220> <223> HLA-DRB3_#4_R4 <400> 78 gtgtgaccgg atccttcgt 19 <210> 79 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> HLA-DRB3_#5_F5 <400> 79 taacctcagc aaagctctat ttcc 24 <210> 80 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HLA-DRB3_#5_R5 <400> 80 aatgaatccg ctcgccatca 20 <210> 81 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> HLA-DRB3_#6_F6 <400> 81 actaacctca gcaaagctct att 23 <210> 82 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HLA- DRB4_#2_F2 <400> 82 gacacctctc tgccatcgtt 20 <210> 83 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> HLA-DRB3_#7_F7 <400> 83 actaacctca gcaaagctct atttc 25 <210> 84 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HLA-DRB3_#7_R7 <400> 84 aacttcggga aggactgtgc 20 <210> 85 <211> 23 <212> DNA <213> Artificial Sequence <220 > <223> HLA-DRB3_#8_F8 <400> 85 catcttgctc tgtgcagatt cag 23 <210> 86 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HLA-DRB3_#8_R8-1 <400> 86 agaaggggtt ttccccgcata 2 0 <210> 87 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HLA-DRB3_#8_R8-2 <400> 87 agaaggggtt tccccgcata 20 <210> 88 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HLA-DRB4_#1_F1 <400> 88 tgacttgctg gctggtttct 20 <210> 89 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HLA-DRB4_# 1_R1 <400> 89 cccatcatgc cctcagcttt 20 <210> 90 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HLA-DRB4_#2_F2 <400> 90 tctgcaggcc acaagctatt 20 <210> 91 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HLA-DRB4_#2_R2 <400> 91 atcagaaggg gttttcccgc 20 <210> 92 <211> 23 <212> DNA <213> Artificial Sequence <220> <223 > HLA-DRB4_#3_F3 <400> 92 ctgccatcat tctagggaaa ctg 23 <210> 93 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HLA-DRB4_#3_R3 <400> 93 caggcacaag gtcagcacta 20 < 210> 94 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> HLA-DRB4_#4_F4 <400> 94 gccatcattc tagggaaact gaat 24 <210> 95 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> H LA-DRB4_#4_R4 <400> 95 aaggaaccgg taaagcgtgt 20 <210> 96 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HLA-DRB4_#5_F5 <400> 96 gaaacgcagt ctcagaccca 20 <210> 97 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> HLA-DRB4_#5_R5 <400> 97 tacccttatc agatgatatt tgcca 25 <210> 98 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> HLA-DRB4_#6_F6 <400> 98 cacatacaca gattccccgc tc 22 <210> 99 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> HLA-DRB4_#6_R6 <400> 99 cccgcccagg gagtccg 17 <210> 100 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> HLA-DRB4_#7_F7 <400> 100 catcttgctc tgtgcagatt cag 23 <210> 101 <211> 23 <212 > DNA <213> Artificial Sequence <220> <223> HLA-DRB4_#7_R7 <400> 101 tctgtcttca tgactcattc cca 23 <210> 102 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> HLA -DRB4_#8_R8 <400> 102 acccttatca gatgatattt gcca 24 <210> 103 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HLA-DRB5_#1_F1 <400> 103 caaccagggc ctgagaaagt 20 <210> 104 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HLA-DRB5_#1_R1 <400> 104 caggaagacg gaggatgagc 20 <210> 105 <211> 23 <212> DNA <213> Artificial Sequence < 220> <223> HLA-DRB5_#2_N-R1 <400> 105 catcttgctc tgtgcagatt cag 23 <210> 106 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> HLA-DRB5_#2_N-F5 <400> 106 gatgaacgcg gtgggagtta g 21 <210> 107 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HLA-DQA1_#1_F1 <400> 107 gctgcatcac aaggggattg 20 <210> 108 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HLA-DQA1_#1_R1 <400> 108 ttagagccat gaggtcgctg 20 <210> 109 <211> 20 <212> DNA <213> Artificial Sequence <220> <223 > HLA-DQA1_#2_F2 <400> 109 ctgcatcaca aggggattgc 20 <210> 110 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> HLA-DQA1_#2_R2 <400> 110 tctgtcttca tgactcattc cca 23 < 210> 111 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HLA-DQA1_#3_F3 <400> 111 tagaggctgc atcacaaggg 20 <210> 112 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> HLA-DQA1_#3_R3 <400> 112 tttagagcca tgaggtcgct g 21 <210> 113 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HLA-DQA1_#4_F4 <400> 113 tgcatcacaa ggggattgcc 20 <210> 114 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> HLA-DQA1_#4_R4 <400> 114 ttctcttacc aatccaatct cagcc 25 <210> 115 <211> 20 <212 > DNA <213> Artificial Sequence <220> <223> HLA-DQA1_#5_F5 <400> 115 gccagggagg gaaatcaact 20 <210> 116 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> HLA- DQA1_#5_R5-1 <400> 116 gctggggatt tctgaagata tt 22 <210> 117 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> HLA-DQA1_#5_R5-2 <400> 117 gctggggatt tctgaagata tc 22 <210> 118 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> HLA-DQA1_#5_R5-3 <400> 118 gctggggatt tctgaagata ct 22 <210> 119 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HLA-DQA1_#6_F6 <400> 119 ccctaggtag gtggggtcag 20 <210> 120 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> HLA-DQA1_ #6_R6 <400> 120 gctg gggatt tctgaagata ttggc 25 <210> 121 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> HLA-DQA1_#8_F7 <400> 121 ggtttggttt gggtgtcttc agatt 25 <210> 122 <211> 25 <212 > DNA <213> Artificial Sequence <220> <223> HLA-DQA1_#8_R7 <400> 122 cacttcccaa ttcccctaca acttt 25 <210> 123 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> HLA -DQA1_#9_R8-1 <400> 123 ctgcaacagg gcagacatga gat 23 <210> 124 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> HLA-DQA1_#9_R8-2 <400> 124 ctgcaacagg acagacatga gat 23 <210> 125 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> HLA-DQA1_#10_R9-1 <400> 125 tatgataaat cgggccagag aatagtgcta 30 <210> 126 <211> 30 <212 > DNA <213> Artificial Sequence <220> <223> HLA-DQA1_#10_R9-2 <400> 126 tatgataaat ggggccagaa aataatgcta 30 <210> 127 <211> 26 <212> DNA <213> Artificial Sequence <220> <223 > HLA-DQA1_#11_F8 <400> 127 agacatgcac acaccagaga agattc 26 <210> 128 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> HLA-DQA1_#11_R10 <400> 128 tcatcatcat gccacttccc aattc 25 <210> 129 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> HLA-DQB1_#1_F1 <400> 129 ctcgttgaat atctggaact agtaactt 28 <210> 130 <211> 25 <212 > DNA <213> Artificial Sequence <220> <223> HLA-DQB1_#1_R1 <400> 130 ctcttctaaa gcacattagt ggtgg 25 <210> 131 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> HLA -DQB1_#2_F2 <400> 131 tttgaaacac cagtgaccaa ggat 24 <210> 132 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> HLA-DQB1_#2_R2 <400> 132 tctgcccaga gacagatgag gt 22 <210 > 133 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> HLA-DQB1_#3_F3 <400> 133 ttcttgatcg atgtgacttt ccag 24 <210> 134 <211> 23 <212> DNA Artificial Sequence <220> <223> HLA-DQB1_#3_R3 <400> 134 cccagagaca gatgaggtcc ttc 23 <210> 135 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> HLA-DQB1_#4_F4 <400 > 135 ttcttgatcg atgtgacttt ccaga 25 <210> 136 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> HLA-DQB1_#4_R4 <400> 136 gacagatgag gtccttcag c tcc 23 <210> 137 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> HLA-DQB1_#5_F5-1 <400> 137 gaaacaccag tgaccaaggg tca 23 <210> 138 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> HLA-DQB1_#5_F5-2 <400> 138 gaaacaccag tgaccaagga tca 23 <210> 139 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> HLA-DQB1_#5_R4-1 <400> 139 tgcccagaga cagatgaggt cct 23 <210> 140 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> HLA-DQB1_#5_R4-2 <400> 140 tgcctagaga cagatgaggt cct 23 <210> 141 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> HLA-DQB1_#5_R4 -3 <400> 141 tgcccagaga cagattaggt cct 23 <210> 142 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> HLA-DQB1_#6_F6 <400> 142 tttcatgtgc ttctcttgag cagtct 26 <210> 143 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> HLA-DQB1_#6_R5 <400> 143 tttcatgtgc ttctcttgag cagtct 26 <210> 144 <211> 22 <212> DNA <213> Artificial Sequence < 220> <223> HLA-DQB1_#7_F7 <400> 144 ggtggggatg aaaggatg ac 22 <210> 145 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> HLA-DQB1_#7_R4-4 <400 > 145 tgcctag aga cagattaggt cct 23 <210> 146 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> HLA-DQB1_#7_R4-5 <400> 146 tgcccagaga cagatgaggt tct 23 <210> 147 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> HLA-DQB1_#8_R5-1 <400> 147 ctgccaggta catcagatcc atcag 25 <210> 148 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> HLA-DQB1_#8_R5-2 <400> 148 ctgccagcta catcagatcc atcag 25 <210> 149 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HLA-DQB1_#9_F8 <400> 149 agccccagca cgaagcctcc 20 <210> 150 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> HLA-DQB1_#9_R6-1 <400> 150 cgcgggcggt tccacagctc c 21 <210> 151 <211> 21 < 212> DNA <213> Artificial Sequence <220> <223> HLA-DQB1_#9_R6-2 <400> 151 cgcgggctgt tccacagctc c 21 <210> 152 <211> 25 <212> DNA <213> Artificial Sequence <220> < 223> HLA-DPA1_#1_F1 <400> 152 aagctcaggg gctgtgaatg gaatc 25 <210> 153 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> HLA-DPA1_#1_R1 <400> 153 cattaaacgc gtagcattcc tgccg 25 <210> 154 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> HLA-DPA1_#2_F2 <400> 154 tgatttaagt tctcccacat ggagt 25 <210> 155 <211> 25 <212> DNA <213 > Artificial Sequence <220> <223> HLA-DPA1_#2_R2 <400> 155 ctaaaattct cccatctctt cccca 25 <210> 156 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> HLA-DPA1_#3_F3 -1 <400> 156 aatatcctca gacctttccg ttca 24 <210> 157 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> HLA-DPA1_#3_F3-2 <400> 157 aatatcctca gacctttcca ttca 24 <210 > 158 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> HLA-DPA1_#3_F3-3 <400> 158 aatatcctca gacctttcca ttcag 25 <210> 159 <211> 25 <212> DNA <213 > Artificial Sequence <220> <223> HLA-DPA1_#3_R3 <400> 159 ggaggtggac ctgaaagaaa gatta 25 <210> 160 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> HLA-DPA1_#4_F4 <400> 160 caaatctctt ccctcagaga cttca 25 <210> 161 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> HLA-DPA1_#4_R4 <400> 161 cattgttacc acaggtaatg ctgtc 25 <210> 162 <2 11> 18 <212> DNA <213> Artificial Sequence <220> <223> HLA-DPA1_#5_F5 <400> 162 ggtcatggcc agaacgca 18 <210> 163 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> HLA-DPA1_#5_R5 <400> 163 tcctgtgctc acagtcatca attatagacc 30 <210> 164 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> HLA-DPA1_#6_F6 <400> 164 acattcccac ctttacagta DNA <213> Artificial Sequence <220> <223> HLA-DPA1_#9_R7 <400> 166 ttgagagccc tctccttggc ttt 23 <210> 167 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> HLA-DPA1_ #11_F7 <400> 167 cgcagagact ttatgatgag gac 23 <210> 168 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> HLA-DPA1_#11_R8 <400> 168 atcagagctg tgatcttgag agc 23 <210> 169 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> HLA-DPB1_#1_F1 <400> 169 aggcaagaca gacagactca gacct 25 <210> 170 <211> 25 <212> DNA <213> A rtificial Sequence <220> <223> HLA-DPB1_#1_R1 <400> 170 taggttccct tcattctgct gggga 25 <210> 171 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> HLA-DPB1_#2_F2 < 400> 171 tccctgtaga tgggccagca gaata 25 <210> 172 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> HLA-DPB1_#2_R2 <400> 172 gtgtggcttc tctttcctga ctccc 25 <210> 173 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> HLA-DPB1_#3_F3 <400> 173 aacacaccct tggacaaagg caaga 25 <210> 174 <211> 25 <212> DNA <213> Artificial Sequence <220> < 223> HLA-DPB1_#3_R3-1 <400> 174 aagagagctg ctgtgcactg attgt 25 <210> 175 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> HLA-DPB1_#3_R3-3 <400> 175 aagagagctg ctgtgcactg attat 25 <210> 176 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> HLA-DPB1_#3_R3-4 <400> 176 cagagagctg ctgtgcactg attgt 25 <210> 177 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> HLA-DPB1_#4_F4 <400> 177 atgatggttc tgcaggtttc tgc 23 <210> 178 <211> 26 <212> DNA <213> Artificial Se quence <220> <223> HLA-DPB1_#4_R4-1 <400> 178 ttgctcctgt tgttttgcat gtagga 26 <210> 179 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> HLA-DPB1_#4_R4 -2 <400> 179 ttgctcctgt tgttttgcat ttagga 26 <210> 180 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> HLA-DPB1_#5_F5 <400> 180 agagagagcg cttagctatg gaaaagagaa 30 <2110> <211> 23 <212> DNA <213> Artificial Sequence <220> <223> HLA-DPB1_#5_R5 <400> 181 aagaagggaa catggttgga ggc 23 <210> 182 <211> 21 <212> DNA <213> Artificial Sequence < 220> <223> HLA-DPB1_#6_R6<400> 182 ggggttcatg cctgagattc c 21

Claims (6)

다음 표 1에 표시된 (a)~(k)의 프라이머 세트를 포함하는 HLA 유전자 증폭용 조성물:
(a) HLA-A 유전자를 증폭할 수 있는 제1 내지 제6 프라이머 세트;
(b) HLA-B 유전자를 증폭할 수 있는 제7 내지 제10 프라이머 세트;
(c) HLA-C 유전자를 증폭할 수 있는 제11 내지 제18 프라이머 세트;
(d) HLA-DRB1 유전자를 증폭할 수 있는 제19 내지 제27 프라이머 세트;
(e) HLA-DRB3 유전자를 증폭할 수 있는 제28 내지 제35 프라이머 세트;
(f) HLA-DRB4 유전자를 증폭할 수 있는 제36 내지 제43 프라이머 세트;
(g) HLA-DRB5 유전자를 증폭할 수 있는 제44 및 제45 프라이머 세트;
(h) HLA-DQA1 유전자를 증폭할 수 있는 제46 내지 제56 프라이머 세트;
(i) HLA-DQB1 유전자를 증폭할 수 있는 제57 내지 제65 프라이머 세트;
(j) HLA-DPA1 유전자를 증폭할 수 있는 제66 내지 제76 프라이머 세트; 및
(k) HLA-DPB 유전자를 증폭할 수 있는 제77 내지 제81 프라이머 세트.

[표 1]
Figure 112020093433187-pat00007

Figure 112020093433187-pat00008

Figure 112020093433187-pat00009

A composition for amplifying HLA genes comprising primer sets of (a) to (k) shown in Table 1 below:
(a) first to sixth primer sets capable of amplifying the HLA-A gene;
(b) 7th to 10th primer sets capable of amplifying the HLA-B gene;
(c) 11th to 18th primer sets capable of amplifying the HLA-C gene;
(d) 19th to 27th primer sets capable of amplifying the HLA-DRB1 gene;
(E) 28 to 35 primer sets capable of amplifying the HLA-DRB3 gene;
(f) 36th to 43rd primer sets capable of amplifying the HLA-DRB4 gene;
(g) 44th and 45th primer sets capable of amplifying the HLA-DRB5 gene;
(h) 46th to 56th primer sets capable of amplifying the HLA-DQA1 gene;
(i) 57th to 65th primer sets capable of amplifying the HLA-DQB1 gene;
(j) 66th to 76th primer sets capable of amplifying the HLA-DPA1 gene; and
(k) 77th to 81st primer sets capable of amplifying the HLA-DPB gene.

[Table 1]
Figure 112020093433187-pat00007

Figure 112020093433187-pat00008

Figure 112020093433187-pat00009

 제1항에 있어서, 상기 증폭은 Long range PCR을 이용한 증폭인 것을 특징으로 하는 조성물.
The composition according to claim 1, wherein the amplification is amplification using long range PCR.
 제 1항에 있어서, 골수 또는 장기이식 시의 조직적합성 검사용인 것을 특징으로 하는 조성물.
The composition according to claim 1, which is used for histocompatibility testing during bone marrow or organ transplantation.
 제1항의 프라이머 세트를 사용하는 것을 포함하는, HLA 유전자의 서열분석(sequencing) 방법.
A method for sequencing the HLA gene, comprising using the primer set of claim 1.
 삭제delete 제1항의 프라이머 세트를 포함하는, HLA 유전자 증폭용 키트(kit).
A kit for amplifying the HLA gene comprising the primer set of claim 1.
KR1020200112432A 2020-09-03 2020-09-03 Composition for Amplifying HLA genes and Uses thereof KR102475292B1 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
KR1020200112432A KR102475292B1 (en) 2020-09-03 2020-09-03 Composition for Amplifying HLA genes and Uses thereof
PCT/KR2021/011854 WO2022050721A1 (en) 2020-09-03 2021-09-02 Composition for amplifying hla genes and use thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020200112432A KR102475292B1 (en) 2020-09-03 2020-09-03 Composition for Amplifying HLA genes and Uses thereof

Publications (2)

Publication Number Publication Date
KR20220030744A KR20220030744A (en) 2022-03-11
KR102475292B1 true KR102475292B1 (en) 2022-12-08

Family

ID=80491850

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020200112432A KR102475292B1 (en) 2020-09-03 2020-09-03 Composition for Amplifying HLA genes and Uses thereof

Country Status (2)

Country Link
KR (1) KR102475292B1 (en)
WO (1) WO2022050721A1 (en)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20160060695A1 (en) 2013-05-09 2016-03-03 Genodive Pharma Inc. Method and kit for multiplex dna typing of hla gene

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JPWO2013011734A1 (en) * 2011-07-21 2015-02-23 ジェノダイブファーマ株式会社 HLA gene DNA typing method and kit
JP6798697B2 (en) * 2017-02-13 2020-12-09 国立大学法人京都大学 PCR primer set for HLA gene and sequencing method using it
US11646103B2 (en) * 2017-09-06 2023-05-09 Nant Holdings Ip, Llc HLA tissue matching and methods therefor
KR20190059780A (en) * 2017-11-23 2019-05-31 (주)오상헬스케어 Kit for hla allele type using real time pcr method

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20160060695A1 (en) 2013-05-09 2016-03-03 Genodive Pharma Inc. Method and kit for multiplex dna typing of hla gene

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
J Hum Genet.,60(11):665-73. (2015.08.27.)*

Also Published As

Publication number Publication date
KR20220030744A (en) 2022-03-11
WO2022050721A1 (en) 2022-03-10

Similar Documents

Publication Publication Date Title
KR101709826B1 (en) New pcr sequencing method and use thereof in hla genotyping
WO2012000150A1 (en) Pcr primers for determining hla-a,b genotypes and methods for using the same
CN106701987A (en) PCR (polymerase chain reaction) amplification system for genotyping of three SNP (single-nucleotide polymorphism) loci related to human folic acid metabolism and detection kit
WO2018147438A1 (en) Pcr primer set for hla gene, and sequencing method using same
CN113817725A (en) HLA gene amplification primer, kit, sequencing library construction method and sequencing method
CN113025701A (en) Early screening method and kit for non-alcoholic fatty liver disease susceptibility gene
US20220228212A1 (en) Major histocompatibility complex single nucleotide polymorphisms
CN109295500B (en) Single cell methylation sequencing technology and application thereof
KR102475292B1 (en) Composition for Amplifying HLA genes and Uses thereof
CN108410972B (en) Genotyping detection kit for 23 genetic loci of human Rh blood group
TW201300528A (en) Method for hla-dqb1 genotyping and related primers thereof
WO2017135396A1 (en) Probe set for hla genotyping by capture method without using pcr, and typing method in which same is used
CN113025702B (en) Early screening method and kit for ankylosing spondylitis susceptibility genes
CN113652474A (en) Detection method for DMD gene exon copy number variation and application thereof
CN113174432B (en) SLC25A13 gene mutation site detection kit and method
CN112831558B (en) Early screening method and kit for Crohn disease susceptibility genes
CN116179671A (en) Amplification primer group, kit and method for HLA genotyping
CN116144743A (en) Primer, kit and method for simultaneously realizing SNP (single nucleotide polymorphism) typing of multiple homologous sequences based on combination of multiple long PCR (polymerase chain reaction) and high-throughput sequencing
CN117210551A (en) ARMS-PCR primer combination and kit for detecting 10 bovine genetic defect genes
CN115354072A (en) Primer group for HLA-DQA1 genotyping and analysis method
CN114540486A (en) HLA-DPA1 gene full-length amplification primer group and typing kit
CN116536410A (en) Mass spectrum-based erythrocyte blood group genotyping method and kit
CN111154914A (en) Kit for rapidly detecting hepatitis B virus drug-resistant site and use method thereof
CN116287308A (en) Genetic marker system containing 55 high-efficiency autosomal micro haplotypes, and detection primer and kit thereof
CN116377084A (en) High-efficiency autosomal micro-haplotype genetic marker system, and detection primer and kit thereof

Legal Events

Date Code Title Description
E902 Notification of reason for refusal
E701 Decision to grant or registration of patent right